A comprehensive generic‐level phylogeny of the sunflower family: Implications for the systematics of Chinese Asteraceae

Abstract

The sunflower family (Asteraceae) is the largest and the most diverse flowering plant family, comprising 24 000–30 000 species and 1600–1700 genera. In China, Asteraceae are also the largest family, with approximately 2336 indigenous species in 248 genera. In the past two decades, molecular phylogenetic analyses has contributed greatly to our understanding of the systematics of Asteraceae. Nevertheless, the large-scale analyses and knowledge about the relationships of Chinese Asteraceae at the generic level as a whole are far from complete due to difficulties in sampling. In this study, we presented a three-marker (rbcL, ndhF, and matK) phylogeny of Asteraceae, including 506 genera (i.e., approximately one-third of Asteraceae genera). The study sampled 200 Chinese genera (i.e., approximately 80% of Chinese Asteraceae genera). The backbones of the new phylogeny were largely congruent with earlier studies, with 13 subfamilies and 45 tribes recognized. Chinese Asteraceae were distributed in 7 subfamilies (Mutisioideae, Wunderlichioideae, Carduoideae, Pertyoideae, Gymnarrhenoideae, Cichorioideae, and Asteroideae) and 22 tribes (Mutiseae, Hyalideae, Cardueae, Pertyeae, Gymnarrheneae, Vernonieae, Cichorieae, Doroniceae, Senecioneae, Astereae, Anthemideae, Gnaphalieae, Calenduleae, Inuleae, Athroismeae, Helenieae, Coreopsideae, Neurolaeneae, Tageteae, Millieae, Eupatorieae, and Heliantheae). Chinese Asteraceae lacked 6 basal subfamilies and 23 tribes. Several previously ambiguous relationships were clarified. Our analyses also resolved some unplaced genera within Chinese Asteraceae. Finally, our phylogenetic tree was used to revise the classification for all genera of Chinese Asteraceae. In total, 255 genera, 22 tribes, and 7 subfamilies in China are recognized.

Full text

Research Article
doi: 10.1111/jse.12216
A comprehensive generic-level phylogeny of the sunflower
family: Implications for the systematics of Chinese
Asteraceae
Zhi-Xi Fu
1,2
, Bo-Han Jiao
1,2
, Bao Nie
1,2
, Guo-Jin Zhang
1,2
, Tian-Gang Gao
1
*, and China Phylogeny Consortium
†
1
State Key Laboratory of Systematic and Evolutionary Botany, Institute of Botany, Chinese Academy of Sciences, Beijing 10093, China
2
University of the Chinese Academy of Sciences, Beijing 100049, China
†
Members of the China Phylogeny Consortium are listed in the Appendix.
*Author for correspondence. E-mail: gaotg@ibcas.ac.cn. Tel.: 86-10-62836447. Fax: 86-10-62590843.
Received 16 April 2016; Accepted 17 June 2016; Article first published online 22 July 2016
Abstract The sunflower family (Asteraceae) is the largest and the most diverse flowering plant family, comprising
24 000–30 000 species and 1600–1700 genera. In China, Asteraceae are also the largest family, with approximately
2336 indigenous species in 248 genera. In the past two decades, molecular phylogenetic analyses has contributed
greatly to our understanding of the systematics of Asteraceae. Nevertheless, the large-scale analyses and
knowledge about the relationships of Chinese Asteraceae at the generic level as a whole are far from complete due
to difficulties in sampling. In this study, we presented a three-marker (rbcL,ndhF, and matK) phylogeny of
Asteraceae, including 506 genera (i.e., approximately one-third of Asteraceae genera). The study sampled
200 Chinese genera (i.e., approximately 80% of Chinese Asteraceae genera). The backbones of the new phylogeny
were largely congruent with earlier studies, with 13 subfamilies and 45 tribes recognized. Chinese Asteraceae were
distributed in 7 subfamilies (Mutisioideae, Wunderlichioideae, Carduoideae, Pertyoideae, Gymnarrhenoideae,
Cichorioideae, and Asteroideae) and 22 tribes (Mutiseae, Hyalideae, Cardueae, Pertyeae, Gymnarrheneae,
Vernonieae, Cichorieae, Doroniceae, Senecioneae, Astereae, Anthemideae, Gnaphalieae, Calenduleae, Inuleae,
Athroismeae, Helenieae, Coreopsideae, Neurolaeneae, Tageteae, Millieae, Eupatorieae, and Heliantheae). Chinese
Asteraceae lacked 6 basal subfamilies and 23 tribes. Several previously ambiguous relationships were clarified. Our
analyses also resolved some unplaced genera within Chinese Asteraceae. Finally, our phylogenetic tree was used to
revise the classification for all genera of Chinese Asteraceae. In total, 255 genera, 22 tribes, and 7 subfamilies in China
are recognized.
Key words: Asteraceae, China, classification, phylogeny, supermatrix.
Asteraceae are the largest family of flowering plants in the
world with over 1600 genera including 23 000 species
(Anderberg et al., 2007). The members of the family are
distributed in every continent but Antarctica (Funk et al.,
2005). The family is placed in Eudicots–Asterids–Campanulids–
Asterales (APG IV, 2016).
Historically, Asteraceae were classified into two subfamilies
(Asteroideae and Cichorioideae) and 13 tribes (Bentham,
1873). This classification was used in some floras and
handbooks (e.g., Ling et al., 1985a in Flora Reipublicae
Popularis Sinicae). However, there have been major changes
in the classification of Asteraceae in recent decades with a
better phylogenetic framework (Jansen & Palmer, 1987;
Kim et al., 1992; Kim & Jansen, 1995; Bayer & Starr, 1998; Kim
et al., 2002; Panero & Funk, 2002, 2008; Goertzen et al., 2003;
Panero, 2005; Funk et al., 2005, 2009a, 2009b, 2009c; Funk &
Specht, 2007; Smith et al., 2009; Torices, 2010; Panero et al.,
2014; Mandel et al., 2015). Based on 10 or 14 chloroplast DNA
(cpDNA) markers, Panero & Funk (2002, 2008) and Panero
et al. (2014) reconstructed the robust “backbone”of
Asteraceae with 12–13 major clades (subfamilies) identified.
Chinese Asteraceae comprise approximately 2336 indigenous
species (ca. 1145 endemic) and 248 genera (nearly 15% of the
world genera, Shih et al., 2011). During the last two decades,
several molecular phylogenetic studies sampled Chinese
Asteraceae. But these studies largely focused on either
generic- or species-level relationships (e.g., Nannoglottis of
Qinghai–Tibet Plateau (QTP), Liu et al., 2002; Ligularia–
Cremanthodium–Parasenecio (LCP) complex of QTP, Liu
et al., 2006; Saussurea of QTP, Wang & Liu, 2004, Wang
et al., 2009b; Himalayan endemic Dolomiaea,Diplazoptilon
Ling, and Xanthopappus, Wang et al., 2007; Nemosenecio,
Sinosenecio, and Tephroseris, Wang et al., 2009a; Para-
syncalathium,Soroseris,Stebbinsia, and Syncalathium of
QTP, Zhang et al., 2011a, 2011b; Ajania and Chrysanthemum,
Zhao et al., 2010, Liu et al., 2012; Aster, Li et al., 2012; Anaphalis,
Nie et al., 2013, 2015; Lactuca alliance, Wang et al., 2013b;
Crepidiastrum, Peng et al., 2014; Faberia, Liu et al., 2013, Wang
J
SE Journal of Systematics
and Evolution
July 2016 | Volume 54 | Issue 4 | 416–437© 2016 Institute of Botany, Chinese Academy of Sciences

et al., 2014; Youngia, Deng et al., 2014; Diplazoptilon and
Saussurea, Yuan et al., 2015). These studies provided new
insights into the phylogeny of Asteraceae and led to a number
of taxonomic changes regarding the circumscription of
genera. However, knowledge of relationships at the generic
level of the whole Chinese Asteraceae remained poorly
understood due to difficulties in sampling. In addition, the
placements of some genera of Chinese Asteraceae (e.g.,
Ainsliaea,Myripnois,Pertya,Cavea,Echinops,Atractylodes,
Carlina,Tugarinovia,Formania,Centipeda, and Doronicum) into
tribes or subfamilies were still disputed or even completely
unknown.
Given the large number of available plastid sequences in
Asteraceae and the fact that no robust large-scale phylogenies
existed for Chinese Asteraceae at the generic level, this study
includes ca. 80% genera (200), all tribes (22), and all subfamilies
(7) of Chinese Asteraceae. The main objectives of this study
were to: (i) produce a most comprehensive generic-level
phylogeny of Chinese Asteraceae; (ii) elucidate phylogenetic
relationships of Chinese Asteraceae at the generic level and
resolve phylogenetic placements of some genera with
uncertain or unknown affinities; and (iii) evaluate the current
classification (Shih et al., 2011) and provide an updated generic
classification of Chinese Asteraceae.
Materials and Methods
Taxon sampling
A supermatrix of 512 genera, 805 species (including outgroup
species), and 1840 sequences was constructed, including
representatives of all (13) subfamilies, all (45) tribes, and 33%
(506 of 1600) genera (according to recent molecular studies,
Panero, 2005; Panero & Funk, 2002, 2008; Funk et al., 2009a,
2009c; Panero et al., 2014). Chinese Asteraceae (Asteraceae
distributed in China, both native and introduced) were broadly
sampled, including 313 species in 200 genera. Six genera and
seven species of two closely related families (Goodenia varia R.
Br. from Goodeniaceae; Acicarpha tribuloides Juss., Acicarpha
spathulata R. Br., Boopis anthemoides Juss., Calycera crassifo-
liav (Miers) Hicken, Nastanthus spathulatus (Phil.) Miers, and
Scaevola aemula R. Br. from Calyceraceae) were selected as
outgroup species according to recent studies (Funk et al.,
2005; Lundberg, 2009; Winkworth et al., 2008; APG IV, 2016). A
total of 51 species representing 38 Chinese genera were newly
sequenced in the Tree of Life for the genera of Chinese
vascular plants project (Chen et al., 2016).
DNA extraction, polymerase chain reaction amplification,
and sequencing
Three markers (rbcL,matK, and ndhF) from the plastid
genome were used in the phylogenetic analyses. Total
genomic DNA was extracted from silica gel-dried leaf material
using a modified CTAB protocol (Doyle & Doyle, 1987) and
Plant Genomic DNA Kit (Tiangen Biotech, Beijing, China).
All primers are provided in Table 1. The reaction volume was
25 mL, containing 7.5–8.5 mL ddH
2
O, 12.5 mL Mix (0.05 U/mL
Taq polymerase, 4 mol/L MgCl
2
, and 0.4 mol/L each dNTP;
TransGen Biotech, Beijing, China), 1.5 mL each primer
(10 pmol/mL), and 50–100 ng template DNA. Polymerase chain
reaction products were purified using an agarose gel
purification kit (Qiagen, Hilden, Germany) following the
recommended protocols. The PCR conditions were: 1 cycle
of 5 min at 94 °C for denaturation, 40 cycles of 1 min at 94 °C for
denaturation (for rbcL, 35 cycles; for ndhF, 30 cycles), 1.5 min
of annealing at 50 °C (for rbcL, 30 s), and 1.5 min at 72 °C for
extension (for matK, 2 min; for trnK, 3 min), with a final 10 min
extension at 72 °C.
Sequencing reactions were carried out using an ABI Prism
BigDye Terminator Cycle Sequencing Kit (Applied Biosystems,
Foster City, CA, USA). Sequences were analyzed on an ABI
3730xl DNA Analysis System (Applied Biosystems) following
the manufacturer’s protocols. GenBank accession numbers of
the 120 sequences newly generated from the 38 Chinese
genera were deposited in GenBank (Table S1; see Chen et al.,
2016).
Molecular markers and DNA alignment
Three genes (plastid rbcL,matK, and ndhF) of the Asteraceae
were obtained from GenBank (National Center for Biotech-
nology Information (NCBI), http://www.ncbi.nlm.nih.gov)
using a Perl script. Three datasets were available by 1 April 2014
(except for Famatinanthus decussatus (Hieron.) Ariza & S. E.
Freire, Panero et al., 2014).
A three-step strategy was used for each region to generate
high-quality alignments. First, the profile alignments of three
markers were carried out using MAFFT version 7.0 (http://
mafft.cbrc.jp/alignment/software/; Katoh & Standley, 2013).
Then, the alignments were checked and adjusted manually
with BioEdit version 7.1.3 (Hall, 1999). Gaps were treated as
Table 1 List of primers used in polymerase chain reaction amplification and cycle sequencing
Gene Primer name Sequence Reference
ndhF ndhF-5F ATGGAACAGACATATCAATATTAAT Olmstead & Palmer (1994)
ndhF-1318R CGAAACATATAAAATGC(AG)GTTAATCC Olmstead & Sweere (1994)
ndhF-972F GTCTCAATTGGGTTATATGATG Olmstead & Sweere (1994)
ndhF-2110R CCCCCTA(CT)ATATTTGATACCTTCTCC Olmstead & Sweere (1994)
rbcL rbcL-1F ATGTCACCACAAACAGAAACTAAAGC Fay et al. (1997)
rbcL-1460R CTTTTAGTAAAAGATTGGGCCGAG Chase et al. (1993)
matK matK-AF CTATATCCACTTATCTTTCAGGAGT Kato et al. (1998)
matK-8R AAAGTTCTAGCACAAGAAAGTCGA Kato et al. (1998)
trnK-3914F GGGGTTGCTAACTCAACGG Johnson & Soltis (1994)
trnK-2R AACTAGTCGGATGGAGTAG Johnson & Soltis (1994)
Phylogeny of Chinese Asteraceae 417
www.jse.ac.cn J. Syst. Evol. 54 (4): 416–437, 2016

