Identification and Characterisation of an Oleaginous Fungus Producing High g-Linoleneic Acid

Abstract

Oleaginous fungi serve as good alternatives for the production of essential, polyunsaturated fatty acids (PUFA) such as g-linolenic acid (GLA; 18:3). In this study, a locally isolated fungus, isolate 2A1, was evaluated for its lipid and GLA production, and its identity was determined. The fungus was grown in nitrogen-limited media and the amount of lipid and GLA produced were determined every 12 hours. The highest percentage of lipid produced per cell dry weight was 38.64% (w/w) while the highest amount of GLA produced was 0.65 g/L. These observations indicate that isolate 2A1 is a good lipid producer and capable of accumulating high amounts of GLA. To identify isolate 2A1 to the species level, its morphology was observed under the light and electron microscope. Subsequently, its 18S rDNA and the internal transcribed spacer (ITS) sequences were cloned, sequenced and analysed phylogenetically to 18S rDNA and ITS1 sequences of related fungi. Microscopic observation showed that isolate 2A1 produced coenocytic hyphae and self-bearing globose sporangioles, with a diameter between 6-8 µm. Neighbour-joining tree built based on the 1.6 kb 18S rDNA region clustered isolate 2A1 with fungi of the genus Cunninghamella. Maximum parsimony tree analysis based on a 154 bp ITS1 sequence grouped isolate 2A1 together with Cunninghamella bainieri strain NRRL 1375 with 100% bootstrap value. Thus, based on morphological and molecular phylogenetic data, isolate 2A1 is designated as C. baineri strain 2A1.

Full text

ISPUB.COM The Internet Journal of Microbiology
Volume 9 Number 2
1 of 9
Identification and Characterisation of an Oleaginous
Fungus Producing High g-Linoleneic Acid
A Murad, N Karim, N Hashim, A Adnan, Z Zainal, A Hamid, F Bakar
Citation
A Murad, N Karim, N Hashim, A Adnan, Z Zainal, A Hamid, F Bakar. Identification and Characterisation of an Oleaginous
Fungus Producing High g-Linoleneic Acid. The Internet Journal of Microbiology. 2010 Volume 9 Number 2.
Abstract
Oleaginous fungi serve as good alternatives for the production of essential, polyunsaturated fatty acids (PUFA) such as g-
linolenic acid (GLA; 18:3). In this study, a locally isolated fungus, isolate 2A1, was evaluated for its lipid and GLA production,
and its identity was determined. The fungus was grown in nitrogen-limited media and the amount of lipid and GLA produced
were determined every 12 hours. The highest percentage of lipid produced per cell dry weight was 38.64% (w/w) while the
highest amount of GLA produced was 0.65 g/L. These observations indicate that isolate 2A1 is a good lipid producer and
capable of accumulating high amounts of GLA. To identify isolate 2A1 to the species level, its morphology was observed under
the light and electron microscope. Subsequently, its 18S rDNA and the internal transcribed spacer (ITS) sequences were
cloned, sequenced and analysed phylogenetically to 18S rDNA and ITS1 sequences of related fungi. Microscopic observation
showed that isolate 2A1 produced coenocytic hyphae and self-bearing globose sporangioles, with a diameter between 6-8 µm.
Neighbour-joining tree built based on the 1.6 kb 18S rDNA region clustered isolate 2A1 with fungi of the genus Cunninghamella.
Maximum parsimony tree analysis based on a 154 bp ITS1 sequence grouped isolate 2A1 together with Cunninghamella
bainieri strain NRRL 1375 with 100% bootstrap value. Thus, based on morphological and molecular phylogenetic data, isolate
2A1 is designated as C. baineri strain 2A1.
INTRODUCTION
Gamma-linolenic acid (GLA: 18:3) is considered as an
essential fatty acid in humans and acts as an important
intermediate in the biosynthesis of biologically active
prostaglandin from linolenic acid. It has been reported to be
effective for the prevention or curing a variety of diseases
including rheumatoid arthritis, cardiovascular diseases,
hyper-cholestromia, atopic eczema and asthma [1-3]. Dietary
supplement of GLA has shown a positive effect on the
disorders related to the deficiencies of this fatty acid. As a
result there is always considerable interest for the large scale
production of GLA to support the demand of the industries.
