Content uploaded by Yousri Mostafa Hussein
Author content
All content in this area was uploaded by Yousri Mostafa Hussein on Feb 08, 2017
Content may be subject to copyright.
Bull. Egypt. Soc. Physiol. Sci. 30 (2) 2010 Hussein et al.
245
MAGE-3 And -4 Genes as Possible Markers for Early
Detection of Metastases in HCV Egyptian Patients
Complicated By HCC
Yousri M Hussein1, Amal F Gharib1, Randa H Mohamed1,
Mohamed I Radwan 3, Wael H Elsawy2
1Medical biochemistry, 2Clinical oncology and Nuclear Medicine and
3 Tropical Medicine Departments, Faculty of Medicine,
Zagazig University
ABSTRACT
The dissemination of hepatocellular carcinoma (HCC) cells into the circulation plays
a critical role in postoperative recurrence and metastasis. Early detection of
metastatic tumor cells is critical to identify HCC patients at high risk of relapse.
MAGE-3 and -4 genes were evaluated by reverse transcription polymerase chain
reaction for the possibility of using them as new markers for early detection of
metastases in 160 HCV Egyptian patients, 115 of them were complicated with HCC.
The expression of MAGE-3 and MAGE-4 mRNA in peripheral blood of patients with
metastatic HCC, were 36 % and 52%, respectively. While the expression of MAGE-3
and MAGE-4 mRNA in peripheral blood of patients with localized HCC, were 12 %
and 16%, respectively. Moreover at least one type of MAGE-3 or MAGE-4 mRNA
was found in the peripheral blood of 68% of the metastatic HCC patients and in 20%
of the localized HCC patients. While neither the controls nor the cirrhotic patients
show expression of MAGE-4 mRNA in their peripheral blood. MAGE-3 and MAGE-4
may be a promising diagnostic tool for monitoring the prognosis of HCC patients and
early detection of occult hematogenous metastasis of HCC.
INTRODUCTION
Hepatocellular carcinoma (HCC)
is one of the most prevalent
malignancies. Though regular
abdominal ultrasonography (US)
examination and serum alpha-
fetoprotein (AFP) can detect small
HCC at an early stage and there are
many modalities of treatment, the
recurrence and metastasis are frequent
and the prognosis remains
unsatisfactory. The high recurrence
rate is probably attributed to the
dissemination of HCC cells into blood
circulation and that they proliferate in
an immunosuppressive environment
during and before therapy. The
dissemination of HCC cells into the
circulation plays a critical role in
postoperative recurrence and
metastasis(1).
Hepatocellular carcinoma (HCC)
accounts for 80% of all primary liver
cancers and ranks globally as the
fourth leading cause of cancer-related
death. Partial hepatectomy remains
the best treatment option for selected
patients with HCC without cirrhosis.
Liver transplantation is well
Bull. Egypt. Soc. Physiol. Sci. 30 (2) 2010 Hussein et al.
246
established as the gold standard for
patients with HCC and cirrhosis in the
absence of extrahepatic spread and
macro-vascular invasion. Local
regional therapy is indicated in
selected patients who are not surgical
candidates(2).
Early detection of metastatic
tumor cells is critical to identify HCC
patients at high risk of relapse and for
the prescriptive therapy. However, it
is difficult to detect such
dissemination of HCC cells through
blood route with conventional
techniques(3).
With respect to HCC, although
the serum level of AFP is a good
biomarker for HCC, it does not
specifically reflect metastasis from
HCC; previously both albumin and
AFP mRNA are widely used as tumor
markers for HCC cells in circulation.
However, the reliability of using them
as tumor markers have been
challenged because both albumin and
AFP mRNA are abundantly expressed
in normal liver cells, they are released
in the peripheral blood by either
surgical injury of the liver or by
diseases other than HCC such as
hepatitis virus infection(4).
The MAGE g4ene family
encodes tumor-specific antigens
recognized by autologous cytotoxic T
lymphocytes(5) and composed of more
than 25 genes in humans and are
classified as type I MAGE genes
(including MAGE-A, MAGE-B, and
MAGE-C genes) and type II MAGE
genes, which include those that reside
outside the MAGE-A, MAGE-B, and
MAGE-C genomic clusters(6). The
MAGE-A subfamily comprises 12
genes (MAGE-A1 to MAGE-A12),
and is expressed in various types of
tumors, but not in normal adult
tissues, except for testis and placenta.
