Content uploaded by Xu Chen
Author content
All content in this area was uploaded by Xu Chen on Nov 21, 2016
Content may be subject to copyright.
Available via license: CC BY 4.0
Content may be subject to copyright.
Heterogeneous nuclear ribonucleoprotein K is associated with
poor prognosis and regulates proliferation and apoptosis in
bladder cancer
Xu Chen
a, b, #
, Peng Gu
a, b, #
, Ruihui Xie
a, b, #
, Jinli Han
a
, Hao Liu
a
, Bo Wang
a, b
,
Weibin Xie
a, b
, Weijie Xie
a
, Guangzheng Zhong
a
, Changhao Chen
a
, Shujie Xie
a
, Ning Jiang
a
,
Tianxin Lin
a, b,
*, Jian Huang
a,
*
a
Department of Urology, Sun Yat-sen Memorial Hospital, Sun Yat-sen University, Guangzhou, China
b
Guangdong Provincial Key Laboratory of Malignant Tumor Epigenetics and Gene Regulation, Sun Yat-Sen Memorial Hospital,
Sun Yat-Sen University, Guangzhou, China
Received: April 23, 2016; Accepted: August 27, 2016
Abstract
Heterogeneous nuclear ribonucleoprotein K (hnRNPK) is an essential RNA- and DNA-binding protein that regulates diverse biological events,
especially DNA transcription. hnRNPK overexpression is related to tumorigenesis in several cancers. However, both the expression patterns
and biological mechanisms of hnRNPK in bladder cancer are unclear. We investigated hnRNPK expression by immunohistochemistry in 188
patients with bladder cancer, and found that hnRNPK expression levels were significantly increased in bladder cancer tissues and that high-
hnRNPK expression was closely correlated with poor prognosis. Loss- and gain-of-function assays demonstrated that hnRNPK promoted prolif-
eration, anti-apoptosis, and chemoresistance in bladder cancer cells in vitro, and hnRNPK knockdown suppressed tumorigenicity in vivo. Mech-
anistically, hnRNPK regulated various functions in bladder cancer by directly mediating cyclin D1, G0/G1 switch 2 (G0S2), XIAP-associated
factor 1, and ERCC excision repair 4, endonuclease catalytic subunit (ERCC4) transcription. In conclusion, we discovered that hnRNPK plays an
important role in bladder cancer, suggesting that it is a potential prognostic marker and a promising target for treating bladder cancer.
Keywords: hnRNPK
bladder cancer
proliferation
apoptosis
transcriptional regulation
Introduction
Bladder cancer is one of the most common cancers and accounts for
approximately 429,800 newly diagnosed cases and 165,100 deaths
per year worldwide [1]. Emerging evidence shows that aberrant cell
cycle [2, 3], excessive anti-apoptosis [3–5], and chemoresistance [6–
8] signalling are involved in the carcinogenesis and progression of
bladder cancer. Previous studies have found that the mechanism of
bladder cancer is complex and coregulated by several molecular net-
works [3, 9], but many of the key elements are not fully understood.
Heterogeneous nuclear ribonucleoprotein K (hnRNPK), a mem-
ber of the hnRNP family, is an essential RNA- and DNA-binding pro-
tein. Structurally, it contains three consecutive K homologue
domains that are responsible for RNA or single-stranded DNA bind-
ing, a nuclear localization signal that induces its transport from the
cytoplasm to the nucleus, and a nuclear shuttling domain that regu-
lates its translocation to the cytoplasm [10–12]. Biologically,
hnRNPK interacts with diverse molecules involved in gene expres-
sion and signal transduction, including chromosome remodelling,
DNA transcription, RNA processing, RNA splicing, and RNA stability
and translation [7, 13].
hnRNPK is overexpressed in human cancers, including colorec-
tal, pancreatic, liver, prostate and renal cancer [14–18]. Heteroge-
neous nuclear ribonucleoprotein K is thought to play an important
role in cancer progression, as high levels of expression correlate
with poor clinical outcome [16–18]. Several studies have found that
hnRNPK promoted metastases in tumours by up-regulating matrix
metalloproteinase [18–20]. Knockdown of hnRNPK suppressed pro-
liferation in pancreatic and renal cancer [16, 18]. In addition,
hnRNPK serves as a transcriptional cofactor for the p53 pathway
during the DNA damage response [21]. However, a recent report
showed that, in liver cancer, hnRNPK suppressed apoptosis inde-
pendent of p53 status by promoting X-linked inhibitor of apoptosis
#
These three authors contributed equally to this work.
*Correspondence to: Tianxin LIN and Jian HUANG.
E-mails: tianxinl@sina.com and urolhj@sina.com
ª2016 The Authors.
Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.
This is an open access article under the terms of the Creative Commons Attribution License, which permits use,
distribution and reproduction in any medium, provided the original work is properly cited.
doi: 10.1111/jcmm.12999
J. Cell. Mol. Med. Vol XX, No X, 2016 pp. 1-14
protein (XIAP) [22]. Until now, there has been no report on hnRNPK
behaviour in bladder cancer.
In this study, we investigated hnRNPK expression in bladder can-
cer tissues and analysed its correlation with the clinicopathological
characteristics and overall survival of bladder cancer. We also studied
the function and mechanism of hnRNPK in bladder cancer cells. Our
findings strongly suggest that hnRNPK participates in bladder cancer
carcinogenesis and is a potential diagnostic and prognostic marker
and a promising therapeutic target.
Material and methods
Tissue samples
Four tissue microarrays containing 159 bladder cancer specimens and 92
normal tissues were purchased from Shanghai Outdo Biotech (Shanghai,
China) and US Biomax. In 59 cases, the tissue microarray contained the
patients’ follow-up data, but the cause of death was unclear. A further 29
bladder cancer specimens, which included the patients’ follow-up data,
and 10 normal tissues were obtained from patients undergoing radical
cystectomy at Sun Yat-sen Memorial Hospital between June 2012 and
June 2014. All samples were evaluated and histologically diagnosed by
expert pathologists. All samples were collected with informed consent
according to the Sun Yat-Sen University internal review and ethics boards.
Table S1 lists the patient and tumour demographics.