The principal sources of GLA are the seeds of evening
primrose (Oenothera biennis) with 8-10% (w/w) GLA,
borage seeds (Borago oficinalis) containing 24-25% (w/w)
GLA and black currant seeds (Ribes nigrum), which consist
of 16-17% (w/w) GLA [4]. However, the productivity of
GLA from these seed oils is still considered low, since both
long periods and huge areas for plant cultivation are
required. The production of GLA from plants is also
dependent on the seasonal and climatic changes, which
could destabilise the price of the oil in the market. In
addition, with the increase interest in growing plants such as
canola and soybean for biodiesel production and the need to
grow crops for essential food production, stiff competition
for fertile agricultural land is expected in the near future.
These factors could further contribute towards the
fluctuation of the production cost of GLA from plants.
To overcome these limitations, microorganisms may serve as
an alternative source for GLA production. Microorganisms
have several advantages over plants in the production of
GLA including high growth rates, simple culture conditions,
independence of seasonal and climatic changes, and can be
readily grown under controlled conditions with nutritional
regimes that may stimulate or repress the key steps of fatty
acid formation [5]. Fungi, such as Zygomycetes have been
widely reported for their competence in producing GLA.
Genera of Mucor, Mortierella, Absidia and Cunninghamella
had been extensively investigated as an alternative source for
GLA production [6].
Research and development of GLA production from fungi is
in progress and mostly aimed at improving the economic
competitiveness of fungal GLA production. These include
searching for high GLA producing fungi [7], optimising

Identification and Characterisation of an Oleaginous Fungus Producing High g-Linoleneic Acid
2 of 9
growth media for optimum lipid and GLA production [8,9]
and exploring the possibility of using cheaper substrates for
fungal growth [10,11]. Screening of potential fungi for GLA
production is an essential step, limiting the number of strains
available for further improvement and practical usage. One
essential aspect needs to be considered during selection for
GLA production is that the selected strain should be able to
produce high amounts of lipid containing high percentages
of fatty acids in the form of GLA. High lipid producers alone
might not be the best candidate unless they produced
relatively high amounts of GLA. Although a number of
filamentous fungi of the class Zygomycetes accumulate
large amounts of oil, they tend to have low contents of GLA
and conversely, those with high GLA content have
comparatively low oil levels. Mucor circinelloides, for
example, was reported to produce up to 23% lipid in the
biomass and approximately 24% of the oil content is GLA
[5]. Mortierella isabellina, on the other hand, produced up to
53% lipid in the biomass but with only 4.5% GLA of the
total fatty acids. Hence, during screening processes, fungi
producing high lipid contents with relatively high
percentages of GLA should be considered.
This study reports on the characterisation of GLA production
and molecular identification of a newly isolated strain of
oleaginous fungus which was previously isolated from
Malaysian soil [12] and could serve as a potential source of
GLA production.
MATERIALS AND METHODS
FUNGAL STRAIN AND CULTIVATION
Fungal isolate 2A1 used in this study was isolated from the
soil collected from Malaysian forest floor [12] and
maintained on potato dextrose agar (PDA) supplied by
Oxoid (United Kingdom). Prior to the isolation of genomic
DNA, fungal cultures were prepared by excising 1 cm2
pieces of mycelia from the PDA plates and were sub-
cultured into 200 mL of potato dextrose broth (PDB). The
culture was grown for 3 days on a rotary shaker at 250 rpm,
30oC. The mycelia were then harvested, placed into a mortar
which had previously been chilled with liquid nitrogen, and
grounded with a pestle in the presence of liquid nitrogen.
The fine powder produced was used as a starting material for
genomic DNA extraction.
For lipid and fatty acid analysis, spore suspensions were
used as starter inoculums for each experiment. A total of 2 
107 spores were inoculated into 200 mL of nitrogen limited
media [13] and grown at 30oC with shaking at 250 rpm.
Cultures were harvested at different time points for 7 days
and filtered through Whatman No. 4 filter paper (Whatman,
USA) and washed twice with deionised distiled water
(ddH2O). The cells were dried in an oven at 60-70oC for 24
to 48 hours and the dry cell weight was determined after the
constant cell weight was achieved.