missing data and no gap coding was applied. All characters
were treated as equally weighted. In the second step, several
preliminary maximum likelihood (ML) trees were constructed
using RAxML (Stamatakis et al., 2008) to identify any
obviously problematic taxa. Duplicate sequences were
eliminated from the same taxon, keeping the sequence
with longest length. In the final step, a generic balance
sampling strategy (i.e., each genus included 1–4 samplings)
was adopted by the present supermatrix.
In the final supermatrix, names of tribes, genera, and
species were checked based on Flora of China (Shih et al.,
2011), Species Catalogue of China (Gao & Zhang, 2016), Tropicos
(http://www.tropicos.org/Home.aspx), and The Plant List
(http://www.theplantlist.org).
Phylogenetic analyses
The best-fitting nucleotide substitution model for each gene
was evaluated using the program Modeltest 3.7 (Posada &
Crandall, 1998) according to the Akaike Information Criterion.
It was the general time reversible model incorporating sites
and a gamma distribution (GTR þIþG) for three genes.
Phylogenetic analyses were undertaken using ML and
Bayesian inference (BI). Maximum likelihood analyses were
generated by RAxML version 7.2.8. (Stamatakis et al., 2008).
All parameter values for the tree search were calculated with
1000 non-parametric inferences to assess nodal support.
Bootstrap values (BS) of 80%–100% were interpreted as strong
support, 60%–80% as moderate. The BI analysis was carried out
in MrBayes version 3.2.2 (Ronquist et al., 2012). Four Markov
chain Monte Carlo chains were run, sampling one tree every
1000 generations for 8 000 000 generations, starting with a
random tree. Bayesian posterior probabilities (PP) were
calculated for the majority consensus tree of all sampled
trees after discarding 25% of trees sampled. Posterior
probabilities of 0.88–1.00 were considered to be strong
support, 0.70–0.87 to be moderate. The ML and BI analyses
were both undertaken in the CIPRES science gateway portal
(https://www.phylo.org/portal2/; Miller et al., 2010). Finally,
the trees were visualized by FigTree version 1.4.0 (Rambaut,
2012).
Results
Characteristics of sequence data
The complete data matrix contained 805 species and three
markers for a total of 120 newly determined sequences and
1720 previously published sequences (see Table S1). The total
length of the three regions of cpDNA was 5125 bp. Sequence
characteristics by genes are summarized in Table 2.
Resolution and backbone of major clades within Asteraceae
A summary of the ML tree based on the rapid bootstrapping
analysis from RAxML (final optimized InL¼104 470.14) is
shown in Figs. 1 and 2. The phylogeny estimated using BI
analysis of three markers shared the same topology with the
ML tree. An overview of inferred topologies and bootstrap
values is given in Fig. 1 and 13 major clades were recognized (as
shown in Figs. 1, 2 in different colors). Recent synonyms of
species from NCBI sequences are listed in brackets in Fig. 2.
In both BI and ML analyses, the monophyly of Asteraceae
was strongly supported (PP ¼1.00; BS ¼92). Twelve of 13
major clades were well supported along the backbone of the
Asteraceae (PP ¼0.88–1.00; Fig. 1) (the only exception,
subfamily Wuderlichioideae were weakly supported: PP
¼0.64; BS ¼49). The Barnadesioideae were resolved as a
monophyletic clade with strong support (PP ¼1.00; BS ¼100).
They were sister to the remaining major clades (Famatinan-
thoideae, Mutisioideae, Gochnatioideae þStifftioideae þ
Wunderlichioideae, Hecastocleidoideae, Carduoideae, Per-
tyoideae, Gymnarrhenoideae, Cichorioideae, Corymbiodeae,
and Asteroideae, PP ¼1.00; BS ¼96), however, the interrela-
tionship within Gochnatioideae þStifftioideae þWunderli-
chioideae was unresolved in the BI and ML analyses.
Phylogenetic relationships of Chinese Asteraceae
The detailed topology of Chinese Asteraceae was investigated
using the 200 genera (nearly 80% of genera in China) and 313
species (Fig. 2, taxon names in black). The ML and BI analyses
recognized seven well-distinguished clades of Chinese Aster-
aceae: Mutisioideae, Wunderlichioideae, Carduoideae, Per-
tyoideae, Gymnarrhenoideae, Cichorioideae, and Asteroideae.
Subfamily Mutisioideae
Within Mutisioideae (Figs. 1, 2A), Nassauvieae þMutisieae and
Onoserideae were supported as monophyletic, albeit with
incongruent levels of support between the two inference
methods (PP ¼0.94; BS ¼48). Each tribe was recovered with
strong support (PP ¼1.00; BS >99). Within Mutisieae, The
Chinese Gerbera (including Piloselloides) was strongly sup-
ported as monophyletic (PP ¼1.00; BS ¼97). The relationship
between Adenocaulon and the remaining groups was not
resolved.
Subfamily Wunderlichioideae
Support for the monophyly of Wunderlichioideae was weak
(PP ¼0.64; Figs. 1, 2A). Within tribe Hyalideae, Chinese genera
Nouelia and Leucomeris were supported as the monophyletic
group with strong support (PP ¼1.00). They were supported
as sister to the monophyletic South American Ianthopappus
þHyalis (PP ¼1.00; BS ¼100).
Table 2 Statistics from analyses of the chloroplast datasets of Asteraceae used in this study
Data Aligned
length
Taxa Newly produced
sequences/GenBank
Variable
sites
Parsimony
informative sites
Missing data in
matrix, %
ndhF 2716 439 31/408 1478 1036 45.1
matK 1113 702 41/661 773 584 26.3
rbcL 1296 699 48/651 542 371 28
Combined 5125 805 120/1720 2793 1991 33.1
418 Fu et al.
J. Syst. Evol. 54 (4): 416–437, 2016 www.jse.ac.cn

Fig. 1. Skeletal representation of the 805 species tree from Bayesian inference (BI) and maximum likelihood (ML) analyses, with
tips representing tribes of Asteraceae based on the taxonomic arrangement of Funk et al. (2009c) and Panero et al. (2014).
Branches and terminals are color-coded by the subfamilies of Asteraceae: aqua, Wunderlichioideae; blue, Cichorioideae; brown,
Gymnarrhenoideae; dark orange, Famatinantheae; gold, Gochnatioideae; green, Carduoideae; light blue, Barnadesieae; light
green, Carduoideae; magenta, Corymbiodeae; mid blue, Hecastocleidoideae; orange, Pertyoideae; pink, Stifftioideae; purple,
Mutisioideae; red, Asteroideae; Support values are provided for each node (BI/ML). , Values <0.50 (BI) or <50% (bootstrap
support).
Phylogeny of Chinese Asteraceae 419
www.jse.ac.cn J. Syst. Evol. 54 (4): 416–437, 2016

Fig. 2. Large-scale Bayesian and maximum likelihood estimate (values >0.50 or 50% are shown) of the Asteraceae phylogeny. A,
Barnadesioideae, Famatinanthoideae, Mutisioideae, Gochnatioideae, Stifftioideae, Wunderlichioideae, and Hecastocleidoideae.
B, Carduoideae. C, Pertyoideae, Gymnarrhenoideae, and Cichorioideae. D, Asteroideae and Corymbiodeae. E–G, Asteroideae;
taxon names of Chinese Asteraceae in black. The tree contains 805 species represented by up to 5125 bp of sequence data from
ndhF,matK, and rbcL.
Continued
420 Fu et al.
J. Syst. Evol. 54 (4): 416–437, 2016 www.jse.ac.cn

Subfamily Carduoideae
The Carduoideae were supported as monophyletic with strong
support (PP ¼0.98; BS ¼74; Figs. 1, 2B). Within Carduoideae, a
subclade composed of tribes Oldenburgieae þTarchonan-
theae was found sister to a subclade containing tribes
Dicomea þCardueae (PP ¼0.98; BS ¼74), but interrelation-
ships in the two subclades were poorly resolved (PP ¼0.56/
0.61). Within Cardueae, Cardopatiinae, Echinopinae, and
Carlininae were resolved as successive sisters to Carduinae
and Centaureinae (PP >0.75). Within Carlininae, the BI and ML
Fig. 2. Continued
Phylogeny of Chinese Asteraceae 421
www.jse.ac.cn J. Syst. Evol. 54 (4): 416–437, 2016

hypotheses supported Chinese genera Tugarinovia and Atrac-
tylodes as successive sister group to Atractylis þCarlina
(PP ¼1.00). Within Carduinae and Centaureinae, the evidence
presented here provided strong support for close relationships
between AucklandiaþFrolovia (PP ¼1.00), Hemisteptia þSaus-
surea (PP ¼1.00), and KlaseaþSerratula (PP ¼0.84). The
Arctium–Cousinia group comprising the representatives of
genera Arctium and Schmalhausenia was supported as
Fig. 2. Continued
422 Fu et al.
J. Syst. Evol. 54 (4): 416–437, 2016 www.jse.ac.cn

monophyletic (PP ¼0.98; BS ¼74). This group was allied with
Cousinia with strong support value (PP ¼0.95).
Subfamily Pertyoideae
The clade of Myripnois and Pertya (PP ¼0.89; BS ¼98; Fig. 2C)
was supported as sister to Ainsliaeae with strong support
(PP ¼0.98; BS ¼96).
Subfamily Gymnarrhenoideae
The monotypic genus Cavea was closely allied to Gymnarrhena
with strong support (PP ¼1.00; BS ¼96).
Subfamily Cichorioideae
The Cichorioideae were rendered monophyletic with high
support in both analyses (PP ¼0.97; BS ¼95; Figs., 1, 2C). The
Fig. 2. Continued
Phylogeny of Chinese Asteraceae 423
www.jse.ac.cn J. Syst. Evol. 54 (4): 416–437, 2016

subfamily consists of two subclades. Within the first subclade
(Figs. 1, 2C), the sister relationship of the tribe Liabeae
(PP ¼0.97; BS ¼95) and Moquinieae þVernonieae (PP ¼
1.00) was well supported (PP ¼1.00; BS ¼76); however,
the well supported tribes containing Eremothamneae þArc-
totideae þPlatycarpheae (PP ¼0.97; BS ¼91) were sister to
former tribes with weak support (PP ¼0.65). Within
Vernonieae (Fig. 2C), a moderately supported group (PP ¼
0.66; BS ¼70) comprising genera Pseudelephantopus þEle-
phantopus þPiptocarpha was supported as sister to Lepida-
ploa with moderate support (PP ¼0.69; BS ¼74). The second
subclade was the strongly supported tribe Cichorieae (PP ¼
0.97; Fig. 2C). Askellia and Ixeris þIxeridium,Lapsanastrum,
and Youngia were recovered with strong support (PP >0.97;
Fig. 2. Continued
424 Fu et al.
J. Syst. Evol. 54 (4): 416–437, 2016 www.jse.ac.cn

BS >65). Cicerbita was sister to Melanoseris in the BI analysis
with moderate support (PP ¼0.78). The monophyly of
Parasyncalathium and Lactuca was poorly supported (PP
¼0.65). Paraprenanthes and Notoseris were supported as
monophyletic (PP ¼1.00; BS ¼79), but neither genus was
itself recovered as monophyletic.
Subfamily Asteroideae
Asteroideae were further subdivided into three subclades.
However, interrelationships among the three subclades were
not resolved (Fig. 1).
Within the first subclade, one additional lineage (Doroni-
ceae) was supported, but the relationships between
Fig. 2. Continued
Phylogeny of Chinese Asteraceae 425
www.jse.ac.cn J. Syst. Evol. 54 (4): 416–437, 2016

