SF3B1 and EIF1AX mutations occur in primary leptomeningeal melanocytic neoplasms; Yet another similarity to uveal melanomas

Abstract

Like uveal melanomas, primary leptomeningeal melanocytic neoplasms (LMNs) frequently carry GNAQ and GNA11 mutations. However, it is currently unknown whether these LMNs harbor mutations in BAP1, SF3B1 and/or EIF1AX like uveal melanomas as well. In this study, we used Sanger sequencing for the detection of mutations in SF3B1 (hotspots in exon 14 and 15) and EIF1AX (exon 1 and 2 and flanking intronic regions) in a series of 24 primary LMNs. Additionally, BAP1 immunohistochemistry was used as a surrogate marker for the detection of inactivating mutations in the BAP1 gene.
Mutations in either SF3B1 or EIF1AX were identified in 8 out of 24 primary LMNs (33 %). The presence of these mutations was mutually exclusive and occurred in primary LMNs of different malignancy grades (melanocytomas, intermediate-grade melanocytic tumors, melanomas). Complete absence of nuclear BAP1 staining as is typically seen in BAP1-mutated tumors was not observed.
Our finding that an SF3B1 or EIF1AX mutation is present in a substantial subset of primary LMNs underscores that these tumors genetically resemble uveal melanoma and are different from cutaneous melanoma at the genetic level. This information may not only aid in the differential diagnosis of primary versus metastatic melanocytic tumor in/around the central nervous system, but also in the identification of more promising therapeutic approaches targeting the molecular pathways involved in the oncogenesis of LMNs. As none of the primary LMNs in our series showed complete loss of nuclear BAP1 protein, it is unlikely that BAP1 mutations are frequent in these tumors but the role of this gene warrants further investigation.

Full text

R E S E A R C H Open Access
SF3B1 and EIF1AX mutations occur in
primary leptomeningeal melanocytic
neoplasms; yet another similarity to
uveal melanomas
Heidi V. N. Küsters-Vandevelde
1*
, David Creytens
2
, Adriana C. H. van Engen-van Grunsven
3
, Marcel Jeunink
1
,
Veronique Winnepenninckx
4
, Patricia J. T. A. Groenen
3
, Benno Küsters
3,4
,PieterWesseling
1,3,5
, Willeke A. M. Blokx
3
and Clemens F. M. Prinsen
1
Abstract
Introduction: Like uveal melanomas, primary leptomeningeal melanocytic neoplasms (LMNs) frequently carry GNAQ and
GNA11 mutations. However, it is currently unknown whether these LMNs harbor mutations in BAP1,SF3B1 and/or EIF1AX
like uveal melanomas as well. In this study, we used Sanger sequencing for the detection of mutations in SF3B1 (hotspots
in exon 14 and 15) and EIF1AX (exon 1 and 2 and flanking intronic regions) in a series of 24 primary LMNs. Additionally,
BAP1 immunohistochemistry was used as a surrogate marker for the detection of inactivating mutations in the BAP1 gene.
Results: Mutations in either SF3B1 or EIF1AX were identified in 8 out of 24 primary LMNs (33 %). The presence of these
mutations was mutually exclusive and occurred in primary LMNs of different malignancy grades (melanocytomas,
intermediate-grade melanocytic tumors, melanomas). Complete absence of nuclear BAP1 staining as is typically seen in
BAP1-mutated tumors was not observed.
Conclusions: Our finding that an SF3B1 or EIF1AX mutation is present in a substantial subset of primary LMNs underscores
that these tumors genetically resemble uveal melanoma and are different from cutaneous melanoma at the genetic level.
This information may not only aid in the differential diagnosis of primary versus metastatic melanocytic tumor in/around
the central nervous system, but also in the identification of more promising therapeutic approaches targeting the
molecular pathways involved in the oncogenesis of LMNs. As none of the primary LMNs in our series showed complete
loss of nuclear BAP1 protein, it is unlikely that BAP1 mutations are frequent in these tumors but the role of this gene
warrants further investigation.
Keywords: Leptomeningeal melanocytic neoplasms, Melanocytoma, Melanoma, Central nervous system, Neurocutaneous
melanocytosis, BAP1,SF3B1,EIF1AX
Introduction
Primary leptomeningeal melanocytic neoplasms (LMNs)
are infrequent tumors, forming a spectrum ranging
from benign or low-grade malignant melanocytomas
to frankly malignant melanomas [1]. These tumors
share molecular features with uveal melanomas (UMs).