FUNGAL LIPID EXTRACTION AND FATTY ACID
ANALYSIS
Extraction of lipids was performed according to the modified
procedure of Folch et al. [14]. Prior to lipid extraction,
mycelia were freeze-dried at -50oC for 24 hours to a constant
weight. The dried mycelia were grounded into fine powder
and added into 150 mL of chloroform/methanol (2:1, v/v).
The suspension was then left overnight at room temperature.
The homogenate was filtered and washed with 150 mL of
0.1% NaCl solution. The mixture was mixed and allowed to
settle into two phases. The lower chloroform phase that
contains lipid was recovered and rinsed twice with 150 mL
distilled water. The mixture was then transferred into a
rotary bottle and was evaporated using a rotary evaporator.
Subsequently, the rotary bottle was washed with diethyl
ether to collect the lipids and the sample was left in the fume
hood to allow evaporation of diethyl ether. The lipids were
weighed and analysed using a gas chromatography unit
equipped with DB 23 cis/trans capilary columns. The
detector FID (flame ionisation detector) was used. Fatty
acids were identified based on the retention time of standard
fatty acids (Sigma, USA). A total of three independent
experiments were carried out to determine the lipid and the
fatty acid production from isolate 2A1.
CHARACTERISATION OF FUNGAL
MORPHOLOGY
Fungal strain 2A1 was identified microscopically using
cellophane tape lactophenol mount method and scanning
electron microscope (SEM). A strip of cellophane
transparent tape was placed onto a 5-day old culture plate
and samples were examined under 40 magnification of a
light microscope (Olympus, Germany). The mycelia were
also observed under an electron microscope (LEO Model
1450VP Variable Pressure Scanning Electron Microscope,
Carl Zeiss, USA).
DNA EXTRACTION
Genomic DNA was isolated from mycelia using the method
developed previously by Voigt et al. [15] with some
modifications. Briefly, the grounded mycelia was
resuspended in 700 μL of hexacetyltrimethylammonium

Identification and Characterisation of an Oleaginous Fungus Producing High g-Linoleneic Acid
3 of 9
bromide (CTAB; Sigma Chemicals, USA) extraction buffer
[100 mM Tris-HCl (pH 8.4), 1.4 M NaCl, 25 mM EDTA,
2% CTAB] and vortexed for 10 seconds. The homogenate
was incubated at 65oC for 10 min. Following extraction, an
equal volume of chloroform was added to the mixture,
vortexed for 5 seconds and then spun for 10 min, 4oC and at
13,000 rpm using Sigma 3-18K centrifuge (Sigma,
Germany). Subsequently, 500 μL of the upper phase was
transferred into a new 1.5 mL tube and 5 μL of RNase A (20
mg/mL) was added to the tube. The mixture was incubated
at 37oC for 30 min. DNA was precipitated with an equal
volume of cold isopropanol and kept for 15 min at -20oC.
After the DNA was pelleted by centrifugation at 13,000 rpm
for 1 min, the supernatant was discarded and the pellet was
gently washed with 70% ethanol and resuspended in 20 μL
distilled water. The DNA was stored at –20oC until further
application.
AMPLIFICATION AND CLONING OF 18S RDNA
AND DNA REGION FOR INTERNAL
TRANSCRIBED SPACERS (ITS)
To amplify the partial 18S rDNA and ITS1-5.8S-ITS2 DNA
region of isolate 2A1, primers were designed using
sequences from related species of Zygomycetes obtained
from the National Center for Biotechnology Information
(NCBI) database. For the amplification of 18S rDNA region,
the forward primer, 5’-AAGGCCTGACTTCGGGAG-3’,
and the reverse primer, 5’-
TCCTCTAAATAATCTAGTTTGCCAT-3’ were used. The
forward primer, 5’
AGGTGAACCTGCGGAAGGATCATTA 3’ and the
reverse primer, 5’ ATTGATATGCTTAAGTTCAGCGGT
3’ in turn were used to amplify ITS1-5.8S-ITS2 DNA
region. PCR amplifications were carried out in a total
volume of 20 µL. The reaction mixture contained 500 ng of
genomic DNA, 1x PCR buffer (Promega, USA), 2.5 mM
MgCl, 10 µM each of dNTP (dGTP, dATP, dCTP and
dTTP), 20 pmol of each primer and 0.5 units of Taq DNA
polymerase (Promega, USA). The PCR cycling profile was
as follows: 95ºC for 5 minutes (one cycle), followed by 29
cycles of 95ºC denaturation for 20 seconds, primer annealing
for 30 seconds at 60ºC for 18S rDNA and 65ºC for ITS, and
elongation at 72ºC for 2 minutes. The final primer extension
continued for an additional 10 minutes.