Doroniceae and Senecioneae were poorly resolved (PP ¼
0.52; Figs., 1, 2D). The monophyletic Senecioneae (PP ¼1.00)
consists of two strongly supported subtribes, Senecioninae
(PP ¼0.96) and Tussi lagininae (PP ¼0.90; BS ¼60). The
sister relationships within Senecioninae were supported as
follows, Emilia þPericallis (PP ¼1.00, BS ¼100) and Crasso-
cephalum þErechtites (PP ¼0.99, BS ¼78). However, the
phylogenetic relationship of Chinese genera Synotis (PP ¼
0.76) and Cissampelopsis þEm ilia þPericallis received mod-
erate resolut ion (PP ¼0.60). Senecio (sensu Chen, 1999)
Fig. 2. Continued
426 Fu et al.
J. Syst. Evol. 54 (4): 416–437, 2016 www.jse.ac.cn

were rendered polyphyletic (Fig. 2D). Within Tussilagininae,
the LCP complex (sensu Liu et al., 2006) comprising
representatives of the genera, such as Ligularia,Cremantho-
dium,Parasenecio,andSinosenecio, were rendered mono-
phyletic with high support (PP ¼0.99; BS ¼73). However,
each genus was not supported as monophyletic group.
Within the LCP complex, Sinosenecio þNemosenecio þTeph-
roseris were grouped together with high support (PP ¼0.98;
BS ¼67). Additionally, the polyphyly of Sinosenecio was
supported.
Within the second subclade, tribes Calenduleae, Gnapha-
lieae, and Anthemideae were subsequent sisters to Astereae.
These pl acements all received strong support (PP >0.88).
Within Calenduleae, a group of Calendula,Osteospermum,
and Chrysanthemoides was resolved with strong support
values (PP ¼1.00; BS ¼98; Fig. 2D). The relationships
within Gnaphalieae (Fig. 2D) were resolved with high
support indices, Athrixia þ(Phagnalon þRelhania þLeysera)
(PP¼1.00; BS ¼85), Xerochrysum þ(Craspedia þRhodanthe)
(PP ¼0.99), Gnaphalium and Vellereophyton (PP ¼1.00),
Helichrysum–Anaphalis–Pseudognaphalium (HAP clade, PP
¼0.99; BS ¼88). Within tribe Anthemideae (Fig. 2E), Ajania,
Stilpnolepis,andArtemisia were confirmed to be a monophy-
letic group with weak support (PP ¼0.65), although the
relationship within the group was collapsed. The phyloge-
netic relationships of some genera were identified as follows,
Glebionis þArgyranthemum,Chamaemelum þSantolina,Leu-
canthemum þMauranthemum (PP >0.95). The tribe Aster-
eae was supported as a monophyletic group (PP ¼0.88)
(Fig. 2E). However, within the tribe, all samples formed a
large polytomy without further resolution (Fig. 2E). Formania
and Thespis were supported as the members of Astereae
(Fig. 2E).
Our results indicated that a third subclade (Figs. 1, 2F, 2G)
could be divided into two well-supported sister groups,
Inuleae (PP ¼0.98) and Athroismeae þHeliantheae alliance
(PP ¼0.93; BS ¼97). The Inuleae consists of Plucheinae and
Inulinae. Within Plucheinae, Pseudoconyza was found sister to
the group containing Sphaeranthus,Laggera,Pluchea,Kar-
elinia, and Epaltes with strong support (PP ¼0.98; BS ¼96).
However, the latter relationships were unambiguously
supported. Within Inulinae, Inula was retrieved as polyphy-
letic. The close relationship of Blumea þCaesulia was strongly
supported (PP ¼0.95; BS ¼88). Within Athroismeae, the
close relationship of Centipeda,Anisopappus, and Athroisma
received strong support (PP ¼0.98; BS ¼84). Within the
Heliantheae alliance, there were moderate support values for
division of the alliance into 13 tribes (including Feddeeae,
Helenieae, Coreopsideae, Polymnieae, Perityleae, Neurolae-
neae, Tageteae, Bahieae, Chaenactideae, Madieae, Millieae,
Eupatorieae, and Heliantheae) (Fig. 2F, 2G; Panero, 2007; Funk
et al., 2009c). Within Millerieae and Eupatorieae, the sister
relationships of Melampodium þAcanthospermum,Galinsoga
þAlloispermum,Sigesbeckia þGuizotia, and Ageratum þCon-
oclinium were resolved with high support indices (PP ¼1.00).
The following sister relationships of the tribe Heliantheae
(Fig. 2G) were strongly recovered, Eleutheranthera þ(Dimer-
ostemma þEclipta), Synedrella þLasianthaea,Calyptocarpus þ
Damnxanthodium,Sphagneticola þTilesia,Wollastonia þ
Lipochae,Ratibida þRudbeckia, and Spilanthes þAcmella
(PP >0.94).
Discussion
Phylogenetic relationships within Asteraceae
Based on the comprehensive generic-level sampling, the
backbone of Asteraceae using three chloroplast markers
corresponded well to those recovered by recent studies based
on 10 or 14 cpDNA markers (Panero & Funk, 2002, 2008;
Panero et al., 2014). In our phylogenetic tree (Figs. 1, 2),
13 clades (subfamilies) were identified and 12 of them were
statistically supported in our BI analysis (PP >0.94), with the
exception of Wuderlichioideae (PP ¼0.64; BS ¼49, the same
result with Panero & Funk, 2008). Our analyses provided new
insights into some previously ambiguous relationships. Within
Carduoideae, several investigators had reported various
lineages with uncertain relationships, for example: two sister
lineages, Dicomeae þ(Oldenburgieae þTarchonantheae þ
Cardueae) (Funk et al., 2005); three unresolved lineages,
Dicomeae, Cardueae, and (Oldenburgieae þTarchonantheae)
(Panero & Funk, 2008; Funk et al., 2009c); and four unresolved
distant lineages, Dicomeae, Cardueae, Oldenburgieae, and
Tarchonantheae (Ortiz et al., 2013). Our results support the
tribes Oldenburgieae þTarchonantheae as the sister to the
tribes Dicomeae þCardueae (PP ¼0.98; BS ¼74; Figs. 1, 2B).
There were still some uncertainties in our results. The
monophyly of Gochnatioideae þStifftioideae þWunderlichioi-
deae received high support in our BI analysis (PP ¼0.97), but
their interrelationship was not resolved in our ML analysis
(Figs. 1, 2A). The recent molecular phylogenetic study (Panero
et al., 2014), in fact, clarified the close sister relationship of
Stifftioideae and Wunderlichioideae þGochnatioideae in the BI
analysis. Within Cichorioideae, the sister relationship between
Cichorieae and theremaining tribes was well supported byour
analysis and recent studies (Funk et al., 2004; Funk & Chan.,
2009). However, our analyses indicated that the placements of
remaining tribes, such as Arctotideae, Liabeae, Eremotham-
neae, and Heterolepis, were still in doubt (Fig. 2C).
Systematics of Chinese Asteraceae
The analyses supported 13 clades (13 subfamilies, including
45 tribes) (Fig. 1, shown in different colors). Chinese
Asteraceae were not monophyletic and were placed into
seven major robust clades (subfamilies), Mutisioideae,
Wunderlichioideae, Carduoideae, Pertyoideae, Gymnarrhenoi-
deae, Cichorioideae, and Asteroideae, and 22 tribes, Mutiseae,
Hyalideae, Cardueae, Pertyeae, Gymnarrheneae, Vernonieae,
Cichorieae, Doroniceae, Senecioneae, Astereae, Anthemi-
deae, Gnaphalieae, Calenduleae, Inuleae, Athroismeae, Helen-
ieae, Coreopsideae, Neurolaeneae, Tageteae, Millieae,
Eupatorieaea, and Heliantheae (Fig. 2). Chinese Asteraceae
lacked 6 subfamilies Barnadesioideae, Famatinanthoideae,
Gochnatioideae, Stifftioideae, Corymbiodeae, and Hecasto-
cleidoideae and 23 tribes, Barnadesieae, Famatinantheae,
Onoserideae, Nassauvieae, Gochnatieae, Stifftieae, Wunder-
lichieae, Hecastocleideae, Oldenburgieae, Tarchonantheae,
Dicomeae, Moquinieae, Liabeae, Arctotideae, Eremotham-
neae, Platycarpheae, Corymbieae, Feddeeae, Polymnieae,
Perityleae, Madieae, Chaenactideae, and Bahieae (names of
subfamilies and tribes following previous studies, Panero &
Funk, 2002, 2008; Panero, 2005; Funk et al., 2009c; Panero
et al., 2014). Details of the phylogenetic relationships within
major Chinese clades were discussed below.
Phylogeny of Chinese Asteraceae 427
www.jse.ac.cn J. Syst. Evol. 54 (4): 416–437, 2016

Subfamily Mutisioideae
The Mutisioideae include 630 species and ca. 44 genera in
three tribes (Onoserideae, Nassauvieae, and Mutisieae; Figs. 1,
2A). The tribe Mutisieae contains ca. 14 genera and over 200
species.
Tribe Mutiseae
Mutisioideae are poorly represented in China with only 1 tribe
Mutisieae (PP ¼1.00; BS ¼99; Figs. 1, 2A), 3 genera, and
13 indigenous species (three endemic spp.). The monophyly of
Gerbera received strong support as sister to the East
Asian–North American disjunct Leibnitzia (PP ¼1.00; BS ¼100;
Fig. 2A), confirming previous hypotheses (Baird et al., 2010;
see also Wen et al., 2010). The placement of Adenocaulon was
unresolved within Mutiseae, as shown by Kim et al. (2002).
Subfamily Wunderlichioideae
The Wunderlichioideae consist of two tribes, Wunderlichieae
and Hyalideae (Figs. 1, 2A). The family (8 genera and 42
species) is disjunctly distributed in northeastern South
America and southwestern China.
Tribe Hyalideae
Wunderlichioideae are poorly represented in China with one
tribe Hyalideae (Fig. 2A), two genera (Nouelia and Leucomeris),
and two indigenous species. Only Nouelia insignis Franch. is
endemic to China. Within Hyalideae, a group comprising the
sister genera Nouelia and Leucomeris was supported as sister
to the South American genera Ianthopappus þHyalis (PP
¼1.00; BS ¼100; Fig. 2A). The relationship was also supported
by recent analyses (e.g., Kim et al., 2002; Panero & Funk,
2008). Therefore, the treatment of placing Nouelia and
Leucomeris into Mutisieae (e.g., Hind, 2007; Gao & Hind,
2011) needs to be revised.
Subfamily Carduoideae
The Carduoideae consist of ca. 2850 species and 85 genera in 4
tribes (Garcia-Jacas et al., 2002; Funk et al., 2005; Susanna &
Garcia-Jacas, 2007, 2009; Ortiz et al., 2013; Figs. 1, 2B).
Tribe Cardueae
The Carduoideae are represented in China with only one tribe
Cardueae (Fig. 2B), four subtribes (Echinopsinae, Carliniaea,
Carduinae, and Centaureinae), except for Cardopatiinae
(Fig. 2B, Table 3), 41 genera, and ca. 464 species (244 endemic
spp.). They are also the most morphologically diverse and
species-rich tribe in China. Within Carlininae, Chinese genera
Tugarinovia and Atractylodes were supported as successive
sisters to Atractylis þCarlina (PP ¼1.00; BS ¼84; Fig. 2B),
which was congruent with the findings reported by Susanna
et al. (2006) and Barres et al. (2013). The Carduinae includes
seven groups (sensu Susanna & Garcia-Jacas, 2009). Five of
seven groups are represented in China (Table 3). Within
Carduinae, the close relationship of Shangwua and Xeranthe-
mum was supported by our analysis and recent studies (Wang
et al., 2009b; Wang et al., 2013a). The close relationships of
Cousinia þ(Arctium þSchmalhausenia) and Aucklandia þ
Frolovia, previously inferred by L
opez-Vinyallonga et al.
(2009) and Wang et al. (2007), separately, were also
supported in our phylogenetic inferences (PP >0.95;
Fig. 2B). Our results also showed that samplings of the
morphological diversity of Saussurea (ca. 300 spp. in China and
400 spp. in the world) were still far from complete. The
intrarelationships and interrelationships between Saussurea
and related genera (e.g., the Chinese monotypic genus
Bolocephalus) remained unresolved (Raab-Straube, 2003;
Kita et al., 2004; Wang & Liu, 2004; Wang et al., 2009b).
Therefore, the full classification of the Saussurea is in need of
revision. Within Centaureinae, Serratula and Klasea were
supported as monophyletic (PP ¼0.84; Fig. 2B), as stated by
Barres et al. (2013).
Subfamily Pertyoideae
The Pertyoideae consist of one tribe (Pertyeae), four genera,
and ca. 80 species distributed only in Asia.
Tribe Pertyeae
The Pertyeae is a well-represented tribe in China with three
genera and ca. 58 species (45 spp. endemic). Based on
incomplete morphological studies (Cabrera, 1977; Hind, 2007;
Katinas et al., 2008; Gao et al., 2011), the genera Ainsliaea,
Pertya, and Myripnois were previously treated as members of
tribe Mutisieae. However, our results (Figs. 1, 2C) and recent
molecular studies (Kim et al., 2002; Panero & Funk, 2002, 2008;
Mitsui et al., 2008) showed that these genera form a distinct
clade (Pertyoideae and Pertyeae, recognized by Panero &
Funk, 2002) nested above the Carduoideae and the mono-
phyly of Ainsliaea and Pertya þMyripnois received strong
support (PP ¼0.98; BS ¼96; Fig. 2C). Furthermore, Myripnois,
a genus endemic to North China, was embedded within the
genus Pertya. These two genera were very similar in gross
morphology (e.g., shrub, dioecious, capitula solitary, terminal
on branchlets, subsessile or with short peduncle, Gao et al.,
2011). Further sampling of more species will certainly
contribute to the redefinition of the two genera.
Subfamily Gymnarrhenoideae
The Gymnarrhenoideae include only one tribe and two
monotypic genera, Gymnarrhena and Cavea (Fig. 2C).
Tribe Gymnarrheneae
The present result (PP ¼0.98; BS ¼96; Fig. 2C) and Anderberg
& Ohlson (2012) strongly supported the monophyly of Cavea
and Gymnarrhena.Gymnarrhena is a rosulate and dwarf desert
annual herb, which is mainly distributed in North Africa and
the Middle East. Cavea is a perennial herb with branched stems
that grows on gravelly ground near streams and glaciers of
high mountains in the Himalaya area. There were no obvious
habitat or morphological characters between Cavea and
Gymnarrhena to support the monophyly of Gymnarrhenoi-
deae, although the two genera might share an important
synapomorphy, that is, two types of flowers (capitula) with a
tendency towards dioecism (Anderberg & Ohlson, 2012).
Subfamily Cichorioideae
The Cichorioideae include ca. 2900 species and ca. 250 genera
in seven described tribes (Cichorieae, Vernonieae, Arctoti-
deae, Liabeae, Platycarpheae, Eremothamneae, and Moqui-
nieae) and one unplaced genus Heterolepis (Figs. 1, 2C; Funk &
Chan, 2009). Two tribes (Vernonieae and Cichorieae),
41 genera, and 426 species are indigenous to China (199
endemic spp.).
Tribe Vernonieae
Six genera and 39 species are indigenous to China (10 spp.
endemic). Both chloroplast and nuclear DNA datasets strongly
supported the sister relationship between Elephantopus and
428 Fu et al.
J. Syst. Evol. 54 (4): 416–437, 2016 www.jse.ac.cn