Immunohistochemical (IHC) staining and scoring
analyses
This experiment was conducted as previously described [23, 24]. Briefly,
paraffin sections of bladder cancer tissues and normal tissues were first
deparaffinized and hydrated. Microwave antigen retrieval was performed
for all antibodies, and endogenous peroxidase activity was blocked by
incubating the slides in 0.3% H
2
O
2
. After serial incubation with primary
antibodies and secondary antibody, sections were developed with peroxi-
dase and 3,30-diaminobenzidine tetrahydrochloride. The sections were
then counterstained with haematoxylin and mounted in non-aqueous
mounting medium. Anti-hnRNPK antibody (1:50; sc-28380; Santa Cruz
Biotechnology, Santa Cruz, CA, USA) was used to detect hnRNPK expres-
sion in the specimens. Anti-hnRNPK and anti-Ki67 antibodies (1:500;
Zhongshan Bio-Tech, Beijing, China) were used to detect hnRNPK and
Ki67 expression in mouse tumours. Human prostate cancer tissues were
used as positive controls to test hnRNPK antibody for IHC staining
(Fig. S1A). Negative controls were created by replacing the primary anti-
body with non-immune immunoglobulin G (IgG; DAKO, Glostrup, Copen-
hagen, Denmark) (Fig. S1B).
Heterogeneous nuclear ribonucleoprotein K expression in the bladder
cancer specimens was blind-quantified by two pathologists using a pre-
viously described scoring system [23]. Briefly, the immunostaining
intensity of each sample was graded as negative =0, weak =1, moder-
ate =2, or strong =3 (Fig. S2). The proportion of positively staining
cells was assessed as the percentage. The score was then calculated as
the intensity score multiplied by the percentage of cells stained
(score =intensity 9% of positive cells). The samples were classed as
low (score <140) or high (score ≥140) hnRNPK expression. Images
were visualized using a Nikon ECLIPSE Ti (Fukasawa, Japan) micro-
scope system and processed with Nikon software.
Cell culture
The human bladder cancer cell lines UM-UC-3 and T24 (ATCC, Manassas,
VA, USA) were used in this study. UM-UC-3 cells were cultured in DMEM
(Gibco, Shanghai, China), whereas T24 cells were cultured in RPMI 1640
(Gibco). All medium was supplemented with 10% foetal bovine serum
(Shanghai ExCell Biology, Shanghai, China) and 1% penicillin/streptomycin.
The cells were grown ina humidified atmosphere of 5% CO
2
at 37°C.
RNA interference
Small interfering RNA (siRNA) oligos targeting hnRNPK (si-hnRNPK;
siRNA-1: GGGUUGUAGAGUGCAUAAATT, siRNA-2: GCCUCCAUCUAGAA-
GAGAUTT) or negative control siRNA were purchased from GenePharma
(Shanghai, China). SiRNA transfections were performed with 75 nM
siRNA and Lipofectamine RNAiMAX (Life Technologies, Thermo Fisher
Scientific Inc., Waltham, Massachusetts, USA) as previously described
[25]. Mock cells were treated with RNAiMAX and cultured in Opti-MEM
for 6 hrs, but without siRNA.
Stable hnRNPK knockdown cell lines
The pLKO.1 TRC cloning vector (Addgene plasmid: 10878) was used to
generate short hairpin RNA (shRNA) against hnRNPK (ATGCCTCCATC-
TAGAAGAGAT) or the negative control (CCTAAGGTTAAGTCGCCCTCG).
The lentivirus production and infection was conducted according to the
manufacturer’s protocol.
Cell proliferation assay
The methyl thiazolyl tetrazolium (MTT; MTS, Promega, Shanghai, China)
colorimetric assay was used to screen for cell viability. Mock cells and
cells transfected with control or hnRNPK siRNA were seeded in 96-well
plates at 2 910
3
cells per well. Then, the absorbance was measured at
490 nm over 5 days using a SpectraMax M5 unit (Molecular Devices).
For the colony formation assay, the cells were seeded in a 6-well
plate at a density of 1000 cells per well after siRNA transfection.
Approximately 10 days later, the clones were washed with 19PBS and
stained with crystal violet for approximately 20 min. Finally, the clones
were imaged and quantified.
For the cell cycle analysis, cells were harvested 48 hrs after transfection
and fixed in 70% ice-cold ethanol, followed by RNase A treatment, and
stained with 50 lg/ml propidium iodide (PI) for DNA content analysis in a
FACSCalibur BD flow cytometer (Franklin Lakes, New Jersey, USA). The
data were collected and processed using BD FACSuite analysis software
(Franklin Lakes, New Jersey, USA).
The ethynyl deoxyuridine (EdU) assay was performed according to
the manufacturer’s instructions (RiboBio, Guangzhou, China). At 24 hrs
after transfection, cells were seeded at 1.5 910
4
cells per well in a 48-
well plate. At 48 hrs after transfection, 50 lM EdU was added to the
2ª2016 The Authors.
Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.
plate, incubated for 2 hrs with the cells, and the nuclei were stained
with 40,6-diamidino-2-phenylindole. The images were captured using an
Olympus laser scanning microscope system (Tokyo, Japan).
Chemosensitivity assay
Mock and transfected cells were treated with 0, 0.5, 1, 1.5, 2 and
2.5 lg/ml cisplatin (Sigma-Aldrich, St. Louis, Missouri, USA) for
48 hrs. Chemosensitivity was measured using the same method as the
MTS assay. To calculate the median inhibitory concentration (IC
50
), data
were fitted in GraphPad Prism 5 (GraphPad, San Diego, CA, USA) and a
dose–response curve was plotted using the four-parameter dose–re-
sponse curve as follows: Y =bottom +(top bottom)/(1 +10
[(Log
IC50-X) 9HillSlope)]
[23].
Apoptosis analysis
At 24 hrs after transfection with control or hnRNPK siRNA, mock cells and
experimental cells were treated with 0 lg/ml or IC
50
cisplatin for 24 hrs. The
IC
50
of cisplatin in the UM-UC-3 and T24 cells was 1.8 lg/ml and 1.3 lg/ml
respectively. The cells were collected, washed with PBS, and apoptosis was
analysed with annexin V–fluorescein isothiocyanate and PI staining (Biotool,
Shanghai, China) in a FACSCalibur BD flow cytometer.
Detection of caspase-3/7 activity
Caspase-3/7 activity was measured using a Caspase-Glo 3/7 Assay kit
(Promega) as previously described [23].
RNA isolation and quantitative RT-PCR
Total cellular RNA was extracted using TRIzol (Invitrogen, Waltham,
Massachusetts, USA) according to the manufacturer’s protocol and was
used for reverse transcription with a PrimeScript RT-PCR kit (TaKaRa
Biotechnology, Dalian, China). RT-qPCR was conducted using a stan-
dard SYBR Green PCR kit (Roche Penzberg, Upper Bavaria, Germany)
protocol with a LightCycler 96 Real-Time System (Roche). The relative
expression was calculated using the comparative cycle threshold
(2
ΔΔCt
) method. The transcription level of GAPDH was used as the
internal control. Table S2 lists the specific primers used.