The MAGE-A antigens are of
particular interest for antitumor
immunotherapy because they are
strictly tumor specific and are shared
by many tumors. Despite the isolation
of growing numbers of MAGE genes,
their function in normal tissues
remains mostly unknown(7).
MAGE-3 belongs to MAGE-A
gene family, and is expressed in a
significant proportion of tumors of
various histological malignancies, and
is silent in normal somatic cells
except male germ line cells(8). MAGE-
3 protein also exists in cytoplasm
showing homogeneous, focal or
scattered pattern of expression, and
the expression undergoes a substantial
change in distribution with increase in
tumor size and invasiveness(9).
How to discriminate well
differentiated HCCs from non-
cancerou9s lesions, and how to
suppress the recurrences that
frequently occur after treatment are
problems which should be solved.
Detection of MAGE transcripts in
peripheral blood mononuclear cells
(PBMC) may be helpful in detecting
circulating tumor cells which also
may help in the early prediction of the
relapse and prognosis of the HCC
patients.
In the present study, we have
carried out the reverse transcription
polymerase chain reaction (RT-PCR)
for MAGE-3 and -4 genes to evaluate
the possibility of using these genes as
new markers for early detection of
metastases in hepatitis C virus (HCV)
infected Egyptian patients
complicated by HCC.
Bull. Egypt. Soc. Physiol. Sci. 30 (2) 2010 Hussein et al.
247
SUBJECTS & METHODS
We studied 165 Egyptian patients
with HCV (50 patients with HCV
complicated with cirrhosis, 40 patients
with localized HCC and 75 patients
with metastatic HCC)
The 50 patient presented by post
chronic HCV hepatitis cirrhosis where
selected according to the clinical and
laboratory examination (18 child B &
32 child C according to child-pugh
classification). Hepatic malignancies
in those patients were excluded by
both abdominal US and AFP.
The 40 HCV patients who
presented by localized HCC were
selected by abdominal US, all patients
with single focal lesions with typical
features of HCC, the HCC confirmed
by Triphasic computed tomography
(CT) and AFP. Fine needle aspiration
biopsy (FNAB) was done in selected
cases (focal lesion < 2cm with normal
AFP). Patients with multiple focal
lesion and/or portal vein thrombosis
were excluded. Distant metastases had
been excluded by chest and abdominal
CT, isotopic bone scan and brain CT
if there is a neurological
manifestation.
Patients with HCC with distant
and /or macro-vascular metastasis
(n=75) were selected from patients
who presented by metastases during
selection of the previous group.
75 healthy control Egyptian
subjects age- and sex-matched with
the patients, were randomly recruited.
Biochemical measurements
Blood samples were drawn from
all subjects after an overnight fast.
Sera were separated immediately and
stored at 20°C.
Alanine aminotransferase (ALT),
aspartate aminotransferase (AST),
Albumin, urea and creatinine were
measured in serum by routine
enzymatic methods (spinreact), serum
AFP concentration was measured by
ELISA (kit provided by Biosource
Europe S.A, Belgium), HCV
antibodies by ELISA.
RNA Extraction
Total RNA was extracted using
the protocol provided by the
manufacturer. The cDNA was reverse
transcribed in a 10 l mixture
containing 6 l of total RNA ,0.5 l
random primers (Promega, Madison,
WI), 2 l of 5× reverse-transcriptase
buffer (Life Technology,
Gaithersburg, MD), 1 l of
dexoyribonucleoside triphosphate
(dNTP) mixtures (10Mm), 0.5 l of
AMV reverse transcriptase (5U/ l).
The mixture was incubated at 37°C
for 10 min, 52°C for 45 min, 95°C for
5 min and ice path for 5 min.
RT-PCR and Electrophoresis
Detection of MAGE-3 and
MAGE-4 genes were done according
to ( 10 ). The amplification reaction
(50 ml) contained 2.5 l cDNA, 0.5 l
each of 5 M primers, 0.5 l of Taq
polymerase (GIBCO BRL), 0.5 l of
dexoyribonucleoside triphosphate
(dNTP) mixtures (10Mm) in buffer
solution. The sequences of primers for
PCR amplification were as follows:
MAGE-3; sense, 5-
TGGAGGACCAGAGGCCCCC-3,
and antisense, 5-
GGACGATTATCAGGAGGCCTGC
-3
MAGE-4; sense, 5-
ACCAAGGAGAAGATCTGCCAGT
GGGTCTC-3, and antisense, 5-
Bull. Egypt. Soc. Physiol. Sci. 30 (2) 2010 Hussein et al.
