Available via license: CC BY 4.0
Content may be subject to copyright.
RESEARCH ARTICLE
CYP1B1 Enhances Cell Proliferation and
Metastasis through Induction of EMT and
Activation of Wnt/β-Catenin Signaling via
Sp1 Upregulation
Yeo-Jung Kwon
1
, Hyoung-Seok Baek
1
, Dong-Jin Ye
1
, Sangyun Shin
1
, Donghak Kim
2
,
Young-Jin Chun
1
*
1College of Pharmacy, Chung-Ang University, Seoul, Korea, 2Department of Biological Sciences, Konkuk
University, Seoul, Korea
*yjchun@cau.ac.kr
Abstract
Cytochrome P450 1B1 (CYP1B1) is a major E
2
hydroxylase involved in the metabolism of
potential carcinogens. CYP1B1 expression has been reported to be higher in tumors com-
pared to normal tissues, especially in hormone-related cancers including breast, ovary, and
prostate tumors. To explore the role of CYP1B1 in cancer progression, we investigated the
action of CYP1B1 in cells with increased CYP1B1 via the inducer 7,12-dimethylbenz[α]
anthracene (DMBA) or an overexpression vector, in addition to decreased CYP1B1 via the
inhibitor tetramethoxystilbene (TMS) or siRNA knockdown. We observed that CYP1B1 pro-
moted cell proliferation, migration, and invasion in MCF-7 and MCF-10A cells. To under-
stand its molecular mechanism, we measured key oncogenic proteins including β-catenin,
c-Myc, ZEB2, and matrix metalloproteinases following CYP1B1 modulation. CYP1B1
induced epithelial-mesenchymal transition (EMT) and activated Wnt/β-catenin signaling via
upregulation of CTNNB1,ZEB2,SNAI1, and TWIST1. Sp1, a transcription factor involved in
cell growth and metastasis, was positively regulated by CYP1B1, and suppression of Sp1
expression by siRNA or DNA binding activity using mithramycin A blocked oncogenic trans-
formation by CYP1B1. Therefore, we suggest that Sp1 acts as a key mediator for CYP1B1
action. Treatment with 4-hydroxyestradiol (4-OHE
2
), a major metabolite generated by
CYP1B1, showed similar effects as CYP1B1 overexpression, indicating that CYP1B1 activ-
ity mediated various oncogenic events in cells. In conclusion, our data suggests that
CYP1B1 promotes cell proliferation and metastasis by inducing EMT and Wnt/β-catenin sig-
naling via Sp1 induction.
Introduction
Cytochrome P450 1B1 (CYP1B1) belongs to the CYP1 family and shares enzymatic activities
with two other CYP1 family members, CYP1A1 and CYP1A2 [1]. It primarily acts as a
PLOS ONE | DOI:10.1371/journal.pone.0151598 March 16, 2016 1/21
OPEN ACCESS
Citation: Kwon Y-J, Baek H-S, Ye D-J, Shin S, Kim
D, Chun Y-J (2016) CYP1B1 Enhances Cell
Proliferation and Metastasis through Induction of
EMT and Activation of Wnt/β-Catenin Signaling via
Sp1 Upregulation. PLoS ONE 11(3): e0151598.
doi:10.1371/journal.pone.0151598
Editor: Masaru Katoh, National Cancer Center,
JAPAN
Received: September 5, 2015
Accepted: March 1, 2016
Published: March 16, 2016
Copyright: © 2016 Kwon et al. This is an open
access article distributed under the terms of the
Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any
medium, provided the original author and source are
credited.
Data Availability Statement: All relevant data are
within the paper and its Supporting Information files.
Funding: This research was supported by the Basic
Science Research Program (NRF-
2012R1A1A2041536 and NRF-2015R1A5A1008958)
through the National Research Foundation of Korea
funded by the Korean government to YJC (http://
www.nrf.re.kr/). The funders had no role in study
design, data collection and analysis, decision to
publish, or preparation of the manuscript.
hydroxylase for 17β-estradiol at positions C2 and C4, and the products from these enzymatic
reactions participate in metabolic processes that generate quinone metabolites involved in the
production of carcinogenic DNA adducts [2–4].
CYP1B1 is normally expressed in most tissues. However, its expression is elevated in tumors
compared to normal tissues [5–8], especially in hormone-related cancers including breast,
ovary, and prostate tumors [9–11] and the pre-disposing potential of CYP1B1 for various can-
cers also has been widely reported [12–14]. Recently, it has been suggested that CYP1B1
enhances cell proliferation by inducing cell cycle transition and inhibiting cellular apoptosis in
endometrial and breast cancer cells [15,16]. Moreover, CYP1B1 polymorphisms have been
implicated as risk factors in various cancers, and CYP1B1-mediated carcinogenesis may
depend on CYP1B1 enzymatic activity [17–19]. Taken together, these findings suggest that
CYP1B1 might be a driver in cancer progression and, therefore, represent a significant cancer
biomarker and potential target for anticancer therapy. However, a detailed molecular mecha-
nism describing CYP1B1-mediated oncogenesis remains unknown.
β-catenin plays an important role as a key mediator in the Wnt/β-catenin signaling path-
way. Following activation by Wnt ligand-receptor binding, β-catenin escapes proteosomal deg-
radation and translocates into the nucleus, where it binds its target genes and promotes
multiple pathways involved in carcinogenesis [20,21].
Several studies have suggested that Wnt/β-catenin signaling may be related to epithelial-
mesenchymal transition (EMT) because they both require β-catenin. In normal tissues, cells
establish tight junctions using cell membrane glycoproteins like E-cadherin [22,23]. Adjacent
epithelial-like cells bind to one another via cell-surface E-cadherins, which are linked to the
actin cytoskeleton or cytoplasmic cell signaling components including α-, γ-, and β-catenin
[24]. During carcinogenesis, E-cadherin repressors including SNAIL, ZEB1/2, and TWIST are
upregulated, which causes the loss of E-cadherin and subsequent induction of EMT [25,26].
Following E-cadherin suppression, β-catenin is released from E-cadherin-catenin-actin com-
plexes and accumulates in the cytosol and nucleus, which allows it to act independently or
synergistically with the Wnt/β-catenin signaling pathway [27–29]. Therefore, EMT and Wnt/
β-catenin signaling may act synergistically during carcinogenesis.
In the present study, we explored the role of CYP1B1 in carcinogenesis and cancer progres-
sion including the molecular mechanism that drives CYP1B1-mediated oncogenesis. To do so,
we measured multiple hallmarks of cancer progression including cell proliferation, invasion,
and migration following CYP1B1 induction or inhibition. We further investigated the key fac-
tors driving cell proliferation and invasion following CYP1B1 modulation and found several
target proteins that are related to EMT and Wnt/β-catenin signaling. To the best of our knowl-
edge, these findings establish the molecular mechanisms driving CYP1B1-mediated oncogene-
sis for the first time.
Materials and Methods
Reagents
7,12-Dimethylbenz[α]anthracene (DMBA), mitomycin C, mithramycin A, 4-hydroxyestradiol,
2-hydroxyestradiol, and charcoal-stripped FBS were purchased from Sigma (St. Louis, MO,
USA). 2,20,4,60-Tetramethoxystilbene (TMS) was kindly provided by Dr. Sanghee Kim (Seoul
National University, Seoul, Korea). Rabbit polyclonal antibody for E-cadherin was purchased
from Millipore (Bedford, MA, USA). M-MLV reverse transcriptase and RNase inhibitor were
purchased from Promega (Madison, WI, USA). Ex Taq Polymerase was obtained from TaKaRa
Bio (Shiga, Japan). SYBR green was purchased from QIAGEN (Hilden, Germany). Rabbit poly-
clonal antibodies for CYP1B1, Sp1, β-catenin, E-cadherin, cyclin D1, vimentin, SNAI1, and
CYP1B1 Induces EMT and Wnt/β-Cat Signaling via Sp1
PLOS ONE | DOI:10.1371/journal.pone.0151598 March 16, 2016 2/21
Competing Interests: The authors have declared
that no competing interests exist.
Abbreviations: CYP1B1, Cytochrome P450 1B1;
DMBA, 7,12-dimethylbenz[α]anthracene; TMS,
Tetramethoxystilbene; EMT, Epithelial-mesenchymal
transition; OHE
2
, hydroxyestradio; CTNNB1, β-
catenin (gene; DAPI, 40,6-diamidino-2-phenylindole;
Sp1, Specificity protein 1; ZEB, Zinc finger E-
box binding homeobox; MMP, Matrix
metalloproteinase; GAPDH, Glyceraldehyde 3-
phosphate dehydrogenase; Hsp, Heat shock protein;
PMSF, Phenylmethanesulfonylfluoride; BCA,
Bicinchoninic acid; SDS-PAGE, Sodium dodecyl
sulfate-polyacrylamide gel electrophoresis; PVDF,
Polyvinylidene fluoride; PBS, Phosphate buffered
saline; PCNA, Proliferating Cell Nuclear Antigen; α-
SMA, α-Smooth Muscle Actin; CDH1, E-cadherin
(gene); miR, microRNA; HDAC, Histone deacetylase;
PAF, PCNA-associated facto.