The amplified products were analysed by gel electrophoresis
on a 1.0% agarose gel containing 10 mg/mL of ethidium
bromide and visualised under UV light. The PCR products
were then gel purified using QIAquick gel extraction kit
(Qiagen, Germany) and ligated into pGEM-T Easy vector
(Promega, USA).
SEQUENCING AND PHYLOGENETIC ANALYSIS
Sequencing of clones was performed on both strands using
BigDye® Terminator v3.1 Cycle Sequencing kit (Applied
Biosystems, USA). Sequencing was carried out from the 5’
end using the T7 primer (5’-
GAGTAATACGACTCACTATAGGG-3) and from the 3’
end using SP6 primer
(5’TATTTAGGTGACACTATAG-3’). The reaction
contained 3.2 pmol of each primer with a reaction volume of
10 µL and 1 µL of Big Dye solution. The cycle sequencing
reaction was 96oC for 5 minutes (one cycle), 35 cycles of
96oC for 30 seconds, 50oC for 15 seconds and 60oC for 5
minutes. The sequences were deposited in the GenBank
database. The accession number of 18S rDNA of isolate 2A1
is EF562534 and ITS1-5.8S-ITS2 DNA fragment is
EF562535.
Sequences of 18S rDNA and ITS1 of isolate 2A1 were
analysed along with the 18S rDNA sequence of 35
Zygomycetes and ITS1 of 13 Zygomycetes. Sequences for
Zygomycetes 18S rDNA and ITS1 for the phylogenetic
analysis were retrieved from the National Center for
Biotechnology Information (http://www.ncbi.nlm.nih.gov).
The sequences were aligned using ClustalW program [16].
Phylogenetic analyses were carried out using both
neighbour-joining (NJ) and maximum parsimony (MP)
methods by using PAUP*4.0
(http://paup.csit.fsu.edu/downl.html). Both analyses were
assessed for support by bootstrap analyses of 1000
replicates. To root the trees, the 18S rDNA sequence of a
few species of Mortierellales and ITS1 sequence of Absidia
glauca and Absidia coerulea were retrieved from the
GenBank sequence database.
RESULTS AND DISCUSSION
LIPID AND GLA PRODUCTION OF STRAIN 2A1
In an effort to identify potential GLA producers, fungi
isolated from soil collected at various sites in Malaysia were
screened for their cellular lipid and GLA content [12].
Subsequently, several fungal isolates, which contain more
than 25% of their biomass in the form of lipids, were
identified (data not shown). Preliminary analysis showed
that isolate 2A1 was able to produce lipid up to more than
30% of its dry weight. In order to further evaluate its
capability to produce lipid and GLA, isolate 2A1 was
cultivated in a nitrogen limited media and the production of

Identification and Characterisation of an Oleaginous Fungus Producing High g-Linoleneic Acid
4 of 9
lipid as well as the composition of different fatty acids was
observed. Nitrogen limited media was used in this
experiment as this medium was shown to enhance lipid
accumulation in fungi [13]. In oleaginous fungi, nitrogen
limitation prevents cell proliferation and allows the
conversion of the available carbon source into storage lipid.
In this growth media, the biomass of isolate 2A1 gradually
increased until 72 hours of growth and then started to be
consistent (Table 1). The highest biomass yield was 4.12 g/L
which was recorded after 72 hours of growth. The
percentage of total lipid produced over dry weight also
increased until 96 hours of growth before it started to be
consistent. Lipid synthesis in isolate 2A1 was correlated
with the production of its biomass. The highest production
of lipid produced per cell dry weight was approximately
38.64% (w/w) after 144 h of growth (Table 1). The amount
of lipid production in this fungus is comparable to the lipid
produced by other oleaginous fungi. For example Mortierella
ramanniana var. ramanniana produced 54.2% (w/w) lipid
over cell dry weight, Mucor sp LB-54 produced 20.73%
[17], Conidiobolus nanodes produced 34% (w/w) [5], Mucor
rouxii produced 32% (w/w) [18] and Cunninghamella strain
LGAM produced 28.1% [19]. Hence, this data indicate that
isolate 2A1 is a good lipid producer and the amount of lipid
produced per cell dry weight was comparable or, in some
cases, better compared to other reported oleaginous fungi.