248
GTCGCCCTCCATTGCATTGTGC-
3
PCR was performed at 96ºC for 5
minute followed by 35 cycles of 94°C
for 1 min, 68°C for 2 min and 72°C
for 4 min, this was followed by 15
min of final extension at 72°C for
MAGE-3, and 94°C for 30 sec, 58°C
for 30 sec and 74°C for 30 sec, this
was followed by 15 min of final
extension for MAGE-4
Reverse- transcription RT- PCR
for -actin was done for each sample
to ensure no degradation of RNA.
Using forward primer-5'-GGC ATC
GTG ATG GAC TCC G-3' and
reverse-5'-GCT GGA AGG TGG
ACA GCG A-3', PCR was performed
at 96ºC for 5 minute followed by 28
cycles of 94°C for 45 sec, 55°C for 45
sec and 72°C for 45 sec .
The PCR products are separated
in 2% agarose gel and visualized with
ethidium bromide staining. The
expected sizes of PCR products are
725 bp for MAGE-3, 726 bp for
MAGE-4, and 613 bp for -actin.
Statistical analysis
The results for continuous
variables are expressed as means ±
SD. The means of the three genotype
groups were compared in a one-way
analysis of variance. The statistical
significances of differences in
frequencies of variants between the
groups were tested using the chi-
square (x2) test. A difference was
considered significant at P < 0.05. All
data were evaluated using SPSS
version 10.0 for windows.
RESULTS
Table 1. Characteristic of the studied group
Control
Group
(n=75)
Cirrhosis
Group
(n=50)
Localized
HCC group
(n=40)
Metastatic HCC
group (n=75)
Age 51.6 ±7.5 50.7 ±5.5 54.2±6.5 56.3 ±8.1
ALT 27.2± 1.9 64.2 ±30.8* 63.2 ±30.8* 59.2 ±19.2*
AST 23.4± 6.8 64.5±36* 62.5±36* 82.3± 34.3*
AFP (ng/ml) 3.2 ± 1.2 127.5± 40* 151.5± 70* 671± 328.4*§
* Significant difference from control group, § significant difference from cirrhosis
group
Table 2. mRNA expression of MAGE-3 and -4 genes in all studied groups
Control
Group
(n=75)
Cirrhosis
Group
(n=50)
Localized
HCC group
(n=40)
Metastatic HCC
group (n=75)
MAGE3 + 0 0 3 (12%) * 27 (36%) *§
MAGE4+ 0 0 4 (16%) * 39(52%) *§
Combined + 0 0 5 (20%) * 51 (68%) *§
* Significant difference from control group, § significant difference from localized
HCC group
Bull. Egypt. Soc. Physiol. Sci. 30 (2) 2010 Hussein et al.
249
Expression of MAGE-3 and
MAGE-4
MAGE-3 and MAGE-4 mRNAs
were positively expressed in
peripheral blood of localized HCC
patients 12% (3/25) and 16% (4/25)
respectively; moreover when
combining the expression of MAGE-3
and MAGE-4 mRNAs in the
peripheral blood of patients with
localized HCC, the rate of expression
was 20% (5/25).
MAGE-3 and MAGE-4 mRNAs
were positively expressed in
peripheral blood of metastatic HCC
patients 36% (27/75) and 52% (39/75)
respectively; moreover when
combining the expression of MAGE-3
and MAGE-4 mRNAs in the
peripheral blood of patients with
metastatic HCC, the rate of expression
were 68% (51/75). On the contrary
none of the healthy subjects and
cirrhotic patients showed expression
of MAGE-3 and MAGE-4 mRNAs in
their peripheral blood
DISCUSSION
The early dissemination of
malignant cells to secondary sites is
the main cause of mortality of patients
with malignant solid tumors.
Metastatic spread through vessels is
the most important factor affecting the
prognosis of HCC patients. If the
metastatic HCC cells via
hematogenous route can be sensitively
and specifically determined at early
stage, more beneficial therapeutic
methods could be manipulated(11).
Conventional diagnostic
procedures usually fail to detect
circulating tumor cells, while reverse
transcriptase-polymerase chain
reaction (RT-PCR) amplification of
specific DNA sequences using
synthesized oligonucleotide primers
that flank the target DNA fragment of
interest is increasingly applied in the
detection of micrometastasis of cancer
cells(11). Reverse transcriptase-
polymerase chain reaction (RT-PCR)
amplification of genes expressed by
the tumor in a tissue-specific manner
is the method with the highest
diagnostic sensitivity allowing the
identification of one tumor cell in up
to 107 normal cells in various sources
such as blood, bone marrow, lymph
nodes, urine or stool(12&13).