GAPDH; mouse monoclonal antibody for ZEB2 and c-Myc; Texas Red-conjugated goat anti-
rabbit IgG; and UltraCruz
TM
Mounting Medium were purchased from Santa Cruz Biotechnol-
ogy (Santa Cruz, CA, USA). HRP-conjugated goat anti-rabbit IgG and DyLight
1
594-conju-
gated goat anti-mouse were obtained from Bethyl (Montgomery, TX, USA) and mouse
monoclonal antibody for PCNA was purchased from Cell Signaling Technology (Beverly, MA,
USA). Other chemicals and reagents were of the highest quality commercially available.
Cell culture
MCF-7, MDA-MB-231, and HeLa cells were obtained from the Korean Society Cell Bank
(KCLB), and MCF-10A cells were kindly provided by Dr. Aree Moon (Duksung Women’s Uni-
versity, Seoul, Korea). Authentication of cells has been performed by KCLB based on DNA fin-
gerprinting analysis using short tandem repeat analysis. MCF-7 and MDA-MB-231 cells were
cultured in RPMI medium supplemented with 10% (v/v) heat-inactivated FBS, 100 U/ml peni-
cillin, and 100 μg/ml streptomycin. HeLa cells were cultured in MEM medium supplemented
with 10% (v/v) heat-inactivated FBS, 100 U/ml penicillin, and 100 μg/ml streptomycin. MCF-
10A cells were cultured in monolayer as described previously [30]. For treatment of MCF-7
cells with 4-OHE
2
or 2-OHE
2,
1×10
6
cells were seeded in growth media as a monolayer onto
100-mm dish plates and maintained at 37°C in a humidified atmosphere with 5% CO
2.
After
24 h, the media was changed to phenol red-free RPMI (Thermo Scientific, IL, USA) with 10%
(v/v) charcoal-stripped FBS, 100 U/ml penicillin, and 100 μg/ml streptomycin. Cells were
maintained for 72 h and were subsequently provided fresh media containing designated con-
centrations of 4-OHE
2
or 2-OHE
2
. After 48 h, cells were harvested and processed for further
studies.
Transient transfection of plasmid DNA and siRNA
CYP1B1-specific siRNA (target sequence: CAGCATGATGCGCAACTTCTT, Qiagen) and the
overexpression vector pcDNA 3.1/Zeo containing the CYP1B1-encoding sequence were used
in transfections. Cells were transfected at room temperature with 37.5 nM siRNA or 8 μg plas-
mid with the Neon Transfection System (Invitrogen, Carlsbad, CA, USA) and cultured in
100-mm dishes in antibiotic-free RPMI with 10% FBS for 48 h.
Adenovirus infection
The infection of adenovirus carrying CYP1B1-ORF genes (ViGene Biosciences Inc., Rockville,
MD, USA) was performed in serum-free media at an m.o.i. of 750 vp (virus particles)/cell for
MCF-7 cells. After 24 h, media change was carried out with serum-containing fresh media.
Cells were maintained at 37°C in a humidified atmosphere with 5% CO
2
for 24 h and harvested
or fixed for further studies. Under these circumstances, the transduction efficiency of the
CYP1B1 gene carrying adenovirus reached almost 100%.
Cell viability assay
CYP1B1-overexpressed cells (1×10
4
cells/well) were plated onto 96-well plates and incubated
in 37°C. After stabilization for 48 h, 10 μl EZ-CyTox (Daeil Lab Service, Seoul, Korea) was
added to each well and incubated for 2 h at 37°C. Formazan formation was quantified by spec-
trophotometry at 450 nm using a Sunrise™microplate reader (Tecan, Männedorf, Switzerland).
Each experiment was performed at least three times independently.
CYP1B1 Induces EMT and Wnt/β-Cat Signaling via Sp1
PLOS ONE | DOI:10.1371/journal.pone.0151598 March 16, 2016 3/21
Subcellular fractionation
Subcellular fractionation was performed using the NE-PER
1
Nuclear and Cytoplasmic Extrac-
tion kit from Thermo Scientific. Western blot analyses were carried out using antibodies
against the following control marker proteins: β-actin for the cytosolic fraction and Hsp70 for
the nuclear fraction.
Invasion assay
Cell invasion was measured using the QCM™24-well Cell Invasion Assay Kit (Millipore),
according to the manufacturer’s instructions. Briefly, cells were seeded onto insert chambers
containing a collagen-coated polycarbonate membrane with 8-μm pores. Cells that invaded the
ECM layer were stained with 40,6-diamidino-2-phenylindole (DAPI). Invading cells in five
fields per chamber were visualized and counted under the LSM700 Confocal Laser Scanning
Microscope (Carl Zeiss, Jena, Germany). Each experiment was performed three times
independently.
Wound healing assay
Cells (1×10
6
cells/well) were cultured in 6-well culture plates. After 24 h, cells with 90% conflu-
ence were washed with PBS and treated with mitomycin C (25 μg/ml) for 30 min. After wash-
ing, a single wound per monolayer was created using sterile pipette tips. Plates were
photographed after the indicated time. Each experiment was performed at least three times
independently.
Quantitative PCR (qPCR)
Total RNA was extracted using Ribospin™(GeneALL, Seoul, Korea). Total RNA (500 ng) was
reverse transcribed at 37°C for 1 h in 20 μl total volume containing 5× RT buffer, 10 mM
dNTPs, 40 U RNase inhibitor, 200 U Moloney murine leukemia virus reverse transcriptase,
and 100 pmol oligo-dT primer. Quantitative PCR (qPCR) was performed using the Rotor-
Gene SYBR
1
PCR Kit, as recommended by the manufacturer, and analyzed using QIAGEN
Rotor-Gene Q Series software. Each reaction contained 12.5 μl2×SYBR
1
Green PCR Master
Mix, 1 μM oligonucleotide primers, and 2 μl cDNA in a final volume of 25 μl. Amplification
was conducted as follows: one cycle at 95°C for 5 min, followed by 40 cycles of denaturation at
95°C for 5 seconds and annealing/extension at 60°C for 10 seconds. Primer sequences are listed
in S1 Table.
Western blot
Whole cells were harvested by scraping and lysed in 50 mM Tris-HCl (pH 8.0) containing
150 mM NaCl, 1% nonidet P-40, 1 mM PMSF, 1 μg/ml aprotinin, and 1 μg/ml leupeptin for
30 min followed by centrifugation at 22000×gfor 15 min at 4°C. Protein concentrations were
measured using BCA Protein Assay Reagents (Thermo). Extracted proteins (20 μg) were sepa-
rated by SDS-PAGE on 10%–12% polyacrylamide gels and electrophoretically transferred onto
PVDF membranes. Membranes were blocked with 5% nonfat milk in Tris-buffered saline con-
taining 0.1% Tween-20 for 1 h at 4°C, and then incubated overnight with specific antibodies.
After incubating with secondary antibodies for 2 h, proteins were visualized using enhanced
chemiluminescence reagents (Thermo). Quantitative data were obtained using Quantity One
software (Bio-Rad, Hercules, CA, USA).
CYP1B1 Induces EMT and Wnt/β-Cat Signaling via Sp1
PLOS ONE | DOI:10.1371/journal.pone.0151598 March 16, 2016 4/21
Dual luciferase reporter assay
Cells (2×10
4
cells/well) were co-transfected with 200 ng of pcDNA 3.1/Zeo CYP1B1, CYP1B1
L432V, CYP1B1 N203S overexpression plasmid and TOP/FOP, ZEB1, TWIST1 or E-cadherin
reporter plasmids, according to the manufacturer’s protocol, using Neon
TM
transfection sys-
tem (Invitrogen). pRL-renilla (Promega) was co-transfected as control. After 24 h, cells were
lysed using passive lysis buffer and luciferase activities were measured with FilterMax F3
(Molecular Devices, LLC, USA) using the Dual Luciferase Assay System (Promega).
Immunofluorescence
Cells grown on coverslips were treated with the indicated reagent concentrations, rapidly
washed with PBS, and fixed with 3.7% (w/v) paraformaldehyde for 30 min at room tempera-
ture. After washing with PBS, the cells were blocked for 30 min in PBS containing 5% goat
serum and 0.2% Triton X-100, and then incubated with specific primary antibodies overnight.