Table 3 Revised taxonomy of the Chinese Asteraceae at the generic level
Subfamily 1. Mutisioideae (Cass.) Lindl. [1829]. (3 genera).
Tribe 1. Mutisieae Cass. [1819]. (3 genera).
Adenocaulon Hook., Leibnitzia Cass., Gerbera L.
Subfamily 2. Wunderlichioideae Panero & V. A. Funk [2007]. (2 genera).
Tribe 2. Hyalideae Panero [2007]. (2 genera).
Leucomeris D. Don, Nouelia Franch.
Subfamily 3. Carduoideae Cass. ex Sweet [1829]. (41 genera).
Tribe 3. Cardueae Cass. [1819]. (41 genera).
Subtribe 3.1 Echinopsinae (Cass.) Dumort.
Echinops L.
Subtribe 3.2 Carlininae Dumort.
Atractylodes DC.,Carlina L., Tugarinovia Iljin
Subtribe 3.3 Carduinae (Cass.) Dumort.
Jurinea–Saussurea group
Aucklandia Falc.,
†
Bolocephalus Hand.-Mazz., Dolomiaea DC., Frolovia (DC.) Lipsch., Hemisteptia Bunge ex Fischer & C. A. Meyer,
Himalaiella Raab-Straube, Jurinea Cass., Saussurea DC.
Arctium–Cousinia group
Arctium L., Cousinia Cass., Schmalhausenia C. Winkl.
Onopordum group
Alfredia Cass., Ancathia DC., Synurus Iljin, Syreitschikovia Pavlov, Olgaea Iljin, Onopordum L., Xanthopappus C. Winkl.
Carduus–Cirsium group
Carduus L., Cirsium Mill.
Xeranthemum group
Shangwua Yu J. Wang, Raab-Straube, Susanna & J. Quan Liu
Subtribe 3.4 Centaureinae (Cass.) Dumort.
Amberboa Vaill., Archiserratula L. Martins, Carthamus L.,
†
Centaurea L.,
‡
Crupina (Pers.) DC., Cyanus Mill.,
†
Klasea Cass.,
Oligochaeta (DC.) K. Koch, Plagiobasis Schrenk, Psephellus Cass., Rhaponticoides Vaill., Rhaponticum Vaill., Russowia C. Winkl.,
Schischkinia Iljin, Serratula L., Tricholepis DC.
Subfamily 4. Pertyoideae Panero & V. A. Funk [2002]. (3 genera).
Tribe 4. Pertyeae Panero & V. A. Funk [2002]. (3 genera).
Ainsliaea DC., Myripnois Bunge, Pertya Sch.-Bip.
Subfamily 5. Gymnarrhenoideae Panero & V. A. Funk [2002]. (1 genus).
Tribe 5. Gymnarrheneae Panero & V. A. Funk [2002]. (1 genus).
Cavea W. W. Smith & J. Small
Subfamily 6. Cichorioideae (Juss.) Chev. [1828]. (42 genera).
Tribe 6. Vernonieae Cass. [1819]. (6 genera).
Camchaya Gagnep., Distephanus Cass., Elephantopus L., Ethulia L.f., Pseudelephantopus Rohr,
†
Vernonia Schreb.
‡
Tribe 7. Cichorieae Lam. & DC. [1806]. (36 genera).
Askellia W. A. Weber, Cicerbita Wallr., Crepidiastrum Nakai, Crepis L., Dubyaea DC., Epilasia (Bunge) Benth., Faberia Hemsl.,
Garhadiolus Jaub. & Spach, Chondrilla L., Cichorium L.,
†
Heteracia Fisch. & C. A. Mey., Hieracium L., Hololeion Kitam.,
Hypochaeris L.,
‡
Ixeridium (A. Gray) Tzvelev, Ixeris (Cass.) Cass., Koelpinia Pall., Lactuca L.,
‡
Lapsanastrum J. H. Pak & K.
Bremer, Launaea Cass., Melanoseris Decne., Nabalus Cass., Notoseris C. Shih, Paraprenanthes C. C. Chang ex C. Shih,
Parasyncalathium J. W. Zhang, Boufford & H. Sun, Picris L., Pilosella Vaill., Podospermum DC., Scorzonera L., Sonchella
Sennikov, Sonchus L.,
‡
Soroseris Stebbins, Syncalathium Lipsch., Taraxacum F. H. Wiggers,
‡
Tragopogon L.,
‡
Youngia Cass.
Subfamily 7. Asteroideae (Cass.) Lindl. [1829]. (163 genera).
Tribe 8. Doroniceae Panero [2005]. (1 genus).
Doronicum L.
Tribe 9. Senecioneae Cass. [1819]. (23 genera).
Subtribe 9.1 Tussilagininae s. str. clade
Cremanthodium Benth., Dicercoclados C. Jeffrey & Y. L. Chen, Farfugium Lindl., Ligularia Cass., Ligulariopsis Y. L. Chen,
Nemosenecio (Kitam.) B. Nord., Parasenecio W. W. Smith & J. Small, Petasites Mill., Sinacalia H. Rob. & Brettell, Sinosenecio B.
Nord., Syneilesis Maxim., Tephroseris (Reichenb.) Reichenb., Tussilago L.
Subtribe 9.2 Senecioninae
Cissampelopsis (DC.) Miq., Crassocephalum (DC.) Miq.,
†
Emilia Cass.,
‡
Erechtites Raf.,
†
Gynura Cass., Hainanecio Y. Liu & Q. E.
Yang, Jacobaea Mill., Pericallis D. Don,
†
Senecio L., Synotis (C. B. Clarke) C. Jeffrey & Y. L. Chen
Tribe 10. Calenduleae Cass. [1819]. (1 genus).
Calendula L.
†
Tribe 11. Gnaphalieae (Cass.) Lecoq & Juillet [1831]. (11 genera).
Anaphalis DC., Antennaria Gaertn., Filago L., Gamochaeta Wedd.,
‡
Gnaphalium L., Gnomophalium Greuter, Helichrysum Mill.,
Leontopodium R. Br. ex Cass., Phagnalon Cass., Pseudognaphalium Kirp., Xerochrysum Tzvelev
†
Tribe 12. Astereae Cass. [1819]. (29 genera).
Continued
Phylogeny of Chinese Asteraceae 429
www.jse.ac.cn J. Syst. Evol. 54 (4): 416–437, 2016

Table 3 Continued
African lineages
Bellis L.,
†
Crinitina Soj
ak, Galatella Cass., Grangea Adans., Tripolium Nees, Nannoglottis Maxim.
Australasian lineages
Aster L., Asterothamnus Novopokr., Arctogeron DC., Callistephus Cass., Calotis R. Br., Eschenbachia Moench, Formania W.W.
Smith & J. Small, Heteroplexis C.C. Chang, Lagenophora Cass., Myriactis Less., Neobrachyactis Brouillet, Psychrogeton Boiss.,
Sheareria S. Moore, Thespis DC., Turczaninovia DC., Rhinactinidia Novopokr.
North American lineages
Erigeron L.,
‡
Eurybia (Cass.) Cass., Grindelia Willd.,
†
Solidago L.,
‡
Symphyotrichum Nees
‡
Unplaced genera
Dichrocephala L’H
er. ex DC., Microglossa DC.
Tribe 13. Anthemideae Cass. [1819]. (29 genera).
Southern Hemisphere grade
Subtribe 13.1 Cotulinae Kitt.
Cotula L., Soliva Ruiz & Pav.
†
Asian–South African grade
Subtribe 13.2 Artemisiinae Less.
Ajania Poljakov, Artemisia L., Brachanthemum DC., Chrysanthemum L., Crossostephium Less., Elachanthemum Y. Ling & Y. R.
Ling, Filifolium Kitam., Hippolytia Poljakov, Kaschgaria Poljakov, Leucanthemella Tzvelev, Microcephala Pobed., Neopallasia
Poljakov, Stilpnolepis Krasch.
Genera of the Asian–South African grade unassigned to a subtribe
Ajaniopsis C. Shih, Cancrinia Kar. & Kir., Opisthopappus C. Shih
Subtribe 13.3 Handeliinae Bremer & Humphries
Allardia Decne, Handelia Heimerl, Pseudohandelia Tzvelev, Richteria Kar. & Kir.
Eurasian grade
Subtribe 13.4 Matricariinae Willk.
Achillea L.,
‡
Matricaria L.
Subtribe 13.5 Anthemidinae (Cass.) Dumort.
Anthemis L.,
†
Tanacetum L.,
‡
Tripleurospermum Sch.-Bip.
Mediterranean clade
Subtribe 13.6 Leucantheminae Bremer & Humphries
Leucanthemum Mill.
†
Subtribe 13.7 Glebionidinae Oberprieler & Vogt
Glebionis Cass.
†
Tribe 14. Inuleae Cass. [1819]. (14 genera).
Subtribe 14.1 Inulinae Dumort.
Blumea DC., Buphthalmum L.,
†
Carpesium L., Duhaldea DC., Inula L., Pentanema Cass., Pulicaria Gaertn.
‡
Subtribe 14.2 Plucheinae Dumort.
Epaltes Cass., Karelinia Less., Laggera Sch.-Bip. ex Benth. & J. D. Hook., Pluchea Cass.,
‡
Pseudoconyza Cuatr., Pterocaulon Ell.,
Sphaeranthus L.
Tribe 15. Athroismeae Panero [2002]. (3 genera).
Anisopappus Hook. & Arnott, Centipeda Lour., Symphyllocarpus Maxim.
Heliantheae alliance (tribes 16–22)
Tribe 16. Helenieae (Cass.) Lindl. [1826]. (1 genus).
Helenium L.
†
Tribe 17. Coreopsideae Lindl. [1829]. (4 genera).
Bidens L.,
‡
Cosmos Cav.,
†
Coreopsis L.,
†
Dahlia Cav.
†
Tribe 18. Neurolaeneae Rydb. [1927]. (1 genus).
Enydra Lour.
Tribe 19. Tageteae Cass. [1819]. (5 genera).
Flaveria Juss.,
†
Glossocardia Cass., Pectis L.,
†
Tagetes L.,
†
Dyssodia Cav.
†
Tribe 20. Millieae Lindl. [1829]. (8 genera).
Acanthospermum Schrank,
†
Blainvillea Cass., Galinsoga Ruiz & Pav.,
†
Guizotia Cass.,
‡
Sigesbeckia L., Smallanthus Mack.,
†
Tridax
L.,
†
Melampodium L.
†
Tribe 21. Eupatorieae Cass. [1819]. (10 genera).
Adenostemma J. R. Forst. & G. Forst., Ageratina Spach,
†
Ageratum L.,
†
Austroeupatorium R. M. King & H. Rob.,
†
Chromolaena
DC.,
†
Conoclinium DC.,
†
Eupatorium L., Gymnocoronis DC.,
†
Mikania Willd.,
‡
Praxelis Cass.
†
Tribe 22. Heliantheae Cass. [1819]. (23 genera).
Acmella Pers.,
‡
Ambrosia L.,
†
Calyptocarpus Less.,
†
Clibadium F. Allam. ex L.,
†
Eleutheranthera Poit. ex Bosc.,
†
Eclipta L.,
†
Gaillardia Foug.,
†
Helianthus L.,
†
Lagascea Cav.,
†
Melanthera Rohr, Parthenium L.,
†
Rudbeckia L.,
†
SanvitaliaLam.,
†
Sclerocarpus
Jacq.,
†
Silphium L.,
†
Sphagneticola O. Hoffm.,
‡
Synedrella Gaertn.,
†
Tithonia Desf. ex Juss.,
†
Wollastonia DC. ex Decaisne,
Xanthium L.,
†
Heliopsis Pers.,
†
Ratibida Raf.,
†
Zinnia L.
†
Names of subfamilies, tribes, subtribes, clades, grades, lineages, and groups are in bold. Publication dates are in brackets.
†Genera containing only introduced species. ‡Indigenous and introduced species.
430 Fu et al.
J. Syst. Evol. 54 (4): 416–437, 2016 www.jse.ac.cn

