Nephroprotective Effects of N-Acetylcysteine Amide against Contrast-Induced Nephropathy through Upregulating Thioredoxin-1, Inhibiting ASK1/p38MAPK Pathway, and Suppressing Oxidative Stress and Apoptosis in Rats

Abstract

Contrast-induced nephropathy (CIN) is a leading cause of hospital-acquired acute kidney injury (AKI) due to apoptosis induced in renal tubular cells. Our previous study demonstrated the novel N-acetylcysteine amide (NACA); the amide form of N-acetyl cysteine (NAC) prevented renal tubular cells from contrast-induced apoptosis through inhibiting p38 MAPK pathway in vitro. In the present study, we aimed to compare the efficacies of NACA and NAC in preventing CIN in a well-established rat model and investigate whether thioredoxin-1 (Trx1) and apoptosis signal-regulating kinase 1 (ASK1) act as the potential activator for p38 MAPK. NACA significantly attenuated elevations of serum creatinine, blood urea nitrogen, and biomarkers of AKI. At equimolar concentration, NACA was more effective than NAC in reducing histological changes of renal tubular injuries. NACA attenuated activation of p38 MAPK signal, reduced oxidative stress, and diminished apoptosis. Furthermore, we demonstrated that contrast exposure resulted in Trx1 downregulation and increased ASK1/p38 MAPK phosphorylation, which could be reversed by NACA and NAC. To our knowledge, this is the first report that Trx1 and ASK1 are involved in CIN. Our study highlights a renal protective role of NACA against CIN through modulating Trx1 and ASK1/p38 MAPK pathway to result in the inhibition of apoptosis among renal cells.

Full text

Research Article
Nephroprotective Effects of N-Acetylcysteine Amide against
Contrast-Induced Nephropathy through Upregulating
Thioredoxin-1, Inhibiting ASK1/p38MAPK Pathway, and
Suppressing Oxidative Stress and Apoptosis in Rats
Xuezhong Gong,1Yiru Duan,1Junli Zheng,1Yiquan Wang,1Guohua Wang,1
Svante Norgren,2and Tom K. Hei3
1Department of Nephrology, Shanghai Municipal Hospital of Traditional Chinese Medicine,
Shanghai University of Traditional Chinese Medicine, 274 Zhijiang Middle Road, Shanghai 200071, China
2Department of Women’s and Children’s Health, Karolinska Institutet, Karolinska University Hospital, 171 77 Stockholm, Sweden
3Center for Radiological Research, Department of Radiation Oncology, College of Physician and Surgeons, Columbia University,
630West168thStreet,NewYork,NY10032,USA
Correspondence should be addressed to Xuezhong Gong; shnanshan@hotmail.com
Received  October ; Accepted  November 
Academic Editor: Mohamed M. Abdel-Daim
Copyright ©  Xuezhong Gong et al. is is an open access article dist ributed under the Creative Commons AttributionL icense,
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Contrast-induced nephropathy (CIN) is a leading cause of hospital-acquired acute kidney injury (AKI) due to apoptosis induced
in renal tubular cells. Our previous study demonstrated the novel N-acetylcysteine amide (NACA); the amide form of N-acetyl
cysteine (NAC) prevented renal tubular cells from contrast-induced apoptosis through inhibiting p MAPK pathway in vitro.
In the present study, we aimed to compare the ecacies of NACA and NAC in preventing CIN in a well-established rat model
and investigate whether thioredoxin- (Trx) and apoptosis signal-regulating kinase  (ASK) act as the potential activator for p
MAPK. NACA signicantly attenuated elevations of serum creatinine, blood urea nitrogen, and biomarkers of AKI. At equimolar
concentration, NACA was more eective than NAC in reducing histological changes of renal tubular injuries. NACA attenuated
activation of p MAPK signal, reduced oxidative stress, and diminished apoptosis. Furthermore, we demonstrated that contrast
exposure resulted in Trx downregulation and increased ASK/p MAPK phosphorylation, which could be reversed by NACA
and NAC. To our knowledge, this is the rst report that Trx and ASK are involved in CIN. Our study highlights a renal protective
role of NACA against CIN through modulating Trx and ASK/p MAPK pathway to result in the inhibition of apoptosis among
renal cells.
1. Introduction
CIN (contrast-induced nephropathy) has become a leading
cause of hospital-acquired acute kidney injury as a result of
the increasing use of iodine contrast media and the simulta-
neous increase in number of at-risk patients, for example, due
to diabetes or hypertension [–]. e most common clinical
course is a transient nonoliguric and asymptomatic decline in
renal function with serum creatinine levels peaking at days
–, but CIN can also cause long-term adverse events and
need for chronic dialysis [–]. us, it is essential not only
to investigate the pathogenesis of CIN but also to develop
preventive interventions [].
ere is accumulating evidence that CIN is caused by a
combination of a reduction in medullary blood ow resulting
in hypoxia and direct tubular damage, including apoptosis
[–]. Oxidative stress has been identied as an important
driver mechanism in the pathogenesis, and this has trig-
gered trials of antioxidants to prevent CIN [, ]. Although
there is no consensus or standard practice regarding the
most eective intervention to prevent CIN besides adequate
hydration, the international work group Kidney Disease:
Hindawi Publishing Corporation
Oxidative Medicine and Cellular Longevity
Volume 2016, Article ID 8715185, 11 pages
http://dx.doi.org/10.1155/2016/8715185

Oxidative Medicine and Cellular Longevity
Improving Global Outcomes (KDIGO) suggested using oral
administration of the antioxidant N-acetylcysteine (NAC)
along with intravenous uids in patients at increased risk
to develop CIN [, ]. ere is, however, an inconsistency
in guidelines regarding the benet of NAC [, ], which
highlights the need for more investigation to seek new
antioxidants and address the eectiveness of antioxidants in
the prevention of the disease.