Next, the cells were washed extensively and stained with Texas Red-conjugated goat anti-rabbit
IgG or DyLight
1
594-conjugated goat anti-mouse IgG (1:500) for 2 h. After additional washes,
the coverslips were mounted onto glass slides using UltraCruz™Mounting Medium containing
DAPI. Fluorescence signals were analyzed using an LSM700 Confocal Laser Scanning Micro-
scope (Carl Zeiss).
7-Ethoxyresorufin-O-Deethylation (EROD) assay
Cells (5×10
5
) were plated in 2 ml of culture medium and incubated for 48 h. After incubation,
the cells were harvested by scrapping in ice-cold 0.1 M potassium phosphate buffer (pH 7.4).
Cells were centrifuged at 1000×gfor 5 min at 4°C and the pellets were resuspended in the same
buffer. The cells were sonicated for 30 seconds at 4°C. The reaction mixture contained 0.1 M
potassium phosphate buffer (pH 7.4), 2 mg/ml bovine serum albumin, 50 pM rabbit
NAPDH-P450 reductase, 2 μM ethoxyresorufin, and cellular sonicates. The reaction mixtures
were pre-incubated at 37°C for 3 min and the reaction was initiated by addition of 120 μM
NADPH. After 20 min of incubation at 37°C in a shaking water bath, the reaction was termi-
nated by addition of 1 ml of ice-cold methanol. The formation of resorufin was determined
fluorometrically with FlexiStation 3 (Molecular Devices), with excitation and emission wave-
lengths of 544 nm and 590 nm, respectively. Protein concentrations were estimated using the
BCA Protein Assay Reagents (Thermo) according to the supplier's recommendations.
Statistical analysis
Statistical analyses were performed using one-way analysis of variance and Dunnett’s Multiple
Comparison t-test on Graph-Pad Prism Software (GraphPad Software Inc., San Diego, CA).
The difference was considered statistically significant when p0.05.
Results
CYP1B1 induces cell proliferation and metastasis
To explore the role of CYP1B1 in cancer progression, its effects on cell proliferation, migration,
and invasion were investigated. CYP1B1 overexpression significantly increased cell prolifera-
tion in MCF-7 cells (Fig 1A).
PCNA (Proliferating cell nuclear antigen) has been widely used as a marker for cell prolifer-
ation [31]. Accordingly, PCNA protein was upregulated by CYP1B1 overexpression (Fig 1B),
while CYP1B1 knockdown had the opposite effect (Fig 1C). Confocal microscopic analysis
likewise indicated that DMBA, a CYP1B1 inducer, increased PCNA expression while TMS, a
CYP1B1 Induces EMT and Wnt/β-Cat Signaling via Sp1
PLOS ONE | DOI:10.1371/journal.pone.0151598 March 16, 2016 5/21
CYP1B1-specific inhibitor, decreased PCNA levels (Fig 1D). These data suggest that CYP1B1
enhances cell proliferation through PCNA expression.
To identify whether CYP1B1 induces EMT-related cell morphology, we observed morpho-
logical changes in MCF-10A cells subsequent to CYP1B1 overexpression. In the models of
CYP1B1 upregulation, cells acquired mesenchymal morphologies (Fig 2A). To investigate
whether CYP1B1 also induces cell migration and invasion, we performed wound healing and
transwell invasion assays. In wound healing assays, DMBA-treated MCF-10A cells demon-
strated 1.7-fold higher migration rates compared to controls; however, this effect was abrogated
when cells were co-treated with DMBA and TMS (Fig 2B). Cell invasion by DMBA-treated
MCF-10A cells increased 1.4-fold and DMBA-treated MCF-7 cells increased 1.7-fold com-
pared to controls, but again, this effect was negated in cells treated with both DMBA and TMS
(Fig 2C).
Matrix metalloproteinases (MMPs) are established markers of cellular invasion. Therefore,
we measured MMP1,MMP9,MMP13, and MMP14 levels following CYP1B1 modulation and
found that CYP1B1 upregulated these MMP transcripts (Fig 2D).
Fig 1. CYP1B1 enhances cell proliferation. (A) Relative cell viability determinedby CCK assay subsequent to induction of CYP1B1 in MCF-7 cells
following CYP1B1 overexpression. Data are representative of experiments in triplicate. (*p0.05) (B-D) PCNA was measured by western blot and confocal
microscopy following (B) CYP1B1 overexpression, and (C) CYP1B1 knockdown. (D) Confocal microscopic analysis ofMCF-7 cells treated with 5 μM DMBA
and 10 μM TMS for 48 h. Cells were pre-treated with TMS for 1 h prior to DMBA.
doi:10.1371/journal.pone.0151598.g001
CYP1B1 Induces EMT and Wnt/β-Cat Signaling via Sp1
PLOS ONE | DOI:10.1371/journal.pone.0151598 March 16, 2016 6/21
CYP1B1 activates Wnt/β-catenin signaling pathway
To identify whether CYP1B1 influences Wnt/β-catenin signaling, we measured β-catenin
expression after CYP1B1 induction and inhibition. Subsequent to CYP1B1 induction by
CYP1B1 overexpression, β-catenin mRNA and protein levels were upregulated while CYP1B1
inhibition accordingly decreased β-catenin expression in MCF-7, MCF-10A, MDA-MB-231,
and HeLa cells (Fig 3A–3J;S1 Fig). Confocal microscopic and subcellular fractionation analyses
Fig 2. CYP1B1 induces cell migration and invasion. (A) MCF-10A morphologies after CYP1B1 induction by CYP1B1 overexpression. (B-C) Cellular
migration and invasion were quantified by (B) wound healing assay and (C) transwell invasion assay, respectively, in MCF-10A and MCF-7 cells. Cells were
treated with 5 μM DMBA and 10 μM TMS for 48 h. Cells were pre-treated with TMS for 1 h prior to DMBA. (D) MMPs were measured by qPCR following
CYP1B1 overexpression in MCF-7 cells. The results were from three independently quantified experiments. (*p0.05)
doi:10.1371/journal.pone.0151598.g002
CYP1B1 Induces EMT and Wnt/β-Cat Signaling via Sp1
PLOS ONE | DOI:10.1371/journal.pone.0151598 March 16, 2016 7/21
CYP1B1 Induces EMT and Wnt/β-Cat Signaling via Sp1
PLOS ONE | DOI:10.1371/journal.pone.0151598 March 16, 2016 8/21
demonstrated that DMBA treatment and CYP1B1 overexpression caused β-catenin to localize
to the nucleus, while co-treatment with both DMBA and TMS failed to induce this effect (Fig
3K–3O). CYP1B1 increased mRNA and protein levels of c-Myc and cyclin D1, widely known
Wnt/β-catenin target proteins (Fig 3). Furthermore, CYP1B1 enhanced the promoter activity
of β-catenin/TCF/LEF (Fig 3F). These results suggest that CYP1B1 promotes cell proliferation
via Wnt/β-catenin signaling activation following β-catenin upregulation and nuclear
localization.
CYP1B1 enhances cell invasion through EMT induction
We observed mesenchymal characteristics in MCF-10A cells with increased CYP1B1 expres-
sion (Fig 2A). Generally, the loss of E-cadherin expression during EMT allows cells to break
tight junctions and become motile, thus permitting metastasis [32]. To elucidate whether
CYP1B1 induces mesenchymal-like phenotypes by initiating EMT, we measured the expres-
sion of multiple EMT-related factors in MCF-7 and MCF-10A cells. CYP1B1 induction by
overexpression increased mRNA expression of mesenchymal markers including N-cadherin,
α-SMA, vimentin, fibronectin, and integrin α5. Transcriptional suppressors of E-cadherin
including ZEB1/2,SNAI1, and TWIST1 were also induced by CYP1B1. However, CYP1B1
decreased the expression of epithelial markers such as E-cadherin and α-catenin (Fig 4A).
These effects were reversed when we decreased CYP1B1 levels by treating cells with TMS or
CYP1B1-specific siRNA (Fig 4B and 4C).
ZEB1 promoter activity was increased in CYP1B1-overexpressing cells and was inhibited in
cells following CYP1B1 knockdown, while CDH1 promoter activity showed the opposite effect
(Fig 4D and 4E). We further measured multiple EMT-related factors by western blot, which
consistently demonstrated that CYP1B1 induces EMT (Fig 4F–4I). Confocal microscopic anal-
yses of ZEB2, SNAI1, and vimentin also confirmed that CYP1B1 promotes EMT, while these
effects were inhibited by TMS (Fig 4J–4N). Furthermore, we found that CYP1B1 considerably
decreased E-cadherin expression (Fig 4O).