Chrysolaena þLepidaploa þLessingianthus (Keeley et al.,
2007). A moderate support lineage consisting of Lepidaploa
þ(Elephantopus þPseudelephantopus) was also observed in
our study (PP ¼0.66; BS ¼70; Fig. 2C).
Tribe Cichorieae
With ca. 95 genera and 2500 species, the Cichorieae is mainly
distributed in the Northern Hemisphere (Shih et al., 2011).
Based on a recent analysis, Kilian et al. (2009) recognized 11
subtribes. It is the third most species-rich tribe of Asteraceae
in China. Eight subtribes, 35 genera, and 387 species are
indigenous to China (the great majority, ca. 189 spp.,
endemic). The monophyly of Soroseris and Stebbinsia was
supported in our analysis (PP ¼0.95; BS ¼77; Fig. 2C) and
previous study (Zhang et al., 2011b). Inclusion of Lapsanastrum
in Youngia observed in our result (PP ¼1.00; BS ¼87) were in
accord with the recently published results from nuclear
ribosomal internal transcribed space (nrITS) analyses (Deng
et al., 2014). In addition, Askellia þ(Ixeris þIxeridium) were
recovered as a monophyletic group (PP ¼0.97; BS ¼66;
Fig. 2C). A monophyletic group including Cicerbita and
Melanoseris was recovered with moderate support (PP ¼
0.78). Parasyncalathium was loosely allied with Lactuca in a
weakly supported clade (PP ¼0.65). More studies are
needed to determine the taxonomic status of its generic
affiliation. Paraprenanthes and Notoseris were nested within
an unresolved trichotomy from our analysis. Based on the
analysis of other multiple five cpDNA and nrITS data, Wang
et al. (2013b) speculated that the monophyly of Para-
prenanthes and Notoseris might be the result of introgressive
hybridization.
Subfamily Asteroideae
Asteroideae are the largest subfamily of Asteraceae, compris-
ing 22 tribes (Fig. 1), ca. 1150 genera, and 16 000 species (data
from http://angio.bergianska.se/). Within Asteroideae, ca. 163
genera and 1400 species are indigenous to China (emend from
Shih et al., 2011). Fifteen tribes (Doroniceae, Senecioneae,
Astereae, Anthemideae, Gnaphalieae, Calenduleae, Inuleae,
Athroismeae, Helenieae, Coreopsideae, Neurolaeneae, Tage-
teae, Millieae, Eupatorieae, and Heliantheae) are represented
in China (ca. 66% tribes and 60% genera of Chinese Asteraceae;
Fig. 2D–2G).
Tribe Doroniceae
The Doroniceae (Panero, 2005) includes only one genus with
ca. 40 species in Eurasia and Northern Africa. It is represented
in China by seven species (four endemic spp.). The position of
Doronicum varied. It was treated either as the members of
tribe Senecioneae (e.g., Jeffrey & Chen, 1984; 
Alvarez
Fern
andez et al., 2001) or as a separate and uncertain clade
of Asteroideae (Goertzen et al., 2003; Pelser et al., 2007;
Nordenstam et al., 2009). The present BI analysis strongly
supported the second alternative (Fig. 2D; PP ¼1.00). It was
also suggested here to reinstate Doronicum as an independent
tribe (sensu Panero, 2005), because Doronicum might occupy a
basal position of Senecionodae and Asterodae (C. F. Zhang
et al., Fudan University, Shanghai, pers. comm.).
Tribe Senecioneae
The Senecioneae, with an estimated 150–170 genera and 3500
species, is the largest tribe of Asteraceae. In China, the
Senecioneae is the second most species-rich tribe, consisting
of two subtribes, 23 genera, and 457 species (the great
majority, ca. 311 spp., endemic). The subtribe Senecioninae
was supported as sister to Tussilagininae (PP ¼1.00; Fig. 2D),
as in previous analyses (Pelser et al., 2007; Nordenstam et al.,
2009). Within Senecioninae, the close relationships of Emilia
þPericallis (PP ¼1.00, BS ¼100) and Crassocephalum þErech-
tites (PP ¼0.99, BS ¼78) supported in our analyses were in
agreement with previous results reported by Pelser et al.
(2007, 2010). The Chinese Synotis,Cissampelopsis,Emilia, and
Pericallis formed a moderately supported monophyletic group
(PP ¼0.60; Fig. 2D). The present result, as in Pelser et al.
(2007, 2010), showed strong phylogenetic divergence within
the polyphyletic Senecio (sensu Chen, 1999).
The Tussilagininae includes species with an almost exclu-
sively East Asian distribution. The monophyly of the LCP
complex (sensu Liu et al., 2006, ca. 12 genera and 400 species)
was supported in the present analysis (PP ¼0.99; BS ¼73;
Fig. 2D), as indicated by some recent analyses (Golden et al.,
2001; Liu et al., 2006; Pelser et al., 2007; Wang et al., 2009a).
However, in our analysis (Fig. 2D), some genera of the LCP
complex, that is, Ligularia (ca. 140 spp.), Cremanthodium (ca.
70 spp.), Parasenecio (ca. 60 spp.), and Sinosenecio (ca. 41
spp.), as described by Jeffrey & Chen (1984) and Chen (1999),
were not monophyletic (Fig. 2D). These findings indicated that
a number of generic problems exist in the current classifica-
tion of Tussilagininae. An enhanced sampling of the LCP
complex is needed to resolve their generic affiliation.
Tephroseridinae (Sinosenecio–Nemosenecio–Tephroseris) was
nested within the Tussilagininae and the species of Sinosene-
cio had different positions in the present trees (Fig. 2D),
consistent with results of recent analyses (Nordenstam et al.,
2009; Wang et al., 2009a).
Tribe Calenduleae
The Calenduleae consists of 12 genera and ca. 120 species,
which are mainly distributed in southern Africa (80% spp.). The
tribe is poorly represented in China with one introduced genus
(one species, Calendula officinalis L.; Fig. 2D). The close
relationship among Calendula,Osteospermum, and Chrysan-
themoides was resolved with strong support values (PP
¼n1.00; BS ¼98; Fig. 2D), congruent with the finding reported
by Nordenstam & Kallersjo (2009).
Tribe Gnaphalieae
The Gnaphalieae is a moderately large tribe with ca. 185
genera and 1240 species. There are only a few taxa of the
Gnaphalieae in the Northern Hemisphere (Anderberg, 1991;
Bayer et al., 2007). Therefore, Gnaphalieae is poorly
represented in China with 11 genera and 120 species (ca. 62
endemic spp.). Our result (PP ¼1.00; BS ¼85; Fig. 2D) and
recent molecular phylogenies (e.g., Ward et al., 2009; Nie
et al., 2015) consistently supported the Relhania clade as the
basal group, which included a representative group of genera
Athrixia,Leysera,Relhania, and Chinese Phagnalon. Within the
crown radiation group, the monophyly of the HAP clade was
strongly supported by our analysis (PP ¼0.99; BS ¼88;
Fig. 2D). Given that Anaphalis and Pseudoganaphalium
rendered Helichrysum paraphyletic, Nie et al. (2013) and
Galbany-Casals et al. (2014) suggested that the traditional
generic concept of Helichrysum was not supported. Further-
more, the monophyly of Anaphalis was weakly supported (Nie
et al., 2013). Within the Filago,Leontopodium,Antennaria,
Phylogeny of Chinese Asteraceae 431
www.jse.ac.cn J. Syst. Evol. 54 (4): 416–437, 2016

Gamochaeta (FLAG) clade (Fig. 2D), the monophyly of
Leontopodium (ca. 58 spp., 37 in China), hypothesized by
Bl€
och et al. (2010), was supported in our analysis. Safer et al.
(2011) identified 10 groups of Leontopodium, however, the
infrageneric relationships were not fully resolved. Their
(Anaphalis and Leontopodium) taxonomic status merits
further study. The sister relationship of Gnaphalium and
Vellereophyton was strongly supported in our analysis
(PP ¼1.00; BS ¼100; Fig. 2D), in accordance with the recent
analysis (Smissen et al., 2011). The monophyly of Xerochrysum
and Craspedia þRhodanthe was recovered with high support
(PP ¼0.99).
Tribe Astereae
With approximately 225 genera and 3100 species, the tribe
Astereae is the second largest tribe of Asteraceae. Twenty-
nine genera and 237 species are indigenous to China (112 spp.
endemic) (emend from Ling et al., 1985b). Due to the limited
value of the three cpDNA markers and samplings, support was
not sufficient to separate different genetic clusters within the
tribe (Figs. 1, 2E). However, we found that the enigmatic
Formania was deeply nested within the tribe Astereae. The
systematic position of monotypic and endemic genus
Formania has puzzled taxonomists for a long time. Our
analysis indicates that it should be a member of the tribe
Astereae (Chen & Brouillet, 2011) (Fig. 2E), not the tribe
Anthemideae as suggested by Shih & Fu (1983). Additionally,
based on cpDNA analysis, Thespis was also imbedded in
Astereae, as proposed from nrDNA data by Zhong et al. (2014).
Recently, Brouillet et al. (2009) hypothesized that Asian Aster
(ca. 152 species worldwide, with ca. 123 spp. distributed in
China) and allies were nested in the Australasian lineages
(Table 3). Li et al. (2012) showed that Aster was paraphyletic
and several allies (e.g., genera Kalimeris,Miyamayomena,
Turczaninowia, and Heteropappus) from Asia should be
merged with Aster. Furthermore, many well-recognized
species of Aster s.s. (e.g., some shrubby taxa such as Aster
ser. Albescentes,Aster ser. Hersileoides (sensu Ling et al.,
1985b), and some alpine taxa) were not closely related to the
Aster clade (including A. amellus L., the type species). A
thorough taxonomic revision of Aster and its allies combining
morphological and molecular analyses is warranted.
Tribe Anthemideae
Based on molecular phylogenetic analyses, Oberprieler et al.
(2007, 2009) proposed a classification consisting of 14
subtribes, ca. 110 genera, and 1750 species. They form the
fourth most species-rich group in Chinese Asteraceae
(including 7 subtribes, ca. 29 genera, 364 species, and 138
endemic spp.; Table 3). The Chinese genera were mainly found
in the Artemisiinae of the Asia–South African grade (Oberpri-
eler et al., 2009). Within Artemisiinae, a group composed of
Ajania,Chrysanthemum,Stilpnolepis, and Artemisia was
supported as monophyletic with moderate statistical support
in our analysis (PP ¼0.65; Fig. 2E). The results partly
corroborated the molecular studies of Zhao et al. (2010)
and Liu et al. (2012), which also suggested a close relationship
among Elachanthemum,Ajania, and Chrysanthemum.A
detailed examination and taxonomic treatment of these
genera are needed. The genus Artemisia includes approxi-
mately 180 species in China (ca. 400 in the world). However,
the interspecific relationships within the genus and among
subgenera were still in doubt (e.g., Watson et al., 2002; Sanz
et al., 2008; Pellicer et al., 2011). More sampling and taxonomic
work are necessary. The close relationships of Glebionis þ
Argyranthemum,Santolina þChamaemelum, and Leucanthe-
mum þMauranthemum were supported with strong boot-
strap values in the present result (PP >0.95; Fig. 2E), which
corroborated the study of Oberprieler et al. (2009).
Tribe Inuleae
The Inuleae includes two subtribes, with ca. 60 genera and
600 species worldwide. There are 2 subtribes, 14 genera, and
92 species indigenous to China (16 spp. endemic). The subtribe
Plucheinae was supported as a sister group to Inulinae
(PP ¼0.98; Fig. 2F), as in most previous studies (Anderberg,
2007, 2009; Englund et al., 2009; Nylinder & Anderberg, 2015).
Within Plucheinae, the Chinese Pseudoconyza was resolved as
sister to the rest of Sphaeranthus,Laggera,Pluchea,Karelinia,
and Epaltes with strong support (PP ¼0.98; BS ¼96; Fig. 2F).
Within Inulinae, the close relationship of Blumea þCaesulia
and polyphyletic Inula observed in this study (Fig. 2F) were
largely consistent with previous molecular analyses (e.g.,
Englund et al., 2009; Nylinder & Anderberg, 2015). The present
study (Fig. 2F) and a recent study (Li et al., 2014) both
identified Cyathocline purpurea (Buch.-Ham. ex D. Don) Kuntze
(former members of Astereae, sensu Ling et al., 1985b) as
congeneric with Blumea.
Tribe Athroismeae
The Athroismeae was a small tribe with ca. 7 genera and 60
species. They are poorly represented in China by three genera
(Anisopappus,Centipeda, and Symphyllocarpus) and three
species (no endemic spp.). Shih & Gilbert (2011) once
mentioned the difficulty in determining the position of the
Centipeda. Strong support was observed in the present
analysis for the close relationship of Centipeda,Anisopappus,
and Athroisma (Fig. 2F). The sister relationship between
Centipeda and Anisopappus þAthroisma þBlepharispermum
was also supported in an earlier nrITS study, as shown by
Wagstaff & Breitwieser (2002).
Heliantheae alliance
The Heliantheae alliance (recognized by Panero, 2007)
appears to be the most derived in the third subclade of
Asteroideae. A large putative monophyletic assemblage had
been identified, including 13 tribes, ca. 460 genera, and 5500
species. They were mostly distributed in the New World
(Baldwin et al., 2002; Panero & Funk, 2002; Panero, 2007;
Baldwin, 2009; Funk et al. 2009c), and poorly represented in
China with ca. 100 species from 7 tribes (Helenieae,
Coreopsideae, Neurolaeneae, Tageteae, Millieae, Eupator-
ieae, and Heliantheae; Fig. 2F, 2G) and 52 genera (39 genera
containing only introduced species, and 13 genera including
both introduced and indigenous species; see Table 3). Within
the Coreopsideae, the present study supported the polyphyly
of Bidens (Fig. 2F), which is consistent with the studies of Kim
et al. (1999), Kimball & Crawford (2004), and Crawford et al.
(2009) based on nrITS analyses. Within Eupatorieae, the close
relationship between Ageratum and Conoclinium was strongly
supported (our results and Robinson et al., 2009; Fig. 2G).
Within Heliantheae, the monophyly of Eleutheranthera þ
(Dimerostemma þEclipta) was recovered by our result (PP ¼
0.95; Fig. 2G). According to the data from J. L. Panero
432 Fu et al.
J. Syst. Evol. 54 (4): 416–437, 2016 www.jse.ac.cn