In contrast to cutaneous melanomas (CMs), both
LMNs and UMs frequently carry mutations in the G
protein encoding genes GNAQ and GNA11,whereas
mutations in BRAF and in the TERT promoter are in-
frequent [2–8]. This situation reflects the heteroge-
neous molecular background of different groups of
melanoma and has important implications for tar-
geted therapy.
In the past years, inactivating mutations in the tumor
suppressor gene BAP1 (BRCA-associated protein 1) were
shown to be implicated in UM [9, 10]. The BAP1 gene is
located on chromosome 3p21.1 and encodes a nuclear
* Correspondence: h.kusters@cwz.nl
1
Department of Pathology, Canisius Wilhelmina Hospital, P.O. Box
90156500GS, Nijmegen, The Netherlands
Full list of author information is available at the end of the article
© 2016 Küsters-Vandevelde et al. Open Access This article is distributed under the terms of the Creative Commons Attribution
4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and
reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to
the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver
(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Küsters-Vandevelde et al. Acta Neuropathologica Communications (2016) 4:5
DOI 10.1186/s40478-016-0272-0
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

ubiquitinase involved in epigenetic modulation of chroma-
tin [11]. Somatic BAP1 mutations are predominantly
present in UMs with monosomy 3 (~85 %), the latter being
a strong predictor for metastatic disease [9, 10, 12]. In this
setting BAP1 functions as a tumor suppressor gene, with
loss of one copy of chromosome 3 and mutation in the
other BAP1 allele representing the two hits causing inacti-
vation of this gene. Indeed, in UMs with disomy 3 (and a
good prognosis), mutations in BAP1 are rare [6, 9, 10]. A
small proportion of patients with UM (~2–3%)har-
bor a germline mutation in BAP1 [13]. These patients
suffer from the BAP1 hereditary cancer syndrome and
have an increased risk of developing cutaneous melanocy-
tic tumors as well as a spectrum of non-melanocytic neo-
plasms including mesothelioma, renal cell carcinoma,
meningeoma, and adenocarcinoma of the lung [14, 15].
Very recently, it was suggested that primary leptomenin-
geal melanoma is part of this cancer predisposition syn-
drome as well [16].
Furthermore, recurrent hotspot mutations in the
SF3B1 gene (mainly at codon 625) and mutations of
the EIF1AX gene (spread over exon 1 and 2) were
recently reported in UMs, especially in tumors with
disomy 3 (up to 30 and 50 % of disomy 3 tumors,
respectively) [17–19]. These mutations in UMs ap-
peared to be largely mutually exclusively with BAP1
mutations, while in CMs these mutations were found
to be very infrequent (~1 %) [20].
It is currently unknown whether somatic mutations in
BAP1,SF3B1 and EIF1AX also characterize primary
LMNs. Using Sanger sequencing, we searched for muta-
tions in hotspot regions of SF3B1 (exon 14 and 15) and
exon 1 and 2 and flanking intronic regions of EIF1AX in
a series of 24 primary LMNs. Additionally, we per-
formed immunohistochemistry for the detection of
BAP1 protein loss as a surrogate marker for identifica-
tion of inactivating BAP1 mutations.
Materials and methods
Patients and histopathology
Formalin fixed and paraffin embedded (FFPE) tissue
samples of twenty-four primary LMNs were obtained
through the Dutch nationwide histopathology and cyto-
pathology data network and archive (PALGA) [21]. Hist-
ology was revised by HK; WHO 2007 criteria were used
for classification into melanocytoma, intermediate-grade
melanocytic tumor and melanoma [1]. Information on
mutation status of GNAQ,GNA11,BRAF,NRAS and
chromosome 3 status of cases #1–7, #10, #13–18, and
#22–24 has been published previously [2, 22, 23]. The
study was approved by the local ethics committees of
the Canisius Wilhelmina Hospital (ref.nr. LTC/TT/013–
2015) and Radboud University (CMO, ref.nr/Dossier-
nummer: 2015–1692).
