Analysis of p and q arms of chromosomes and its effects on the causes of Scoliosis disorders

Abstract

The spine is very delicate structure of the human body. The spinal cord is located inside the spine.
Vertebrae are small bone forming the spinal column. Human spine has natural “S” curve. These
curves round our shoulders and make our lower back curve slightly inward. Spine has three slight
curves one in the neck, one in the upper back, and another in the lower back. These curves are
normal and can be seen from a side view. From a back view, spine should appear straight. If a spine
have side to side curve the curve is called scoliosis. The curve may be very small (mild). It may be
bigger (moderate). Or it may be sharp (sever). Scoliosis is present in 0.2 – 6% of the population,
affecting females in most cases. Scoliosis affects Young girls engaged in rhythmic gymnastics,
swimmers, professional musicians and dancers. The gathering of all the genetic data on spinal cord
disorders, then a comparative analysis was performed on the various types of genes and their
biological factors which are the likely to cause scoliosis in either mutant or deficiency forms. The qarm
contributes to scoliosis disorder than the p-arm. Scoliosis is prevalence among most active
group between 18-70 years.

Full text

ANALYSIS OF P AND Q ARMS OF CHROMOSOMES AND ITS EFFECTS ON THE
CAUSES
OF SCOLIOSIS DISORDERS
THE OFFICIAL PUBLICATION OF
INTERNATIONAL JOURNAL OF RECENT SCIENTIFIC RESEARCH (IJRSR)
http://www.recentscientific.
International Journal Of
Recent
Danquah Amoah E.D an
ANALYSIS OF P AND Q ARMS OF CHROMOSOMES AND ITS EFFECTS ON THE
OF SCOLIOSIS DISORDERS
THE OFFICIAL PUBLICATION OF
INTERNATIONAL JOURNAL OF RECENT SCIENTIFIC RESEARCH (IJRSR)
http://www.recentscientific.
com/ recentscientific@gmail.com
International Journal Of
Recent
Scientific
Research
ISSN: 0976-3031
Volume: 7(6) June -2016
Danquah Amoah E.D an
d Amit Alexander Charan
ANALYSIS OF P AND Q ARMS OF CHROMOSOMES AND ITS EFFECTS ON THE
INTERNATIONAL JOURNAL OF RECENT SCIENTIFIC RESEARCH (IJRSR)

*Corresponding author: Danquah Amoah E.D
Department of Molecular and Cellular Engineering.(Jacob School of Biotechnology and Bioengineering). Sam Higginbottom Institute of Agriculture
Technology & Sciences, (Shiats) Nani, Allahabad (UP).India
ISSN: 0976-3031
Research Article
ANALYSIS OF P AND Q ARMS OF CHROMOSOMES AND ITS EFFECTS ON THE CAUSES
OF SCOLIOSIS DISORDERS
Danquah Amoah E.D and Amit Alexander Charan
Department of Molecular and Cellular Engineering.(Jacob School of Biotechnology and Bioengineering).
Sam Higginbottom Institute of Agriculture Technology & Sciences,
(Shiats) Nani, Allahabad (UP).India
ARTICLE INFO ABSTRACT
The spine is very delicate structure of the human body. The spinal cord is located inside the spine.
Vertebrae are small bone forming the spinal column. Human spine has natural “S” curve. These
curves round our shoulders and make our lower back curve slightly inward. Spine has three slight
curves one in the neck, one in the upper back, and another in the lower back. These curves are
normal and can be seen from a side view. From a back view, spine should appear straight. If a spine
have side to side curve the curve is called scoliosis. The curve may be very small (mild). It may be
bigger (moderate). Or it may be sharp (sever). Scoliosis is present in 0.2 – 6% of the population,
affecting females in most cases. Scoliosis affects Young girls engaged in rhythmic gymnastics,
swimmers, professional musicians and dancers. The gathering of all the genetic data on spinal cord
disorders, then a comparative analysis was performed on the various types of genes and their
biological factors which are the likely to cause scoliosis in either mutant or deficiency forms. The q-
arm contributes to scoliosis disorder than the p-arm. Scoliosis is prevalence among most active
group between 18-70 years.
INTRODUCTION
The spine is a column of small bones, or vertebrae, that support
the entire upper body. The column is grouped into three
sections of vertebrae: The cervical (C) vertebrae are the five
spinal bones that support the neck. The thoracic (T) vertebrae
are the twelve spinal bones that connect to the rib cage. The
lumbar (L) vertebrae are the five lowest and largest bones of
the spinal column. Most of the body’s weight and stress falls on
the lumbar vertebrae. Below the lumbar region is the sacrum, a
shield-shaped bony structure that connects with the pelvis at
the sacroiliac joints. At the end of the sacrum are two to four
tiny, partially fused vertebrae known as the coccyx or “tail
bone. Spine has three slight curves one in the neck, one in the
upper back, and another in the lower back. These curves are
normal and can be seen from a side view. From a back view,
your spine should appear straight. If a spine have side to side
curve the curve is called scoliosis. The curve may be very small
(mild). It may be bigger (moderate). Or it may be sharp (sever).
Spine has three slight curves one in the neck, one in the upper
back, and another in the lower back. These curves are normal
and can be seen from a side view. From a back view, your
spine should appear straight. The vertebras of the lower back
are connected by ligaments which attach bone to bone, and
tendons that connect muscle to bone. The main lower back
muscles maintain the arch in the spine known as the lordotic
curve, while the upper back maintain a reverse curve known as
kyphosis. These curves can be changed by injuries and
weakening of these muscles. When the lower back and upper
back lose its normal curves, injury and back bone pain become
an increasing risk. Ligaments and muscles of the back may be
injured through a traumatic tearing of the fibers known as a
sprain (ligament tearing) and strain (muscle tearing). The spine
is very delicate structure of the human body. The spinal cord is
located inside the spine. Vertebrae are small bone forming the
spinal column. Human spine has natural “S” curve. These
curves round our shoulders and make our lower back curve
slightly inward. In poor posture, the spine will be bent on sides.