Western blotting
Western blotting was performed as previously described [23, 26]. Pri-
mary antibodies specific to hnRNPK, XIAP-associated factor 1 (XAF1),
ERCC excision repair 4, endonuclease catalytic subunit (ERCC4),
ERCC1, G0/G1 switch 2 (G0S2) (1:200; Santa Cruz Biotechnology),
Fig. 1 hnRNPK is up-regulated in bladder cancer tissues. (A) Western blot detection of hnRNPK expression in six cases of bladder cancer tissue (T)
and normal urothelium (N). (B) IHC expression of hnRNPK quantified by expression score (0–300) in normal urothelium and bladder cancer. (C)
Representative IHC analysis of hnRNPK protein in normal, well-differentiated, and poorly differentiated bladder cancer tissues. Magnification: 9400
(top) and 91000 (bottom). (D) The overall survival rates of the 88 patients with bladder cancer were compared according to low- and high-hnRNPK
status. Statistical significance was determined using the log-rank test. The samples were classed as low (score <140) or high (score ≥140) hnRNPK
expression.
ª2016 The Authors.
Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.
3
J. Cell. Mol. Med. Vol XX, No X, 2016
cyclin A2, cyclin D1, cyclin E2, cleaved caspase-7, and GAPDH (1:1000;
CST, Danvers, Massachusetts, USA) were used. The blots were then
incubated with goat anti-rabbit or anti-mouse secondary antibody (CST)
and visualized using enhanced chemiluminescence.
Tumorigenesis study
The Sun Yat-sen University Institutional Animal Care and Use Commit-
tee approved all of the animal care and experimental procedures. Male
BALB/c nude mice (4–5 weeks old) were purchased from the Sun Yat-
sen University Experimental Animal Center and housed in specific
pathogen–free barrier facilities. Cells (3 910
6
) were injected subcuta-
neously in to the right or left side of the dorsum; six mice were used.
Tumour sizes were measured every 3 days. At 21 days post-implanta-
tion, the mice were killed and the tumours were surgically dissected;
tumour specimens were fixed in 4% paraformaldehyde.
RNA sequencing analysis
Cells were transfected with si-hnRNPK (mixture of siRNA-1 and -2) or
control siRNA for 48 hrs. Then, total RNA was extracted from cells
using TRIzol (Invitrogen). Library construction and sequencing were
performed by Annoroad Gene Technology (Beijing, China). The libraries
were sequenced on an Illumina HiSeq 2500 platform and 100-bp
paired-end reads were generated. All primary data in RNA sequencing
(RNA-seq) analysis have been uploaded to the Gene Expression Omni-
bus (GSE79832). Gene ontology (GO) pathway analysis was performed
with Molecule Annotation System 3.0 (MAS 3.0; CapitalBio, Beijing,
China).
Chromatin immunoprecipitation
Chromatin immunoprecipitation (ChIP) was conducted using a EZ-
Magna ChIP A/G kit (Millipore, Billerica, Massachusetts, USA) according
to the manufacturer’s instructions. Cells were transfected with si-
hnRNPK (a mixture of siRNA-1 and -2) or control siRNA for 48 hrs;
1910
6
cells were used for each reaction. The cells were fixed in 1%
formaldehyde at room temperature for 10 min., and the nuclei were iso-
lated with nuclear lysis buffer (Millipore) supplemented with protease
inhibitor cocktail (Millipore). Chromatin DNA was sonicated and sheared
to lengths between 200 and 1000 bp. The sheared chromatin was
immunoprecipitated at 4°C overnight with anti-hnRNPK antibody
(ab39975; Abcam, Cambridge, Massachusetts, USA). Normal rabbit IgG
and anti-RNA polymerase II antibody (Millipore) were used as the nega-
tive and positive control respectively. Table S3 lists the ChIP-qPCR pri-
mers. Heterogeneous nuclear ribonucleoprotein K and RNA polymerase
II protein levels in the ChIP assays were detected by western blotting
(Fig. S7).
Statistical analyses
Data are presented as the mean S.D. of three independent experi-
ments. Two-tailed Student’s t-tests and one-way ANOVA were used to
evaluate the data. Cumulative survival time was calculated using the
Kaplan–Meier method and analysed by the log-rank test. A multivariate
Cox proportional hazards model was used to estimate the adjusted haz-
ard ratios and 95% confidence intervals and to identify independent
prognostic factors. All statistical analyses were performed with SPSS
19.0 (SPSS Inc., Chicago, IL, USA). Differences were considered statis-
tically significant at P<0.05 and P<0.01.
Results
hnRNPK expression is increased in bladder
cancer and associated with bladder cancer
clinical characteristics
To detect hnRNPK expression in bladder cancer, we first performed
western blot analysis on six cases of primary bladder cancer. Hetero-
geneous nuclear ribonucleoprotein K expression was up-regulated in
Table 1 Relationship between hnRNPK expression and
clinicopathological features of bladder caner
Characteristics Cases (%) Score P-value
Patients (N) 188
Gender, N(%)
Male 130 (69.1) 137.4 6.7 0.1241
Female 58 (30.9) 156.6 10.9
Age (year)
≤65 94 (50.0) 129.8 8.2 0.0184*
>65 94 (50.0) 156.8 7.8
Pathologic tumour grade, N(%)
Low grade 59 (29.8) 83.7 7.2 <0.0001*
High grade 129 (70.2) 170.6 6.4
Tumour stage
CIS,Ta,T1 56 (29.8) 123.0 8.2 0.0209*
T2-4 132 (70.2) 151.9 7.3
Patients (N) 116
Tumour size N(%)
≤3 cm 45 (38.8) 148.0 9.7 0.4900
>3 cm 71 (61.2) 157.7 9.3
Lymphnodes status, N(%)
Negative 99 (85.3) 153.8 7.3 0.9621
Positive 17 (14.7) 154.7 18.4
*P<0.05 is considered significant. The score is presented as the
means SD of values obtained in three independent experiments.
4ª2016 The Authors.
Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.
five of the cases as compared to the adjacent normal tissues
(Fig. 1A). To further evaluate hnRNPK expression and its relationship
with the clinical features of bladder cancer, we examined hnRNPK
expression in 188 bladder cancer tissues and 102 normal tissues by
IHC. Figure S1 shows the positive and negative controls for hnRNPK
in IHC. Heterogeneous nuclear ribonucleoprotein K was mainly
expressed in the nuclei of the bladder cancer cells and was signifi-
cantly overexpressed in bladder cancer tissues as compared with nor-
mal tissues (score: 143.3 5.7 versus 95.3 5.8, P<0.001,
Fig. 1B, Fig. S3). Moreover, hnRNPK expression was obviously
higher in poorly differentiated tissues as compared to well-differen-
tiated tissues (Fig. 1C). Clinicopathological correlation analysis
revealed positive correlation between elevated hnRNPK levels with
poor differentiation and advanced tumour stage (Table 1). There was
no correlation between hnRNPK expression and tumour size or lymph
node status.
hnRNPK expression predicts disease prognosis
Kaplan–Meier survival analysis showed significantly reduced overall
survival (P=0.0133, median survival, 26 months) in patients with
bladder cancer with increased hnRNPK expression as compared
with the median overall survival of 57 months in patients with low
hnRNPK immunostaining (Fig. 1D). To further evaluate the prog-
nostic factors associated with overall survival in bladder cancer,
we first carried out univariate analysis using age, sex, tumour
stage, histological grade, node stage, tumour size and hnRNPK
expression as parameters. Heterogeneous nuclear ribonucleopro-
tein K expression and nodal metastasis were significantly associ-
ated with overall survival (P=0.017 and 0.020, respectively,
Table 2). Moreover, the variables associated with survival by uni-
variate analyses were adopted as covariates in the multivariate
analyses, which revealed that high-hnRNPK expression in addition
to positive node stage was an independent predictor of overall
survival (P=0.013 and 0.013, respectively, Table S2). These find-
ings clearly demonstrate the potential of hnRNPK as a marker of
poor prognosis in bladder cancer.
hnRNPK knockdown inhibits bladder cancer cell
proliferation by regulating the cell cycle
To study the role of hnRNPK in bladder cancer, we suppressed
hnRNPK in bladder cancer cells via siRNA transfection. As shown
in Figure 2A and B, hnRNPK was remarkably down-regulated in
UM-UC-3 and T24 cells transfected with the hnRNPK siRNAs as
compared with those transfected with control siRNA at both
mRNA and protein level, as confirmed by RT-qPCR and western
blotting. Moreover, hnRNPK knockdown using the two si-hnRNPKs
significantly inhibited tumour cell growth as compared to the
mock and control cells (Fig. 2C). Consistent with our cell growth
data, hnRNPK knockdown cells formed significantly fewer colonies
than the mock and control cells (Fig. 2D). Furthermore, hnRNPK
overexpression in UM-UC-3 cells by transfection revealed that
hnRNPK upregulation promoted tumour cell growth and colony
formation (Fig. S4A–E).
Next, we performed flow cytometry and EdU assays to charac-
terize whether hnRNPK was involved in the cell cycle. Interest-
ingly, hnRNPK silencing dramatically increased the cell population
in the G0/G1 phase, whereas it reduced the cell population in the
S and G2/M phases (Fig. 3A and B). On the contrary, hnRNPK up-
regulation decreased the cell population in the G0/G1 phase and
increased the cell population in the S and G2/M phases (Fig. S4F–
G). The EdU assay showed that hnRNPK knockdown significantly
decreased the cell population in the S phase (Fig. 3C and D). Col-
lectively, these results indicate that hnRNPK knockdown inhibits
bladder cancer cell proliferation by inducing G0/G1 arrest.
Table 2 Univariate and multivariate analysis of factors associated with overall survival in bladder cancer
Variable
Univariate Multivariate
HR
2
95% CI PHR
2
95% CI P
Age, years (>65/≤65) 1.107 0.592–2.070 0.751 NA
Gender (female/male) 1.522 0.673–3.444 0.313 NA
Histological grade (high/low) 0.984 0.447–2.166 0.968 NA
Tumour stage (T2–T4/Ta–T1) 1.296 0.646–2.600 0.466 NA
Nodal metastasis (N1–N2/N0) 2.435 1.151–5.151 0.020 2.588 1.225–5.469 0.013
Tumour size (>3 cm/≤3 cm) 0.642 0.343–1.200 0.165 NA
hnRNPK (high/low) 2.391 1.167–4.899 0.017 2.487 1.212–5.103 0.013
Univariate and multivariate analysis. Cox proportional hazards regression model. Variables associated with survival by univariate analyses were
adopted as covariates in multivariate analyses. Significant P-values are shown in bold font. HR >1, risk for death increased; HR <1, risk for
death reduced.
ª2016 The Authors.
Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.
5
J. Cell. Mol. Med. Vol XX, No X, 2016
hnRNPK regulates apoptosis and
chemoresistance in bladder cancer cells
We investigated the role of hnRNPK in apoptosis and chemoresis-
tance via the MTT assay and flow cytometry. As shown in Figure 4A
and B, cells transfected with si-hnRNPK exhibited lower resistance to
cisplatin and the cisplatin IC
50
than the mock and control cells. How-
ever, hnRNPK overexpression increased UM-UC-3 cell resistance to
cisplatin and the cisplatin IC
50
(Fig. S5A and B). We quantified apop-
tosis by staining cells with annexin V and PI. Heterogeneous nuclear
ribonucleoprotein K knockdown induced apoptosis and significantly
increased the percentage of apoptotic cells under cisplatin treatment
(Fig. 4C and D). Heterogeneous nuclear ribonucleoprotein K up-regu-
lation decreased the percentage of apoptotic cells under cisplatin
treatment in an obvious manner (Fig. S5C and D). Compared with the
mock and control cells, caspase-3/7 activity was up-regulated in
hnRNPK knockdown cells and was obviously increased when the cells
were treated with cisplatin (Fig. 4E). These results suggest that
hnRNPK plays a critical role in bladder cancer cell apoptosis and
chemoresistance to cisplatin.
hnRNPK down-regulation suppresses bladder
cancer cell tumorigenicity in vivo
To further explore the effects of hnRNPK in bladder cancer tumorige-
nesis in vivo, we stably suppressed hnRNPK in UM-UC-3 cells by len-
tiviral transfection (Fig. S6). Next, the hnRNPK stable knockdown or
Fig. 2 hnRNPK knockdown inhibits bladder cancer cell proliferation. (Aand B) RT-qPCR and western blotting verification of si-hnRNPK knockdown
efficiency in UM-UC-3 and T24 cells. (C) MTT assay evaluation of influence of hnRNPK knockdown on UM-UC-3 and T24 cell viability. (D) Colony
formation assay determining the effect of hnRNPK knockdown in UM-UC-3 and T24 cells. The results are presented as the means S.D. of three
independent experiments. *P<0.05, **P<0.01.
6ª2016 The Authors.
Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.
Fig. 3 hnRNPK knockdown induces G0/G1 arrest in bladder cancer cells. (Aand B) Flow cytometry analysis of UM-UC-3 and T24 cells transfected
with si-hnRNPK or control siRNA for 48 hrs. The percentages (%) of cell populations at different stages of the cell cycle are listed in the panels. All
histograms show the percentage (%) of cell populations from three independent experiments. (Cand D) EdU assay measurement of the cell popula-
tion in the S phase. Blue, nucleus; red, S-phase cells (EdU-positive). Histological analysis of the percentage of EdU-positive cells in control and
hnRNPK knockdown cells is shown. The results are presented as the means S.D. of three independent experiments. *P<0.05, **P<0.01.