DNA extraction
Representative regions of about five 4-μm-thick FFPE sec-
tions with an estimated tumor cell percentage of at least
70 % were manually dissected and used for DNA extraction.
After heating in ATL buffer, the tissue sections were incu-
bated in proteinase K for one hour, followed by subsequent
purification of the DNA according to the manufacturer
(QIAamp DNA Mini Kit, QIAGEN GmbH, Germany).
After DNA purification, possible melanin contamination
was removed by using an inhibitor removal kit (OneStep™
PCR Inhibitor Removal Kit, Zymo Research). The DNA
sample concentration was assessed spectrophotometrically
(Varian Cary 50 spectrophotometer, Agilent Technologies).
The integrity of the isolated DNA was tested by means of a
multiplex ladder PCR [24].
BAP1 immunohistochemistry
Immunohistochemistry was performed on 4-μm-thick
FFPE sections using an automated immunostainer
(Benchmark XT, Ventana Medical Systems, Tucson, AZ,
USA) according to the manufacturer’s instructions. Sec-
tions were immunostained with a primary monoclonal
antibody against BAP1 (clone C4, 1:100 dilution, Santa
Cruz Biotechnology, Dallas, TX, USA) using 3,3-diami-
nobenzidine (DAB) as chromogen. Selected cases that
showed a staining result that was difficult to interpret
including strongly pigmented tumors (patients #1–8,
#12–16, #22–24) were manually stained (clone C4, 1:50
dilution, Immunologic, Duiven, the Netherlands) accord-
ing to the manufacturer’s instructions. The VECTOR
NovaRED Peroxidase (HRP) Substrate Kit was used for
visualization (Vector Laboratories, USA, Catalogue
Number SK-4800). Nuclei of endothelial and lympho-
cytic cells in the slides served as positive internal control
for BAP1 protein expression. The staining results were
scored independently by three pathologists (HK, DC,
WB). The percentage of positive tumor cell nuclei was
scored only in areas with positive internal controls.
Mutation analysis
Sanger sequencing was used for analysis of mutations in
hotspot areas of SF3B1 including codon 625 and codon 700
as well as for mutations in exon 1 and 2 and flanking in-
tronic regions of EIF1AX. Primers are listed in Table 1. Nor-
mal tissue to exclude germline mutations was not available.
All primers contained a M13 forward or M13 reverse
consensus sequence for sequencing. PCR amplification
was performed in a total volume of 25 μl, containing
20 ng DNA, PCR Reaction Buffer with 20 mM MgCl2
(Roche), 200 μM of each deoxynucleotide triphosphate,
10 pmol of each primer and 2 units of FastStart Taq
DNA polymerase (Roche). DNA amplification was
performed in a Biometra T-Professional thermocycler
(Westburg). The PCR was started with 5 min. at 95 °C
Küsters-Vandevelde et al. Acta Neuropathologica Communications (2016) 4:5 Page 2 of 11
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

and followed with 40 cycles of denaturation 30 s at 95 °C,
annealing at 60 °C for 45 s and extension at 72 °C for 30 s,
followed by a final extension at 72 °C for 10 min. and
cooling down for 5 min. at 22 °C. All PCR products were
purified with ExoSAP-IT (Affymetrix). Two μl of the PCR
product was used for the sequence reaction on an ABI
PRISM 3500XL DNA analyzer (Applied Biosystems). Both
strands were sequenced using the M13 primers.
Information on BAP1 mutation status was available for
three patients (#20, #23, #24) (obtained by Sanger sequen-
cing as previously described) while the chromosome 3 sta-
tus was in part obtained from a previous MLPA study [22,
25]. For all cases, the mutation status of GNAQ and
GNA11 (codons 209 and 183), BRAF (codon 600) and
NRAS (codons 12, 13 and 61) was available, part of this in-
formation has been published previously [2, 22, 23].
Results
Patients and histology
Main patient characteristics are summarized in Table 2.
The study group consisted of thirteen melanocytomas,
seven intermediate-grade melanocytic tumors and four
primary leptomeningeal melanomas. A subset of the tu-
mors was strongly pigmented.