CYP1B1-mediated Wnt/β-catenin activation and EMT are regulated by
Sp1
To identify the key regulator of CYP1B1-mediated EMT and Wnt/β-catenin signaling activa-
tion, we considered Sp1, because it is widely known as a transcription factor involved in cell
proliferation and metastasis. Moreover, Sp1 was recently implicated in ZEB2-induced EMT
[33,34]. Therefore, we investigated whether CYP1B1 regulates Sp1 expression by measuring its
expression subsequent to CYP1B1 induction or inhibition in MCF-7, MCF-10A, and
MDA-MB-231 cells. Sp1 mRNA and protein was upregulated in CYP1B1-overexpressing cells
(Fig 5A, 5B, 5E and 5F). This effect was reversed when CYP1B1 expression was suppressed by
TMS or siRNA (Fig 5C, 5D, 5G and 5H;S2 Fig). Confocal microscopic analysis confirmed that
Fig 3. CYP1B1 activates Wnt/β-catenin signaling by inducing β-catenin expression and nuclear localization. (A-B) mRNA expression of β-catenin
and Wnt/β-catenin signaling target genes in MCF-7 cells following CYP1B1 overexpression was determined by (A) RT-PCR, (B) qPCR, and (C-D) mRNA
expression of β-catenin and Wnt/β-catenin signaling target genes in MCF-7 cells following CYP1B1 knockdown was determined by (C) RT-PCR, and (D)
qPCR. (E) mRNA expression of β-catenin and Wnt/β-catenin signaling target genes in MCF-10A cells following CYP1B1 knockdown was determined by
qPCR. (F) β-catenin/TCF/LEF promoter activity was determined using dual-luciferase assay following CYP1B1 overexpression in MCF-7 cells. Data are
representative of experiments in triplicate. (*p0.05) Wnt/β-catenin signaling proteins were measured following (G) CYP1B1 overexpression in MCF-7 and
MCF-10A cells, (H) adenoviral CYP1B1 overexpression in MCF-7 cells, (I) CYP1B1 knockdown in MCF-7 cells, and (J) treatment with TMS (0, 1, 5, and
10 μM) for 48 h in MCF-7 and MCF-10A cells. (K) Confocal microscopic analyses of β-catenin following treatment with 5 μM DMBA in the presence of 10 μM
TMS for 48 h in MCF-7 cells and (L) CYP1B1 overexpression in MCF-10A cells. (M-N) Confocal microscopic analyses in adenoviral CYP1B1 overexpressed
MCF-7 cells for (M) CYP1B1, and (N) β-catenin. (O) β-catenin proteins in nucleus or cytosol were measured following treatment with 5 μM DMBA in the
presence of 10 μM TMS for 48 h in MCF-7 cells.
doi:10.1371/journal.pone.0151598.g003
CYP1B1 Induces EMT and Wnt/β-Cat Signaling via Sp1
PLOS ONE | DOI:10.1371/journal.pone.0151598 March 16, 2016 9/21
CYP1B1 Induces EMT and Wnt/β-Cat Signaling via Sp1
PLOS ONE | DOI:10.1371/journal.pone.0151598 March 16, 2016 10 / 21
CYP1B1 overexpression and DMBA increased Sp1 expression while TMS treatment blocked
this effect (Fig 5I–5k). These data indicate that CYP1B1 positively regulates Sp1 expression.
Next, we investigated whether Sp1 modulates the key regulators involved in EMT and Wnt/
β-catenin signaling and found that Sp1 upregulates these pathways (Fig 6A–6F). Specifically,
CDH1 promoter activity in Sp1-overexpressing cells was 40% as active compared to control
cells (Fig 6B). To ascertain whether Sp1 is required for CYP1B1-mediated effects, we measured
the expression of β-catenin, c-Myc, cyclin D1, ZEB2, SNAI1, and vimentin in cells with
CYB1B1 overexpression and Sp1 knockdown. Sp1 knockdown prevented CYP1B1-mediated
Wnt/β-catenin activation (Fig 6G;S3A Fig). Moreover, ZEB2, SNAI1, and vimentin levels nor-
mally induced by CYP1B1 were markedly suppressed in Sp1 knockdown cells (Fig 6H;S3B
Fig).
To clarify whether Sp1 DNA-binding plays a role in CYP1B1-mediated transcriptional reg-
ulation, we co-treated cells with DMBA and mithramycin A, an inhibitor of Sp1 DNA-binding,
and measured the expression of multiple key proteins. The upregulation of β-catenin, c-Myc,
cyclin D1, ZEB2, vimentin, and SNAI1 induced by DMBA was suppressed by mithramycin A
in a concentration-dependent manner (Fig 6I and 6J;S4 Fig). These data suggested that Sp1
serves as the transcription factor that facilitates CYP1B1-mediated oncogenesis.
In confocal microscopic and subcellular fractionation analyses, DMBA likewise increased
PCNA, ZEB2, and β-catenin. Interestingly, when cells were treated with both DMBA and
mithramycin A (100 nM), the induction of PCNA, ZEB2, and β-catenin was almost completely
blocked and β-catenin failed to localize to the nucleus (Fig 6K–6N). Similarly, the enhanced
promoter activities of β-catenin/TCF/LEF, ZEB1, and TWIST1observed with DMBA treatment
were suppressed in the presence of mithramycin A (Fig 6O). These results suggest that Sp1
directly regulates the transcriptional activities of β-catenin, ZEB1, and TWIST1 and initiates
EMT and Wnt/β-catenin signaling.
4-Hydroxyestradiol (4-OHE
2
) may play an important role in
CYP1B1-mediated oncogenesis
To clarify whether CYP1B1-mediated EMT and Wnt/β-catenin signaling activation are initiated
by CYP1B1 activity, we examined the enzyme activity of CYP1B1 following CYP1B1 overexpres-
sion (Fig 7A). The significant increase of CYP1B1 enzymatic activity could suggest that the onco-
genic events occurred by CYP1B1 overexpression may be the results of CYP1B1 activity. To
identify whether our hypothesis is valid, the expression levels of key proteins following treatment
of the enzymatic products of CYP1B1, 4-OHE
2
or 2-OHE
2
.CTNNB1 and MYC mRNA levels
were upregulated whereas CDH1 was suppressed in 4-OHE
2
-treated cells (Fig 7B). Sp1, a key reg-
ulator for CYP1B1-mediated effects, was induced by 4-OHE
2
in a concentration-dependent man-
ner (Fig 7C). β-catenin protein also increased with 4-OHE
2
treatment, and we found that β-
catenin in 4-OHE
2
-treated cells localized to the nucleus, as was observed in DMBA-treated or
CYP1B1-overexpressing cells (Fig 7D). To compare the effects of estrogen metabolites produced
by CYP1B1, cells were treated with 4-OHE
2
or 2-OHE
2
(Fig 7E and 7F;S5A and S5B Fig).
Fig 4. CYP1B1 induces EMT by regulating of EMT-related factors. (A) mRNA expression of EMT-related factors were measured in MCF-7 cells using
RT-PCR or qPCR following CYP1B1 overexpression, (B) CYP1B1 knockdown, and (C) TMS treatment (0, 1, 5, and 10 μM) for 48 h. (D-E) ZEB1 and E-
cadherin promoter activities in MCF-7 cells were determined by luciferase assay following (D) CYP1B1 overexpression and (E) CYP1B1 knockdown. Data
are representative of experiments in triplicate. (*p0.05) (F-I) EMT-related factors were measured in MCF-7 and MCF-10A cells using western blot following
(F) CYP1B1 overexpression, (G) adenoviral CYP1B1 overexpression, (H) CYP1B1 knockdown, and (I) treatment with TMS (0, 1, 5, and 10 μM) for 48 h.