(released from NCBI), we recovered some clades including
some Chinese introduced genera (PP >0.94; Fig. 2G),
Synedrella þLasianthaea,Calyptocarpus þDamnxanthodium,
Sphagneticola þTilesia,Wollastonia þLipochae,Ratibida þ
Rudbeckia, and Spilanthes þAcmella.
Revised taxonomy of Chinese Asteraceae at the generic
level
Asteraceae are the largest angiosperm family in China in
terms of species number (Wang et al., 2015). In this study,
the molecular phylogeny largely resolved the relationships of
Chinese Asteraceae at the generic level, although 55 Chinese
genera remain to be sampled. It also provided a framework
for revising the recent classification of Asteraceae in Flora of
China (Shih et al., 2011). The following rearrangements on the
classification of Chinese Asteraceae were suggested: trans-
ferring the genera Leucomeris and Nouelia from the tribe
Mutisieae to the tribe Hyalideae (Wunderlichioideae);
Ainsliaea,Myripnois,andPertya from the tribe Mutisieae to
the tribe Pertyeae (Pertyoideae); Echinops from the tribe
Echinopeae and Atractylodes,Carlina,andTugarinovia from
the tribe Carlineae to the tribe Cardueae (Carduoideae);
Cavea from the genera incertae sedis to the tribe Gymnar-
rhenoideae (Gymnarrhenoideae), Centipeda from the genera
incertae sedis to the tribe Athroismeae (Asteroideae); and
Doronicum from the tribe Senecioneae to the tribe
Doroniceae (Asteroideae). Other systematic studies related
to Chinese Asteraceae (e.g., Liu, 2005; Anderberg et al.,
2007; Gao & Liu, 2007; Funk et al. 2009b; Bl€
och et al., 2010;
Fan et al. 2011; Liu & Yang, 2011; Zhang et al., 2011a; Wang
et al., 2013a, 2013b; Li et al., 2014; Yuan et al., 2015) and The
Phylogeny of Angiosperms (http://angio.bergianska.se/)
were also considered here. Finally, we herein proposed an
updated classification of Chinese Asteraceae at the generic
level to reflect the recent phylogenetic and taxonomic
changes (see Table 3, containing their placements in
subfamilies, tribes, subtribes, and groups). The updated
classification accounted for 7 subfamilies, 22 tribes, and 255
genera (48 introduced). A new classification of Chinese
Asteraceae based on broader sampling, more markers, and
detailed morphological and cytological evidence is still
needed in the near future.
Acknowledgements
This study was financially supported by grants from the
National Natural Science Foundation of China (Grant Nos.
31270237, 31570204, 31070167, 30670148, and J1310002), S & T
Basic Work (Grant Nos. 2013FY112100, 2014FY210300), the
National Key Basic Research Program of China (Grant No.
2014CB954100), the Chinese Academy of Sciences Interna-
tional Institution Development Program (Grant No.
SAJC201315), the Chinese Academy of Sciences External
Cooperation Program of BIC (Grant No. GJHZ201321), and
the Chinese Academy of Sciences Visiting Professorship for
Senior International Scientists (Grant No. 2011T1S24), awarded
to Prof. Zhi-Duan Chen et al. We would like to thank Drs. Jun
Wen, Zhi-Duan Chen, Wei Wang, and Cai-Fei Zhang for critical
and valuable comments on the improvement of our manu-
script, and Yan-Chao Bi and Yu Han for data collection.
References

Alvarez Fern
andez I, Fuertes Aquilar J, Panero JL, Nieto Feliner G.
2001. A phylogenetic analysis of Doronicum (Asteraceae, Sen-
ecioneae) based on morphological, nuclear ribosomal (ITS), and
chloroplast (trnL-F) evidence. Molecular Phylogenetics and
Evolution 20: 41–64.
Anderberg AA. 1991. Taxonomy and phylogeny of the tribe
Gnaphalieae (Asteraceae). Opera Botanica 104: 1–195.
Anderberg AA. 2007. Tribe Inuleae Cass. In: Kadereit JW, Jeffrey C eds.
The families and genera of vascular plants, Vol. 8, Flowering plants.
Eudicots. Asterales. Berlin: Springer. 374–391.
Anderberg AA. 2009. Inuleae. In: Funk VA, Susanna A, Stuessy T, Bayer
RJ eds. Systematics, evolution, and biogeography of Compositae.
Vienna: IAPT. 667–680.
Anderberg AA, Baldwin BG, Bayer RG, Breitwieser J, Jeffrey C, Dillon
MO, Elden€
as P, Funk VA, Garcia-Jacas N, Hind DJN, Karis PO, Lack
HW, Nesom G, Nordenstam B, Oberprieler C, Panero JL, Puttock C,
Robinson H, Stuessy TF, Susanna A, Urtubey E, Vogt R, Ward J,
Watson LE. 2007. Compositae. In: Kadereit JW, Jeffrey C eds. The
families and genera of vascular plants, Vol. 8, Flowering plants.
Eudicots. Asterales. Berlin: Springer. 61–588.
Anderberg AA, Ohlson JL. 2012. The genus Cavea, an addition to the
tribe Gymnarrheneae (Asteraceae–Gymnarrhenoideae). Compo-
sitae Newsletter 50: 46–55.
APG IV. 2016. An update of the Angiosperm Phylogeny Group
classification for the orders and families of flowering plants: APG
IV. Botanical Journal of the Linnean Society 181: 1–20.
Baird KE, Funk VA, Wen J, Weeks A. 2010. Molecular phylogenetic
analysis of Leibnitzia Cass. (Asteraceae: Mutisieae: Gerbera-
complex), an Asian–North American disjunct genus. Journal of
Systematics and Evolution 48: 161–174.
Baldwin BG. 2009. Heliantheae alliance In: Funk VA, Susanna A,
Stuessy T, Bayer RJ eds. Systematics, evolution, and biogeography
of Compositae. Vienna: IAPT. 689–711.
Baldwin BG, Wessa BL, Panero JL. 2002. Nuclear rDNA evidence for
major lineages of helenioid Heliantheae (Compositae). Systematic
Botany 27: 161–198.
Barres L, Sanmart

ın I, Anderson CL, Susanna A, Buerki S, Galbany-
Casals M, Vilatersana R. 2013. Reconstructing the evolution and
biogeographic history of tribe Cardueae (Compositae). American
Journal of Botany 100: 867–882.
Bayer MB, Breitweiser I, Ward J, Puttock CF. 2007. Tribe Gnaphalieae.
In: Kadereit JW, Jeffrey C eds. The families and genera of vascular
plants, Vol. 8, Flowering plants. Eudicots. Asterales. Berlin:
Springer. 246–283.
Bayer RJ, Starr JR. 1998. Tribal phylogeny of the Asteraceae based on
two non-coding chloroplast sequences, the trnL intron and trnL/
trnF intergenic spacer. Annals of the Missouri Botanical Garden 85:
242–256.
Bentham G. 1873. Compositae. In: Bentham G, Hooker JD eds. Genera
Plantarum Vol. 2 (1). London: Reeve. 163–533.
Bl€
och C, Dickor
e WB, Samuel R, Stuessy TF. 2010. Molecular phylogeny
of the edelweiss (Leontopodium, Asteraceae–Gnaphalieae).
Edinburgh Journal of Botany 67: 235–264.
Brouillet L, Lowrey TK, Urbatsch L, Karaman-Castro V, Sancho G,
Wagstaff S, Semple JC. 2009. Astereae. In: Funk VA, Susanna A,
Stuessy T, Bayer R eds. Systematics, evolution, and biogeography
of the Compositae. Vienna: IAPT. 449–490.
Cabrera A. 1977. Mutisieae—systematic review. In: Heywood VH,
Harborne JE, Turner B eds. The biology and chemistry of the
compositae, Vol. 2. London: Academic Press. 1039–1066.
Phylogeny of Chinese Asteraceae 433
www.jse.ac.cn J. Syst. Evol. 54 (4): 416–437, 2016