All patients were adults, the age at operation ranging
from 27–69 years. None of the patients had clinical evi-
dence of primary melanoma outside the CNS. One pa-
tient was known with a large congenital melanocytic
nevus in the buttocks in the context of neurocutaneous
melanocytosis (patient #21). Two of the patients in this
series developed liver metastases, both after an initial histo-
logical diagnosis of intermediate-grade melanocytic tumor
(patients #19 and #20). One melanoma patient developed
distant metastases to bones and lungs (patient #23).
BAP1 immunohistochemistry
BAP1 immunohistochemistry was available in 20 out of
24 cases. For three cases there was no FFPE material left
for immunohistochemistry (patients #9–11), while in
one patient the tumor showed intense pigmentation,
preventing reliable interpretation of staining results (pa-
tient #6). Only nuclear staining was considered as posi-
tive, although cytoplasmic staining was found in a
substantial subset of tumors as well. In two melanocyto-
mas (patients #1 and #4), a mosaic pattern with alternat-
ing positive and negative (areas of ) nuclear staining was
present, the vast majority (about 80 %) of these nuclei
being positive (Fig. 1a, b). All other cases showed mod-
erate to strong nuclear staining in 90 % or more of nu-
clei. Complete absence of nuclear BAP1 staining as is
typically seen in BAP1-mutated tumors was not ob-
served (Figs. 1, 2 and 3).
Mutation analysis
We detected a total of three mutations in SF3B1 (13 %),
including two hotspot mutations at codon 625 (R625C
and R625H) and one mutation affecting codon 634
(V634I) (Table 2). Mutations in codon 700 of SF3B1 were
not detected. In the cosmic database the V634I mutation
in SF3B1 (c.1900G > A (p.(Val634Ile))) has not been re-
ported in cancer before (http://cancer.sanger.ac.uk/cos
mic). This mutation was present in a GNAQ-mutated mel-
anocytoma of a 27-year-old male patient who developed
leptomeningeal seeding shortly after initial presentation
(patient #4) (Fig. 1a, b, e).
One case with mutation in codon 625 of SF3B1
(c.1873C > T (p.(Arg625Cys))) concerned an intermediate-
grade melanocytic tumor showing aggressive behavior
with leptomeningeal seeding (patient #18). A concomitant
GNA11 mutation was present in this tumor while immu-
nohistochemistry showed intact nuclear BAP1 expression
(Fig. 1c, d, f).
The other mutation in codon 625 of SF3B1
(c.1874G > A (p.(Arg625His))) was present in a CNS
melanoma of a 31-year-old woman (patient #21). Since
birth this patient was known with a large congenital mela-
nocytic nevus on the buttocks for which multiple excisions
had been performed, confirming melanocytic nevus with-
out malignant transformation. At the age of 29, she devel-
oped an intracranial tumor in the left frontal region with
diffuse leptomeningeal extension. Biopsy showed melan-
oma in a background of diffuse melanocytosis, consistent
with the diagnosis of primary melanoma of the CNS occur-
ring in the context of neurocutaneous melanocytosis. This
was supported by the presence of an NRAS mutation in
boththeCNSmelanomaandinamorerecentbiopsyof
the melanocytic nevus (c.182A > G (p.(Gln61Arg))). In con-
trast, the SF3B1 mutation (c.1874G > A (p.(Arg625His)))
was present in the CNS melanoma but not in the melano-
cytic nevus. Immunohistochemically, intact BAP1 protein
expression was found in the tumor cell nuclei of this
melanoma (Fig. 2).