(J-O) The protein levels of EMT-related factors were measured in MCF-7 and MCF-10A cells using confocal microscopy. ZEB2 expression level in (J) 5 μM
DMBA and 10 μM TMS treated MCF-7 cells, (K) 5 μM DMBA and 10 μM TMS treated MCF-10A cells, and (L) adenoviral CYP1B1 overexpressed MCF-7
cells. (M) SNAI1, (N) vimentin, and (O) E-cadherin expression in 5 μM DMBA and 10 μM TMS treated MCF-7 cells. As before, cells were pre-treated with
TMS for 1 h prior to DMBA.
doi:10.1371/journal.pone.0151598.g004
CYP1B1 Induces EMT and Wnt/β-Cat Signaling via Sp1
PLOS ONE | DOI:10.1371/journal.pone.0151598 March 16, 2016 11 / 21
Fig 5. CYP1B1 upregulates Sp1 expression. (A-D) Sp1 mRNA levels were measured in MCF-7 cells by (A) RT-PCR following CYP1B1 overexpression,
(B) qRT-PCR following CYP1B1 overexpression, (C) RT-PCR following CYP1B1 knockdown, (D) qRT-PCR following CYP1B1 knockdown. Data are
representative of experiments in triplicate. (*p0.05) (E-H) Sp1 protein levels were measured by western blot (E) in MCF-10A cells following CYP1B1
overexpression, (F) in MCF-7 cells following adenoviral CYP1B1 overexpression, (G) in MCF-7 cells following CYP1B1 knockdown, and (H) in MCF-7 and
MCF-10A cells following TMS treatment (0, 1, 5, and 10 μM) for 48 h. (I-K) Using confocal microscopic analysis, Sp1 levels were determined following (I)
adenoviral CYP1B1 overexpression in MCF-7 cells and (J-K) treatment with 5 μM DMBA in the presence of 10 μM TMS for 48 h in (J) MCF-7 and (K) MCF-
10A cells. Cells were pre-treated with TMS for 1 h prior to DMBA.
doi:10.1371/journal.pone.0151598.g005
CYP1B1 Induces EMT and Wnt/β-Cat Signaling via Sp1
PLOS ONE | DOI:10.1371/journal.pone.0151598 March 16, 2016 12 / 21
CYP1B1 Induces EMT and Wnt/β-Cat Signaling via Sp1
PLOS ONE | DOI:10.1371/journal.pone.0151598 March 16, 2016 13 / 21
4-OHE
2
significantly increased Sp1, β-catenin, c-Myc, cyclin D1, PCNA, ZEB2, SNAI1, and
vimentin expression and decreased E-cadherin levels, while 2-OHE
2
did not demonstrate any sig-
nificant effects (Fig 7G and 7H;S5C Fig). The allelic variants of CYP1B1 gene having higher or
lower enzymatic activity have been reported previously and CYP1B1 L432V and N203S have
been reported to have markedly higher and lower enzymatic activity, respectively [35–37]. To
elucidate whether the enzymatic activity of CYP1B1 is a major cause of EMT induction and
Wnt/β-catenin signaling activation, the expression levels of Wnt/β-catenin signaling target pro-
teins and Sp1 were determined following overexpression of CYP1B1 L432V or N203S polymor-
phic genes and showed to be positively regulated by CYP1B1 enzymatic activity. E-cadherin,
however, showed the opposite result (Fig 7I). These data indicate that the activity of CYP1B1
with generation of 4-OHE
2
, a major metabolite produced from estrogen by CYP1B1, may play a
crucial role in CYP1B1-mediated EMT and Wnt/β-catenin signaling activation through induc-
tion of Sp1.
Discussion
Increased cell proliferation, migration, and invasion are widely considered as cancer hallmarks
and key processes for tumor progression. To the best of our knowledge, the current study rep-
resents the first evidence that CYP1B1 enhances EMT and activates Wnt/β-catenin signaling
by upregulating Sp1. Sp1 expression was promoted in cells treated with 4-OHE
2
and mediated
the upregulation of EMT-inducing factors. This cascade of events inhibited E-cadherin expres-
sion and simultaneously increased Wnt/β-catenin signaling through the upregulation and
nuclear localization of β-catenin. These results demonstrate that Sp1 mediates the downstream
transcriptional effects associated with elevated CYP1B1 and is essential for EMT and Wnt/β-
catenin signaling.
Up to this point, the relationship between Sp1 and Wnt/β-catenin signaling has been
unclear. Several studies have reported that Sp1-related transcription factors might act as activa-
tors of Wnt/β-catenin target genes during cell development [38,39]. Importantly, we show that
CYP1B1-induced cell proliferation in MCF-7 and MCF-10A cells is caused by PCNA upregula-
tion. PCNA acts as an auxiliary component of the DNA polymerase-δcomplex and plays an
important role in DNA replication [40]. Recently, the relationship between PCNA and Wnt/β-
catenin signaling became clearer with the report that PAF (PCNA-associated factor) can disso-
ciate from PCNA complexes and bind to β-catenin, which enhances Wnt/β-catenin target gene
expression upon Wnt signaling activation [41]. Based on these data, we suggest that PCNA
mediates CYP1B1-induced Wnt/β-catenin signal activation, and that the relationship between
PCNA and Sp1 be investigated in detail.
In this study, we found that Sp1 upregulates E-cadherin repressors like ZEB1/2, SNAIL, and
TWIST1, which subsequently induce EMT. Recently, it has been reported that Sp1 induces cell
migration and invasion in cooperation with ZEB2 [34]. Moreover, Sp1 has been shown to
inhibit miR-200a expression; this subsequently allows HDAC4-mediated promoter
Fig 6. Sp1 is sufficient to induce CYP1B1-mediated effects. (A) ZEB2 and E-cadherin mRNA were measured by RT-PCR and (B) E-cadherin promoter
activity was determined by luciferase assay after Sp1 overexpression in MCF-7 cells. (C) Key proteins in Wnt/β-catenin signaling and (D) EMT-related factors
were measured by western blot after Sp1 induction in MCF-7 cells. (E and F) Similar to Fig 5C and 5D, but following Sp1 inhibition. (G and H) Also similar to
Fig 5C and 5D, but in MCF-7 cells co-transfected with CYP1B1 overexpression vector and Sp1 siRNA. (I and J) MCF-7 cells treated with DMBA and
mithramycin A for 24 h following pre-treatment with mithramycin A for 1 h. (I) Key factors in Wnt/β-catenin signaling and (J) EMT were determined by western
blot. (K) PCNA in MCF-7 cells, (L) β-catenin in MCF-10A cells, (N) ZEB2 in MCF-7 cells were observed by confocal microscopy after treatment with 5 μM
DMBA and 100 nM mithramycin A for 24 h. (M) β-catenin proteins in nuclear or cytosolic fraction of MCF-10A cells were measured following treatment with
5μM DMBA and 100 nM mithramycin A for 24 h. Cells were pre-treated with mithramycin A for 1 h prior to DMBA. (O) Relativepromoter activity of β-catenin/
TCF/LEF, ZEB1, and TWIST1 was determined by dual-luciferase assay after treatment with DMBA and mithramycin A. As before, cells were pre-treated with
mithramycin A for 1 h prior to DMBA. Data are representative of experiments in triplicate. (*p0.05)
doi:10.1371/journal.pone.0151598.g006
CYP1B1 Induces EMT and Wnt/β-Cat Signaling via Sp1
PLOS ONE | DOI:10.1371/journal.pone.0151598 March 16, 2016 14 / 21
Fig 7. 4-OHE
2
induces CYP1B1-mediated oncogenic events through upregulation of Sp1. (A) Enzyme activity of CYP1B1 was determined by EROD
assay in CYP1B1-overexpressed MCF-7 cells. Data are representative of experimentsin duplicate. (*p0.05) (B) Wnt/β-catenin signaling target genes and
E-cadherin mRNA were measured by qPCR and (C) Sp1 and (D) β-catenin expression were analyzed by confocal microscopy in 4-OHE
2
-treated MCF-7
CYP1B1 Induces EMT and Wnt/β-Cat Signaling via Sp1
PLOS ONE | DOI:10.1371/journal.pone.0151598 March 16, 2016 15 / 21
diacetylation at ZEB1/2, which inhibits their expression [42,43]. The relationship between Sp1
and SNAIL is not fully understood, although it has been shown that Sp1 directly binds to the
SNAIL promoter and thus upregulates SNAIL during EMT [44]. Moreover, SNAIL can induce
Sp1 by suppressing an inhibitor of Sp1, miR-128 [45]. These data suggest that Sp1 and SNAIL
mutually upregulate one another. Finally, Sp1 upregulation of TWIST1 expression by associat-
ing with CCT repeats in the TWIST1 promoter has been suggested; however, this process
requires further investigation [46].
During invasion, cancer cells secrete MMPs to induce extracellular matrix (ECM) degrada-
tion. Sp1 has been reported to regulate the expression of multiple MMPs. For example, the pro-
moters of MMP1,MMP9, and MMP14 contain Sp1 binding sites, and transcriptions from
these loci are directly upregulated by Sp1 [47,48]. MMP1 and MMP14 have been reported to
induce cancer cell invasion, and MMP14 is further recognized in the activation of MMP2 and
MMP9 [49,50]. MMP13 expression is also increased by Sp1, and both MMP13 and MMP9 are
implicated in the progression of various tumors [51–54]. In this study, we show that CYP1B1
upregulated the transcripts for all of these MMPs. Therefore, Sp1 is likewise assumed to play
an important role in cell invasion, since CYP1B1 increases Sp1 expression and DNA binding.