Chase MW, Soltis DE, Olmstead RG, Morgan D, Les DH, Mishler BD,
Duvall MR, Price RA, Hills HG, Qiu Y, Kron KA, Rettig JH, Conti E,
Palmer JD, Manhart JR, Sytsma KJ, Michaels HJ, Kress WJ, Karol
KG, Clark WD, Hedren M, Gaut BS, Jansen RK, Kim KJ, Wimpee CF,
Smith JF, Furnier GR, Strauss SH, Xiang Q, Plunkett GM, Soltis PS,
Swensen SM, Williams SE, Gadek PA, Quinn CJ, Eguiarte LE,
Golenberg E, Learn GH, Jr, Graham SW, Barrett SCH, Dayanandan
S, Albert VA. 1993. Phylogenetics of seed plants: An analysis of
nucleotide sequences from the plastid gene rbcL.Annals of the
Missouri Botanical Garden 80: 528–548, 550–580.
Chen YL. 1999. Senecioneae. In: Flora Reipublicae Popularis Sinica.
Beijing: Science Press. 77(1): 5–326.
Chen YL, Brouillet L. 2011. Formania. In: Wu ZY, Raven PH, Hong DY eds.
Flora of China. Beijing: Science Press; St. Louis: Missouri Botanical
Garden Press. 20–21: 569.
Chen ZD, Yang T, Lin L, Lu LM, Li HL, Sun M, Liu B, Chen M, Niu YT, Ye
JF, Cao ZY, Liu HM, Wang XM, Wang W, Zhang JB, Meng Z, Cao W,
Li JH, Wu SD, Zhao HL, Liu ZJ, Du ZY, Wang QF, Guo J, Tan XX, Su
JX, Zhang LJ, Yang LL, Liao YY, Li MH, Zhang GQ, Chung SW, Zhang
J, Xiang KL, Li RQ, Soltis DE, Soltis PS, Zhou SL, Ran JH, Wang XQ,
Jin XH, Chen YS, Gao TG, Li JH, Zhang SZ, Lu AM, China Phylogeny
Consortium. 2016. Tree of life for the genera of Chinese vascular
plants. Journal of Systematics and Evolution 54: 277–306.
Crawford DJ, Tadesse M, Mort ME, Kimball RT, Randle CP. 2009.
Coreopsideae. In: Funk VA, Susanna A, Stuessy T, Bayer RJ eds.
Systematics, evolution, and biogeography of Compositae. Vienna:
IAPT. 713–730.
Deng T, Zhang JW, Zhu XX, Zhang DG, Nie ZL, Sun H. 2014. Youngia
zhengyiana (Asteraceae, Crepidinae), a new species from south
China, with notes on the systematics of Youngia inferred from
morphology and nrITS phylogeny. Phytotaxa 170: 259–268.
Doyle JJ, Doyle JL. 1987. A rapid DNA isolation procedure for small
quantities of fresh leaf tissue. Phytochemical Bulletin 19: 11–15.
Englund M, Pornpongrungrueng P, Gustafsson M, Anderberg AA.
2009. Phylogenetic relationships and generic delimitation in
Inuleae subtribe Inulinae (Asteraceae) based on ITS and cpDNA
sequence data. Cladistics 25: 319–352.
Fay MF, Swensen SM, Chase MW. 1997. Taxonomic affinities of
Medusagyne oppositifolia (Medusagynaceae). Kew Bulletin 52: 111–120.
Fan XY, Zhang SM, Gao TG. 2011. Grindelia, a new naturalized genus of
the tribe Astereae, Asteraceae in China. Plant Diversity and
Resources 33: 171–173.
Funk VA, Anderberg AA, Baldwin BG, Bayer RJ, Bonifacino JM,
Breitwieser I, Brouillet L, Carbajal R, Chan R, Coutinho AXP,
Crawford DJ, Crisci JV, Dillon MO, Freire SE, Galbany-Casals M,
Garcia-Jacas N, Gemeinholzer B, Gruenstaeudl M, Hansen HV,
Himmelreich S, Kadereit JW, Kallersjo M, Karaman-Castro V, Karis
PO, Katinas L, Keeley SC, Kilian N, Kimball RT, LowreyTK, Lundberg
J, McKenzie RJ, Tadesse M, Mort ME, NordenstamB, Oberprieler C,
Ortiz S, Pelser PB, Randle CP, Robinson H, Roque N, Sancho G,
Semple JC, SerranoM, Stuessy TF, Susanna A, UnwinM, Urbatsch L,
Urtubey E, Valles J, Vogt R, Wagstaff S, Ward J, Watson LE. 2009a.
Compositae metatrees: The next generation. In: Funk VA, Susanna
A, Stuessy T, BayerRJ eds. Systematics, evolution,and biogeography
of Compositae. Vienna: IAPT. 747–777.
Funk VA, Bayer RJ, Keeley S, Chan R, Watson L, Gemeinholzer B,
Schilling EE, Panero JL, Baldwin BG, Garcia-Jacas NT, Susanna A,
Jansen RK. 2005. Everywhere but Antarctica: Using a supertree to
understand the diversity and distribution of the Compositae.
Biologiske Skrifter 55: 343–374.
Funk VA, Chan R. 2009. Introduction to Cichorioideae. In: Funk VA,
Susana A, Stuessy TF, Bayer RJ eds. Systematics, evolution, and
biogeography of Compositae. Vienna: IAPT. 335–342.
Funk VA, Chan R, Keeley SC. 2004. Insights into the evolution of the
tribe Arctoteae (Compositae: subfamily Cichorioideae s.s.) using
trnL-F, ndhF, and ITS. Taxon 53: 637–655.
Funk VA, Specht C. 2007. Meta-trees: Grafting for a global perspective.
Proceedings of the Biological Society of Washington 120: 232–240.
Funk VA, Susanna A, Stuessy T, Bayer RJ eds. 2009b. Systematics,
evolution, and biogeography of the Compositae. Vienna: IAPT.
Funk VA, Susanna A, Stuessy TF, Robinson H. 2009c. Classification of
Compositae. In: Funk VA, Susana A, Stuessy TF, Bayer RJ eds.
Systematics, evolution, and biogeography of Compositae. Vienna:
IAPT. 171–189.
Galbany-Casals M, Unwin M, Garcia-Jacas N, Smissen RD, Susanna A,
Bayer RJ. 2014. Phylogenetic relationships in Helichrysum
(Compositae: Gnaphalieae) and related genera: Incongruence
between nuclear and plastid phylogenies, biogeographic and
morphological patterns, and implications for generic delimitation.
Taxon 63: 608–624.
Gao TG, Freire SE, Hind DJN. 2011. Ainsliaea, Pertya and Myripnois. In:
Wu ZY, Raven PH, Hong DY eds. Flora of China. Beijing: Science
Press; St. Louis: Missouri Botanical Garden Press. 20–21: 15–32.
Gao TG, Hind DJN. 2011. Nouelia, Leucomeris. In: Wu ZY, Raven PH,
Hong DY eds. Flora of China. Beijing: Science Press; St. Louis:
Missouri Botanical Garden Press. 20–21: 10.
Gao TG, Liu Y. 2007. Gymnocoronis, a new naturalized genus of the
tribe Eupatorieae, Asteraceae in China. Acta Phytotaxonomica
Sinica 45: 329–332.
Gao TG, Zhang GJ. 2016. Species Catalogue of China. Volume I:
Spermatophytes X. Beijing: Science Press. (in press)
Garcia-Jacas N, Garnatje T, Susanna A, Vilatersama R. 2002. Tribal and
subtribal delimitation and phylogeny of the Cardueae (Aster-
aceae): A combined nuclear and chloroplast DNA analysis.
Molecular Phylogenetics and Evolution 22: 51–64.
Goertzen LR, Cannone JJ, Gutell RR, Jansen RK. 2003. ITS secondary
structure derived from comparative analysis: Implications for
sequence alignment and phylogeny of Asteraceae. Molecular
Phylogenetics and Evolution 29: 216–234.
Golden JL, Kim YD, Bain JF. 2001. A re-evaluation of North American
Tephroseris and Sinosenecio (Asteraceae: Senecioneae) based on
molecular and micromorphological data. Canadian Journal of
Botany 79: 1195–1201.
Hall TA. 1999. BioEdit: A user-friendly biological sequence alignment
editor and analysis program for Windows 95/98/NT. Nucleic Acids
Symposium Series 41: 95–98.
Hind DJN. 2007. Mutisieae. In: Kadereirt J, Jeffrey C eds. The families
and genera of vascular plants, Vol. 8. Berlin and Heidelberg:
Springer. 90–123.
Jansen RK, Palmer JD. 1987. A chloroplast DNA inversion marks an
ancient evolutionary split in the sunflower family (Asteraceae).
Proceedingsof the National Academy of Sciences USA 84: 5818–5822.
Jeffrey C, Chen YL. 1984. Taxonomic studies on the tribe Senecioneae
(Compositae) of Eastern Asia. Kew Bulletin 39: 205–446.
Johnson LA, Soltis DE. 1994. matK DNA sequences and phylogenetic
reconstruction in Saxifragaceae s. str. Systematic Botany 19:
143–156.
Katinas L, Pruski J, Sancho G, Teller

ıa MC. 2008. The subfamily
Mutisioideae (Asteraceae). Botanical Review 74: 469–716.
Katoh K, Standley DM. 2013. MAFFT multiple sequence alignment
software version 7: Improvements in performance and usability.
Molecular Biology and Evolution 30: 772–780.
Kato HK, Oginuma Z, Gu B, Tobe H. 1998. Phylogenetic relationships of
Betulaceae based on matK sequences with particular reference to
434 Fu et al.
J. Syst. Evol. 54 (4): 416–437, 2016 www.jse.ac.cn

the positions of Ostryopsis.Acta Phytotaxonomica et Geobotanica
49: 89–97.
Keeley SC, Forsman ZH, Chan R. 2007. A phylogeny of the “evil tribe”
(Vernonieae: Compositae) reveals Old/New World long distance
dispersal: Support from separate and combined congruent
datasets (trnL-F,ndhF, ITS). Molecular Phylogenetics and Evolution
44: 89–103.
Kilian N, Gemeinholzer B, Lack HW. 2009. Cichorieae. In: Funk VA,
Susanna A, Stuessy T, Bayer RJ eds. Systematics, evolution, and
biogeography of the Compositae. Vienna: IAPT. 343–383.
Kim HG, Loockerman DJ, Jansen RK. 2002. Systematic implications of
ndhF sequence variation in the Mutisieae (Asteraceae). System-
atic Botany 27: 598–609.
Kim KJ, Jansen RK. 1995. ndhF sequence evolution and the major
clades in the sunflower family. Proceedings of the National
Academy of Sciences USA 92: 10379–10383.
Kim KJ, Jansen RK, Wallace RS, Michaels HJ, Palmer JD. 1992.
Phylogenetic implications of rbcL sequence variation in the
Asteraceae. Annals of the Missouri Botanical Garden 79: 428–445.
Kim SC, Crawford DJ, Tadesse M, Berbee M, Ganders FR, Pirseyedi M,
Esselman EJ. 1999. ITS sequences and phylogenetic relationships
in Bidens and Coreopsis (Asteraceae). Systematic Botany 24:
480–493.
Kimball RT, Crawford DJ. 2004. Phylogeny of Coreopsideae (Aster-
aceae) using ITS sequences suggests lability in reproductive
characters. Molecular Phylogenetics and Evolution 33: 127–139.
Kita Y, Fujikawa K, Ito M, Ohba H, Kato M. 2004. Molecular
phylogenetic analyses and systematics of the genus Saussurea
and related genera (Asteraceae, Cardueae). Taxon 53: 679–690.
Li WP, Qian FM, Yang XL, Chen SM. 2014. Systematic position of
Cyathocline Cass. (Asteraceae): Evidences from molecular,
cytological and morphological data. Plant Systematics and
Evolution 300: 595–606.
Li WP, Yang FS, Jivkova T, Yin GS. 2012. Phylogenetic relationships and
generic delimitation of Eurasian Aster (Asteraceae: Astereae)
inferred from ITS, ETS and trnL-F sequence data. Annals of Botany
109: 1341–1357.
Ling Y, Chen YL, Shih C. 1985a. Compositae. Flora Reipublicae Popularis
Sinicae, Beijing: Science Press 74: 1–2.
Ling Y, Chen YL, Shih C. 1985b. Astereae. Flora Reipublicae Popularis
Sinicae, Beijing: Science Press 74: 70–353.
Liu JQ, Gao TG, Chen ZD, Lu AM. 2002. Molecular phylogeny and
biogeography of the Qinghai–Tibet Plateau endemic Nannoglottis
(Asteraceae). Molecular Phylogenetics and Evolution 23: 307–325.
Liu JQ, Wang Y, Wang AL, Hideaki O, Abbott RJ. 2006. Radiation and
diversification within the Ligularia–Cremanthodium–Parasenecio
complex (Asteraceae) triggered by uplift of the Qinghai–Tibetan
Plateau. Molecular Phylogenetics and Evolution 38: 31–49.
Liu PL, Wan Q, Guo YP, Yang J, Rao GY. 2012. Phylogeny of the genus
Chrysanthemum L.: Evidence from single-copy nuclear gene and
chloroplast DNA sequences. Plos One 7(11): e48970.
Liu QR. 2005. Flaveria Juss. (Compositae), a newly naturalized genus in
China. Acta Phytotaxonomica Sinica 43: 178–180.
Liu Y, Chen YS, Yang QE. 2013. Generic status, circumscription, and
allopolyploid origin of Faberia (Asteraceae: Cichorieae) as
revealed by ITS and chloroplast DNA sequence data. Taxon 62:
1235–1247.
Liu Y, Yang QE. 2011. Hainanecio, a new genus of the Senecioneae,
Asteraceae from China. Botanical Studies 52: 115–120.
L
opez-Vinyallonga S, Mehregan I, Garcia-Jacas N, Tscherneva O,
Susanna A, Kadereit JW. 2009. Phylogeny and evolution of the
Arctium–Cousinia complex (Compositae, Cardueae–Carduinae).
Taxon 58: 153–171.
Lundberg J. 2009. Asteraceae and relationships within Asterales. In:
Funk VA, Susana A, Stuessy TF, Bayer RJ eds. Systematics,
evolution, and biogeography of Compositae. Vienna: IAPT. 157–169.
Mandel JR, Dikow RB, Funk VA. 2015. Using phylogenomics to resolve
mega-families: An example from Compositae. Journal of System-
atics and Evolution 53: 391–402.
Miller MA, Pfeiffer W, Schwartz T. 2010. Creating the CIPRES science
gateway for inference of large phylogenetic trees. In: Gateway
Computing Environments Workshop (GCE 2010). Proceedings of a
meeting held New Orleans, LA, 14 November, 2010. New York:
IEEE. 1–8.
Mitsui Y, Chen ST, Peng CI, Deng YF, Setoguchi H. 2008. Phylogeny and
biogeography of the genus Ainsliaea (Asteraceae) in the Sino-
Japanese region based on nuclear rDNA and plastid DNA
sequence data. Annals of Botany 101: 111–124.
Nie ZL, Funk VA, Meng Y, Deng T, Sun H, Wen J. 2015. Recent assembly
of the global herbaceous flora: Evidence from the paper daisies
(Asteraceae: Gnaphalieae). New Phytologist 209: 1795–1806.
Nie ZL, Funk VA, Sun H, Deng T, Meng Y, Wen J. 2013. Molecular
phylogeny of Anaphalis (Asteraceae, Gnaphalieae) with biogeo-
graphic implications in the Northern Hemisphere. Journal of Plant
Research 126: 17–32.
Nordenstam B, Kallersjo M. 2009. Calenduleae. In: Funk VA, Susanna
A, Stuessy T, Bayer RJ eds. Systematics, evolution, and
biogeography of Compositae. Vienna: IAPT. 527–538.
Nordenstam B, Pelser PB, Kadereit JW, Watson LE. 2009. Senecioneae.
In: Funk VA, Susanna A, Stuessy T, Bayer RJ eds. Systematics,
evolution, and biogeography of Compositae. Vienna: IAPT. 503–525.
Nylinder S, Anderberg AA. 2015. Phylogeny of the Inuleae (Aster-
aceae) with special emphasis on the Inuleae–Plucheinae. Taxon
64: 110–130.
Oberprieler C, Himmelreich S, Kallersjo M, Valles J, Watson LE, Vogt R.
2009. Anthemideae. In: Funk VA, Susanna A, Stuessy T, Bayer RJ
eds. Systematics, evolution, and biogeography of Compositae.
Vienna: IAPT. 631–666.
Oberprieler C, Himmelreich S, Vogt R. 2007. New subtribal classifica-
tion of the tribe Anthemideae (Compositae). Willdenowia 37:
89–114.
Olmstead RG, Palmer JD. 1994. Chloroplast DNA systematics: A review
of methods and data analysis. American Journal of Botany 81:
1205–1224.
Olmstead RG, Sweere JA. 1994. Combining data in phylogenetic
systematics: An empirical approach using three molecular data
sets in the Solanaceae. Systematic Biology 43: 467–481.
Ortiz S, Carbajal R, Serrano M, Rodr