A point mutation in EIF1AX was detected in five of
the primary LMNs in this series (21 %), each leading to
Table 1 Primers used for mutational analysis
Gene Exon Forward (Fw)
Reverse (Rv)
Primer sequence 5′-3′
SF3B1 14 Fw TGATTATGGAAAGAAATGGTTGAAG
Rv AGGGCAATAAAGAAGGAATGC
SF3B1 15 Fw TGCAGTTTGGCTGAATAGTTG
Rv GGCCAAAGCACTGATGGT
EIF1AX 1 Fw CCCCTCGGAGCAGCAG
Rv CCTGGGTGACCTGCAATCTAC
EIF1AX 2 Fw GCCTTAATTTCATTTTATTTCATACTGTTT
Rv AGGATGTTATTTTAAAAAGCGTAATTT
Küsters-Vandevelde et al. Acta Neuropathologica Communications (2016) 4:5 Page 3 of 11
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Table 2 Patient characteristics and results of immunohistochemistry and mutation analyses
Patient Sex Age Diagnosis Location BAP1
immunostaining
Chrom 3 SF3B1 exon 14
(codon 625)
SF3B1 exon 15
(codon 700)
EIF1AX exon 1 EIF1AX exon 2 Follow-up
1 F 27 MC Right CPA + (80 %) disomy wt wt Intronc.1–
4C > T
wt local recurrence
2
a
M 41 MC C0-C3 + disomy wt wt c.9G > C
(p.(Lys3Asn))
wt local recurrence and LM seeding 3 years
after diagnosis
3
a
M 47 MC Extramedullary,
intradural
+ disomy wt wt wt na local recurrence and LM seeding shortly after
initial presentation
4
a
M 27 MC Tentorium
cerebelli
+ (80 %) na c.1900G > A
(p.(Val634Ile))
wt wt na LM seeding shortly after initial presentation
5 M 38 MC C5–6 + na wt na na na tumor spread in neck and vertebra; deceased
6
a
M 41 MC Th6 na na wt wt na na local recurrence; no distant metastasis
7
a
V 57 MC Th11 + disomy wt wt wt wt unknown
8
b
F 62 MC C0-C1 + na wt wt wt wt unknown
9 F 23 MC Fossa posterior na na wt wt wt wt local recurrence after 2 years
10
a
M55MC C3–6 na na wt wt wt na local recurrence 8 years after diagnosis
11
a
M na MC Spinal region na na wt wt wt wt unknown
12 M 69 MC Conus
medullaris
+ na wt wt wt wt alive
13 M 37 MC Left CPA + na wt wt wt wt unknown
14
b
F 68 IMT Tentorium
cerebelli
+ disomy wt wt c.11A > G
(p.(Asn4Ser))
wt deceased (not disease related)
15
a
V 44 IMT Cauda + disomy wt wt wt wt stable (no recurrence)
16
a
M 41 IMT Intramedullary
(NOS)
+ disomy wt wt wt c.25G > C
(p.(Gly9Arg))
local recurrence and LM seeding
17
b
V 59 IMT Vermis
cerebelli
+ na wt wt wt wt unknown
18
b
F 30 IMT Th10–11 + disomy c.1873C > T
(p.(Arg625Cys))
wt wt wt leptomeningeal seeding; deceased (disease
related)
19
a
F 53 IMT Th9 + na wt wt wt c.28A > G
(p.(Lys10Glu))
liver metastasis shortly after diagnosis
20
a,e
F 48 IMT Cervical spinal
region
+ disomy wt wt wt wt local recurrence after 3 years; distant
metastasis to liver and pancreas 1 year later;
deceased 5 years after initial presentation
21
c
F 31 MM Frontal left + disomy c.1874G > A
(p.(Arg625His))
d
wt wt neurocutaneous melanocytosis patient; the
SF3B1 mutation was only present in the CNS
melanoma and not in the congenital
melanocytic nevus of the skin
Küsters-Vandevelde et al. Acta Neuropathologica Communications (2016) 4:5 Page 4 of 11
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Table 2 Patient characteristics and results of immunohistochemistry and mutation analyses (Continued)
22
a
M 62 MM Th7–9 + na na na c.9G > C
(p.(Lys3Asn))
na unknown
23
a,e
F 59 MM S2 + Monosomy
3
wt wt wt wt distant metastases after 2 years (bone, lungs);
liver metastasis unknown
24
a,e
M 55 MM L1-L2 + na wt wt wt wt leptomeningeal seeding 1 year after initial
presentation; no distant metastases; deceased
Information on GNAQ/GNA11 mutation status and chromosome 3 status of cases 1–7, 10, 13–18, and 22–24 has been published previously [2,22,23]
Ffemale, Mmale, MC melanocytoma, IMT intermediate-grade melanocytic tumor, MM melanoma, LM leptomeningeal, na not available (BAP1 immunohistochemistry of cases #9–11) or not assessable, CPA
cerebello-pontine angle
+ positive nuclear staining in 90 % or more of nuclei
a
GNAQ
Q209
or
b
GNA11
Q209
or
c
NRAS
Q61
mutation present
d
the SF3B1 mutation was not present in the congenital melanocytic nevus of this neurocutaneous melanocytosis patient
e
cases for which all 17 exons of the BAP1 gene were tested with Sanger sequencing and no mutations were detected
Küsters-Vandevelde et al. Acta Neuropathologica Communications (2016) 4:5 Page 5 of 11
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

an amino acid substitution (at codons 3, 4, 9 or 10).