Kyphosis is a curve seen from the side in which the spine is
bent forward. Lordosis is a curve seen from the side in which
the spine is bent backward. People with scoliosis develop
additional curves to either side, or the bones of the spine twist
on each other like a corkscrew. These curves can't be corrected
simply by trying to stand up straight. Scoliosis is a disorder that
Available Online at http://www.recentscientific.com
International Journal of
Recent Scientific
Research
International Journal of Recent Scientific Research
Vol. 7, Issue, 6, pp. 11860-11868, June, 2016
Copyright © Danquah Amoah E.D and Amit Alexander Charan., 2016, this is an open-access article distributed under the
terms of the Creative Commons Attribution License, which permits unrestricted use, distribution and reproduction in any
medium, provided the original work is properly cited.
Article History:
Received 06th March, 2015
Received in revised form 14th April, 2016
Accepted 23rd May, 2016
Published online 28
th
June, 2016
Key Words:
Gene, Adolescent, Idiopathic, Scoliosis,
Chromosomes Polymorphism,
p and q arms.

Danquah Amoah E.D and Amit Alexander Charan., Analysis of P and Q arms of Chromosomes and its Effects on the Causes
of Scoliosis Disorders
11861 | P a g e
causes an abnormal curve of the spine, or backbone. The spine
has normal curves when looking from the side, but it should
appear straight when looking from the front. Scoliosis is about
two times more common in girls than boys. It can be seen at
any age, but it is most common in those over 10 years old.
However, there is no correlation between the severities of the
curves between the age groups. In most cases, the cause of
scoliosis is unknown (idiopathic). This type of scoliosis is
described based on the age when scoliosis develops. If the
person is less than 3 years old, it is called infantile idiopathic
scoliosis. Scoliosis that develops between 3 and 10 years of age
is called juvenile idiopathic scoliosis, and people that are over
10 years old have adolescent idiopathic scoliosis (Gummerson
et al, 2011). Scoliosis is present in 0.2 – 6% of the population,
affecting females in most cases (Wilson, 2013).
Young girls engaged in rhythmic gymnastics (Micheli 1983;
Cirillo, and Jackson, 1985; Sward et al., 1990) had a 10-fold
increased risk for scoliosis. Scoliosis if not detected and
checked earlier can affect the performance of swimmers
(Becker, 1986), athletes (Green et al., 2008; Stosic et al.,
2011), professional musicians and dancers (Bird and Pinto,
2013; Steinberg et al., 2013).
Gene Abnormalities for Adolescent Idiopathic Scoliosis (AIS)
Many abnormalities associated with this condition have been
described, and the debate on whether Idiopathic Scoliosis (IS)
is a primary or secondary disorder is still open. These
abnormalities include disorders of the central and the peripheral
nervous system maturation (such as the vestibular system
affecting proprioception), of the connective tissues (such as
elastic and collagen fibers found in ligaments), muscles and
bones. Other related diseases include platelet disorders and
several molecular biology anomalies (such as melatonin,
calmodulin, and growth hormones levels). For many of these
disorders, specific gene abnormalities were described.
Adolescent idiopathic scoliosis (AIS) is considered an inherited
complex disease of childhood. Genetic twin studies and
observation of familial aggregation revealed significant genetic
contribution to IS. Familial forms of IS (FIS) were described as
early as 1922. There are now many well-recognized skeletal
deformities in man which are inherited according to Mendelian
law, and a large proportion of these are inherited as Mendelian
dominants-that is, each affected person has an affected parent
and an affected grandparent, and on the average half the
children of an affected parent are themselves affected; among
the commoner skeletal defects inherited in this way is
brachydactyly. One of the commonest deformities seen in
hospital practice is scoliosis, the causes of which are numerous
and often clearly understood, but there seems to be
considerable doubt as to the importance played by heredity in
the production of this condition (Hugh, 1934). Since then,
reports of multiple twin series have shown higher concordance
in monozygotic compared to dizygotic twins. Autosomal
dominant inheritance of infantile IS has been suggested from
evaluation of single families or small family collections. A
genetic survey study reported an overall risk of IS to first-
degree relatives of 11% compared to 2.4 and 1.4% in more
frequently encountered in females than in males. Cowell et al.
(1970) reported that the second- and third-degree relatives,
respectively, suggesting inheritance is multi factorial. IS is
possibility that Idiopathic Scoliosis may be determined on
genetic basis has not been considered in the past by orthopedic
surgeons in the past. The evaluations and testing more than
1400 patients with Idiopathic Scoliosis lead the author and his
team to believe that Idiopathic Scoliosis is an inherited
condition. Kimberly (1997) compared and contrasted the
concordance, severity, and curve patterns in monozygotic and
dizygotic, twins with adolescent idiopathic scoliosis in an
attempt to document a genetic etiology and delineate
inheritance patterns for adolescent idiopathic scoliosis.
He discovered that Monozygous twins have a significant higher
rate of concordance than dizygous twins and the curves in
monozygous twins, develop and progress together. Based on
these data, there is strong evidence for a genetic etiology for
adolescent idiopathic scoliosis. Justice et al. (2006) studied
1,198 patients from 202 families who had at least two
individuals with IS. Their results indicated that 15% of these
families presented a locus on the X chromosome that could be
linked to familial idiopathic scoliosis, suggesting an X-linked
dominant mode of inheritance in some patients. Montanaro et
al. 2006 showed evidence of a linkage between idiopathic
scoliosis and three microsatellite polymorphisms in the MATN1
gene (encoding for Matrilin 1, cartilage matrix protein),
respectively consisting of 103, 101 and 99 base pairs.
Autosomal dominant inheritance has been suggested from
evaluation of single families or small family collections. X-
linked dominant inheritance has been a prevailing theory to
explain apparent lack of male-male transmission. However this
was disputed after re-evaluation of X-ray data from original
study subjects. Wise et al. (2007) reported that at least one
gene, CHD7, has been associated with the idiopathic form of
scoliosis. Studies conducted by Various studies have found that
IS disease risk falls off quickly comparing first-degree relatives
of a pro-band to subsequent generations (Xiaochong et al.,
2008). These observations may be most consistent with a multi-
factorial inheritance model involving many genes, interplaying
with unknown environmental factors. The general consensus
gathered from all of this is that, while families with dominant
inheritance may exist, IS is generally a “complex” genetic
disease that is not easily explained by existing inheritance
models. Other molecular studies found that isolated critical
regions on autosomal chromosomes also had potential
importance in the occurrence of scoliosis. Candidate regions on
chromosomes 6, 9, 16, and 17 were considered to have the
strongest evidence for linkage a cross all subsets of scoliosis-
families studied (Romaine et al., 2013).