NACA,alsotermedAD,astheamideformofNAC,is
a thiol antioxidant with enhanced properties of lipophilicity,
membrane permeability, and antioxidant capacity when com-
pared with NAC []. Recently emerging evidence conrmed
NACA as a protective agent against oxidative stress in vitro
and in vivo [–]. Our previous study also indicated NACA
could protect renal tubular epithelial cell against contrast-
induced apoptosis in vitro []. We thus hypothesized NACA
could be a better renoprotective agent against CIN than NAC
in vivo through its prominent antioxidant activity.
We have previously demonstrated that the low-osmolar,
nonionic contrast agent iohexol, the most widely used radio-
contrast media, induces renal tubular cell apoptosis through
activation of the p MAPK/iNOS signal pathway in vitro
and vivo [, ]. is signal pathway has been conrmed
by others in a human renal tubular cell line (HK) and
cultured renal tubular cells isolated from CIN patients [,
]. We have subsequently identied the Forkhead box O
transcriptional factor (FoxO) as a downstream element of
the p MAPK cascade []. However, little is known of the
upstream modulators of the p MAPK pathway in CIN as
well as in kidney disease [].
One putative candidate for the upstream signal activa-
tor of p MAPK is Apoptosis Signal-regulating Kinase 
(ASK) []. As a serine/threonine kinase belonging to the
mitogen activated protein kinase kinase kinase (MAPK)
family, ASK has been reported to play a critical role in
reactive oxygen species (ROS)-induced apoptosis in vari-
ous cell types and oxidative stress-related diseases such as
D-galactosamine/lipopolysaccharide induced hepatotoxicity
and cardiovascular disease [–]. Meanwhile, as an impor-
tant redox regulator, thioredoxin- (Trx) could bind to the N
terminal non catalytic region of ASK and act as an upstream
inhibitor of ASK [, ].
Inthepresentstudy,weaimedtocomparetheecaciesof
NACA and NAC in preventing CIN and further investigated
whether Trx/ASK signal, as the potential upstream modu-
lators of p MAPK, were involved in CIN pathogenesis.
2. Materials and Methods
2.1. Reagents. All chemicals were purchased from Sigma (St.
Louis, MO, USA) unless otherwise stated. N-Acetylcysteine
amide (NACA) was provided by Dr. Glenn Goldstein (New
York, NY, USA). e contrast media iohexol (Omnipaque)
was purchased from Amersham Health (Princeton, NJ, USA).
2.2. Animals. e study was approved by Medicine Animal
Ethics Committee of Shanghai University of Traditional
Chinese Medicine. A total of  adult –-week-old male
Sprague-Dawley rats weighing – g were purchased
from Shanghai Lab Animal Research Center (certicate num-
ber: -). Rats were housed in an air-conditioned room
at ∘Cwithacycleofh/hlight/dark.Foodandwater
were provided ad libitum except for the day of dehydration.
2.3. Experimental Protocol and Drugs. We us e d a w e l l -
established rat model of CIN [, –]. Rats were randomly
divided into  groups of  rats each: controls (CON), rats
injected with CM (CIN), rats treated with  mg/kg/d NAC
andinjectedwithCM(CIN+NAC),ratstreatedwithmg/
kg/d NACA and injected with CM (CIN+NACA), and
rats treated with  mg/kg/d NACA and injected with CM
(CIN+NACA). NAC and NACA were injected intraperi-
toneally (i.p.) once daily for  consecutive days (days –).
CONandCINratsweregiventhesamevolumeofsaline.
On day , all rats were le without water for h. On day
,  min aer injections of saline, NAC or NACA, CIN,
CIN+NAC, CIN+NACA, and CIN+NACA rats were
injected with a nitric oxide synthase inhibitor (NG-nitro-L-
arginine methyl ester, L-NAME,  mg/kg, i.p.), followed aer
 and  min, respectively, by injection of an inhibitor of
prostaglandin synthesis (indomethacin,  mg/kg, i.p.) and
iohexol (.– g iodine/kg, i.p.). CON rats received injections
of equivalent volume of saline. On day , all rats were allowed
regular chow and tap water in metabolic cages for  h.
Baseline blood samples were collected from the tail vein
under ether anaesthesia for analysis of serum creatine (Scr),
blood urea nitrogen (BUN), and plasma Cystatin-C (CysC).
Urine samples (-h) were collected on day  (baseline)
and on day  for determination of urinary N-acetyl-𝛽-
glucosaminidase (UNAG) and urinary 𝛾-glutamyl transpep-
tidase (UGGT). At the end of day , blood samples were
collected from the abdominal aorta under pentobarbital
( mg/kg) anesthesia for determination of Scr, BUN, and
CysC. Subsequently the rats were killed and kidneys removed
for biochemical and morphological studies.
2.4. Histopathological Examinations
2.4.1. Light Microscopy. Le kidney samples were xed in %
formalin and prepared for examination by light microscopy
by hematoxylin and eosin (HE) staining, TUNEL staining, or
immunohistochemistry (IHC).
For TUNEL staining, sections were stained using In
Situ Cell Death Detection Kit (Roche Applied Science,
Mannheim, Germany). TUNEL-positive tubular cell num-
bers were counted in  nonoverlapping random cortical
elds under a x magnication.
For IHC, sections (mm) were immersed in citrate buer
and autoclaved at ∘C for  min and then immersed in
% aqueous hydrogen peroxide (H2O2). e sections were
incubated with a rabbit polyclonal antibody (phospho-p
MAPK, , Cell Signaling Technology, Danvers, MA, USA,
 : ) for  h at room temperature. Immunodetection was
performed using biotinylated anti-rabbit IgG and peroxidase-
labeled avidin chain working uid (Beijing Zhong Shan

Oxidative Medicine and Cellular Longevity 
Golden Bridge Biotechnology Co., China), with diaminoben-
zidine as the substrate. Finally, the slides were lightly counter-
stained with hematoxylin for  sec. e positive signals were
measured using Motic Med . CMIAS Image Analysis Sys-
tem (Motic China Group Co., Ltd., China). e area density
representing the positive staining intensity was calculated as
the ratio between the stained area and the total analyzed eld.