These mutations occurred in tumors diagnosed as mela-
nocytomas, intermediate-grade tumors, and melanomas
(Fig. 3). In addition, one point mutation was detected in
the Kozak consensus sequence of exon 1 (c.1–4C > T)
which may have an influence on the start of translation
(patient #1). EIF1AX mutations were mutually exclusive
with SF3B1 mutations and generally co-occurred with
GNAQ or GNA11 mutations (Table 2).
Discussion
In this study we investigated whether primary LMNs
share genetic alterations with UMs in addition to GNAQ
and GNA11 mutations. Recently, a role for BAP1 in
primary melanoma of the CNS was suggested based on
the identification of a BAP1 germline mutation in a pa-
tient with primary CNS melanoma with monosomy 3
and a family history of UM and meningioma [16]. In our
study, we chose for BAP1 immunohistochemistry as a
surrogate marker for the identification of an underlying
inactivating BAP1 mutation as it offers an economical
and faster alternative to sequence analysis of all 17
exons of BAP1 [12, 26, 27]. Typically, complete loss
of nuclear BAP1 expression is found in BAP1-mu-
tated UMs [12, 26–28]. None of the samples in our
series showed such complete loss of nuclear BAP1
staining, suggesting absence of underlying BAP1 mu-
tations. In three cases (including the single patient
Fig. 1 Examples of SF3B1 mutation in a primary leptomeningeal melanocytoma and intermediate-grade melanocytic tumor. a. Hematoxylin-and-
Eosin (H&E) staining of the melanocytoma of patient #4 showing round to oval, slightly pleomorphic, vesicular nuclei, often with a prominent
nucleolus, and with dispersed melanin pigment in the cytoplasm of the tumor cells. b. BAP1 immunostaining of this melanocytoma revealed
heterogeneous staining of the tumor cell nuclei, the majority of these nuclei being positive. The arrows indicate nuclear staining in endothelial
cells. Note that the tumor cells also show variable cytoplasmic staining. c. H&E staining of the intermediate-grade melanocytic tumor of patient
#18 showing a proliferation of spindle cells with invasion in glial tissue (at the right). d. BAP1 immunostaining of the tumor depicted in (c) reveals
positive nuclei in more than 90 % of tumor cells. The arrows indicate nuclear staining in endothelial cells. e. Forward sequence tracing surrounding
codon 634 of SF3B1 showing the c.1900G > A (p.(Val634Ile)) mutation detected in the tumor depicted in (a)and(b). f. Forward sequence tracing
surrounding codon 625 of SF3B1 showing the c.1873C >T (p.(Arg625Cys)) mutation present in the tumor depicted in (c) and (d)
Küsters-Vandevelde et al. Acta Neuropathologica Communications (2016) 4:5 Page 6 of 11
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

with monosomy 3 in the LMN and the patient with
liver metastases but disomy 3 in the LMN), BAP1
mutation status was available through Sanger sequen-
cing analyses and confirmed absence of mutations.
However, our study has some limitations. In some
cases, BAP1 mutations may still have been missed as
BAP1 immunohistochemistry was reported to have a
sensitivity of ~ 88 % [12]. Also, very rarely, heteroge-
neous (‘mosaic’) BAP1 nuclear immunostaining has
been described in UM cases with a BAP1 mutation
showing loss of nuclear staining in only 20 % of nu-
clei [12]. In our series, two cases showed nuclear
BAP1 staining in about 80 % of tumor cells and an
underlying BAP1 mutation can thus not completely
beruledout.Furthermore,asBAP1 is mainly
implicated in metastatic UM with monosomy 3, there
might be a selection bias in our patient group as it
mainly concerns (relatively) low-grade tumors with di-
somy for chromosome 3. A larger number of primary
LMNs with monosomy 3 should thus be investigated
to further explore the role of BAP1 in these neo-
plasms. This is also important for therapeutic reasons
as epigenetic modulators such as histone deacetylase
(HDAC) inhibitors were shown to reverse the bio-
chemical effects of BAP1 mutations in UM cells by
inducing growth arrest and differentiation. Clinical
trials are now evaluating HDAC inhibitors as a thera-
peutic option in UM patients [13, 29].