The Role of Heritable Genes in the Occurrence and
Development of AIS
Heritable and genetic factors have been found to play a vital
role in the occurrence and development of AIS. Several loci
associated with predisposition to AIS have been identified in
genome-wide linkage studies in such regions as 6p, 10q, 18q,
19p13.3, 17p11, 19p13, 8q12, 9q31.2-q34.2, 17q25.3-qtel, 12p,
and Xq (Wenjie, 2013). Single nucleotide polymorphisms
(SNPs) in the genes for estrogen receptor a (ESR1), estrogen
receptor b (ESR2), matrilin 1 (MATN1), melatonin receptor
1B(MTNR1B), tryptophan hydroxylase 1(TPH1), interleukin-6
(IL-6) and matrixmetalloproteinase-3 (MMP-3) have been
reported to be associated with AIS predisposition. However, so

International Journal of Recent Scientific Research Vol. 7, Issue, 6, pp. 11860-11868, June, 2016
11862 | P a g e
far these studies have not been replicated in other ethnic
groups. Polymorphisms of ESR1, ESR2, MATN1, insulin-like
growth factor-I (IGF-I), tissue inhibitor of metalloproteinase-2
(TIMP-2), G protein-coupled estrogen receptor 1 (GPER), and
neurotrophin3 (NTF3) have been reported to be associated with
the severity of curvature in AIS. These might be the modifier
genes for AIS, but at present there is a lack of conclusive
functional studies. Genetic association studies are the means of
identifying risk variants in complex traits, and replication
studies that confirm their findings in other ethnic groups are
quite necessary. A genome-wide association study (GWAS)
was performed in a Japanese population, and three SNPs
(rs11190870, rs625039 and rs11598564), all of which were
located near the gene LBX1 on chromosome 10q24.31 (Wenjie
et.al, 2013).
Degree of the Curvature for Scoliosis Detection
In general, the severity of the scoliosis depends on the degree
of the curvature and whether it threatens vital organs,
specifically the lungs and heart.
Effect of Mild Scoliosis (less than 20 degrees): Mild scoliosis
is not serious and requires no treatment other than monitoring.
Effect of Moderate Scoliosis (between 25 and 70 degrees). It
is still not clear whether moderate scoliosis causes significant
health problems. In one study (Kesten et al., 1991), adults with
moderate scoliosis had normal lung function, although they had
difficulty exercising. (The researchers believed that this low
exercise tolerance might have been because many patients with
scoliosis do not engage in regular physical activity).
Effect of Severe Scoliosis (Over 70 degrees): If the curvature
exceeds 70 degrees, the severe twisting of the spine that occurs
in structural scoliosis can cause the ribs to press against the
lungs, restrict breathing and reduce oxygen levels. One study
(Asher and Burton, 2006), concluded that almost two-thirds of
patients with curves of 90 degrees and under had less than 80%
of normal lung capacity. The distortions can also affect the
heart and cause dangerous 7
Effect of Very Severe Scoliosis (Over 100 degrees):
Eventually, if the curve reaches over 100 degrees, both the
lungs and heart can be injured. Patients with this degree of
severity are susceptible to lung infections and pneumonia.
Curves greater than 100 degrees increase mortality rate, but this
problem is very uncommon (Asher and Burton, 2006).
Calculation of the Curve of Spine: The degree of the spinal
curve is nearly always calculated using a technique known as
the Cobb Method.
On an X-ray of the spine, the examiner draws two lines. One
line extends out and up from the edge of the top vertebrae of
the curve. The second line extends out and down from the
bottom vertebrae. A perpendicular line is then drawn between
the two lines. The intersecting angle is measured to determine
the degree of curvature.
The Cobb method is limited because it cannot fully determine
the three-dimensional aspect of the spine. It is not as effective,
then, in defining spinal rotation or kyphosis. It also tends to
over-estimate the curve. Other diagnostic tools are needed to
make a more accurate diagnosis.
An improved technique using calculations based on geometric
principles of the apex of the curve as well as the top and
bottom of the curve may prove to be accurate in determining all
the dimensions of the curve (Suken et al., 2009).
Chromosome region for adolescent idiopathic scoliosis (AIS
and IS)
Salehi et al. (2002) found regions linking adolescent idiopathic
scoliosis to chromosome17, through the investigation three
generations of a family of Italian origin with 11 members
affected, who presented curves between 10 and 20 degrees and
autosomal dominant inheritance pattern with complete
penetrance. This study located chromosome 17p11 linked to
idiopathic scoliosis. Ocaka et al. (2007) found chromosomal
regions in chromosomes 9q34 and 17q25. Montanaro et al.
(2006) conducted a study aimed at investigating the loci
responsible for susceptibility to idiopathic scoliosis in a
genome-wide linkage survey identified, and a limited number
of genetic loci predisposing to idiopathic scoliosis (IS)
evidence of allele-sharing in one family was detected for three
loci on chromosome 6p, 10q, and 18q. Another study found a
linkage with IS at locus 17p11 in a three generation IS Italian
family 9 and another linkage with IS was found at locus
19p13.3 in a Chinese family. The results obtained from the
analysis of transmissions of the allelic variants of the
microsatellite marker internal to matrilin-1(MATN1) gene, in a
population of trios composed of children affected by IS and
their parents, show the presence of a linkage between the allele
and IS. It is actually more correct to talk about susceptibility to
scoliosis because the genetic expression of IS may be
dependent on multiple factors and genetic interactions.