ª2016 The Authors.
Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.
7
J. Cell. Mol. Med. Vol XX, No X, 2016
Fig. 4 hnRNPK regulates apoptosis and chemoresistance in bladder cancer cells. (A) MTT assay analysis of viability of cells transfected with si-
hnRNPK or control siRNA and treated with cisplatin for 48 hrs. (B) The four-parameter logistic curve (best-fit solution, non-linear regression
dynamic fitting) and normality tests were used to determine the IC
50
.(Cand D) At 24 hrs after transfection with control siRNA or si-hnRNPK, UM-
UC-3 cells were treated with 0 or 1.8 lg/ml cisplatin for 24 hrs; T24 cells were treated with 0 or 1.3 lg/ml cisplatin. The percentage of apoptotic
cells was analysed by flow cytometer. Histograms show the percentage (%) of late and early apoptotic cells from three independent experiments.
(E) Caspase-3/7 activity assay was performed on UM-UC-3 and T24 cells transfected with control sRNA or si-hnRNPK and treated with or without
the cisplatin IC
50
of the parental cells for 24 hrs. Relative caspase-3/7 activity is indicated as the percentage of untreated parental cells. The results
are presented as the means S.D. of three independent experiments. *P<0.05, **P<0.01.
8ª2016 The Authors.
Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.
sh-control cells were subcutaneously injected into BALB/c nude mice
and the tumour growth activity was measured. Interestingly, the
growth of tumours derived from the hnRNPK knockdown group was
prominently suppressed as compared with the control group at
10 days after inoculation (Fig. 5A and B). The size and weight of
tumours from the hnRNPK knockdown group were significantly lower
than that of the control group (Fig. 4B and C). Moreover, the tumours
derived from the hnRNPK knockdown group had lower expression of
hnRNPK and the proliferation marker Ki67 than the control group
(Fig. 5D and E). These results indicate that hnRNPK promotes blad-
der cancer cell tumorigenicity in vivo.
The target genes of hnRNPK are identified in
bladder cancer
Heterogeneous nuclear ribonucleoprotein K is mainly expressed in
the nuclei of bladder cancer cells. To investigate the mechanism of
hnRNPK in bladder cancer, we performed RNA-seq to analyse the
changes in target gene mRNA levels between UM-UC-3 cells that had
been transfected with si-hnRNPK or control siRNA. The hnRNPK
knockdown group had 1223 up-regulated genes and 1279 down-
regulated genes compared with the control group (Fig. 6A). Gene
ontology pathway analysis revealed that the genes regulated by
hnRNPK were enriched in signal transduction, transcription, cell
cycle, response to DNA damage and apoptosis (Fig. 6B). Next, we
validated the expression of these genes in UM-UC-3 and T24 cells
transfected with control siRNA or si-hnRNPK by RT-qPCR. Compared
with the mock and control cells, the mRNA expression of cyclin A2,
cyclin D1, and cyclin E2, which promote the cell cycle, were signifi-
cantly decreased in hnRNPK-silenced cells, whereas the mRNA
expression of G0S2, which arrests the cell cycle, was obviously
increased in hnRNPK-silenced cells (Fig. 6C). Moreover, hnRNPK
knockdown inhibited the genes of chemoresistance, such as ERCC1
and ERCC4. However, hnRNPK knockdown promoted the genes of
apoptosis, such as that for caspase-7 (CASP7), and XAF1 (Fig. 6D).
The protein expression of these genes was consistent with the change
in mRNA level (Fig. 6E). ChIP-qPCR performed to confirm whether
hnRNPK directly regulates these genes determined that hnRNPK
knockdown decreased the levels of hnRNPK in the promoter regions
of cyclin D1, G0S2,XAF1 and ERCC4, but not in the negative control
or in other genes. Moreover, RNA polymerase II levels were
decreased in the promoter regions of cyclin D1 and ERCC4, but were
increased in the promoter regions of G0S2 and XAF1 (Fig. 6F, Figs S8
Fig. 5 hnRNPK down-regulation suppresses bladder cancer cell tumorigenicity in vivo.(A) Animals and tumours in this study. (B) The tumour
growth volume was measured every 3 days. The results are presented as the means S.D. (n=6). (C) Tumour weights were measured after the
tumours were surgically dissected. (D) IHC examination of tumour hnRNPK and Ki67 expression. Histogram shows the IHC score in control and
hnRNPK knockdown groups. **P<0.01.
ª2016 The Authors.
Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.
9
J. Cell. Mol. Med. Vol XX, No X, 2016
10 ª2016 The Authors.
Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.
and S9). Taken together, these data indicate that hnRNPK regulates
target genes in bladder cancer by directly mediating transcription.
Discussion
The hnRNP family members play key roles in several biological
functions, such as chromosome remodelling, cellular signal trans-
duction, and transcriptional and translational regulation. Emerging
evidence shows that aberrant up-regulation of hnRNP is involved
in tumorigenesis. hnRNPA/B proteins are overexpressed in hepato-
cellular carcinoma and non-small cell lung cancer, and indicate
poor prognosis [27, 28]. Balasubramani et al. showed that
hnRNPF was a potential marker for colorectal cancer progression
[29]. Aberrant hnRNPK expression in the cytoplasm has been
reported in pancreatic cancer [15], colorectal cancer [16], prostate
cancer [17], and renal cell carcinoma [18], and was associated
with poor clinical prognosis. However, the expression and biologi-
cal functions of hnRNPK underlying tumorigenesis and progression
in bladder cancer remain unknown. In this study, we found that
hnRNPK is mainly expressed in the nucleus and rarely detected in
the cytoplasm of bladder cancer cells. We show for the first time
that increased expression of nuclear hnRNPK in bladder cancer
cells is positively correlated with poor differentiation and advanced
tumour stage. Furthermore, high nuclear hnRNPK expression was
associated with poor prognosis and served as an independent pre-
dictor of overall survival in bladder cancer. Consistent with our
findings, Barboro et al. found that high-hnRNPK expression in
prostate cancer was closely associated with Gleason score and
poor prognosis [17]. Taken together, high-hnRNPK expression
levels may serve as a novel prognostic marker for bladder cancer.