Recurrent mutations in the SF3B1 gene have been de-
tected in several types of cancer such as UMs, breast
Fig. 2 SF3B1 mutation in primary leptomeningeal melanoma in a patient with neurocutaneous melanocytosis. a. H&E staining of the primary
LMN diagnosed as melanoma; the arrows indicate mitotic figures (patient #21). b. H&E staining of the congenital melanocytic nevus of the
buttocks; in the right lower corner higher magnification of the superficial part of the nevus with a proliferation of bland nevoid cells. c. BAP1
immunostaining of the melanoma depicted in (a) with nuclear staining in more than 90 % of tumor cells. d. Sequence tracing surrounding
codon 61 of NRAS showing a c.182A >G (p.(Gln61Arg)) mutation present in both the CNS melanoma as well as in the congenital melanocytic
nevus (reverse sequence/antisense strand). e. Forward sequence tracing surrounding codon 625 of SF3B1 showing a c.1874G > A (p.(Arg625His))
mutation in the CNS melanoma. f. The SF3B1 mutation depicted in (e) is absent in the congenital melanocytic nevus of this patient
Küsters-Vandevelde et al. Acta Neuropathologica Communications (2016) 4:5 Page 7 of 11
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

and pancreatic carcinoma, and hematological diseases
like CLL and MDS [18, 30–33]. These mutations affect
hotspot codons, the hotspot being associated with can-
cer type. For example, codon 700 mutations are fre-
quently present in CLL and MDS, while in UMs codon
625 is much more frequently involved [18, 34]. Espe-
cially in low-grade UMs with disomy for chromosome 3,
heterozygous mutations in SF3B1 are present in 10 to
30 % of UM [6, 17–19]. The fact that in UMs these
SF3B1 mutations are almost mutually exclusive with
BAP1 mutations suggests different pathways in the
oncogenesis and/or malignant progression of these neo-
plasms. SF3B1 encodes subunit 1 of splicing factor 3b,
which is a component of the spliceosome that
participates in splicing of pre-mRNA. It was shown that
SF3B1 mutations are associated with differential alterna-
tive splicing of several protein encoding genes in UMs
[19]. Moreover, SF3B1 mutant cell lines were found to
be sensitive to the SF3b complex inhibitor spliceostatin
A, suggesting a new therapeutic target in tumors carry-
ing this mutation [32]. Up to now, it was unknown
whether SF3B1 mutations also occur in primary LMNs.
In our series, in three out of 24 cases (13 %) an SF3B1
mutation affecting codon 625 or 634 was detected, this
is at the lower end of the range of the frequency of
SF3B1 mutations reported in UMs (10–30 %) and in
contrast to the very low frequency reported for CMs
(~1 %) [6, 17–20]. As far as could be assessed, all three
Fig. 3 Examples of EIF1AX mutation in a primary leptomeningeal melanocytoma and intermediate-grade melanocytic tumor. a. H&E staining of
the melanocytoma of patient #2, consisting of epithelioid cells with moderate to strong melanin pigmentation. b. BAP1 immunostaining of the
melanocytoma depicted in A revealing positive staining of nuclei in more than 90 % of tumor cells. The arrows indicate nuclear staining in
endothelial cells. Note that cytoplasmic staining is also present. c. H&E staining of the intermediate-grade melanocytic tumor of patient #19 showing
a nested proliferation of epithelioid cells; the arrow indicates a mitotic figure. d. BAP1 immunostaining of the intermediate-grade melanocytic tumor
depicted in C revealing positive staining of nuclei in more than 90 % of tumor cells. e. Forward sequence tracing surrounding codon 3 of EIF1AX
showing a c.9G >C (p.(Lys3Asn)) mutation in the melanocytoma depicted in (a) and (b). f. Forward sequence tracing surrounding codon 10 of EIF1AX
showing a c.28A > G (p.(Lys10Glu)) mutation in the intermediate-grade melanocytic tumor depicted in (c) and (d)
Küsters-Vandevelde et al. Acta Neuropathologica Communications (2016) 4:5 Page 8 of 11
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

LMNs showing an SF3B1 mutation were tumors with
disomy for chromosome 3. Furthermore, like in UMs, in
two cases the SF3B1 mutation co-occurred with a
GNAQ or GNA11 mutation, while in a third case (with
neurocutaneous melanocytosis) an NRAS mutation was
present. The GNAQ,GNA11 and NRAS genes are now
thought to play a role in the initiation of tumorigenesis,
while mutation in SF3B1 (or BAP1) would then occur in
a later phase of the oncogenic process [18]. The co-
occurrence of an NRAS and an SF3B1 mutation in the
CNS melanoma of the neurocutaneous melanocytosis
patient in our study is interesting in this respect as the
SF3B1 mutation was absent in the congenital melanocy-
tic nevus of this patient. Patients with neurocutaneous
melanocytosis have a large and/or multiple congenital
melanocytic nevi of the skin in association with a pri-
mary LMN [1]. Instead of GNAQ or GNA11 mutations,
these patients frequently demonstrate identical NRAS
mutations in both the congenital melanocytic nevus and
in the LMN [35, 36]. This is thought to be the result of
an NRAS-mutated clone of melanocyte precursors mi-
grating to skin and CNS early in embryogenesis [37].