MATN1 gene is mainly expressed in cartilage. Its proteic
product, also known with the alternative name of cartilage
matrix protein, is an extracellular matrix structural constituent,
which is associated with cartilage proteoglycans as well as
being a component of both collagen-dependent and collagen-
independent fibrils. Gao et al. (2007), soughted to refine the
search for IS susceptibility loci and to identify contributing
genes, by following up results of genomewide scans in a new
set of multiplex families with IS. All participated research
subjects were ascertained under a protocol approved by the
University of Texas Southwestern Medical Center Institutional
Review Board. The SNTG1 gene disrupted in the 8q inversion
breakpoint was detected, other genes like, chromodomain
helicase DNA-binding protein 7 gene (CHD7) was also
indentified. The reduction of functional CHD7 in the postnatal
period, particularly during the adolescent growth spurt, may
disrupt normal growth patterns and predispose an individual to
spinal deformity. The strongest results was obtained for 8q12
loci . This revealed positive evidence of linkage between IS
and chromosome 8q loci in the more proximal region that had
provided modest evidence of linkage. The chromosome 8 has
been most progress, where CHD7and SNTG1have been
proposed as candidate genes. Previous work has also suggested
the possibility these genes contribute to AIS. The chromosome
region 12 susceptibility loci is gene rich, and have 95 known
genes and a similar number of uncharacterized known or
potential transcripts. Some of the genes are susceptible for
AIS. These include genes encoding ion channels
(KCNA1,KCNA5 KCNA6, SCNN1A), bone-derived growth
factors (GDF3), growth factors regulating muscle (FGF6), and

Danquah Amoah E.D and Amit Alexander Charan., Analysis of P and Q arms of Chromosomes and its Effects on the Causes
of Scoliosis Disorders
11863 | P a g e
neurons (NTF3),enzymes involved in protein processing
(USP5, SPSB2), and components of the extracellular matrix
(MFAP5) (Raggio et al., 2009). Several research studies of
AIS says the most progressive chromosome region has been
made on chromosome 8, with CHD7 and SNTG1 as genes.
Previous work has also suggested the possibility that genes’
contributing to AIS when mutated is responsible for known
genetic syndromes (Cathleen et al., 2009). Another study
conducted by Clough et al. (2010), confirmed, the relationship
between the region described by Salehi et al. (2002), and
familial idiopathic scoliosis, when studying 17 families.
Genetic factors are thought to contribute to the development of
scoliosis, as demonstrated by an increased incidence (6–11%)
in first-degree relatives. Previous analyses of several moderate-
sized Caucasian families gave some evidence for linkage to
three loci on chromosomes 6p, distal 10q, and 18q. An
additional locus on chromosome 17p was identified in a large
Italian family. However, linkage of scoliosis to these loci has
not been replicated. Evidence for linkage to chromosome 19p
was demonstrated in one large Chinese family with AIS and
confirmed in a separate Caucasian family, but no causative
gene mutations have been found. More recently, linkage and
association of AIS was demonstrated to single nucleotide
polymorphisms on chromosome 8q within CHD7, the gene
responsible for CHARGE syndrome, making it the first
recognized AIS susceptibility gene (Gurnette et al., 2010). In
2011, Takahashi et al. performed an important multi-center
study. About 1050 Japanese women with AIS and 1,474
control women without AIS were evaluated using of curves
greater than or equal to 15 degrees as the criterion for affected
patients, by Using a genome-wide association study (GWAS),
it was successfully correlated that the chromosome region
10q24.3 is within the region 10q which contains LBX1 gene
was associated with AIS. Other family studies over the years
have suggested that AIS is related to chromosomes 6, 9, 16 and
17, and to the chromosomal regions 17p11, 19p13.3, 8q12 ,
9q31-q34.2, 17q25.3, and 12, 18q12.1-12.2 (Wajchenberg et
al., 2015). X-linked inheritance of adolescent idiopathic
scoliosis (AIS) or Idiopathic scoliosis (IS)
Male-to-male transmission is apparently rare and was
specifically absent in 17 families studied by Cowell et al.
(1972), who suggested X-linked dominant inheritance. The 8 to
1 ratio of females to males supports this conclusion that there is
X chromosomal linkage. Report written by the national
Institutes of Health, Maryland, USA, says that a region on the
X chromosome may be linked to the expression of familial
idiopathic scoliosis in families. If the scoliosis genes are
located on the X chromosome the means that it will give rise to
various disorders. Severe scoliosis is more common in females
than males, at a ratio of 4:1.Males only have one X
chromosome, whereas females have two (Justice et al., 2003).
Ward et al. (2009) studied 69 extended Utah families with a
history of adolescent idiopathic scoliosis, including a total of
247 affected individuals with disease confirmed by x-rays and
medical records. He concluded that the condition is polygenic
and multifactorial. Excluding all probands and assuming
autosomal dominant inheritance, 1,260 individuals over the age
of 16 years were determined to be at risk because they had a
parent with AIS. This controversy regarding the inheritance
pattern of IS served as the rationale to investigate X-linkage as
a potential inheritance pattern in familial idiopathic scoliosis
(FIS). Through the use of a large sample of families affected
with idiopathic scoliosis. Genomic screening and statistical
linkage analysis was done. It was previously reported that
Xq26 as a susceptibility locus for FIS within a subgroup of FIS
families. The current studies support that within a subset of
families affected by familial idiopathic scoliosis a genetic
determinant on the X-chromosome predisposes individuals to
this disorder (Miller et al., 2010).
Giampietro (2012) performed study to determine the genetic
factors that may predict curve progression in IS females.304
females with IS demonstrated significantly greater Cobb angle
at the time of growth maturation among patients with estrogen
receptor genotype XX and Xx compared to patients with
genotype xx . A higher level of risk for operative treatment
was observed among patients with genotype XX and Xx,
compared to patients with genotype xx.
Polymorphism gene in adolescent idiopathic scoliosis
Ocaka et al. (2008) conducted a study aimed at relating
angiotensin converting enzyme (ACE), and Alpha-actinin-3
(ACTN3) polymorphisms to AIS. This show that the insert
(I)allele is more frequent in endurance athletes, while the delete
(D )allele appears more often in strength and muscular
explosion athletes. The variability of this polymorphism can
affect the performance of certain muscle groups that act as a
means of support for the spinal column. The paraspinal
musculature plays a trunk support and movement role, and any
significant changes affect patients with AIS, who have trunk
deformity in the three planes and significant rotation.