Two blinded examiners independently analyzed all slides.
2.4.2. Transmission Electron Microscopy (TEM). e right
renal cortex samples were cut into pieces ( × mm) on
ice and xed in .% (v/v) glutaraldehyde-polyoxymethylene
solutionfor–hat
∘C and subsequently embedded in Epon
. Ultrathin sections (– nm) were stained with uranyl
acetate and alkaline lead citrate and visualized under a JEM
CX transmission electron microscope.
2.4.3. Analysis of Renal Oxidative Stress Indicators. Super-
oxide dismutase (SOD), malondialdehyde (MDA), and glu-
tathione (GSH) levels in renal tissues were determined using
SOD kit, MDA kit, and GSH kit, respectively (Sigma, St.
Louis, MO, USA). Briey, tissue blocks of the appropriate size
were placed in ice-cold normal saline and homogenated in
aratioof:,𝑤(g) : V(ml). Aer  min of centrifugation
at  rpm, the supernatant was removed and used for
determination of SOD, MDA, and GSH using the respective
kitsandanUV-visiblespectrophotometer.
2.4.4. Quantitative Real-Time PCR (QPCR). Renal cortexes
were dissected and total RNA was extracted using Tri-
zol according to the manufacturer’s instructions (Invitro-
gen, Carlsbad, USA). cDNA was synthesized using random
primer and a High Capacity cDNA Reverse Transcrip-
tion Kit (Applied Biosystems, USA). e following primers
were used: Trx F-GTGGTGTGGACCTTGCAAAA, R-
GGAAGGTCGGCATGCATTTG; beta-actin F-CTGTGT-
GGATTGGTGGCTCT, R-GCAGCTCAGTAACAGTCC-
GC. QPCR was performed on a  Real-Time PCR System
(Applied Biosystems, USA).
2.4.5. Western Blot Analysis. Western blotti n g w a s p e r fo r m e d
as described [, , , ]. Renal cortex samples were lysed in
a lysis buer, separated by electrophoresis in –% poly-
acrylamide gel, and transferred to polyvinylidene uoride
(PVDF) membranes. Protein expression was quantied by
Image J . soware (Wayne Rasband, NIH, Bethesda,
MD, USA) aer scanning the lm. Primary antibodies used
included anti-ASK (abcam); anti-phospho-ASK (abcam,
Ser); anti-Trx (abcam); anti-p MAPK (Cell Signal-
ing Technology); anti-phospho-p MAPK (Cell Signaling
Technology, r/Tyr); anti-cleaved caspase  (Cell
Signaling Technology); and anti-beta-actin (Cell Signaling
Technology). All experiments were performed at least  times
(i.e.,  separate protein preparations) under the same condi-
tions.
2.4.6. Statistical Analysis. Results are expressed as means ±
SD. One-way analysis of variance (ANOVA) with Tukey’s post
hoc multiple-comparison test was used to determine the sig-
nicance of dierences in multiple comparisons. Dierences
were considered signicant if 𝑝 < 0.05 and highly signicant
if 𝑝 < 0.01.
3. Results
3.1. Eects of Induction of CIN (Table 1). At baseline, there was
no dierence in blood levels of markers of renal functional
among the  groups. CIN was eectively induced in CIN
group as evident from drastic deterioration in renal func-
tion (Table ) and morphological changes, including severe
vacuolization of the renal cortex, intratubular cast formation,
and medullary congestion (Figure (b)).
3.2. Eect of NAC and NACA on Renal Function Parameters.
Pretreatment with NAC or NACA preserved renal function as
evident from analysis of renal function parameters (Table ).
At the same dose ( mg/kg/d), NACA was uniformly more
eective than NAC as demonstrated by lower Scr, BUN,
UNAG, and UGGT (Table , 𝑝 < 0.05 versus CIN+NAC).
In fact,  mg/kg/d NACA had similar eects to  mg/kg/d
of NAC.
3.3. Eects of NAC and NACA on Histopathology and Ultra-
structures (Figure 1). Histopathological examinations of renal
samples from CIN rats revealed normal glomerulus structure
but severe renal tubular interstitial injury (Figure (b)).
Pretreatment with NAC or NACA markedly attenuated the
development of these lesions (Figures (c), (d), and (e)).
Renal tubular epithelial cell apoptosis in CIN rats was
evident by TEM. Cells undergoing apoptosis were character-
ized by injuries to ultrastructures (Figure (g)), for example,
condensation of the nuclear chromatin, wrinkling of nuclear
membranes, swelling of mitochondria, fracture of cristae, and
shedding of microvilli of cell cavity. In comparison, both
the apoptotic cell number and injuries to ultrastructures
were obviously reduced in CIN+NAC, CIN+NACA, and
CIN+NACA rats compared to CIN rats (Figures (h),
(i), and (j)). Consistent with the ndings under light
microscopy, no obvious glomerular lesions were observed by
TEM in CIN rats (Figures (k) and (l)).
3.4. Eects of NAC and NACA on Renal Tubular Apoptosis as
Assessed by TUNEL Staining and Analysis of Cleaved Caspase
3 (Figure 2). In addition to TEM, apoptosis was assessed
with two independent methods: TUNEL staining in kidney
sections and analysis of cleaved caspase  by western blot-
ting. Compared to CON rats, CIN rats exhibited markedly
increased numbers of TUNEL-positive tubular cells (Figures
(a), (b), and (f), 𝑝 < 0.01 versus CON) and also
increased cleavage of caspase  (Figures (g) and (h), 𝑝<
0.01 versus CON). Pretreatment with NAC or NACA signif-
icantly decreased both apoptotic cell numbers (Figures (c)–
(f), 𝑝 < 0.01 versus CIN) and caspase  cleavage (Figures
(g) and (h), 𝑝 < 0.01 versus CIN). At the same dose
( mg/kg/d), NACA exhibited better protection than NAC

Oxidative Medicine and Cellular Longevity
T : Eects of NACA on renal function parameters. e baseline levels of Scr, BUN, CysC, UNAG, and UGGT did not dier among the
groups. In CIN rats, BUN, Scr, CysC, UNAG, and UGGT were markedly increased on day  as compared to CON rats (𝑝 < 0.01). Pretreatment
with NAC or NACA attenuated the eect of CM, and the increases in Scr, BUN, CysC, UGGT, and UNAG were signicantly lower than in
CIN group (𝑝 < 0.05 or .). At the same dose ( mg/kg/d), NACA was signicantly more eective than NAC (CIN+NACA versus
CIN+NAC).