As reported previously, hnRNPK has been implicated in several
biological functions crucial for cancer development [30], including
proliferation [15, 31, 32], metastases [19, 20], angiogenesis [33]
and neuroendocrine differentiation [34]. Here, we discovered that
hnRNPK knockdown significantly inhibited bladder cancer cell pro-
liferation in vitro and tumour growth in vivo by inducing G0/G1
arrest. Supporting our findings, recent studies have found that
hnRNPK down-regulation suppressed cell proliferation in pancreatic
cancer [15] and renal cell carcinoma [18] in vitro, but the underly-
ing mechanism remains largely unknown. Through RNA-seq analy-
sis and ChIP, we determined that hnRNPK regulates cyclin D1 and
G0S2 transcription. Cyclin D1, a key regulator in G1-to-S-phase
transition, is overexpressed in bladder cancer and associated with
poor prognosis [35–37]. Several studies have revealed that G0S2
suppresses oncogenic transformation and induces apoptosis in
cancer cells [38, 39]. These data strongly suggest that hnRNPK
regulates the cell cycle of bladder cancer cells mainly by transcrip-
tional regulation of cyclin D1 and G0S2.
In this study, we found that hnRNPK knockdown increased apop-
tosis and sensitized bladder cancer cells to cisplatin. Mechanistically,
we first demonstrated that hnRNPK maintained anti-apoptosis and
promoted chemoresistance in bladder cancer cells via transcriptional
regulation of XAF1 and ERCC4. A recent study revealed that XAF1 is
down-regulated in bladder cancer and associated with good progno-
sis [40, 41]. Zhu et al. [42] found that XAF1 induces apoptosis, inhi-
bits angiogenesis, and inhibits tumour growth in hepatocellular
carcinoma. Similarly, hnRNPK suppresses apoptosis independent of
p53 status in hepatocellular carcinoma by increasing XIAP transcrip-
tion [22]. However, hnRNPK knockdown did not affect XIAP mRNA
levels in bladder cancer cells (data not shown), suggesting that the
mechanism of hnRNPK on apoptosis differs between cancers. ERCC4
plays an essential role in the nucleotide excision repair pathway and
is involved in chemoresistance in several cancers [43–45], including
bladder cancer [46, 47]. Consistent with our findings, hnRNPK down-
regulation by a mitogen-activated extracellular signal-regulated kinase
kinase inhibitor increased the radiotherapy sensitivity in malignant
melanoma cells [48]. Collectively, these findings indicate that
hnRNPK enhances bladder cancer cell anti-apoptosis and chemore-
sistance to cisplatin by regulating XAF1 and ERCC4 and that it may be
a potential target for drug development.
Heterogeneous nuclear ribonucleoprotein K is closely implicated
in various molecular functions in cancer, such as transcription, mRNA
stability, splicing, translation and protein interaction [30, 49, 50]. Sev-
eral studies have found that hnRNPK transcription activates several
important oncogenes, including c-SRC and c-MYC [51, 52]. As
hnRNPK is mainly expressed in the nuclei of bladder cancer cells, we
focused on its function in the nucleus and used RNA-seq to explore
the target genes. Interestingly, the genes regulated by hnRNPK were
mainly enriched in signal transduction, cell cycle, response to DNA
damage and apoptosis, which is consistent with cellular function in
bladder cancer. As hnRNPK binds tightly to polyC-DNA [30], we per-
formed a ChIP assay and designed primers to detect such DNA frag-
ments on the gene promoters. We found that hnRNPK regulated the
transcription of cyclin D1 (CCND1), G0S2,XAF1 and ERCC4 by bind-
ing their promoters. These results suggest that hnRNPK plays an
oncogenic role in bladder cancer by directly mediating these genes.
However, the function of hnRNPK in mRNA splicing and the cyto-
plasm remains largely unknown, and further investigation is under-
way to elucidate these key questions in bladder cancer.
In conclusion, it is our novel discovery that hnRNPK is up-
regulated in bladder cancer and correlates with poor prognosis.
Fig. 6 Identification of target genes of hnRNPK in bladder cancer. (A) Heat map representing unsupervised hierarchical clustering of mRNA
expression levels in UM-UC-3 cells transfected with control siRNA or si-hnRNPK for 48 hrs. Each column represents the indicated sample; each row
indicates one mRNA. Red and green indicate high and low expression respectively. (B) GO pathway analysis was used to identify the enrichment of
biological processes. (Cand D) RT-qPCR verification of differentially expressed genes in the RNA-seq of UM-UC-3 and T24 cells. The results are
presented as the means S.D. of three independent experiments. (E) Western blot detection of the expression of hnRNPK target genes. GAPDH
was used as the internal control. (F) ChIP analysis of IgG, hnRNPK, and RNA polymerase II status of candidate hnRNPK target genes in UM-UC-3
cells after knockdown assay. The values are normalized to input and presented as the mean S.D. *P<0.05, **P<0.01.
ª2016 The Authors.
Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.
11
J. Cell. Mol. Med. Vol XX, No X, 2016
Moreover, hnRNPK promotes bladder cancer cell proliferation,
anti-apoptosis and chemoresistance to cisplatin by regulating a
series of genes at transcriptional level. Therefore, hnRNPK is a
potential biomarker for bladder cancer and a promising target for
drug development.
Acknowledgements
This study was funded by the National Natural Science Foundation of China
(grant nos’. 81572514, U1301221, 81472384, 81402106, 81372729,
81272808, 81172431), Guangdong Province Natural Scientific Foundation
(grant nos’. 2016A030313321, 2015A030311011, 2015A030310122,
S2013020012671, 07117336, 10151008901000024), “Three Big Construc-
tions” funds of Sun Yat-sen University (for Jian Huang and Tianxin Lin), Spe-
cialized Research Fund for the Doctoral Program of Higher Education (for
Tianxin Lin, 20130171110073), the Fundamental Research Funds for the Cen-
tral Universities (for Jian Huang), Elite Young Scholars Program of Sun Yat-
Sen Memorial Hospital (for Tianxin Lin, J201401), and National Clinical Key
Specialty Construcion Project for Department of Urology and Department of
Oncology. Grant KLB09001 from the Key Laboratory of Malignant Tumor Gene
Regulation and Target Therapy of Guangdong Higher Education Institutes,
Sun-Yat-Sen University. Grant [2013]163 from Key Laboratory of Malignant
Tumor Molecular Mechanism and Translational Medicine of Guangzhou Bureau
of Science and Information Technology.
Conflict of interest
The authors declare no conflict interest.
Supporting information
Additional Supporting Information may be found online in the
supporting information tab for this article:
Figure S1 (A) Human prostate cancer tissues as the positive control
to test IHC hnRNPK antibody staining.
Figure S2 The immunostaining intensity of each sample was
graded as negative =0, weak =1, moderate =2, or strong =
3. Representative samples are shown at 9400 magnification.
Figure S3 Immunocytochemical analyses of hnRNPK expres-
sion in UM-UC-3 and T24 cells.