There are several studies that have been reported the effects of CYP1B1 knockout in vivo
models. The Cyp1b1(-/-) mice represented the elevated protection against DNA adduct forma-
tion induced by carcinogenic agents like DMBA or benzo[a,l]pyrene in tumors [55–57] and
also showed the blocking effect on tumor tissue metastasis induced by benzo[a]pyrene [58].
Based on these previously reported in vivo data, the novel mechanism of CYP1B1-induced cell
proliferation, migration, and invasion might have the preclinical significance but the in vivo
experiments such as transplantation assay should be investigated in further study.
Although CYP1B1 upregulation via Sp1 binding in the CYP1B1 promoter has been
reported, the reciprocal effect of CYP1B1 on Sp1 expression has not yet been described [59].
Recently, estrogens have been reported to regulate microRNA expression [60]. Among the
estrogen-dependent microRNAs, miR-375 is generally suppressed in multiple cancers, includ-
ing gastric, cervical, liver, lung, and esophageal cancer. This downregulation has recently been
attributed to hypermethylation of its promoter in cancer cells [61–65]. These findings suggest
that miR-375 may act as a tumor suppressor. As miR-375 directly binds the 30UTR of Sp1 and
thereby negatively regulates Sp1 expression, this microRNA might suppress cell migration and
invasion [61]. Furthermore, miR-375 downregulation accompanies tamoxifen resistance and
EMT in tamoxifen-resistant breast cancer cells [66]. Since CYP1B1 overexpression and
4-OHE
2
treatment induce Sp1 expression, 4-OHE
2
might be responsible for the suppression of
miR-375 or other microRNAs, which subsequently promotes Sp1 expression.
In summary, to the best of our knowledge, our present study is the first report to identify
the molecular mechanism underlying CYP1B1-mediated cancer progression. Our results dem-
onstrate that CYP1B1 enhances cell proliferation via Wnt/β-catenin signaling activation by
inducing the expression and nuclear localization of β-catenin. Moreover, EMT induction by
CYP1B1 was mediated by the upregulation of E-cadherin transcriptional repressors. Our
results further indicate that CYP1B1 enzymatic activity is essential for CYP1B1-mediated EMT
and Wnt/β-catenin signaling activation, because 4-OHE
2
treatment was sufficient to induce
Sp1 and other key proteins in EMT and Wnt/β-catenin signaling. The scheme in Fig 8
cells. (E) Protein levels of Wnt/β-catenin signaling target proteins and (F) EMT-related factors were determined using western blot in 4-OHE
2
-treated MCF-7
cells. All western blots were performed independently three times and the bands were quantified using Quantity One software program. (G) Wnt/β-catenin
signaling target proteins in 4-OHE
2
-treated cells, and (H) EMT-related factors in 4-OHE
2
-treated cells. The results were from three independently quantified
experiments. (*p0.05) (I) Wnt/β-catenin signaling target proteins, Sp1, and E-cadherin proteins were measured by western blot following overexpression of
CYP1B1 polymorphic genes in MCF-10A cells.
doi:10.1371/journal.pone.0151598.g007
CYP1B1 Induces EMT and Wnt/β-Cat Signaling via Sp1
PLOS ONE | DOI:10.1371/journal.pone.0151598 March 16, 2016 16 / 21
summarizes these novel findings revealing CYP1B1-induced oncogenic mechanisms. Since
CYP1B1 is implicated as a significant factor in the development of various cancers, a more
detailed understanding of the precise mechanisms underpinning CYP1B1-mediated cancer
progression may facilitate the development of new strategies for cancer treatment.
Supporting Information
S1 Fig. CYP1B1 upregulates Wnt/β-catenin signaling target proteins in MDA-MB-231 and
HeLa cells. (A) β-catenin protein levels were measured following treatment with TMS (0, 1, 5,
and 10 μM) for 48 h in MDA-MB-231 cells, and (B) CYP1B1 overexpression in HeLa cells.
(EPS)
S2 Fig. CYP1B1 upregulates Sp1 expression in MDA-MB-231 cells. (A) Sp1 mRNA and pro-
tein levels were measured in MDA-MB-231 cells by RT-PCR following TMS treatment (0, 1, 5,
and 10 μM) for 48 h, (B) by western blot following TMS treatment (0, 1, 5, and 10 μM) for 48
h.
(EPS)
S3 Fig. Sp1 is sufficient to induce CYP1B1-mediated effects. (A) Key proteins in Wnt/β-cate-
nin signaling and (B) EMT-related factors were measured by western blot after MCF-10A cells
Fig 8. Scheme for the novel mechanisms of CYP1B1 action. Scheme for CYP1B1-induced cell proliferation via activation of Wnt/β-catenin signaling and
CYP1B1-induced celll migration and invasion through induction of EMT.
doi:10.1371/journal.pone.0151598.g008
CYP1B1 Induces EMT and Wnt/β-Cat Signaling via Sp1
PLOS ONE | DOI:10.1371/journal.pone.0151598 March 16, 2016 17 / 21
were co-transfected with CYP1B1 overexpression vector and Sp1 siRNA.
(EPS)
S4 Fig. DNA binding ability of Sp1 is sufficient to induce CYP1B1-mediated effects. MCF-
10A cells treated with 5 μM DMBA for 24 h following pre-treatment with 100 nM mithramycin
A for 1 h. (A) Protein levels of Wnt/β-catenin signaling target genes and (B) EMT-related fac-
tors were determined using western blot.
(EPS)
S5 Fig. 2-OHE
2
has no significant effect on CYP1B1-mediated oncogenic events. (A) Wnt/
β-catenin signaling target proteins and (B) EMT-related factors in 2-OHE
2
-treated MCF-7
cells were measured by western blot. All western blots were performed independently three
times and the bands were quantified using Quantity One software program. (C) Wnt/β-catenin
signaling target proteins in 2-OHE
2
-treated MCF-7 cells and (D) EMT-related factors in
2-OHE
2
-treated MCF-7 cells. The results were from three independently quantified experi-
ments. (p0.05)
(EPS)
S1 Table. Primers for quantitative realtime-PCR (qPCR) analysis.
(DOCX)
Acknowledgments
This research was supported by a National Research Foundation of Korea (NRF) funded by the
Korean government (MSIP) (NRF-2012R1A1A2041536 and NRF-2015R1A5A1008958).
Author Contributions
Conceived and designed the experiments: YJK YJC. Performed the experiments: YJK HSB DJY.
Analyzed the data: YJK SS HSB DJY DK YJC. Contributed reagents/materials/analysis tools:
DK YJC. Wrote the paper: YJK YJC.
References
1. Sutter TR, Tang YM, Hayes CL, Wo YY, Jabs EW, Li X, et al. Complete cDNA sequence of a human
dioxin-inducible mRNA identifies a new gene subfamily of cytochrome P450 that maps to chromosome
2. J Biol Chem 1994; 269:13092–13099. PMID: 8175734
2. Spink DC, Hayes CL, Young NR, Christou M, Sutter TR, Jefcoate CR, et al. The effects of 2,3,7,8-tetra-
chlorodibenzo-p-dioxin on estrogen metabolism in MCF-7 breast cancer cells: evidence for induction of
a novel 17β-estradiol 4-hydroxylase. J Steroid Biochem Mol Biol 1994; 51:251–258. PMID: 7826886
3. Belous AR, Hachey DL, Dawling S, Roodi N, Parl FF. Cytochrome P450 1B1-mediated estrogen
metabolism results in estrogen-deoxyribonucleoside adduct formation. Cancer Res 2007; 67:812–817.
PMID: 17234793
4. Hachey DL, Dawling S, Roodi N, Parl FF. Sequential action of phase I and II enzymes cytochrome
p450 1B1 and glutathione S-transferase P1 in mammary estrogen metabolism. Cancer Res 2003;
63:8492–8499. PMID: 14679015
5. Tang YM, Wo YY, Stewart J, Hawkins AL, Griffin CA, Sutter TR, et al. Isolation and characterization of
the human cytochrome P450 CYP1B1 gene. J Biol Chem 1996; 271:28324–28330. PMID: 8910454
6. Shimada T, Hayes CL, Yamazaki H, Amin S, Hecht SS, Guengerich FP, et al. Activation of chemically
diverse procarcinogens by human cytochrome P-450 1B1. Cancer Res 1996; 56:2979–2984. PMID:
8674051
7. Murray GI, Taylor MC, McFadyen MC, McKay JA, Greenlee WF, Burke MD, et al. Tumor-specific
expression of cytochrome P450 CYP1B1. Cancer Res 1997; 57:3026–3031. PMID: 9230218
8. Patel SA, Gooderham NJ. Interleukin-6 promotes dietary carcinogen-induced DNA damage in colorec-
tal cancer cells. Toxicol Res 2015; 4:858–866.