Detection of micrometastasis in
HCC is still a controversial issue. As
the two frequently used mRNA
markers in detection of HCC, albumin
and mRNA AFP are also shown to be
expressed in blood of patients with
hepatitis, liver cirrhosis and the liver
infectious diseases such as HBV/HCV
infection(14). Furthermore, AFP
transcripts was detected even in the
blood samples from patients without
HCC after the surgical injury of the
liver, which results in the shedding of
liver cells into circulation under
surgical operation(15). Thus, AFP
represents an indicator of ongoing
liver damage without absolute
specificity for hepatocellular
carcinoma (Peck-Radosavljevic et al.,
19981(16,17&18).
MAGE gene transcripts have
been regarded as tumor-specific
markers and were found to be highly
expressed in variety of histological
types of cancers(3). When
overexpressed in the cytosol of cancer
cells, MAGE proteins are
proteolytically processed, transported
to the endoplasmic reticulum, and
Bull. Egypt. Soc. Physiol. Sci. 30 (2) 2010 Hussein et al.
250
then presented on the cell surface as
antigenic major histocompatibility
complex-associated peptides(6). Thus,
attention has been focused on the
potential of MAGE as a target for
cancer immunotherapy.
The MAGE-3 and MAGE-4
genes are members of the CT
(cancer/testis) antigen family used as
cancer specific markers. It has been
reported that MAGE-3 and MAGE-4
mRNAs are positive in HCC tissue,
but there is no MAGE expression in
pericancerous tissue, hepatitis,
cirrhosis or normal liver tissue(3,11&19).
Our goal is to detect occult
hematogenous metastasis of HCC
cells by RT – PCR of MAGE-3 and/or
MAGE-4 transcripts and to combine
these markers with each other to
detect HCC cells in the peripheral
blood in order to elevate their
sensitivity and specificity.
The important implication for the
detection of occult hematogenous
metastasis of HCC cells by RT – PCR
of MAGE-3 and/or MAGE-4
transcripts, is its value in the
prediction of recurrence after
treatment and prognosis of the
disease.
In our study, the expression of
MAGE-3 and MAGE-4 mRNA in
peripheral blood of patients with
metastatic HCC, were 36 % and 52%,
respectively. While the expression of
MAGE-3 and MAGE-4 mRNA in
peripheral blood of patients with
localized HCC, were 12 % and 16%,
respectively. This is in accordance
with(3) who reported that MAGE-3
was expressed in 33.3% in peripheral
blood of HCC patients and 53.3% in
HCC tissues while Zhang et al.
(2008)(20) reported that MAGE-3 was
expressed in 20.1% in peripheral
blood of HCC patients and 60.5% in
HCC tissues.
Up to our knowledge our study is
the first study to detect MAGE-4
mRNA expression in peripheral blood
of patients with HCC. MAGE-4
mRNA was expressed in peripheral
blood of 52% of patients with HCC,
while neither the controls nor the
cirrhotic patients show expression of
MAGE-4 mRNA in their peripheral
blood. Previous studies about MAGE-
4 and HCC is minimal. (11) reported
that MAGE-4 mRNA was expressed
in 18% HCC tissues while(21) found
that MAGE-4 protein was not only
significantly increased in HCC, but
also in HCV-related cirrhotic liver
patients and these cirrhotic patients
are already at high risk to develop
HCC.
At least one type of mRNA was
found in the peripheral blood of 68%
of the metastatic HCC patients, which
is markedly higher than the 36% and
52% of the patients who were positive
only by MAGE-3 or MAGE-4 mRNA
detection, we also found at least one
type of mRNA was found in the
peripheral blood of 20% of localized
HCC patients, which is markedly
higher than the 12 % and 16% of the
patients who were positive only by
MAGE-3 or MAGE-4 mRNA
detection. So combining detection of
MAGE-3 and MAGE-4 mRNAs in
PBMCs is a feasible method as this
method possesses high sensitivity and
specificity, and is practical in
detecting tumor cells in the blood.
Interestingly our results showed
that the positive rate of expression
MAGE-3 and MAGE-4 mRNA is
markedly increased in peripheral
Bull. Egypt. Soc. Physiol. Sci. 30 (2) 2010 Hussein et al.