Figure 1
Table1: Yield of cellular biomass, lipid and GLA produced
by fungal isolate 2A1 grown in nitrogen limited media
To determine the fatty acid profile in lipid extracted from
isolate 2A1, lipid extracted at different time points of fungal
growth was analysed using gas chromatography. The
presence of twelve fatty acids in the lipid samples, namely
lauric acid (C12:0), myristic acid (C14:0), pentadecanoic
acid (C15:0), palmitic acid (C16:0), palmitoleic acid
(C16:1), stearic acid (C18:0), oleic acid (C18:1), linoleic
acid (C18:2), -linolenic acid (C18:3G), -linolenic acid
(C18:3A) and behenic acid (C22:0), were investigated and
examined. Data presented in Table 2 shows the result of
changes in the amounts of fatty acids in the lipid produced
by isolate 2A1 during growth in shake flasks at different
time points. Fatty acid analyses indicate that the lipid of
isolate 2A1 was rich in five fatty acids, namely palmitic acid
with the highest production of 24.2 % (percentage of fatty
acid from the total lipid), stearic acid with the highest
production of 8.6%, oleic acid with the highest production of
41.6%, linoleic acid with the highest production of 18.7%
and -linolenic acid with the highest production of 15.64%
(Table 2). There was very minimal presence of alpha-
linolenic acid (18:3) (Table 2) and other beneficial, long
polyunsaturated fatty acids such as dihomo--linolenic acid
(20:3), arachidonic acid (20:4) and eicosapentaenoic acid
(20:5) detected in lipid of isolate 2A1 (data not shown).
Amongst fatty acids that were present in this analysis, -
linolenic acid (GLA), an important fatty acid due to its
tremendous commercial potential was chosen for further
analysis. To analyse further on the GLA production, the
amount of GLA produced per liter of medium was measured
at different growth points. The highest amount of GLA
produced by isolate 2A1 was 0.65 g/L which was produced
after 144 hours of growth (Table 1). Although the highest
percentage of GLA over lipid production was 15.64% after
12 hours of growth, their production of GLA per liter was
the lowest. This is because at this stage the amount of the
biomass produced was the least amongst the biomass taken
from different time points. It also should be noted that at this
stage, the conidia of isolate 2A1 started to germinate and
produce germ tubes. Khunyoshyeng et al. [20] reported that
the level of GLA is high during germ tube emergence of
Mucor rouxii. Therefore, the high percentage of GLA over
lipid production detected at 12 hours could coincide with the
germination of the conidia of isolate 2A1 and not represent
the storage GLA.

Identification and Characterisation of an Oleaginous Fungus Producing High g-Linoleneic Acid
5 of 9
Figure 2
Table 2: Fatty acids composition of the cellular lipids
produced during growth in nitrogen limited medium at
various time points.
The data represent the mean values from three independent
cultures and fatty acid determination were carried out in
duplicate.
However, it is difficult to make a direct comparison in GLA
production between isolate 2A1 with published GLA
production data of other fungal species. This is due to the
differences in media formulation and growth conditions
employed by different studies. However, based on the data
obtained, it can be concluded that isolate 2A1 is a good
candidate for GLA production since it can accumulate high
amounts of lipid (up to 38.2% lipid/ dry biomass) with
satisfactory content of GLA (11% GLA/total lipid). Further
analysis, such as the usage of cheap substrates for growth
and variations in growth media formulation, should be
explored in order to maximise the production of lipid and
GLA from isolate 2A1, which in turn will increase its
industrial competitiveness.
MOLECULAR IDENTIFICATION AND
PHYLOGENETIC ANALYSIS OF NUCLEAR
RDNA SEQUENCE
In an effort to identify isolate 2A1 to the species level,
detailed microscopic observation and analysis of the 18S
rDNA and the ITS sequences of the fungus were performed.