ıguez-Oubi~
na J, Iglesias I. 2013.
Phylogeny of the African Mutisieae s.l. (Asteraceae) based on
ndhF and trnL-F sequences (cpDNA). Taxon 62: 525–536.
Panero JL. 2005. New combinations and infrafamilial taxa in the
Asteraceae. Phytologia 87: 1–14.
Panero JL. 2007. Key to the tribes of the Heliantheae alliance. In:
Kadereit JW, Jeffrey C eds. The families and genera of vascular
plants, Vol. 8, Flowering plants. Eudicots. Asterales. Berlin:
Springer. 391–395.
Panero JL, Funk VA. 2002. Toward a phylogenetic subfamilial
classification for the Compositae (Asteraceae). Proceedings of
the Biological Society of Washington 115: 909–922.
Panero JL, Funk VA. 2008. The value of sampling anomalous taxa in
phylogenetic studies: Major clades of the Asteraceae revealed.
Molecular Phylogenetics and Evolution 47: 757–782.
Phylogeny of Chinese Asteraceae 435
www.jse.ac.cn J. Syst. Evol. 54 (4): 416–437, 2016

Panero JL, Susana EF, Espinar LA, Crozier BS, Barboza GE, Cantero
JJ. 2014. Resolution of deep nodes yields an improved
backbone phylogeny and a new basal lineage to study early
evolution of Asteraceae. Molecular Phylogenetics and Evolution
80: 43–53.
Pellicer J, Vall
es J, Korobkov AA, Garnatje T. 2011. Phylogenetic
relationships of Artemisia subg. Dracunculus (Asteraceae) based
on ribosomal and chloroplast DNA sequences. Taxon 60: 691–704.
Pelser PB, Kennedy AH, Tepe EJ, Shidler JB, Nordenstam B, Kadereit
JW, Watson LE. 2010. Patterns and causes of incongruence
between plastid and nuclear senecioneae (Asteraceae) phyloge-
nies. American Journal of Botany 97: 856–873.
Pelser PB, Nordenstam B, Kadereit JW, Watson LE. 2007. An ITS
phylogeny of tribe Senecioneae (Asteraceae) and a new
delimitation of Senecio L. Taxon 56: 1077–1104.
Peng YL, Zhang Y, Gao XF, Tong LJ, Li L, Li RY, Zhu ZM, Xian JR. 2014.
A phylogenetic analysis and new delimitation of Crepidiastrum
(Asteraceae, tribe Cichorieae). Phytotaxa 159: 241–255.
Posada D, Crandall KA. 1998. Modeltest: Testing the model of DNA
substitution. Bioinformatics 14: 817–818.
Raab-Straube EV. 2003. Phylogenetic relationships in Saussurea
(Compositae, Cardueae) sensu lato, inferred from morphological,
ITS and trnL-trnF sequence data, with a synopsis of Himalaiella
gen. nov., Lipschitziella and Frolovia.Willdenowia 33: 379–402.
Rambaut A. 2012. FigTree v 1.4.0. [online]. Available from tree.bio.ed.
ac.uk/Software/figtree [accessed 16 April 2016].
Robinson H, Schilling E, Panero JL. 2009. Eupatorieae. In: Funk VA,
Susanna A, Stuessy T, Bayer RJ eds. Systematics, evolution, and
biogeography of Compositae. Vienna: IAPT. 731–744.
Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Hohna S,
Larget B, Liu L, Suchard MA, Huelsenbeck JP. 2012. MrBayes 3.2:
Efficient Bayesian phylogenetic inference and model choice
across a large model space. Systematic Biology 61: 539–542.
Safer S, Tremetsberger K, Guo YP, Kohl G, Samuel MR, Stuessy TF,
Stuppner H. 2011. Phylogenetic relationships in the genus
Leontopodium (Asteraceae: Gnaphalieae) based on AFLP data.
Botanical Journal of the Linnean Society 165: 364–377.
Sanz M, Vilatersana R, Hidalgo O, Garcia-Jacas N, Susanna A,
Schneeweiss GM, Vall
es J. 2008. Molecular phylogeny and
evolution of floral characters of Artemisia and allies (Anthemi-
deae, Asteraceae): Evidence from nrDNA ETS and ITS sequences.
Taxon 57: 66–78.
Shih C, Chen YL, Chen YS, Lin YR, Liu SW, Ge XJ, Gao TG, Zhu SX, Liu Y,
Yang QE, Humphries CJ, Raab-Straube EV, Gilbert MG, Norden-
stam B, Kilian N, Brouillet L, Illarionova ID, Hind DJN, Jeffrey C,
Bayer RJ, Kirschner J, Greuter W, Anderberg AA, Semple JC,
St
ep
anek J, Freire SE, Martins L, Koyama H, Kawahara T, Vincent
L, Sukhorukov AP, Mavrodiev EV, Gottschlich G. 2011. Asteraceae
(Compositae). In: Wu ZY, Raven PH, Hong DY eds. Flora of China.
Beijing: Science Press; St. Louis: Missouri Botanical Garden Press.
20–21: 1–894.
Shih C, Fu GX. 1983. Formania. In: Flora Reipublicae Popularis Sinica.
Beijing: Science Press. 76(1): 81.
Shih C, Gilbert MG. 2011. Centipeda. In: Wu ZY, Raven PH, Hong DY eds.
Flora of China. Beijing: Science Press; St. Louis: Missouri Botanical
Garden Press. 20–21: 892–893.
Smissen RD, Galbany-Casals M, Breitwieser I. 2011. Ancient allopoly-
ploidy in the everlasting daisies (Asteraceae: Gnaphalieae):
Complex relationships among extant clades. Taxon 60: 649–662.
Smith SA, Beaulieu JM, Donoghue MJ. 2009. Mega-phylogeny
approach for comparative biology: An alternative to supertree
and supermatrix approaches. BMC Evolutionary Biology 9: 37.
Stamatakis A, Hoover P, Rougemont J. 2008. A rapid bootstrap
algorithm for the RAxML Web servers. Systematic Biology 57:
758–771.
Susanna A, Garcia-Jacas N. 2007. Tribe Cardueae Cass. In: Kadereit JW,
Jeffrey C eds. The families and genera of vascular plants, Vol. 8,
Flowering plants.Eudicots. Asterales. Berlin: Springer. 123–146.
Susanna A, Garcia-Jacas N. 2009. Cardueae. In: Funk VA, Susanna A,
Stuessy T, Bayer RJ eds. Systematics, evolution, and biogeography
of Compositae. Vienna: IAPT. 293–313.
Susanna A, Garcia-Jacas N, Hidalgo O, Vilatersana R, Garnatje T. 2006.
The Cardueae (Compositae) revisited: Insights from ITS, trnL-trnF,
and matK nuclear and chloroplast DNA analysis. Annals of the
Missouri Botanical Garden 93: 150–171.
ToricesR. 2010. Adding time-calibrated branchlengths to the Asteraceae
supertree. Journal of Systematics and Evolution 48: 271–278.
Wagstaff SJ, Breitwieser I. 2002. Phylogenetic relationships of New
Zealand Asteraceae inferred from ITS sequences. Plant Systemat-
ics and Evolution 231: 203–224.
Wang GY, Meng Y, Deng T, Yang YP. 2014. Molecular phylogeny of
Faberia (Asteraceae: Cichorieae) based on nuclear and chloroplast
sequences. Phytotaxa 167: 223–234.
Wang LS, Jia Y, Zhang XC, Qin HN. 2015. Overview of higher plant
diversity in China. Biodiversity Science 23: 217–224.
Wang LY, Pelser PB, Nordenstam B, Liu JQ. 2009a. Strong
incongruence between the ITS phylogeny and generic delimita-
tion in the Nemosenecio–Sinosenecio–Tephroseris assemblage
(Asteraceae: Senecioneae). Botanical Studies 50: 435–442.
Wang YJ, Liu JQ. 2004. Phylogenetic analyses of Saussurea sect.
Pseudoeriocoryne (Asteraceae: Cardueae) based on chloroplast
DNA trnL-F sequences. Biochemical Systematics and Ecology 32:
1009–1023.
Wang YJ, Liu JQ, Miehe G. 2007. Phylogenetic origins of the Himalayan
endemic Dolomiaea,Diplazoptilon and Xanthopappus (Asteraceae:
Cardueae) based on three DNA fragments. Annals of Botany 99:
311–322.
Wang YJ, Raab-Straube EV, Susanna A, Liu JQ. 2013a. Shangwua
(Compositae), a new genus from the Qinghai–Tibetan Plateau and
Himalayas. Taxon 62: 984–996.
Wang YJ, Susanna A, Raab-Straube EV, Milne R, Liu JQ. 2009b. Island-
like radiation of Saussurea (Asteraceae: Cardueae) triggered by
uplifts of the Qinghai–Tibetan Plateau. Biological Journal of the
Linnean Society 97: 893–903.
Wang ZH, Peng H, Kilian N. 2013b. Molecular phylogeny of the Lactuca
alliance (Cichorieae Subtribe Lactucinae, Asteraceae) with focus
on their Chinese centre of diversity detects potential events of
reticulation and chloroplast capture. Plos One 8(12): e82692.
Ward J, Bayer R, Breitwieser I, Smissen R, Galbany M, Unwin M. 2009.
Gnaphalieae. In: Funk VA, Susanna A, Stuessy T, Bayer RJ eds.
Systematics, evolution, and biogeography of Compositae. Vienna:
IAPT. 539–588.
Watson LE, Bates PL, Evans TM, Unwin MM, Estes JR. 2002.
Molecular phylogeny of subtribe Artemisiinae (Asteraceae),
including Artemisia and its segregate genera. BMC Evolutionary
Biology 2: 17.
Wen J, Ickert-Bond, SM, Nie ZL, Li R. 2010. Timing and modes of
evolution of eastern Asian–North American biogeographic dis-
junctions in seed plants. In: Long M, Gu H, Zhou Z eds. Darwin’s
heritage today: Proceedings of the Darwin 200 Beijing International
Conference. Beijing: Higher Education Press. 252–269.
Winkworth RC, Lundberg J, Donoghue MJ. 2008. Toward a resolution
of Campanulid phylogeny, with special reference to the
placement of Dipascales. Taxon 57: 53–65.
436 Fu et al.
J. Syst. Evol. 54 (4): 416–437, 2016 www.jse.ac.cn

Yuan Q, Bi YC, Chen YS. 2015. Diplazoptilon (Asteraceae) is merged
with Saussurea based on evidence from morphology and
molecular systematics. Phytotaxa 236: 53–61.
Zhang JW, Boufford DE, Sun H. 2011a. Parasyncalathium JW
Zhang, Boufford, H. Sun (Asteraceae, Cichorieae): A new genus
endemic to the Himalaya–Hengduan Mountains. Taxon 60:
1678–1684.
Zhang JW, Nie ZL, Wen J, Sun H. 2011b. Molecular phylogeny and
biogeography of three closely related genera, Soroseris,
Stebbinsia,andSyncalathium (Asteraceae, Cichorieae), endemic
to the Tibetan Plateau, SW China. Taxon 60: 15–26.
Zhao HB, Chen FD, Chen SM, Wu GS, Guo WM. 2010. Molecular
phylogeny of Chrysanthemum,Ajania and its allies (Anthemideae,
Asteraceae) as inferred from nuclear ribosomal ITS and chloro-
plast trnL-F IGS sequences. Plant Systematics and Evolution 284:
153–169.
Zhong CX, Li WP, Yang XL, Tang M, Liao W, Chen SM. 2014. Molecular
phylogeny of Chinese Conyza,Microglossa and Thespis (Aster-
aceae: Astereae) based on two nuclear ribosomal DANN regions.
Plant Science Journal 32: 216–227.
Appendix
Members of the China Phylogeny Consortium
Zhi-Duan CHEN, An-Ming LU, Hong-Zhi KONG, Xiao-Quan
WANG, Yin-Zheng WANG, Shi-Liang ZHOU
Institute of Botany, Chinese Academy of Sciences, Beijing,
China
Shou-Zhou ZHANG, Xiao-Ming WANG
Fairylake Botanical Garden, Shenzhen, China
Zhong-Jian LIU
The Orchid Conservation and Research Center of Shenzhen,
Shenzhen, China
Qing-Feng WANG
Wuhan Botanical Garden, Chinese Academy of Sciences,
Wuhan, China
Jian-Hui LI
Computer Network Information Center, Chinese Academy of
Sciences, Beijing, China
De-Zhu LI, Ting-Shuang YI
Kunming Institute of Botany, Chinese Academy of Sciences,
Kunming, China
Hong MA
Fudan University, Shanghai, China
Douglas E. SOLTIS, Pamela S. SOLTIS
University of Florida, Gainesville, USA
Jian-Hua LI
Hope College, Holland, USA
Cheng-Xin FU
Zhejiang University, Hangzhou, China
Qi-Xin LIU
Nanjing Institute of Botany, Jiangsu Province and Chinese
Academy of Sciences, Nanjing, China
Supplementary Material
The following supplementary material is available online
for this article at http://onlinelibrary.wiley.com/doi/10.1111/
jse.12216/suppinfo
Table S1. Taxa and GenBank accession numbers for DNA
sequences used in this study.
Phylogeny of Chinese Asteraceae 437
www.jse.ac.cn J. Syst. Evol. 54 (4): 416–437, 2016