Figure S4 hnRNPK overexpression promotes bladder cancer
cell proliferation by regulating the cell cycle.
Figure S5 hnRNPK promotes anti-apoptosis and chemoresis-
tance to cisplatin in bladder cancer cells.
Figure S6 Western blot verification of hnRNPK stable knock-
down efficiency in UM-UC-3 cells by lentivirus.
Figure S7 Western blot detection of hnRNPK and RNA poly-
merase II levels in the ChIP assays.
Figure S8 ChIP analysis of IgG, hnRNPK, and RNA polymerase
II status of candidate hnRNPK target genes in UM-UC-3 and
T24 cells in DNA gel.
Figure S9 ChIP analysis of IgG, hnRNPK, and RNA polymerase
II status of candidate hnRNPK target genes in UM-UC-3 and
T24 cells after knockdown assay.
Table S1 Characteristics of patients and tumours in tissue
specimens.
Table S2 List of primer sequences for PCR studies.
References
1. Torre LA, Bray F, Siegel RL, et al. Global
cancer statistics, 2012. CA Cancer J Clin.
2015; 65: 87–108.
2. Weinstein JN, Akbani R, Broom BM, et al.
Comprehensive molecular characterization
of urothelial bladder carcinoma. Nature.
2014; 507: 315–22.
3. Knowles MA, Hurst CD. Molecular biology of
bladder cancer: new insights into pathogene-
sis and clinical diversity. Nat Rev Cancer.
2015; 15: 25–41.
4. Shariat SF, Karakiewicz PI, Godoy G, et al.
Survivin as a prognostic marker for urothe-
lial carcinoma of the bladder: a multicenter
external validation study. Clin Cancer Res.
2009; 15: 7012–9.
5. Nikpour P, Baygi ME, Steinhoff C, et al. The
RNA binding protein Musashi1 regulates
apoptosis, gene expression and stress gran-
ule formation in urothelial carcinoma cells. J
Cell Mol Med. 2011; 15: 1210–24.
6. Drayton RM, Catto JW. Molecular mechanisms
of cisplatin resistance in bladder cancer. Expert
Rev Anticancer Ther. 2012; 12: 271–81.
7. Wu Q, Yang Z, Nie Y, et al. Multi-drug resis-
tance in cancer chemotherapeutics: mecha-
nisms and lab approaches. Cancer Lett.
2014; 347: 159–66.
8. Li K, Chen X, Liu C, et al. Pirarubicin
induces an autophagic cytoprotective
response through suppression of the mam-
malian target of rapamycin signaling
pathway in human bladder cancer cells. Bio-
chem Bioph Res Co. 2015; 460: 380–5.
9. Kiselyov A, Bunimovich-Mendrazitsky S,
Startsev V. Key signaling pathways in the
muscle-invasive bladder carcinoma: clinical
markers for disease modeling and optimized
treatment. Int J Cancer. 2016; 138: 2562–9.
10. Klimek-Tomczak K, Wyrwicz LS, Jain S,
et al. Characterization of hnRNP K protein-
RNA interactions. J Mol Biol. 2004; 342:
1131–41.
11. Bomsztyk K, Denisenko O, Ostrowski J.
hnRNP K: one protein multiple processes.
BioEssays. 2004; 26: 629–38.
12. Michael WM, Eder PS, Dreyfuss G. The K
nuclear shuttling domain: a novel signal for
12 ª2016 The Authors.
Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.
nuclear import and nuclear export in the
hnRNP K protein. EMBO J. 1997; 16: 3587–
98.
13. Mikula M, Dzwonek A, Karczmarski J, et al.
Landscape of the hnRNP K protein-protein
interactome. Proteomics. 2006; 6: 2395–
406.
14. Hong X, Song R, Song H, et al. H PTEN
antagonises Tcl1/hnRNPK-mediated G6PD
pre-mRNA splicing which contributes to
hepatocarcinogenesis. Gut. 2014; 63: 1635–
47.
15. Zhou R, Shanas R, Nelson MA, et al.
Increased expression of the heterogeneous
nuclear ribonucleoprotein K in pancreatic
cancer and its association with the mutant
p53. Int J Cancer. 2010; 126: 395–404.
16. Carpenter B, McKay M, Dundas SR, et al.
Heterogeneous nuclear ribonucleoprotein K
is over expressed, aberrantly localised and is
associated with poor prognosis in colorectal
cancer. Br J Cancer. 2006; 95: 921–7.
17. Barboro P, Repaci E, Rubagotti A, et al.
Heterogeneous nuclear ribonucleoprotein K:
altered pattern of expression associated with
diagnosis and prognosis of prostate cancer.
Br J Cancer. 2009; 100: 1608–16.
18. Otoshi T, Tanaka T, Morimoto K, et al.
Cytoplasmic accumulation of heterogeneous
nuclear ribonucleoprotein K strongly pro-
motes tumor invasion in renal cell carci-
noma cells. PLoS ONE. 2015; 10: e145769.
19. Chung IC, Chen LC, Chung AK, et al. Matrix
metalloproteinase 12 is induced by hetero-
geneous nuclear ribonucleoprotein K and
promotes migration and invasion in
nasopharyngeal carcinoma. BMC Cancer.
2014; 14: 348.
20. Gao R, Yu Y, Inoue A, et al. Heterogeneous
nuclear ribonucleoprotein K (hnRNP-K) pro-
motes tumor metastasis by induction of
genes involved in extracellular matrix, cell
movement, and angiogenesis. J Biol Chem.
2013; 288: 15046–56.
21. Moumen A, Masterson P, O’Connor MJ,
et al. hnRNP K: an HDM2 target and tran-
scriptional coactivator of p53 in response to
DNA damage. Cell. 2005; 123: 1065–78.
22. Xiao Z, Ko HL, Goh EH, et al. hnRNP K sup-
presses apoptosis independent of p53 status
by maintaining high levels of endogenous
caspase inhibitors. Carcinogenesis. 2013;
34: 1458–67.
23. Chen X, Xie W, Gu P, et al. Upregulated
WDR5 promotes proliferation, self-renewal
and chemoresistance in bladder cancer via
mediating H3K4 trimethylation. Sci Rep.
2015; 5: 8293.
24. Wang B, Wu S, Zeng H, et al. CD103
+
tumor
infiltrating lymphocytes predict a favorable
prognosis in urothelial cell carcinoma of the
bladder. J Urol. 2015; 194: 556–62.
25. Chen X, Gu P, Li K, et al. Gene expression
profiling of WDR5 regulated genes in blad-
der cancer. Genom Data. 2015; 5: 27–9.
26. Fan X, Chen X, Deng W, et al. Up-regulated
microRNA-143 in cancer stem cells differen-
tiation promotes prostate cancer cells
metastasis by modulating FNDC3B expres-
sion. BMC Cancer. 2013; 13: 61.