CYP1B1 Induces EMT and Wnt/β-Cat Signaling via Sp1
PLOS ONE | DOI:10.1371/journal.pone.0151598 March 16, 2016 18 / 21
9. McKay JA, Melvin WT, Ah-See AK, Ewen SW, Greenlee WF, Marcus CB, et al. Expression of cyto-
chrome P450 CYP1B1 in breast cancer. FEBS Lett 1995; 374:270–272. PMID: 7589551
10. Tokizane T, Shiina H, Igawa M, Enokida H, Urakami S, Kawakami T, et al. Cytochrome P450 1B1 is
overexpressed and regulated by hypomethylation in prostate cancer. Clin Cancer Res 2005; 11:5793–
5801. PMID: 16115918
11. McFadyen MC, Cruickshank ME, Miller ID, McLeod HL, Melvin WT, Haites NE, et al. Cytochrome P450
CYP1B1 over-expression in primary and metastatic ovarian cancer. Br J Cancer 2001; 85:242–246.
PMID: 11461084
12. Ragavan N, Hewitt R, Cooper LJ, Ashton KM, Hindley AC, Nicholson CM, et al. CYP1B1 expression in
prostate is higher in the peripheral than in the transition zone. Cancer Lett 2004; 215:69–78. PMID:
15374634
13. Singh PB, Ragavan N, Ashton KM, Basu P, Nadeem SM, Nicholson CM, et al. Quantified gene expres-
sion levels for phase I/II metabolizing enzyme and estrogen receptor levels in benign prostate from
cohorts designated as high-risk (UK) versus low-risk (India) for adenocarcinoma at this organ site: a
preliminary study. Asian J Androl 2010; 12:203–214. doi: 10.1038/aja.2009.71 PMID: 19935673
14. Le Marchand L, Donlon T, Kolonel LN, Henderson BE, Wilkens LR. Estrogen metabolism-related
genes and breast cancer risk: the multiethnic cohort study. Cancer Epidemiol Biomarkers Prev 2005;
14:1998–2003. PMID: 16103451
15. Saini S, Hirata H, Majid S, Dahiya R. Functional significance of cytochrome P450 1B1 in endometrial
carcinogenesis. Cancer Res 2009; 69:7038–7045. doi: 10.1158/0008-5472.CAN-09-1691 PMID:
19690133
16. Hong M, Park N, Chun YJ. Role of annexin a5 on mitochondria-dependent apoptosis induced by tetra-
methoxystilbene in human breast cancer cells. Biomol Ther 2014; 22:519–524
17. Chen B, Qiu LX, Li Y, Xu W, Wang XL, Zhao WH, et al. The CYP1B1 Leu432Val polymorphism contrib-
utes to lung cancer risk: evidence from 6501 subjects. Lung Cancer 2010; 70:247–252. doi: 10.1016/j.
lungcan.2010.03.011 PMID: 20395011
18. Jiang W, Sun G, Xiong J, Xi X, Shi Z. Association of CYP1B1 L432V polymorphism with urinary cancer
susceptibility: a meta-analysis. Diagn Pathol 2014; 9:113. doi: 10.1186/1746-1596-9-113 PMID:
24913727
19. De Vivo I, Hankinson SE, Li L, Colditz GA, Hunter DJ. Association of CYP1B1 polymorphisms and
breast cancer risk. Cancer Epidemiol Biomarkers Prev 2002; 11:489–492. PMID: 12010864
20. Polakis P. Wnt signaling and cancer. Genes Dev 2000; 14:1837–1851. PMID: 10921899
21. Giles RH, van Es JH, Clevers H. Caught up in a Wnt storm: Wnt signaling in cancer. Biochim Biophys
Acta 2003; 1653:1–24. PMID: 12781368
22. Aberle H, Schwartz H, Kemler R. Cadherin-catenin complex: protein interactions and their implications
for cadherin function. J Cell Biochem 1996; 61:514–523. PMID: 8806074
23. Son H, Moon A. Epithelial-mesenchymal transition and cell invasion. Toxicol Res 2010; 26:245–252.
doi: 10.5487/TR.2010.26.4.245 PMID: 24278531
24. Carvell MJ, Marsh PJ, Persaud SJ, Jones PM. E-cadherin interactions regulate beta-cell proliferation in
islet-like structures. Cell Physiol Biochem 2007; 20:617–626. PMID: 17762188
25. Batlle E, Sancho E, Franci C, Dominguez D, Monfar M, Baulida J, et al. The transcription factor snail is
a repressor of E-cadherin gene expression in epithelial tumour cells. Nat Cell Biol 2000; 2:84–89.
PMID: 10655587
26. Comijn J, Berx G, Vermassen P, Verschueren K, van Grunsven L, Bruyneel E, et al. The two-handed E
box binding zinc finger protein SIP1 downregulates E-cadherin and induces invasion. Mol Cell 2001;
7:1267–1278. PMID: 11430829
27. Thiery JP. Epithelial-mesenchymal transitions in tumour progression. Nat Rev Cancer2002; 2:442–
454. PMID: 12189386
28. Ciruna B, Rossant J. FGF signaling regulates mesoderm cell fate specification and morphogenetic
movement at the primitive streak. Dev Cell 2001; 1:37–49. PMID: 11703922
29. Onder TT, Gupta PB, Mani SA, Yang J, Lander ES, Weinberg RA. Loss of E-cadherin promotes metas-
tasis via multiple downstream transcriptional pathways. Cancer Res 2008; 68:3645–3654. doi: 10.
1158/0008-5472.CAN-07-2938 PMID: 18483246
30. Maga G, Hubscher U. Proliferating cell nuclear antigen (PCNA): a dancer with many partners. J Cell Sci
2003; 116:3051–3060. PMID: 12829735
31. Debnath J, Muthuswamy SK, Brugge JS. Morphogenesis and oncogenesis of MCF-10A mammary epi-
thelial acini grown in three-dimensional basement membrane cultures. Methods 2003; 30:256–268.
PMID: 12798140
CYP1B1 Induces EMT and Wnt/β-Cat Signaling via Sp1
PLOS ONE | DOI:10.1371/journal.pone.0151598 March 16, 2016 19 / 21
32. Christiansen JJ, Rajasekaran AK. Reassessing epithelial to mesenchymal transition as a prerequisite
for carcinoma invasion and metastasis. Cancer Res 2006; 66:8319–8326. PMID: 16951136
33. Zhang JP, Zhang H, Wang HB, Li YX, Liu GH, Xing S, et al. Down-regulation of Sp1 suppresses cell
proliferation, clonogenicity and the expressions of stem cell markers in nasopharyngeal carcinoma. J
Transl Med 2014; 12:222. doi: 10.1186/s12967-014-0222-1 PMID: 25099028
34. Nam EH, Lee Y, Zhao XF, Park YK, Lee JW, Kim S. ZEB2-Sp1 cooperation induces invasion by upre-
gulating cadherin-11 and integrin α5 expression. Carcinogenesis 2014; 35:302–314. doi: 10.1093/
carcin/bgt340 PMID: 24130169
35. Li DN, Seidel A, Pritchard MP, Wolf CR, Friedberg T. Polymorphisms in P450 CYP1B1 affect the con-
version of estradiol to the potentially carcinogenic metabolite 4-hydroxyestradiol. Pharmacogenetics
2000; 10:343–353. PMID: 10862525
36. Chavarria-Soley G, Sticht H, Aklillu E, Ingelman-Sundberg M, Pasutto F, Reis A, Rautenstrauss B.
Mutations in CYP1B1 cause primary congenital glaucoma by reduction of either activity or abundance
of the enzyme. Hum Mutat 2008; 29:1147–1153. doi: 10.1002/humu.20786 PMID: 18470941
37. Campos-Mollo E, Lopez-Garrido MP, Blanco-Marchite C, Garcia-Feijoo J, Peralta J, Belmonte-Marti-
nez J, et al. CYP1B1 mutations in Spanish patients with primary congenital glaucoma: phenotypic and
functional variability. Mol Vis 2009; 15:417–431. PMID: 19234632
38. Weidinger G, Thorpe CJ, Wuennenberg-Stapleton K, Ngai J, Moon RT. The Sp1-related transcription
factors sp5 and sp5-like act downstream of Wnt/beta-catenin signaling in mesoderm and neuroecto-
derm patterning. Curr Biol 2005; 15:489–500. PMID: 15797017
39. Thorpe CJ, Weidinger G, Moon RT. Wnt/β-catenin regulation of the Sp1-related transcription factor
sp5l promotes tail development in zebrafish. Development 2005; 132:1763–1772. PMID: 15772132
40. Bravo R, Frank R, Blundell PA, Macdonald-Bravo H. Cyclin/PCNA is the auxiliary protein of DNA poly-
merase-δ. Nature 1987; 326:515–517. PMID: 2882423
41. Jung HY, Jun S, Lee M, Kim HC, Wang X, Ji H, et al. PAF and EZH2 induce Wnt/β-catenin signaling
hyperactivation. Mol Cell 2013; 52:193–205. doi: 10.1016/j.molcel.2013.08.028 PMID: 24055345
42. Wang G, Guo X, Hong W, Liu Q, Wei T, Lu C, et al. Critical regulation of miR-200/ZEB2 pathway in
Oct4/Sox2-induced mesenchymal-to-epithelial transition and induced pluripotent stem cell generation.