CON (𝑛=8)CIN(𝑛=8)CIN+NAC(𝑛=8)CIN+NACA(𝑛=8)CIN+NACA(𝑛=8)
Scr (𝜇mol/l)
Baseline . ±. . ±. . ±. . ±. . ±.
Day  . ±. . ±.∗∗ . ±.∗∗#. ±.   ∗∗#. ±.∗##&
Serum BUN (mmol/l)
Baseline . ±. . ±. . ±. . ±. . ±.
Day  . ±. . ±.∗∗ . ±.∗∗## . ±.∗∗## . ±.∗##&
Serum Cystatin-C (U/l)
Baseline . ±. . ±. . ±. . ±. . ±.
Day  . ±. . ±.∗∗ . ±.∗∗#. ±.∗∗#. ±.∗∗##
UNAG (U/l)
Baseline . ±. . ±. . ±. . ±. . ±.
Day  . ±. . ±.∗∗ . ±.   ∗∗#. ±.∗∗#. ±. ∗##&
UGGT (IU/l)
Baseline . ±. . ±. . ±. . ±. . ±.
Day  . ±. . ±.∗∗ . ±.∗∗## . ±.∗∗## . ±.∗∗##&
Data are means ±SD. ∗𝑝<0.05versus CON, ∗∗𝑝<0.01versus CON, #𝑝<0.05versus CIN, ##𝑝<0.01versus CIN, and &𝑝<0.05versus CIN+NAC.
(a) (b) (c) (d) (e)
(f) (g) (h) (i) (j)
(k) (l)
F : NACA attenuated CM-induced morphological changes. HE staining of kidney sections (magnication ×) from CON rats
(a), CIN rats (b), NAC+CIN rats (c), NACA+CIN rats (d), and NACA+CIN rats (e). Representative changes of ultrastructure by TEM
(magnications ×) from CON rats (f), CIN rats (g), NAC+CIN rats (h), NACA+CIN rats (i), NACA+CIN group (j), normal glomerular
basement membrane and podocyte in CON rats (k), and CIN rats (l). Note the condensation of the nuclear chromatin (red arrow) and
cytoplasm vacuoles (orange arrow) in CIN rats. Blue arrows refer to severe vacuolization of the renal cortex. Figures are representative of 
to  rats from each group.

Oxidative Medicine and Cellular Longevity 
(a) (b) (c) (d) (e)
Con CIN CIN+CIN+CIN+
NAC NACA1NACA2
∗∗##
∗∗## ∗∗##&
∗∗
10
0
20
30
40
% of apoptotic cells
(TUNEL-positive)
(f)
Con CIN CIN+
NAC
CIN+
NACA1
CIN+
NACA2
Cleaved
caspase 3
Beta-actin
19 kd
17 kd
(g)
Con CIN CIN+CIN+CIN+
NAC NACA1NACA2
∗## ∗##
##&
∗∗
0.0
0.2
0.4
0.6
0.8
1.0
Relative density (cleaved
caspase 3/actin)
(h)
F : NACA inhibited CM-induced renal tubular cell apoptosis as detected by TUNEL staining and western blot analyses of cleaved
caspase.CMincreasedthenumberofTUNEL-positiverenaltubularcells(bluearrows),andpretreatmentwithNACorNACAblocked
this eect. TUNEL-stained kidney sections (magnications ×) from CON rats (a), CIN rats (b), NAC+CIN rats (c), NACA+CIN rats
(d), and NACA+CIN rats (e). TUNEL-positive cells are marked by blue arrows. (f) Quantitative analysis of TUNEL-positive cell number.
(g) Western blot analyses of cleaved capsase-. (h) Relative densitometry analysis of the ratio of cleaved caspase  to beta-actin. Figures are
representative of  to  rats from each group. e values are means ±SD (𝑛=5). ∗𝑝< 0.05 versus CON, ∗∗ 𝑝< 0.01 versus CON, ##𝑝< 0.01
versus CIN, and &𝑝< 0.05 versus CIN+NAC.
(Figure (f), 𝑝 < 0.05 versus CIN+NAC, and Figures (g) and
(h), 𝑝 < 0.05 versus CIN+NAC).
3.5. Eects of NAC and NACA on Indicators of Oxidative Stress
in Renal Tissue. Induction of CIN attenuated renal SOD
(Figure (a)) and GSH (Figure (c)) and increased MDA (Fig-
ure (b)) levels (𝑝 < 0.01 versus CON). Pretreatment with
NAC or NACA signicantly prevented this (Figure , 𝑝<
0.05 and 𝑝 < 0.01 versus CIN, resp.). At equimolar concen-
trations, NACA was more eective than NAC at preserving
SOD, MDA, and GSH levels (𝑝 < 0.05 versus CIN+NAC,
Figures (a)–(c)).
3.6. Eects of NAC and NACA on P38 MAPK Phosphorylation.
Activation of p MAPK was conrmed by a signicant
increase in phospho-p MAPK levels as detected by western
blotting and IHC (Figures (b) and (g), 𝑝 < 0.01 ver-
sus CON). Pretreatment with NAC or NACA signicantly
prevented the CIN-induced p MAPK activation in kidney
(Figures (c), (d), (e), and (g), 𝑝 < 0.01 versus CIN).