251
blood of metastatic HCC patients than
in peripheral blood of localized HCC
patients, while patients with hepatitis,
cirrhosis or the 75 healthy subjects
showed no expression of MAGE-3 or
MAGE-4 mRNA so using MAGE-3
or MAGE-4 mRNA expression in
peripheral blood of in patients with
localized HCC may be helpful in early
detection of circulating cancer cells
and consequently early identification
of distant metastasis. As blood
dissemination is the main metastatic
route for HCC(22), identifying and
dynamically monitoring blood cancer
cells may be helpful in estimating
prognosis of HCC, guiding treatment
and avoiding recurrence since if a
small number of cancer cells enter the
blood circulation before surgery,
relapse may occur after surgery even
though the HCC is of a small size(23)
Conclusion
A cancer specific multi-marker
assay such as MAGE-3 and MAGE-4
may be a promising diagnostic tool
for monitoring HCC in HCV infected
Egyptian patients and early detection
of occult hematogenous metastasis of
HCC with better sensitivity and
specificity and this may be valuable in
the prediction of the prognosis of the
disease and construction of the
guidelines for treatment.
Acknowledgments
This study was funded with the
support of academic research in
Zagazig University Projects, Zagazig
University. Postgraduate & Research
Affairs.
REFRENCES
1. Sakon M, Nagano H, Nakamori
S, Dono K, Umeshita K,
Murakami T, Nakamura H,
Monden M. Intrahepatic
recurrences of hepatocellula
carcinoma after hepatectomy:
analysis based on tumor
hemodynamics. Arch Surg 2002;
137: 94-99.
2. Abrams P, Marsh JW. Current
approach to hepatocellular
carcinoma. Surg Clin North Am.
2010; 90(4): 803-816.
3. Mou DC, Cai SL, Peng JR,
Wang Y, Chen HS, Pang XW,
Leng XS, Chen WF. Evaluation
of MAGE-1 and MAGE-3 as
tumour-specific markers to detect
blood dissemination of
hepatocellular carcinoma cells Br
J Cancer. 2002; 86: 110 – 116
4. Wong IH, Leung T, Ho S, Lau
WY, Chan M, Johnson PJ.
Semiquantitation of circulating
hepatocellular carcinoma cells by
reverse transcriptase polymerase
chain reaction. Br J Cancer. 1997;
76(5): 628 – 633
5. Suzuki K, Tsujitani S, Konishi
I, Yamaguchi Y, Hirooka Y,
Kaibara N. Expression of
MAGE genes and survival in
patients with hepatocellular
carcinoma. Int J Oncol. 1999;
15:1227–1232
6. Baker PA, Salehi A. The MAGE
proteins: emerging roles in cell
cycle progression, apoptosis, and
neurogenetic disease. J. Neurosci.
Res. 2002; 67: 705–712
7. Nagao T, Higashitsuji H,
Nonoguchi K, Sakurai T,
Dawson S, Mayer RJ, Itoh K,
Fujita J. MAGE-A4 interacts
with the liver oncoprotein
gankyrin and suppresses its
tumorigenic activity. J. Biol.
Bull. Egypt. Soc. Physiol. Sci. 30 (2) 2010 Hussein et al.
252
Chem. 2003; 278 (12): 10668–
10674.
8. Kariyama K, Higashi T,
Kobayashi Y, Nouso K,
Nakatsukasa H, Yamano T,
Ishizaki M, Kaneyoshi T,
Toshikuni N, Ohnishi T,
Fujiwara K, Nakayama E,
Terracciano L, Spagnoli GC
and Tsuji T. Expression of
MAGE-1 and -3 genes and gene
products in human hepatocellular
carcinoma. Br J Cancer. 1999;
81(6): 1080–1087
9. Gunther FL, Hofbauer L,
Schaefer C, Noppen C, Boni R,
Kamarashev J, Nestlé FO,
Spagnoli GC and Dummer R.
MAGE-3 immunoreactivity in
formalinfixed paraffin-embedded
primary and metastatic
melanoma. Am J Pathol. 1997;
151: 1549–1553
10. Chen CH, Huang GT, Lee HS,
Yang PM, Yan MD, Chen DS,
Sheu JC. High genes frequency
in human of expression of MAGE
hepatocellular carcinoma Liver
1999; 19: 110-114.
11. Tahara K, Mori M, Sadanaga
N, Sakamoto Y, Kitano S,
Makuuchi M. Expression of the
MAGE gene family in human
hepatocellular carcinoma. Cancer
1999; 85:1234-1240.