Both 18S rDNA and the ITS sequences have shown great
variables and were frequently used to differentiate many
fungal species [21, 22]. The morphology of the fungus was
examined under light and scanning electron microscopes.
One obvious characteristic of the fungus was the absence of
septate hyphae, which indicates that it is a Zygomycete. This
correlates with the findings associating Zygomycetes such as
Mortierella, Mucor, Rhizopus and Cunninghamella with
high amounts of cellular lipid and GLA [5, 19, 23]. In
addition, the presence of globose sporangioles with spines
was observed. These sporangioles were attached to a vesicle
which was located at the tip of the sporangiophore (Figure
1). The size of a sporangiola was approximately 6-7 µm in
diameter. Sporangioles are structures that contain
sporangiospores and the spines present on the outer surface
mainly consist of calcium oxalate dihydrate [24]. Based on
these morphological structures it was deduced that isolate
2A1 is a Zygomycete and may be a member of the genus
Cunninghamella.
Figure 3
Figure 1: Structure of isolate 2A1 under Scanning Electron
Microscopy (SEM)
A. Spiny sporangiola. B. Sporangioles attached to a
shrunken vesicle located at the tip of sporangiophore. C:
Released mature sporangiola with a scar represented the
attachment site to the vesicle. D. Sporangioles attached to a
vesicle
To identify the fungus at the genus and species level, the 18S
rDNA was sequenced and compared with the 18S rDNA of
other Zygomycetes. The primers used to amplify the 18S
rDNA was designed based on the sequence of conserved
region of 18S rDNA of several species of Zygomycetes. A
total of 1613 bp of the 18S rDNA sequence were amplified,
cloned and sequenced. The sequence obtained was submitted
to GenBank with the accession number, EF562534. Initial
analysis of 18S rDNA sequence using BLAST program from
the National Center for Biotechnology Information (NCBI)
(http://www.ncbi.nlm.nih.gov/) showed 99% identity to
Cunninghamella polymorpha, C. elegans and C.
bertholletiae. Using the 18S rDNA sequence, phylogenetic
trees that include 18S rDNA sequences of 35 Zygomycetes

Identification and Characterisation of an Oleaginous Fungus Producing High g-Linoleneic Acid
6 of 9
that are available from GenBank, were constructed.
Neigbour-joining using 18S rDNA and bootstrap analyses
support that the isolate 2A1 sequence falls within species of
Cunninghamella genus (Figure 2). Similar analysis using
maximum parsimony generated the same result (data not
shown).
Based on the observations from both morphological
characterisation and 18S rDNA sequence analysis, the rDNA
region comprising the 5.8S rDNA and two adjacent internal
transcribed spacers (ITS1 and ITS2) was sequenced and
compared with ITS1 sequences of other Cunninghamella
species. The sequence data for the ribosomal internal
transcribed spacers for most members of the genus
Cunninghamella was available from work described by Liu
et al. [25]. PCR amplicon containing the ITS1-5.8S rDNA-
ITS2 with the size of 706 bp was amplified, cloned and
sequenced. The sequence obtained was submitted to the
GenBank with accession number, EF562535. BLAST
analysis showed 97% identity between isolate 2A1 to C.
bainieri strain NRRL 1375 [25] for both ITS1 and ITS2
regions. Using a 154 bp of the ITS1 sequence, a
phylogenetic tree was constructed. The aligned sequence
was 154 bases with gaps. The maximum parsimony tree
grouped the isolate 2A1 sequence together with C. bainieri
with 100% bootstrap support (Figure 3). Similar relationship
was obtained when phylogenetic analysis was carried out
using neighbour-joining (data not shown). Thus, the isolate
2A1 is designated as Cunninghamella baineri strain 2A1
based on the molecular phylogenetic inferences that provide
strong support for the close relationship of isolate 2A1 to C.
baineri.
Figure 4
Figure 2: Neighbour-joining tree showing the phylogenetic
relationship amongst Zygomycetes based on their 18S rDNA
sequences. 18S rDNA sequence of three species were used
as outgroups to root the tree.

Identification and Characterisation of an Oleaginous Fungus Producing High g-Linoleneic Acid
7 of 9
Figure 5
Figure 3: Maximum parsimony tree showing the
phylogenetic relationship between species based on their
ITS1 sequences. The ITS sequence of two species were used
as outliers.