Again,NACAwasmoreeectivethanNACatthesamedose
(Figures (f) and (h), 𝑝 < 0.05 versus CIN+NAC).
3.7. Eects of NAC and NACA on ASK1 Phosphorylation. We
next examined whether ASK, a potential upstream signal of
p MAPK, was involved in CIN pathogenesis. As shown in
Figures (a) and (b), phospho-ASK level was upregulated
in CIN rats (𝑝 < 0.01 versus CON). Pretreatment with NAC
(𝑝 < 0.01 versus CIN) or, more eectively, NACA (Figures
(a) and (b), 𝑝 < 0.05 versus CIN+NAC) inhibited this
activation.
3.8. Eects of NAC and NACA on Trx1 mRNA and Protein
Expressions. In order to deduce the role of Trx in CIN, Trx
mRNA and protein expressions were evaluated by QPCR and
western blotting, respectively. As shown in Figure , Trx
protein expression (c, d) and mRNA level (e) were decreased
in renal cortex following CIN induction (𝑝 < 0.01 CON

Oxidative Medicine and Cellular Longevity
0
100
200
300
400
500
600
SOD (U/mg protein)
Con CIN CIN+
NAC
CIN+
NACA1
CIN+
NACA2
∗∗
∗## ∗##
##&
(a)
0
2
4
6
8
MDA (nmol/mg protein)
Con CIN CIN+
NAC
CIN+
NACA1
CIN+
NACA2
∗∗
∗∗## ∗∗## ∗##&
(b)
0.0
1.0
2.0
3.0
GSH (nmol/mg protein)
Con CIN CIN+
NAC
CIN+
NACA1
CIN+
NACA2
∗∗## ∗∗##
∗∗
∗∗##&
(c)
F : NACA inhibited CM-induced indicators of oxidative stress in kidney. Exposure to CM signicantly attenuated renal SOD (a) and
GSH levels and increased MDA (b) levels. Pretreatment with NAC or NACA blocked the CIN-induced changes. Figures are representative
of  to  rats in each group. e values are means ±SD (𝑛=5). ∗𝑝< 0.05 versus CON, ∗∗ 𝑝< 0.01 versus CON, ##𝑝< 0.01 versus CIN, and
&𝑝< 0.05 versus CIN+NAC.
versus CIN). However, the downregulated expressions of Tr x
were markedly blocked by NAC and NACA (𝑝 < 0.01 versus
CIN).
4. Discussion
Although the mechanisms underlying CIN have not been
fully claried, several studies have shown that ROS-induced
oxidative stress and direct cytotoxicity of contrast media are
important in the pathogenesis of the disease [, , , ].
Here, we conrm the importance of oxidative stress and
demonstrate that the novel antioxidant NACA, an amide
derivate of NAC with better tissue penetration, oers more
eective prevention against CIN. Furthermore, we show that
Txr/ASK signal act as the upstream modulator of the p
MAPK and present a potential drug target for prevention.
Toourknowledge,thisistherstreportdemonstratingthat
Trx/ASK signal are involved in CIN.
e oxidative stress induced in rats with CIN was evident
by drastically decreased levels of SOD and GSH, as well as
an increased level of MDA, which is consistent with our
previous data [, ] and other reports [, ]. e ndings
that NACA consistently exhibited better renoprotection than
NAC may be related to its better membrane penetration.
However, whether other mechanisms of action are involved
is not clear and needs further studies. Overall, the present
ndings conrmed again that oxidative stress is an important
factor in the pathogenesis of CIN.
Since there is signicant inconsistency in the guidelines
regarding the benet of NAC to reduce the risk for CIN [,
], large-scale, randomized clinical trials that are adequately
powered have been proposed to determine the eectiveness
of NAC for prevention of CIN. Our present ndings suggest
that consideration should be given to the use of NACA as a
result of its superior renoprotective function relative to NAC.
CIN, also called contrast-induced acute kidney injury
(CI-AKI), is typically dened by an increase in serum cre-
atinine aer intravascular administration of contrast media,
but serum creatinine is a late and insensitive indicator of AKI
[, –]. us, several additional biomarkers have been
investigated in order to improve both prediction and diag-
nosis of AKI. Our previous study rst reported that urinary
𝛾-glutamyl transpeptidase (UGGT) has good sensitivity in
early detection of contrast-induced acute renal injury and
thus in early diagnosing AKI []. UGGT as a potential early
diagnosticbiomarkerofAKIhasbeenconrmedinAKI
patients aer liver transplantation []. Furthermore, another
GSH-dependent enzyme present in large amount in liver,
urinary glutathione S-transferases (UGST), has recently been

Oxidative Medicine and Cellular Longevity 
(a) (b) (c) (d) (e)
Area density of phospho-
0.0
0.1
0.2
0.3
p38 MAPK in kidney
Con CIN CIN+
NAC
CIN+
NACA1
CIN+
NACA2
∗∗
∗∗## ∗∗##
∗##&
(f)
P-p38 MAPK
p38 MAPK
43 kd
43 kd
Con CIN CIN+CIN+CIN+
NAC NACA1NACA2
(g)
Con CIN CIN+
NAC
CIN+
NACA1
CIN+
NACA2
∗∗
∗##
∗##
##&
Relative density (phospho-p38
0.0
0.2
0.4
0.6
0.8
1.0
1.2
MAPK/p38 MAPK)
(h)
F : Eects of NACA on p MAPK phosphorylation in kidney. IHC staining of phospho-p MAPK in CON (a), CIN (b), NAC+CIN
(c), NACA+CIN (d), and NACA+CIN (e) rats, respectively (gures are representative of  to  rats in each group). Note positive stained area
(yellow) of IHC staining (arrow). (f) Semiquantitative analysis of phosphor-p MAPK expression in kidneys with IHC. (g) Phospho-p
MAPK and total-p MAPK expressions by western blotting (𝑛=3each). (h) Relative densitometry analysis of the ratio of phospho-p
MAPK to total-p MAPK. Data are shown as means ±SD (𝑛=3each). ∗𝑝< 0.05 versus CON, ∗∗𝑝< 0.01 versus CON, ##𝑝< 0.01 versus
CIN, and &𝑝 < 0.05 versus CIN+NAC.
identied as a biomarker of AKI []. Subsequent studies
should address usefulness of these and other biomarkers in
terms of sensitivity and early detection of kidney injury.