Wajchenberg et al. (2013) reported on genetic polymorphisms
studies carried out on patients with AIS in an attempt to
correlate alterations in certain proteins that might be related to
the disease. The polymorphisms were related to the genes
MATN1 in region 1p35 and CHD7 in region 8q12.1. The
human genetic map contains at least 170 variant sequences of
genes, which are related to the phenotypes of physical
performance and of fitness related to health. These genes
include the angiotensin-converting enzyme (ACE) gene, which
is located on chromosome 17q23, composed of 26 exons and
25 introns. A common genetic variant in the ACE gene was
described as absence or deletion (D allele) and presence or
insertion (I allele) of 287 base pairs in intron 16. The genetic
studies associated this polymorphism with health, sports, and
also the genesis and maintenance of various diseases.The
genotyping of the I/D polymorphism of the ACE gene was
conducted using two specific primers (Primer,ACES
5'CTGGAGACCACTCCCATCCTTTCT3')
(Primer,ACEAS5'GATGTGGCCATCACATTCGTCAGAT-
3') this shows the sequence where polymorphism occurs in the
gene. Wise et al. (2000) using a genome-wide association
study (GWAS), successfully correlated the chromosome region
10q24.31 with the disease by locating the single nucleotide
polymorphism (SNP). This region is within the region 10q, and
contains the Drosophila lady bird genes (LBX1) gene. This
gene was expressed in the dorsal region of the spinal cord and
skeletal muscle, and also operates in somatosensory neurons.
LBX1 was related to the etiology of the disease due to
somatosensitive dysfunction. The DNA region also contains
regulators of gene expression, which could influence the

International Journal of Recent Scientific Research Vol. 7, Issue, 6, pp. 11860-11868, June, 2016
11864 | P a g e
manifestation of the disease depending on the polymorphism
(TT, TC and CC) that is present. LBX1, and detected high
levels of expression in the skeletal muscle, and spinal cords of
adult, and fetal humans. (Wajchenberg et al., 2015) Ward et
al, (2010) reported that 53 SNPs were closely associated with
AIS severity. The markers used for these SNPs are rs2449539,
rs1437480, rs448013, rs10493083, rs16945692. Based on this
study, a diagnostic kit was developed that predict the
progression of Cobb's angle and was sold commercially.
Sharma et al, (2011) genotyped the SNPs chromosome,
3p26.3, and. discovered other significant associations in their
genome-wide association study (GWAS) for SNPs (rs2222973)
in the Down syndrome cell adhesion molecule (DSCAM) gene.
Common SNPs in the genes of matrilin 1 (MATN1) and
insulin-like growth factor 1 (IGF1) are said to be associated
with AIS in Chinese (Moon et al., 2013).
METHOD
This research work seek to gather all the genetic data on spinal
cord disorders, then a comparative analysis was performed on
the various types of genes and their biological factors which are
the likely to cause scoliosis in either mutant or deficiency
forms. Comparative analysis was done on the various genes
and the biological factors that are susceptible to the causes of
scoliosis.
RESULTS
Table 1 Showing Chromosomal Regional locations and
their Gene types for Adolescent Idiopathic scoliosis
disorders.
Chromosome Regional Locations
for adolescent idiopathic scoliosis
(AIS &IS)
Gene Type Reference
1p3.5 MATN1 Montanaro et al,
2006
8q12.1-q12.2 CHD7
Arbanas. C., 2007;
Zentner et al, 2010;
Swarkar et at,
2010.
Xq GATA Carol et al, 2008,
6p,6q,8q,9q,10q,16q,17p,18q,19p SNTG1 Carol et al, 2008,
18q12.1-12.2 DTNA,
B4GALT6,GALNT1,
Christiana et al,
2009.
3p
26.3
CHL1, ROBO3
Swarkar et al, 2010
10q24-31 LBX1 Tkahashi et
al,2011
6p, 10q, 18q, 19p13.3, 17p11, 19p
13,
8q12, 9q31.2, q34.2, 17q25.3, 12p.
ESR1, ESR2,
MATN1, MATNR1B
Gao et al, 2013
X
q
MANT1 Gao et al, 2013
12p,17q25.3,18q12.1-12.2 Wajchenberg et
al,2015
Table 2 shows the Full names of the various types genes
associated with Adolescent Idiopathic scoliosis disorders.
Genes Type Full name
MANT1 Matrilin 1, cartilage matrix protein
CHD
7
chromodomain helicase DNA binding protein 7
GATA globin transcription factor
SNTG1 Gamma-1-syntrophin
DTNA Dystrobrevin alpha
B4GALT6 Beta-1, 4-galactosyltransferase 6.
GALNT1 Polypeptide N-acetylgalactosaminyl transferase 1
CHL1 cell adhesion molecule L1
ROBO3 roundabout, axon guidance receptor, homolog 3
(Drosophila)
LBX1 Ladybird Estrogen Receptor 1Homeobox 1
ESR1 EStrogen Receptor 1
ESR2 EStrogen Receptor 2
MATNR1B melatonin receptor 1B
Table 3 showing the number of occurrences of
Chromosome types in the scoliosis disorder considering
table 4.1above.
Chromosome
number
Number of
Occurrences
1 1
3 1
6 2
8 3
9 2
10 3
12 2
16 1
17 3
18 4
19 3
X 2
Table 4 comparing the p-arm (short) and the q-arm
(long) of the chromosomes to determine which arm is
more susceptible to scoliosis disorders. Considering the
date from table 1
Chromosome
number
p-arm number of
occurrence
q-arm number of
occurrence
1 1 -
3 1 -
6 2 1
8 - 3
9 - 2
10 - 3
12 2 -
16 - 1
17 2 2
18 - 4
19 3 -
X - 2
Total 11 18
Figure 1 showing the number of occurrence of chromosome number
Figure 2 showing the number of occurrence of the p-arm in the scoliosis
disorder chromosomes.