The identification of C. bainieri as a potential GLA
producer, as described in this work, is not uncommon since a
number of Cunninghamella species such as C. elegans [10],
C. echinulata [26] and Cunninghamella strain LGAM [19]
has been reported to produce high lipid and GLA. The
production of lipid and GLA from C. bainieri 2A1 is
comparable, if not better, to other Cunninghamella species.
Further analysis involving optimisation of growth media and
utilisation of cheap substrates should be explored in the
future so that the potential of this strain to produce GLA at
the industrial level will be materialised.
ACKNOWLEDGEMENTS
This work was supported by the Ministry of Science,
Technology and Innovation (MOSTI), Malaysia (IRPA grant
09-02-02-001-BTK/TD/001) and Universiti Kebangsaan
Malaysia (UKM-OUP-KPB-33-167/2011). Noor Adila
Abdul Karim is supported by the National Science
Fellowship (MOSTI).
References
1. Das, U. N. Can essential fatty acids reduce the burden of
disease(s). Lipids in Health and Disease; 2008; 7: 9.
2. Surette, M. E, Koumenis, I. L., Edens, M. B., Tramposch,
K. M., Clayton, B., Bowton, D. and Chilton, F.H. Inhibition
of leukotriene biosynthesis by a novel dietary fatty acid
formulation in patients with atopic asthma: A randomized,
placebo-controlled, parallel-group, prospective trial. Clinical
Therapeutics; 2003; 25(3): 972-979.
3. Zamaria, N. Alteration of polyunsaturated fatty acid status
and metabolism in health and disease. Reproduction
Nutrition Development; 2004; 44(3): 273-282.
4. Lawson, L. D. and Hughes, B. G. Triacylglycerol
structure of plant and fungal oils containing -linolenic acid.
Lipids; 1988; 23(4): 313-317.
5. Certik, M. and Shimizu, S. Biosynthesis and regulation of
microbial polyunsaturated fatty acid production. Journal of
Bioscience and Bioengineering; 1999; 87(1): 1-14.
6. Sancholle M., Laruelle, F., Losel, D. M. and
Muchembled, J. Biotechnological potential of fungal lipids;
in Arora, D. K. Handbook of Fungal Biotechnology Volume
20; Marcel Dekker; New York; 2004.
7. Aki, T., Matsumoto, Y., Morinaga, T., Kawamoto, S.,
Shigeta, S., Ono, K. and Suzuki, O. Lipid composition of a
newly isolated poyunsaturated fatty acid-producing fungus,
Achlya sp. ma-2801. Journal of Fermentation and
Bioengineering; 1998; 86(5): 504-507.
8. Dyal S. D. and Narine, S. S. Implications for the use of
Mortierella fungi in the industrial production of essential
fatty acids. Food Research International; 2005; 38(4):
445-467.
9. Gema, H., Kavadia, A., Dimas, D., Tsagou, V., Komaitis,
M. and Aggelis, G. Production of -linoleneic acid by
Cunninghamella echinulata cultivated on glucose and orange
peel. Applied Microbiology and Biotechnology; 2002;
58(3):303-307.
10. Conti, E., Stredansky, M., Stredanska, S. and Zanetti, F.
-Linolenic acid production by solid-state fermentation of
Mucorales strains on cereal. Bioresource Technology; 2001;
76(3): 283-286.
11. Stredansky, M., Conti, E., Stredanska, S. and Zanetti, F.
-Liolenic acid production with Thamnidium elegans by
solid-state fermentation on apple pomace. Bioresource
Technology; 2000; 73(1): 41-45.
12. Hamid, A.A., Yusof, W.M.W., Illias, R.M. and
Nadarajah, K. Pengasingan strain baru kulat dari tanah
Malaysia untuk penghasilan asid γ-linolenik (GLA). Jurnal
Teknologi; 2001; 34: 1 – 8.
13. Kendrick, A. and Ratledge, C. Lipids of selected molds
grown for production of n-3 and n-6 polyunsaturated fatty
acids. Lipids; 1992; 27(1): 15-20.
14. Folch, J., Lees, M. and Stanley, G. H. S. A simple
method for the isolation and purification of total lipids from
animal tissues. Journal of Biological Chemistry; 1957;
226(1): 497-509.