Previous work from our laboratory and others has con-
rmed that contrast-induced apoptotic cell death via p
MAPK pathway is an important pathogenic mechanism in
CIN[,,,].ereisevidencethatpMAPKactivation
is associated with renal injury, which highlights p MAPK
pathway as an attractive therapeutic target. However, the
potential pathway by which p MAPK is activated in CIN
isstillnotwelldenedsofar.
SinceMAPKscouldberegulatedupstreambytheMAPK
kinase kinase kinase (MAPK) and p MAPK could act as
the target of ASK, we investigated the eect of contrast media
on activation of ASK, a member of MAPK family [, ].
e present data demonstrated increased ASK phosphory-
lation in CIN, which could be blocked by NACA and NAC.
Our present data indicated clearly that contrast media could
activate the stress/death signaling mitogen-activated protein
kinase (MAPK) phosphorylation cascade and thus conrmed
that ASK/p MAPK could be a potential drug target for
preventing CIN. e study of Ma et al. has also identied
ASK as a potential therapeutic target in renal brosis [].
Reduced Trx could be a direct inhibitor or negative
regulatorofASK,whileROSstimulationcoulddissociate
Trx from Trx/ASK complex and lead to ASK activation
andinturnresultinthephosphorylationofitsdownstream
substrate p MAPK [, ]. As mentioned above, we
previously reported that contrast media exposure directly
increased cellular oxidation and induced p AMPK/iNOS

Oxidative Medicine and Cellular Longevity
P-ASK 1
ASK1
155 kd
155 kd
Con CIN CIN+CIN+CIN+
NAC NACA1NACA2
(a)
Con CIN CIN+CIN+CIN+
NAC NACA1NACA2
Relative density (phospho-
0.0
0.2
0.4
0.6
0.8
1.0
ASK1/ASK1)
∗## ∗## ##&
∗∗
(b)
Con CIN CIN+CIN+CIN+
NAC NACA1NACA2
Trx1
Beta-actin
12 kd
(c)
Con CIN CIN+CIN+CIN+
NAC NACA1NACA2
∗∗##
∗∗##
∗∗##
∗∗
0.0
0.3
0.5
0.8
1.0
1.3
Relative density (Trx1/actin)
(d)
Con CIN CIN+CIN+CIN+
NAC NACA1NACA2
##
##
##
∗∗
0.00
0.25
0.50
0.75
1.00
1.25
Relative Trx1mRNA expression
(e)
F : NACA blocked CM-induced p MAPK activation by inhibiting ASK phosphorylation and upregulating Trx mRNA and protein
expression. (a) Phospho-ASK and ASK expressions by western blotting (𝑛=3each). (b) Relative densitometry analysis of the ratio of
phospho-ASK to ASK. (c) Trx expression by western blotting (𝑛=3each). (d) Relative densitometry analysis of the ratio of Trx to beta-
actin. (e) QPCR analysis for Trx mRNA in renal cortex. Data are shown as means ±SD (𝑛=3each). ∗𝑝< 0.05 versus CON, ∗∗ 𝑝< 0.01
versus CON, ## 𝑝< 0.01 versus CIN, and &𝑝< 0.05 versus CIN+NAC.
pathway mediated apoptosis in renal tubular cells in vitro
and vivo [, ]. Additionally, our present data further clearly
indicated that contrast media exposure downregulated Trx
and increased ASK phosphorylation in CIN rat model. us
we could speculate that the more complete signal mechanism
for CIN should include the following key steps (Figure );
rst, contrast medium exposure increased ROS production
of kidney, resulting in suppression of Trx, which lead to
Trx/ASK complex dissociation to facilitate the activation of
ASK. is results in the downstream activation of its sub-
strate p MAPK and an imbalance of pro- and antiapoptotic
members of the Bcl- family and nally induced apoptotic
cell death. Interestingly, such a pathologic process could be
eciently inhibited by NACA through its antioxidant activity
and by upregulating Trx.
5. Conclusion
Summarily, based on our present and previous studies, we
demonstrated that NACA is more eective than NAC in
preventing CIN both in vivo and in vitro and identied the

Oxidative Medicine and Cellular Longevity 
Contrast media Iohexol
ASK1
Trx1
ASK1
FoxO1
p-ASK1
p-p38
Trx1
Cytoskeleton disorganization
(Ps externalization)
NACA
caspase 9
Pro-caspase 9
Pro-caspase 3
caspase 3
Mitochondria
Bcl-2
Mcl-1
Bax
Nucleus
ROS ↑
iNOS ↑
NO ↑
↑Cyt c
F : Schematic diagram illustrates the signal mechanism for CIN and the renoprotection of NACA. Contrast media exposure increases
ROS production in kidney, resulting in suppression of Trx and thus dissociating the Trx/ASK complex to facilitate the activation of ASK
(phosphorylation). Subsequently, activated ASK results in the downstream activation of its substrate p MAPK, an imbalance of pro- and
antiapoptotic members of the Bcl- family, and nally induces apoptosis. NACA eciently inhibits such a pathologic process through its
antioxidant activity and by upregulating Trx. p, phosphorylation. Ps, phosphatidylserine.
underlying mechanisms including suppression of oxidative
stress, upregulating Trx and in turn inhibiting ASK/p
MAPK pathway, and preventing renal tubular cell apoptosis.
Competing Interests
e authors declare that there is no conict of interests
regarding the publication of this paper.
Acknowledgments
e authors would like to thank Dr. Glenn Goldstein for
providing N-acetylcysteine amide. is work was supported
by National Natural Science Foundation of China (Grants
 and ) and sponsored by Shanghai Pujiang
Program.