12. Houghton RL, Dillon DC,
Molesh DA, Zehentner BK,
Xu J, Jiang J, Schmidt C,
Frudakis A, Repasky E,
Maltez Filho A, Nolasco M,
Badaro R, Zhang X, Roche
PC, Persing DH, Reed SG.
Transcriptional complementarity
in breast cancer: application to
detection of circulating tumor
cells. Mol Diagn. 2001; 6(2):79-
91.
13. Berois N, Varangot M, Aizen
B, Estrugo R, Zarantonelli L,
Fernández P, Krygier G,
Simonet F, Barrios E, Musé
I, Osinaga E. Molecular
detection of cancer cells in bone
marrow and peripheral blood of
patients with operable breast
cancer. Comparison of CK19,
MUC1 and CEA using RT-PCR.
Eur J Cancer. 2000; 36(6):717-
723.
14. Jiang SY, Shyu RY, Huang MF,
Tang HS, Young TH, Roffler
SR, Chiou YS, Yeh MY.
Detection of alphafetoprotein
expressing cells in the blood of
patients with hepatoma and
hepatitis. Br J Cancer 1997; 75:
928 – 933.
15. Malek L, Jerome N, Herve Z,
Abdelmajid S, Corinne V,
Giovanna V, Karine P,
Monique T, Frederique C,
Stanislas P, Dominique F,
Bernard L, Christian B,
Paterlini PB. Liver resection and
needle liver biopsy cause
hematogeneous dissemination of
liver cells. Hepatology 1999; 29:
879 – 882.
16. Peck-Radosavljevic M, Pidlich
J, Bergmann M, Ferenci P,
Seelos C, Wichlas M, Lipinski
E, Gnant M, Gangl A,
Mühlbacher F. Preoperative
TNM-classification is a better
prognostic indicator for
recurrence of hepatocellular
carcinoma after liver
transplantation than albumin
mRNA in peripheral blood. Liver
Bull. Egypt. Soc. Physiol. Sci. 30 (2) 2010 Hussein et al.
253
Transplant Oncology Group. J
Hepatol. 1998; 28(3):497-503.
17. Lemoine, Le Bricon T, Salvucci
M, Azoulay D, Pham P,
Raccuia J, Bismuth H, Debuire
B. Prospective evaluation of
circulating hepatocytes by alpha-
fetoprotein mRNA in humans
during liver surgery. Ann Surg.
1997; 226(1): 43–50.
18. Barbu V, Bonnand AM,
Hillaire S, Coste T,
Chazouilleres O, Gugenheim J,
Boucher E, Poupon R, Poupon
RE. Circulating albumin
messenger RNA in hepatocellular
carcinoma: results of a
multicenter prospective study.
Hepatology. 1997;26(5):1171-5.
19. Yuasa T, Okamoto K,
Kawakami T, Mishina M,
Ogawa O, Okada Y. Expression
patterns of cancer testis antigens
in testicular germ cell tumors and
adjacent testicular tissue. J Urol
2001; 165: 1790-1794.
20. Zhang Y, Li Q, Liu N, Song T,
Guo R, Meng L, Hao X.
Multimarker Detection of
MAGE-1, MAGE-3 and AFP
mRNAs by a Real-time
Quantitative PCR Assay: a
Possible Predictor of
Hematogenous Micrometastasis
of Hepatocellular Carcinoma.
Chin J Clin Oncol 2008; 5: 93-98
21. Tsuzuraharsa S, Sata M ,
Iwamoto O, Shichijo S, Kojiro
M, Tanikawa K, Itoh K.
Detection of MAGE-4 protein in
the sera of patients with hepatitis-
c virus-associated hepatocellular
carcinoma and liver cirrhosis. Jpn
J Cancer Res 1997; 88: 915-8.
22. Imamura H, Matsuyama Y,
Tanaka E, Ohkubo T,
Hasegawa K, Miyagawa S,
Sugawara Y, Minagawa M,
Takayama T, Kawasaki S,
Makuuchi M. Risk factors
contributing to early and late
phase intrahepatic recurrence of
hepatocellular carcinoma after
hepatectomy. J Hepatol 2003; 38:
200-207.
23. Yanaga K. Current status of
hepatic resection
forhepatocellular carcinoma. J
Gastroenterol 2004; 39:919-926.
Bull. Egypt. Soc. Physiol. Sci. 30 (2) 2010 Hussein et al.
254
.
-
.
% % % %
%
%
.
.
View publication statsView publication stats