15. Voigt, K., Cigelnik, E. and O’Donnell, K. Phylogeny and
PCR identification of clinically important Zygomycetes
based on nuclear ribosomal-DNA sequence data. Journal of
Clinical Microbiology; 1999; 37(12): 3957-3964.
16. Chenna, R., Sugawara, H., Koike, H., Lopez, R., Gibson,
T. J., Higgins, D. G. and Thompson, J. D. Multiple sequence
alignment with Clustal series of programs. Nucleic Acids
Research; 2003; 31(13): 3497-3500.
17. Carvalho, P. O., Oliveira J. G. and Pastore, G. M.
Enhancement of gamma-linolenic acid production by the
fungus Mucor sp LB-54 by growth temperature. Revista de
Microbiologia; 1999; 30: 170-175.

Identification and Characterisation of an Oleaginous Fungus Producing High g-Linoleneic Acid
8 of 9
18. Somashekar, D., Venkateshwaran, G., Sambaiah, K. and
Lokesh, B. R. Effect of culture conditions on lipid and
gamma-linolenic acid production by mucoraceous fungi.
Process Biochemistry; 2002; 38(12): 1719-1724.
19. Kavadia, A., Komaitis, M., Chavelot, I., Blanchard, F.,
Marc, I. and Aggelis, G. Lipid and -linolenic acid
accumulation in strains of Zygomycetes growing on glucose.
Journal of the American Oil Chemists' Society; 2001; 78(4):
341-346.
20. Khunyoshyeng, S., Cheevadhanarak, S., Rachdawong, S.
and Tanticharoen, M. Differential expression of desaturases
and changes in fatty acid composition during sporangiospore
germination and development in Mucor rouxii. Fungal
Genetics and Biology; 2002; 37(1): 13-21.
21. de Llanos, R., Fernandez-Espinar, M. T. and Querol, A.
Identification of species of the genus Candida by analysis of
the 5.8S rRNA gene and the two ribosomal internal
transcribed spacers. Antonie Van Leewenhoek; 2004; 85:
175-185.
22. Zhang, C. L., Druzhinina, I. S., Kubicek, C. P. and Xu,
T. Trichoderma biodiversity in China: evidence for a north
to south distribution of species in East Asia. FEMS
Microbiology Letters; 2005; 251(2): 251-257.
23. Dyal, S. D., Bouzidi, L. and Narine, S. S. Maximizing
the production of -linolenic acid in Mortierella
rammanniana var. ramanniana as a function of pH,
temperature and carbon source, nitrogen source, metal ions
and oil supplementation. Food Research International; 2005;
38(7): 815-829.
24. Alexopoulus, C. J. and Mims, C. W. Introductory
Mycology. 3rd edition; John Wiley and Sons; New York;
1979.
25. Liu, X. Y., Huang, H. and Zheng, R. Y. Relationships
within Cunninghamella based on sequence analysis of ITS
rDNA. Mycotaxon; 2001; 80: 77-95.
26. Fakas, S., Papanikolaou, S., Galiotou-Panayotou, M.,
Komitis, M. and Aggelis, G. Lipids of Cunninghamella
echinulata with emphasis to -linolenic acid distribution
among lipid classes. Appl. Microbiology and Biotechnology;
2006; 73(3): 676-683.

Identification and Characterisation of an Oleaginous Fungus Producing High g-Linoleneic Acid
9 of 9
Author Information
Abdul Munir Abdul Murad
School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia
Noor Adila Abdul Karim
School of Biosciences and Biotechnology, Faculty of Science and Technology, University Kebangsaan Malaysia
Noor Haza Fazlin Hashim
School of Biosciences and Biotechnology, Faculty of Science and Technology, University Kebangsaan Malaysia
Adura Mohd Adnan
School of Biosciences and Biotechnology, Faculty of Science and Technology, University Kebangsaan Malaysia
Zamri Zainal
School of Biosciences and Biotechnology, Faculty of Science and Technology, University Kebangsaan Malaysia
Aidil Abdul Hamid
School of Biosciences and Biotechnology, Faculty of Science and Technology, University Kebangsaan Malaysia
Farah Diba Abu Bakar
School of Biosciences and Biotechnology, Faculty of Science and Technology, University Kebangsaan Malaysia