References
[] J. J. Keaney, C. M. Hannon, and P. T. Murray, “Contrast-induced
acute kidney injury: how much contrast is safe?” Nephrology
Dialysis Transplantation,vol.,no.,pp.–,.
[]H.Li,C.Wang,C.Liu,R.Li,M.Zou,andG.Cheng,
“Ecacyofshort-termstatintreatmentforthepreventionof
contrast-induced acute kidney injury in patients undergoing
coronary angiography/percutaneous coronary intervention: a
meta-analysis of  randomized controlled trials,” American
Journal of Cardiovascular Drugs,vol.,no.,pp.–,.
[]R.J.Owen,S.Hiremath,A.Myers,M.Fraser-Hill,andB.
J. Barrett, “Canadian association of radiologists consensus
guidelines for the prevention of contrast-induced nephropathy:
update ,” Canadian Association of Radiologists Journal,vol.
,no.,pp.–,.
[] R. Rear, R. M. Bell, and D. J. Hausenloy, “Contrast-induced
nephropathy following angiography and cardiac interventions,”
Heart,vol.,no.,pp.–,.
[] R. M. Bell, R. Rear, J. Cunningham, A. Dawnay, and D. M.
Yellon, “Eect of remote ischaemic conditioning on contrast-
induced nephropathy in patients undergoing elective coronary
angiography (ERICCIN): rationale and study design of a ran-
domised single-centre, double-blind placebo-controlled trial,”
Clinical Research in Cardiology,vol.,no.,pp.–,.
[] X.Gong,G.Celsi,K.Carlsson,S.Norgren,andM.Chen,“N-
acetylcysteine amide protects renal proximal tubular epithelial
cells against iohexol-induced apoptosis by blocking p MAPK
and iNOS signaling,” American Journal of Nephrology,vol.,
no. , pp. –, .
[] X. Gong, Q. Wang, X. Tang et al., “Tetramethylpyrazine pre-
vents contrast-induced nephropathy by inhibiting p MAPK
and FoxO signaling pathways,” American Journal of Nephrol-
ogy,vol.,no.,pp.–,.
[] T. B. Sterenborg, T. P. Menting, Y. de Waal et al., “Remote
ischemic preconditioning to reduce contrast-induced nephrop-
athy: study protocol for a randomized controlled trial,” Trial s ,
vol. , article , .
[]J.A.Neyra,S.Shah,R.Mooney,G.Jacobsen,J.Yee,andJ.
E. Novak, “Contrast-induced acute kidney injury following
coronary angiography: a cohort study of hospitalized patients
with or without chronic kidney disease,” Nephrology Dialysis
Transplanta tio n,vol.,no.,pp.–,.

 Oxidative Medicine and Cellular Longevity
[] J. Kooiman, Y. W. J. Sijpkens, J.-P. P. M. De Vries et al., “A
randomized comparison of -h sodium bicarbonate hydration
versus standard peri-procedural saline hydration in patients
with chronic kidney disease undergoing intravenous contrast-
enhanced computerized tomography,” Nephrology Dialysis
Transplanta tio n,vol.,no.,pp.–,.
[] N. Lameire, J. A. Kellum, P. Aspelin et al., “Contrast-induced
acute kidney injury and renal support for acute kidney injury:
a KDIGO summary (part ),” Critical Care,vol.,no.,article
, .
[] K. A. Carver and D. Yang, “N-acetylcysteine amide protects
against oxidative stress–induced microparticle release from
human retinal pigment epithelial cells,” Investigative Ophthal-
mology and Visual Science,vol.,no.,pp.–,.
[] M. Paul, M. Hemshekhar, R. M. ushara et al., “Methotrexate
promotes platelet apoptosis via JNK-mediated mitochondrial
damage: alleviation by N-acetylcysteine and N-acetylcysteine
amide,” PLoS ONE,vol.,no.,ArticleIDe,.
[]T.Benterud,M.B.Ystgaard,S.Manueldasetal.,“N-
acetylcysteine amide exerts possible neuroprotective eects in
newborn pigs aer perinatal asphyxia,” Neonatology, vol. , no.
, pp. –, .
[] K. Sunitha, M. Hemshekhar, R. M. ushara et al., “N-
Acetylcysteine amide: a derivative to fulll the promises of N-
Acetylcysteine,” Free Radical Research,vol.,no.,pp.–,
.
[]X.Gong,G.Celsi,K.Carlsson,andS.Norgren,“Protective
eects of N-acetylcysteine amide (NACA) on gentamicin-
induced apoptosis in LLC-PK cells,” Renal Failure,vol.,no.
, pp. –, .
[] M. Andreucci, G. Lucisano, T. Fagaet al., “Dierential activation
of signaling pathways involved in cell death, survival and
inammation by radiocontrast media in human renal proximal
tubular cells,” Toxicological Sciences,vol.,no.,pp.–,
.
[] C. Quintavalle, M. Brenca, F. De Micco et al., “In vivo and
in vitro assessment of pathways involved in contrast media-
induced renal cells apoptosis,” Cell Death and Disease,vol.,
no. , article no. e, .
[] F.Y.Ma,G.H.Tesch,andD.J.Nikolic-Paterson,“ASK/p
signaling in renal tubular epithelial cells promotes renal brosis
in the mouse obstructed kidney,” American Journal of Physiolog y
-RenalPhysiology,vol.,no.,pp.F–F,.
[] F.Y.Ma,G.H.Tesch,andD.J.Nikolic-Paterson,“ASK/psig-
naling in renal tubular epithelial cells promotes renal brosis in
the mouse obstructed kidney,” American Journal of Physiolog y—
Renal Physiology,vol.,no.,pp.F–F,.
[] W. Hao, T. Takano, J. Guillemette, J. Papillon, G. Ren, and A.
V. Cybulsky, “Induction of apoptosis by the Ste-like kinase
SLK, a germinal center kinase that activates apoptosis signal-
regulating kinase and p,” Journal of Biological Chemistry,vol.