Danquah Amoah E.D and Amit Alexander Charan., Analysis of P and Q arms of Chromosomes and its Effects on the Causes
of Scoliosis Disorders
11865 | P a g e
DISCUSSION
A scoliosis disorder occurs due to several factors and mostly it
is by a Gene Abnormalities. Such abnormalities arises because
of changes in the molecular biological systems of humans,
These causes the degree of changes in the various internal
structure components such as melatonin, calmodulin, and
growth hormones levels to change. Table 2 shows the various
abnormal genes that contribute to the Adolescent Idiopathic
scoliosis disorders. Table 1 shows the sample data of the
various research conducted by various researchers to determine
which types of chromosomes in the human is susceptible to
adolescent idiopathic scoliosis disorders. Montanaro et al,
(2006) detected 1p3.5 chromosomes to be the chromosomal
region for the occurrence of Adolescent Idiopathic scoliosis
disorders. 8q12.1-q12.2 chromosomal regions was identified by
(Arbanas. C., 2007; Zentner et al, 2010; Swarkar et at,
2010).Regions on chromosomes 6, 9, 16, and 17 were
considered to have the strongest evidence for linkage a cross all
subsets of scoliosis-families studied (Romaine et al., 2013).
Salehi et al. (2002) found regions linking adolescent idiopathic
scoliosis to chromosome17. Carol et al, (2008) also discovered
chromosomal region 6p, 6q, 8q, 9q, 10q, 16q, 17p, 18q, 19p to
Figure 3 showing the number of occurrence of the q-arm in the scoliosis
disorder chromosomes.
Figure 4 showing the number of occurrence of X-chromosomes number
1 represents X chromosome on the x axis
Figure 5 showing the number of occurrence of the p-arm in the scoliosis
disorder of the X-chromosomes.
1 represent X chromosome x axis
Figure 6 showing the number of occurrence of the q-arm in the scoliosis
disorder of the X-chromosomes
Figure 7 Pie Chart showing the total percentage occurrences of p and q
arms of the chromosomes of the scoliosis disorders.
Figure 8 Total occurrences of p and q arms chromosomes it the causes of
scoliosis disorders.
Total
occurrences
of p arm in
the
scoliosis
disorders
38%
Total
occurrences
of q arm in
the
scoliosis
Disorders
62%
Total percentage occurences of p and q
arm scoliosis disorders
Total
occurrences
of p arm in
the scoliosis
disorders, 11
Total
occurrences
of q arm in
the scoliosis
Disorders, 18
0
2
4
6
8
10
12
14
16
18
20
Total occurrences of p arm in the
scoliosis disorders
Total occurrences of q arm in the
scoliosis Disorders
Total occurrences of p and q arm in the scoliosis
disorders

International Journal of Recent Scientific Research Vol. 7, Issue, 6, pp. 11860-11868, June, 2016
11866 | P a g e
be susceptible to Adolescent Idiopathic scoliosis disorders.
Christiana et al, (2009), fine out that chromosomal region
number 18q12.1-12.2 is also a region for susceptible to adolescent
idiopathic scoliosis disorders .Furthermore Swarkar et al,
(2010) identified that chromosomal region 3p26. 3 to be
susceptible. 10q24-31 chromosomal location was discovered
by Tkahashi et al, (2011). Gao et al, (2013), discovered a
large number of chromosomal regional locations 6p, 10q, 18q,
19p13.3, 17p11, 19p13, 8q12, 9q31.2, q34.2, 17q25.3, 12p. which are
very much susceptible to susceptible to adolescent idiopathic
scoliosis disorders (AIS).12p, 17q25.3, and 18q12.1-12.2
chromosomal region location was identified by Wajchenberg
et al, (2015).
Heritable genes and genetic factors have been found to play a
vital role in the occurrence and development of AIS which
have been identified in genome-wide linkage studies conducted
by (Wenjie, 2013). A genome-wide association study (GWAS)
was performed in a Japanese population, and three SNPs
(rs11190870, rs625039 and rs11598564), all of which were
located near the gene LBX1 on chromosome 10q24.31 (Wenjie
et.al, 2013). Male-to-male transmission is apparently rare and
was specifically absent in 17 families studied by Cowell et al.
(1972), who suggested X-linked dominant inheritance as it
shown in the table 4.1above Carol et al,( 2008) also identified
Xq to be a heritable adolescent idiopathic scoliosis disorders.
Xq was also discovered by Gao et al, (2013) as a heritable
disorders from X-chromosomes.
Table 3 showing number of occurrences of a Chromosome
types in the scoliosis disorder considering table 4.1above.It can
be identified that chromosome number 18 was reported by four
times by different researchers to be associated with susceptible
to adolescent idiopathic scoliosis disorders. Chromosome
numbers 19, 17, 10, 8 was reported to occur three times each in
the table 1 chromosome numbers 12, 9, 6, and X occurred two
times each from the data collected by researchers.
Chromosomes numbers 16, 3, and 1 appeared one time each in
their susceptibility to adolescent idiopathic scoliosis disorders.
This shows that chromosome number 18 is more susceptible to
adolescent idiopathic scoliosis disorders as reported by (Carol
et al, 2008; Christiana et al, 2009; Gao et al, 2013, and
Wajchenberg et al, 2015). This Followed by Chromosome
numbers 19, 17, 10, and 8, then chromosome numbers 12, 9, 6,
and X. The least susceptible Chromosomes numbers are 16, 3,
and 1 which occurred once as reported by (Montanaro et al,
2006; Carol et al, 2008; Swarkar et al, 2010).