27. Cui H, Wu F, Sun Y, et al. Up-regulation and
subcellular localization of hnRNP A2/B1 in
the development of hepatocellular carci-
noma. BMC Cancer. 2010; 10: 356.
28. Boukakis G, Patrinou-Georgoula M,
Lekarakou M, et al. Deregulated expres-
sion of hnRNP A/B proteins in human
non-small cell lung cancer: parallel assess-
ment of protein and mRNA levels in paired
tumour/non-tumour tissues. BMC Cancer.
2010; 10: 434.
29. Balasubramani M, Day BW, Schoen RE,
et al. Altered expression and localization of
creatine kinase B, heterogeneous nuclear
ribonucleoprotein F, and high mobility group
box 1 protein in the nuclear matrix associ-
ated with colon cancer. Cancer Res. 2006;
66: 763–9.
30. Barboro P, Ferrari N, Balbi C. Emerging
roles of heterogeneous nuclear ribonucleo-
protein K (hnRNP K) in cancer progression.
Cancer Lett. 2014; 352: 152–9.
31. Notari M, Neviani P, Santhanam R, et al. A
MAPK/HNRPK pathway controls BCR/ABL
oncogenic potential by regulating MYC
mRNA translation. Blood. 2006; 107: 2507–
16.
32. Almeida LO, Garcia CB, Matos-Silva FA,
et al. Accumulated SET protein up-regulates
and interacts with hnRNPK, increasing its
binding to nucleic acids, the Bcl-xS repres-
sion, and cellular proliferation. Biochem Bio-
phys Res Commun. 2014; 445: 196–202.
33. Benelli R, Monteghirfo S, Balbi C, et al.
Novel antivascular efficacy of metronomic
docetaxel therapy in prostate cancer: hnRNP
K as a player. Int J Cancer. 2009; 124:
2989–96.
34. Ciarlo M, Benelli R, Barbieri O, et al. Regu-
lation of neuroendocrine differentiation by
AKT/hnRNPK/AR/beta-catenin signaling in
prostate cancer cells. Int J Cancer. 2012;
131: 582–90.
35. Malumbres M, Barbacid M. Cell cycle, CDKs
and cancer: a changing paradigm. Nat Rev
Cancer. 2009; 9: 153–66.
36. Watters AD, Latif Z, Forsyth A, et al.
Genetic aberrations of c-myc and CCND1 in
the development of invasive bladder cancer.
Br J Cancer. 2002; 87: 654–8.
37. Seiler R, Thalmann GN, Rotzer D, et al.
CCND1/CyclinD1 status in metastasizing
bladder cancer: a prognosticator and predic-
tor of chemotherapeutic response. Mod
Pathol. 2014; 27: 87–95.
38. Yim CY, Sekula DJ, Hever-Jardine MP,
et al. G0S2 suppresses oncogenic transfor-
mation by repressing a MYC-regulated tran-
scriptional program. Cancer Res. 2016; 76:
1204–13.
39. Welch C, Santra MK, El-Assaad W, et al.
Identification of a protein, G0S2, that lacks
Bcl-2 homology domains and interacts with
and antagonizes Bcl-2. Cancer Res. 2009;
69: 6782–9.
40. Lee MG, Huh JS, Chung SK, et al. Promoter
CpG hypermethylation and downregulation
of XAF1 expression in human urogenital
malignancies: implication for attenuated p53
response to apoptotic stresses. Oncogene.
2006; 25: 5807–22.
41. Pinho MB, Costas F, Sellos J, et al. XAF1
mRNA expression improves progression-
free and overall survival for patients with
advanced bladder cancer treated with neoad-
juvant chemotherapy. Urologic Oncology:
Seminars and Original Investigations. 2009;
27: 382–90.
42. Zhu LM, Shi DM, Dai Q, et al. Tumor sup-
pressor XAF1 induces apoptosis, inhibits
angiogenesis and inhibits tumor growth in
hepatocellular carcinoma. Oncotarget. 2014;
5: 5403–15.
43. Usanova S, Piee-Staffa A, Sied U, et al.
Cisplatin sensitivity of testis tumour cells is
due to deficiency in interstrand-crosslink
repair and low ERCC1-XPF expression. Mol
Cancer. 2010; 9: 248.
44. Hatch SB, Swift LP, Caporali S, et al. XPF
protein levels determine sensitivity of malig-
nant melanoma cells to oxaliplatin
chemotherapy: suitability as a biomarker for
patient selection. Int J Cancer. 2014; 134:
1495–503.
45. Li W, Melton DW. Cisplatin regulates the
MAPK kinase pathway to induce increased
expression of DNA repair gene ERCC1 and
increase melanoma chemoresistance. Onco-
gene. 2012; 31: 2412–22.
46. Wang M, Wang M, Yuan L, et al. A novel
XPF -357A>C polymorphism predicts risk
and recurrence of bladder cancer. Onco-
gene. 2010; 29: 1920–8.
47. Li J, Zhang J, Liu Y, et al. Increased expres-
sion of DNA repair gene XPF enhances resis-
tance to hydroxycamptothecin in bladder
cancer. Med Sci Monit. 2012; 18: R156–62.
48. Eder S, Lamkowski A, Priller M, et al.
Radiosensitization and downregulation of
heterogeneous nuclear ribonucleoprotein K
ª2016 The Authors.
Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.
13
J. Cell. Mol. Med. Vol XX, No X, 2016
(hnRNP K) upon inhibition of mitogen/extra-
cellular signal-regulated kinase (MEK) in
malignant melanoma cells. Oncotarget.
2015; 6: 17178–91.
49. Fan X, Xiong H, Wei J, et al. Cytoplasmic
hnRNPK interacts with GSK3band is essen-
tial for the osteoclast differentiation. Sci
Rep. 2015; 5: 17732.
50. Gao X, Feng J, He Y, et al. hnRNPK inhibits
GSK3bSer9 phosphorylation, thereby stabi-
lizing c-FLIP and contributes to TRAIL resis-
tance in H1299 lung adenocarcinoma cells.
Sci Rep. 2016; 6: 22999.
51. Naarmann IS, Harnisch C, Flach N, et al.
mRNA silencing in human erythroid cell mat-
uration: heterogeneous nuclear ribonucleo-
protein K controls the expression of its
regulator c-Src. J Biol Chem. 2008; 283:
18461–72.
52. Takimoto M, Tomonaga T, Matunis M,
et al. Specific binding of heterogeneous
ribonucleoprotein particle protein K to the
human c-myc promoter, in vitro.J Biol
Chem. 1993; 268: 18249–58.
14 ª2016 The Authors.
Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.