Proc Natl Acad Sci U SA 2013; 110:2858–2863.
43. Yuan JH, Yang F, Chen BF, Lu Z, Huo XS, Zhou WP, et al. The histone deacetylase 4/SP1/microrna-
200a regulatory network contributes to aberrant histone acetylation in hepatocellular carcinoma. Hepa-
tology 2011; 54:2025–2035. doi: 10.1002/hep.24606 PMID: 21837748
44. Barbera MJ, Puig I, Dominguez D, Julien-Grille S, Guaita-Esteruelas S, Peiro S, et al. Regulation of
Snail transcription during epithelial to mesenchymal transition of tumor cells. Oncogene 2004;
23:7345–7354. PMID: 15286702
45. Dong Q, Cai N, Tao T, Zhang R, Yan W, Li R, et al. An axis involving SNAI1, microRNA-128 and SP1
modulates glioma progression. PLoS One 2014; 9:e98651. doi: 10.1371/journal.pone.0098651 PMID:
24959930
46. Ohkuma M, Funato N, Higashihori N, Murakami M, Ohyama K, Nakamura M. Unique CCT repeats
mediate transcription of the TWIST1 gene in mesenchymal cell lines. Biochem Biophys Res Commun
2007; 352:925–931. PMID: 17157810
47. Poplineau M, Schnekenburger M, Dufer J, Kosciarz A, Brassart-Pasco S, Antonicelli F, et al. The DNA
hypomethylating agent, 5-aza-2'-deoxycytidine, enhances tumor cell invasion through a transcription-
dependent modulation of MMP-1 expression in human fibrosarcoma cells. Mol Carcinog 2015; 54:24–
34. doi: 10.1002/mc.22071 PMID: 24038389
48. Turner NA, Porter KE. Regulation of myocardial matrix metalloproteinase expression and activity by
cardiac fibroblasts. IUBMB Life 2012; 64:143–150. doi: 10.1002/iub.594 PMID: 22215527
49. Foley CJ, Luo C, O'Callaghan K, Hinds PW, Covic L, Kuliopulos A. Matrix metalloprotease-1apromotes
tumorigenesis and metastasis. J Biol Chem 2012; 287:24330–24338. doi: 10.1074/jbc.M112.356303
PMID: 22573325
50. Hernandez-Perez M, El-hajahmad M, Massaro J, Mahalingam M. Expression of gelatinases (MMP-2,
MMP-9) and gelatinase activator (MMP-14) in actinic keratosis and in in situ and invasive squamous
cell carcinoma. Am J Dermatopathol 2012; 34:723–728. PMID: 22534634
51. Park JH, Jo JH, Kim KH, Kim SJ, Lee WR, Park KK, et al. Antifibrotic effect through the regulation of
transcription factor using ring type-Sp1 decoy oligodeoxynucleotide in carbon tetrachloride-induced
liver fibrosis. J Gene Med 2009; 11:824–833. doi: 10.1002/jgm.1355 PMID: 19554625
52. Storz P, Doppler H, Copland JA, Simpson KJ, Toker A. FOXO3a promotes tumor cell invasion through
the induction of matrix metalloproteinases. Mol Cell Biol 2009; 29:4906–4917. doi: 10.1128/MCB.
00077-09 PMID: 19564415
CYP1B1 Induces EMT and Wnt/β-Cat Signaling via Sp1
PLOS ONE | DOI:10.1371/journal.pone.0151598 March 16, 2016 20 / 21
53. Kim ES, Moon A. Role of transforming growth factor-βin tumor invasion and metastasis. Toxicol Res
2007; 23:197–205.
54. Piao MJ, Susara Ruwan Kumara MH, Kim KC, Kang KA, Kang HK, Lee NH, et al. Diphlorethohydroxy-
carmalol suppresses ultraviolet B-induced matrix metalloproteinases via inhibition of JNK and ERK sig-
naling in human keratinocytes. Biomol Ther 2015; 23:557–563.
55. Buters JT, Sakai B, Richter T, Pineau T, Alexander DL, Savas U, et al. Cytochrome P450 CYP1B1
determines susceptibility to 7, 12-dimethylbenz[a]anthracene-induced lymphomas. Pro Natl Acad Sci
U S A 1999; 96:1977–1982.
56. Page TJ O’Brien S, Holston K, MacWilliams PS, Jefcoate CR, Czuprynski CJ. 7,12-Dimethylbenz[a]
anthracene-induced bone marrow toxicity is p53-dependent. Toxicol Sci 2003; 74:85–92. PMID:
12730609
57. Buters JT, Mahadevan B, Quintanilla-Martinez L, Gonzalez FJ, Greim H, Baird WM, et al. Cytochrome
P450 1B1 determines susceptibility to dibenzo[a,l]pyrene-induced tumor formation. Chem Res Toxicol
2002; 15:1127–1135. PMID: 12230405
58. Galvez-Peralta M, Shi Z, Chen J, Miller ML, Nebert DM. Oral benzo[a]pyrene in Cyp1a1/1b1(-/-) dou-
ble-knockout mice: Microarray analysis during squamous cell carcinoma formation in preputial gland
duct. Int J Cancer 2013; 132:2065–2075. doi: 10.1002/ijc.27897 PMID: 23047765
59. Tsuchiya Y, Nakajima M, Yokoi T. Critical enhancer region to which AhR/ARNT and Sp1 bind in the
human CYP1B1 gene. J Biochem 2003; 133:583–592. PMID: 12801909
60. Maillot G, Lacroix-Triki M, Pierredon S, Gratadou L, Schmidt S, Benes V, et al. Widespread estrogen-
dependent repression of micrornas involved in breast tumor cell growth. Cancer Res 2009; 69:8332–
8340. doi: 10.1158/0008-5472.CAN-09-2206 PMID: 19826037
61. Ding L, Xu Y, Zhang W, Deng Y, Si M, Du Y, et al. MiR-375 frequently downregulated in gastric cancer
inhibits cell proliferation by targeting JAK2. Cell Res 2010; 20:784–793. doi: 10.1038/cr.2010.79 PMID:
20548334
62. Wang F, Li Y, Zhou J, Xu J, Peng C, Ye F, et al. miR-375 is down-regulated in squamous cervical can-
cer and inhibits cell migration and invasion via targeting transcription factor SP1. Am J Pathol 2011;
179:2580–2588. doi: 10.1016/j.ajpath.2011.07.037 PMID: 21945323
63. Liu AM, Poon RT, Luk JM. MicroRNA-375 targets Hippo-signaling effector YAP in liver cancer and
inhibits tumor properties. Biochem Biophys Res Commun 2010; 394:623–627. doi: 10.1016/j.bbrc.
2010.03.036 PMID: 20226166
64. Nishikawa E, Osada H, Okazaki Y, Arima C, Tomida S, Tatematsu Y, et al. miR-375 is activated by
ASH1 and inhibits YAP1 in a lineage-dependent manner in lung cancer. CancerRes 2011; 71:6165–
6173. doi: 10.1158/0008-5472.CAN-11-1020 PMID: 21856745
65. Li X, Lin R, Li J. Epigenetic silencing of microRNA-375 regulates PDK1 expressionin esophageal can-
cer. Dig Dis Sci 2011; 56:2849–2856. doi: 10.1007/s10620-011-1711-1 PMID: 21533613
66. Ward A, Balwierz A, Zhang JD, Kublbeck M, Pawitan Y, Hielscher T, et al. Re-expression of microRNA-
375 reverses both tamoxifen resistance and accompanying EMT-like properties in breast cancer.
Oncogene 2013; 32:1173–1182. doi: 10.1038/onc.2012.128 PMID: 22508479
CYP1B1 Induces EMT and Wnt/β-Cat Signaling via Sp1
PLOS ONE | DOI:10.1371/journal.pone.0151598 March 16, 2016 21 / 21