Comparing the p-arm (short) and the q-arm (long) of the
chromosomes to determine which arm is more susceptible to
scoliosis disorders from table 4 shows that the p-arm of the
chromosome number 19 has the highest occurrence of three
(3).This is also shown by the figure 2 and collaborated by the
figure 3 showing p-arm to be three. The chromosomes number
18 shows that it has highest occurrences in its q-arm than the p-
arm .Its q-arm occurred four (4) times and no occurrences
appeared at its p –arms. Chromosomes number 8 and 10 has
their q arms occurring three times with their p-arms occurring
not appearing to contribute to the disorder. The total number of
p-arm contributing to the scoliosis disorder by the chromosome
numbers 1,3,6,8,9,10,12,16,17,18,19,and X is 11 whiles the
total contribution of the q-arm by chromosome numbers
1,3,6,8,9,10,12,16,17,18,19,and X is 18 as it is represented in
figure 7 and figure 8 respectively. From this analysis it shows
clear that q –arms of the chromosomes in the humans are more
susceptible to adolescent idiopathic scoliosis disorders than p-
arms of the chromosomes. This is also can be confirmed from
table 1 which shows that chromosome number 18 which has
the highest occurrences of four (4) from the data collected to
show the scoliosis disorders among the other chromosomes
occurred at the q-arm as shown in figure 2 and 3, and nothing
occurred at the p-arm. The least chromosomes number
occurrence from table .1 are chromosomes 1, 3, and
16.Chromosomes number 1 and 3 occurred one time and it
appear on p-arm whiles chromosome number 16 which
occurred one time appeared on q-arm. This confirmed that p-
arm is least susceptible to adolescent idiopathic scoliosis
disorders in humans.
X-chromosomes inheritance is also determinate factor of
scoliosis from parents to children as show in the table 4.1 of the
collected data above .The number of X-chromosomes
occurrence is two (2).This occurred on the q arm as shown in
figure 6.The p arm chromosomes of x did not show any
occurrences of scoliosis disorder as described in figure
4.9..This further confirms p arms are susceptible to scoliosis
than p arm. If the scoliosis genes are located on the X
chromosome this means that it will give rise to various
disorders. Scoliosis is more common in females than males, at
a ratio of 4:1.Males only has one X chromosome, whereas
females have two (Justice et al., 2003). Polymorphisms which
was related to the genes MATN1 in region 1p35 and CHD7 in
region 8q12 also contributed to the scoliosis disorders in
humans. This was confirmed by Wise et al. (2000) using a
genome-wide association study (GWAS).
CONCLUSION
Though scoliosis can be term genetic disorder it is mostly
acquired through various activities by the human subjects. The
chromosomes number 18 shows that it has highest occurrences
than others chromosomes in the human subject’s .The q-arm
contribute to scoliosis disorder than the p-arm. Scoliosis is
prevalence among most active group between 18-70 years.
Specially athletes, motor bike riders and office workers who sit
down lots. Using very lighter, simple designed and fabricated
buzzer device scoliosis can be detected earlier (mild and
moderate levels) and controlled to prevent severe form of
scoliosis which will lead to surgery.
References
Asher, M.A. and Burton, D.C. (2006). Adolescent idiopathic
scoliosis: natural history and long term treatment
effects. Scoliosis 1: 2
Becker, T.J. (1986). Scoliosis in swimmers.Clinics in Sports
Medicine. 5(1):149-158.
Bird, A.B, and Pinto .S.O (2013). Scoliosis in musicians and
dancers; Clinical Rheumatology. 32(4):515-521.
Cathleen, R.L., Giampietro, P.F., Dobrin, S., Zhao, C.,
Dorshorst, D., Ghebranious, N., Weber, J.L., and Blank,
R.D. (2009). A Novel Locus for Adolescent Idiopathic
Scoliosis on Chromosome 12p .Journal Orthopaedic
Research . 27(10): 1366–1372.
Cirillo, J.V. and Jackson, D.W. (1985). Pars interarticularis
stress reaction, spondylolysis, and

Danquah Amoah E.D and Amit Alexander Charan., Analysis of P and Q arms of Chromosomes and its Effects on the Causes
of Scoliosis Disorders
11867 | P a g e
Clough, M., Justice, C.M., Marosy, B., and Miller, N.H.
(2010). Males with familial idiopathic scoliosis: a distinct
phenotypic subgroup.Spine.35 (2):162-8.
Cowell, H. R., Hall, J. N., and MacEwen, G.
D.(1970). Genetic aspects of idiopathic scoliosis. Clinical
Orthopedics and Related Research.86: 121-131,
Gao, X., Gordon, D., Zhang, D., Browne, R., Helms,
C., Wise., C. (2007). CHD7 Gene Polymorphisms Are
Associated with Susceptibility to Idiopathic Scoliosis.
American Journal of Human Genetics 80(5); 957-965.
Giampietro, P. F. (2012). Genetic aspects of congenital and
idiopathic scoliosis. Scientifica. 152365 (2012).
Green, D. W., Mik, G., Gholve, P. A., Scher, D. M., and
Widmann, R. F. (2008) Down syndrome orthopedic
issues.Current Opinion in Pediatrics 20(1): 30–36
Gummerson, N., Wade .R., Yang, H., McKenna, C., Faria,
R., and Woolac, N.(2011) A systematic review of the
clinical effectiveness of EOS 2D/3D X-ray imaging
system. European Spine Journal 2(2): 296-304.
Gurnette, C,A., Alaee, F., Bowcock, A., Kruse, L., Lenke,
L.G., Bridwell,K.H., Kuklo, T., Scott J. Luhmann, S.J.,
and Dobbs. M.B. (2009). Genetic Linkage Localizes an
Adolescent Idiopathic Scoliosis and Pectus Excavatum
Gene to the 18q Chromosome.The spine34(2);94-100.
Hugh, G (1934) Hereditary Scoliosis. The British Medical
Journal 66(1): 686.
Justice, C. M., Wilson, A. F., Miller, N. H., Alden, K J.,
Marosy, B., Nzegwu, N. (2006) Idiopathic Scoliosis:
Identification of Candidate Regions on Chromosome
19p13. Spine 31(16): 1815-1819
Justice, C.M., Miller, N.H., Marosy, B., Zhang ,J.,
and Wilson, A.F( 2003). Familial idiopathic scoliosis:
evidence of an X-linked susceptibility locus. The
Spine.28 (6):589-94.
Kesten, S., Garfinkel, S. K ., Wright, T. and Rebuck, A.S.
(1991). Impaired exercise capacity in adults with
moderate scoliosis. Chest 99 (3): 663-666.
Micheli, L .J., Hood, R.W, (1983) Anterior exposure of the
cervicothoracic spine using a combined cervical and
thoracic approach.J Bone Joint Surgrey 65(7):992-997.
Montanaro, L., Parisini, P., Greggi, T., Di Silvestre, M.,
Campoccia1, D., Rizzi1, S., and Arciola,
C.R.(2006).Evidence of a linkage between matrilin-1
gene (MATN1) and idiopathic scoliosis . Scoliosis and
spinal disorders .1 (21); 1-7.