, no. , pp. –, .
[] R. M. Hashem, K. M. Hassanin, L. A. Rashed, M. O. Mah-
moud, and M. G. Hassan, “Eect of silibinin and vitamin
E on the ASK-p MAPK pathway in D-galactosamine/
lipopolysaccharide induced hepatotoxicity,” Experimental Biol-
ogy and Medicine,vol.,no.,pp.–,.
[] Q.-Q. Wu, M. Xu, Y. Yuan et al., “Cathepsin B deciency atten-
uates cardiac remodeling in response to pressure overload via
TNF-𝛼/ASK/JNK pathway,” AmericanJournalofPhysiology—
Heart and Circulatory Physiology,vol.,no.,pp.H–
H, .
[] Y. Huang, L. Wu, J. Wu, Y. Li, and L. Hou, “Cellular FLICE-
like inhibitory protein protects against cardiac hypertrophy by
blocking ASK/p signaling in mice,” Molecular and Cellular
Biochemistry,vol.,no.-,pp.–,.
[] K. Shen, F. Lu, J. Xie et al., “Cambogin exerts anti-proliferative
and pro-apoptotic eects on breast adenocarcinoma through
the induction of NADPH oxidase  and the alteration of
mitochondrial morphology and dynamics,” Oncotarget,vol.,
no. , pp. –, .
[] R. Jin, Y. Gao, S. Zhang et al., “Trx/TrxR system regulates post-
selected DP thymocytes survival by modulating ASK-JNK/p
MAPK activities,” Immunology and Cell Biology,vol.,no.,
pp. –, .
[] Y. Agmon, H. Peleg, Z. Greenfeld, S. Rosen, and M. Brezis,
“Nitric oxide and prostanoids protect the renal outer medulla
from radiocontrast toxicity in the rat,” Journal of Clinical
Investigation,vol.,no.,pp.–,.
[] Y. Yokomaku, T. Sugimoto, S. Kume et al., “Asialoerythropoietin
prevents contrast-induced nephropathy,” Journal of the Ameri-
can Society of Nephrology,vol.,no.,pp.–,.
[] H. T. Lee, M. Jan, C. B. Soo et al., “A adenosine receptor knock-
out mice are protected against acute radiocontrast nephropathy
in vivo,” American Journal of Physiology—Renal Physiology,vol.
, no. , pp. F–F, .
[]X.Gong,V.N.Ivanov,andT.K.Hei,“,,,-Tetrameth-
ylpyrazine (TMP) down-regulated arsenic-induced heme
oxygenase- and ARS expression by inhibiting Nrf, NF-𝜅B,
AP- and MAPK pathways in human proximal tubular cells,”
Archives of Toxicology, vol. , no. , pp. –, .
[] X. Gong, V. N. Ivanov, M. M. Davidson, and T. K. Hei,
“Tetramethylpyrazine (TMP) protects against sodium arsenite-
induced nephrotoxicity by suppressing ROS production, mito-
chondrial dysfunction, pro-inammatory signaling pathways
and programed cell death,” Archives of Toxicology,vol.,no.
,pp.–,.
[] L. Tongqiang, L. Shaopeng, Y. Xiaofang et al., “Salvianolic acid
B prevents iodinated contrast media-induced acute renal injury
in rats via the PIK/Akt/Nrf pathway,” Oxidative Medicine and
Cellular Longevity,vol.,ArticleID,pages,.
[] M. Buyuklu, F. M. Kandemir, M. Ozkaraca, T. Set, E. M.
Bakirci, and E. Topal, “Protective eect of curcumin against
contrast induced nephropathy in rat kidney: what is happening
to oxidative stress, inammation, autophagy and apoptosis?”
European Review for Medical and Pharmacological Sciences,vol.
,no.,pp.–,.
[] A.Tasanarong,S.Kongkham,andA.Itharat,“Antioxidanteect
of Phyllanthus emblica extract prevents contrast-induced acute
kidney injury,” BMC Complementary and Alternative Medicine,
vol. , article , .
[] N. Wang, R.-B. Wei, Q.-P. Li et al., “Renal protective eect of
probucol in rats with contrast-induced nephropathy and its
underlying mechanism,” Medical Science Monitor,vol.,pp.
–, .
[] M. Lichosik, A. Jung, K. Jobs, A. Mierzejewska, R. Zdanowski,
and B. Kalicki, “Interleukin  and neutrophil-gelatinase
associated lipocalin in assessment of the risk of contrast-
induced nephropathy in children,” Central European Journal of
Immunology,vol.,no.,pp.–,.
[] G. F. Lehner, L. G. Forni, and M. Joannidis, “Oliguria and
biomarkers of acute kidney injury: star struck lovers or
strangers in the night?” Nephron,vol.,no.,pp.–,
.

Oxidative Medicine and Cellular Longevity 
[] S. S. Waikar and J. V. Bonventre, “Creatinine kinetics and
the denition of acute kidney injury,” Journal of the American
Society of Nephrology,vol.,no.,pp.–,.
[] P. Marcelino, I. Tavares, D. Carvalho et al., “Is urinary
𝛾-glutamyl transpeptidase superior to urinary neutrophil
gelatinase-associated lipocalin for early prediction of acute
kidney injury aer liver transplantation?” Tra nsp lanta tio n Pro -
ceedings,vol.,no.,pp.–,.
[] K. H. Shu, C. Wang, C. Wu et al., “Urinary 𝜋-glutathione S-
transferase predicts advanced acute kidney injury following
cardiovascular surgery,” Scientic Reports,vol.,article,
.
[] A. Ray, N. Sehgal, S. Karunakaran, G. Rangarajan, and V.
Ravindranath, “MPTP activates ASK-p MAPK signaling
pathway through TNF-dependent Trx oxidation in parkinson-
ism mouse model,” FreeRadicalBiologyandMedicine,vol.,
Article ID , pp. –, .