Moon, E.S., Kim, H.S., Sharma., Park, J.O., Lee, H.M.,
Moon, S.H., and Chong, H.S.(2013). Analysis of Single
Nucleotide Polymorphism in Adolescent Idiopathic
Scoliosis in Korea: For Personalized Treatment. Yonsei
medical Journal. 54(2): 500–509.
Ocaka, L., Zhao, C., Reed, J. A., Ebenezer, N. D., Brice, G.,
Morley, T., and Child, A. H. (2007). Assignment of two
loci for autosomal dominant adolescent idiopathic
scoliosis (AIS) to chromosomes 9q31. 2-q34. 2 and
17q25. 3-qtel.Journal of medical genetics.
Ocaka, L., Zhao, C., and Reed , J.A., (2008).Assignment of
two loci for autosomal dominant adolescent idiopathic
scoliosis to chromosomes 9q31.2-q34.2 and 17q25.3-
qtel. Journal of Medical Genetics. 45:87-92
Raggio, C. L., Giampietro, P. F., Dobrin, S., Zhao, C.,
Dorshorst, D., Ghebranious, N., and Blank, R. D. (2009).
A novel locus for adolescent idiopathic scoliosis on
chromosome 12p. Journal of Orthopedic Research.27
(10); 1366-1372.
Romain, D., Thierry, H., Wilson, B. and Pierre, L.(2013).
Idiopathic scoliosis etiological concepts and hypotheses
.Current Oncept Review Springer 7:11–16.
Salehi, L., Mangino, M., De Serio, S., De Cicco, D., Capon,
F., Semprini, S., Pizzuti, A .,Novelli, G.,
and Dallapiccola, B.(2002). Assignment of a locus for
autosomal dominant idiopathic scoliosis (IS) to human
chromosome 17p11. Human Genetics111(4-5); 401-404
Scoliosis: A Study of Extended Families in Utah.
Sharma, S., Gao, X., Londono, D., Devroy, S.E., Mauldin,
K.N., and Frankel, J.T. (2011).Genome-wide association
studies of adolescent idiopathic scoliosis suggest
candidate susceptibility genes. Human Molecular
Genetics Journal. 20; 1456–1466
spondylolisthesis in gymnasts. Clinic Sports Medicine 4: 95–
110
Steinberg, N., Hershkovit, I., Peleg, S., Dar, G., Masharawi ,
Y., Zeev , A ., Siev-Ner, I. (2013). Morphological
characteristics of the young scoliotic dancer. Physical
Therapy in Sport 14(4): 213–220
Stosic , D., Milenkovic, S . and Zivkovic, D .(2011). The
Influence of Sport on the Devolopment of Postural
Disorders in Athletes. Physical Education and Sport 9
(4): 375 – 384.
Suken, A., George, H., Dormans, J., Emans, J.B., Skaggs, D.L
.(2009) Neurologic Risk in Growing Rod Spine Surgery in
Early Onset Scoliosis .Spine 34(18):1952-1955.
Sward, L.,Eriksson, .B., Peterson, L.( 1990 ).Anthropometric
Characteristics, Passive Hip Flexion, and Spinal Mobility
in Relation to Back Pain in Athletes. Spine 15(5)
Takahashi, Y., Kou, I., Takahashi, A., Johnson, T. A., Kono,
K., Kawakami, N., and Ikegawa, S. (2011). A genome-
wide association study identifies common variants near
LBX1 associated with adolescent idiopathic scoliosis.
Nature genetics.43(12) ;1237-1240.
Wajchenberg, M., Martins, D.E., and Lazar, M. (2015).What
is the best way to determine the cause of adolescent
idiopathic scoliosis. Annals of translational medicine.
3(4); 48.
Wajchenberg, M., Luciano, R., Araújo, C.R., Martins, D.E.,
Puertas, E.B., and Almeida, S.S. (2013).Polymorphism
of the ace gene and the α-actinin-3 gene in adolescent
idiopathic scoliosis. Acta Ortopédica Brasileira
Journal.21 (3); 170–174.
Ward K, Ogilvie, J.W., Singleton, M.V., Chattier, R., Engler.
G., and Nelson, L.M.( 2010). Validation of DNA-based
prognostic testing to predict spinal curve progression in
adolescent idiopathic scoliosis. Spine 35; 1455–1464.
Wenjie, G., Yan, P., Guoyan , L., Anjing, L., Wei, Y.,
Liangming, Z. S., Peiqiang, S. and Dongsheng , H.
(2013). Association between Common Variants near
LBX1 and Adolescent Idiopathic Scoliosis Replicated in
the Chinese Han Population 8(1) e53234.
Wilson, M., Honnons , S., Brendan, F. B., Xing , L., Yi
Zhang, Y. and Archibald S.(2013) Deletion of Mecom in

International Journal of Recent Scientific Research Vol. 7, Issue, 6, pp. 11860-11868, June, 2016
11868 | P a g e
mouse results in early-onset spinal deformity and
osteopenia. Bone 60; 148–161.
Wise, C., Herring, J., Bowcock, A., Lovett, M., Sheffiel, V.
and Morcuende, J.(2007) CHD7 Gene Polymorphisms
Are Associated with Susceptibility to Idiopathic
Scoliosis. The American Journal of Human Genetic
80(5): 957–965.
Wise, C.A.,, Barnes R., Gillum, J., Herring, J.A., and
Bowcock, A.M. (2000).Localization of susceptibility to
familial idiopathic scoliosis. Spine 25; 2372–2380.
Xiaochong, G., Shoemaker.S., Derek .G.D. , and Herring, J.
(2008). Understanding Genetic Factors in Idiopathic
Scoliosis, a Complex Disease of Childhood. Current
Genomics 9(1): 51–59
How to cite this article:
Danquah Amoah E.D and Amit Alexander Charan. 2016, Analysis of P and Q arms of Chromosome
s and its Effects on the
Causes of Scoliosis Disorders. Int J Recent Sci Res. 7(6), pp. 11860-11868.
*******