The observation that the SF3B1 mutation was not
present in the melanocytic nevus of this patient suggests
that it indeed plays a role later on in tumorigenesis. In
addition, all three mutations in SF3B1 in our study were
found in tumors which clinically showed aggressive
behavior. However, the number of patients and the
follow-up in our study are too limited to allow for firm
conclusions about a prognostic role of SF3B1 in this set-
ting. Of note, in one of the three patients the SF3B1
mutation (c.1900G > A (p.(Val634Ile))) was present in a
neoplasm diagnosed as melanocytoma, suggesting that
SF3B1 mutations are not necessarily associated with
worrisome histology.
Several recent studies have reported mutations in
EIF1AX in different cancer types, including melanoma
and thyroid and ovarian cancer [17, 38, 39]. In UMs,
heterozygous mutations in exon 1 and 2 of EIF1AX have
reported to occur especially in tumors with disomy for
chromosome 3 (up to 48 % of these tumors) [17]. Muta-
tions may occur in different loci of these exons and lead
to amino acid substitutions or short deletions. Rarely
splice site mutations have been reported [6, 10, 17].
EIF1AX encodes the eukaryotic translation initiation fac-
tor 1A (eIF1A), which is involved in initiation phase of
translation of eukaryotic cells by stabilizing the forma-
tion of the functional ribosome around the AUG start
codon. The exact role of EIF1AX mutations in tumori-
genesis is currently not well understood but it has been
suggested that mutations in EIF1AX could diminish the
rate of bulk translation [17, 40]. In our series of primary
LMNs we found a relatively high frequency of EIF1AX
missense mutations (21 %) which is in the range
reported for UM (19–48 %) [6, 17]. In contrast, EIF1AX
mutations are very rare in CM (5/231, ~2 %) [20]. As in
UMs, as far as could be assessed in our series, these mu-
tations occurred in primary LMNs with disomy for
chromosome 3 and were mutually exclusive with SF3B1
mutations, but co-occurred with GNAQ or GNA11 mu-
tations. In addition (and like SF3B1 mutations), the
EIF1AX mutations in our cases occurred both in mela-
nocytomas as well as melanomas, suggesting that they
are not necessarily associated with worrisome histology,
but the prognostic implications of these mutations re-
main to be elucidated. Finally, the EIF1AX and SF3B1
mutations in LMNs occurred in hotspot regions of these
genes, and in UMs such mutations were shown to be
somatic in origin [17, 18]. However, as non-neoplastic
tissue of the patients with LMNs was not available for
further testing, strictly speaking we cannot rule out the
possibility that in some of these cases it concerned a
germline mutation.
Conclusions
We report for the first time that a substantial subset of
LMNs carries a mutation in SF3B1 or EIF1AX. Like in
UMs, SF3B1 or EIF1AX mutations are mutually exclu-
sive and generally co-occur with either a GNAQ or
GNA11 mutation (SF3B1 occasionally with NRAS muta-
tion), suggesting that SF3B1 and EIF1AX mutations
occur later on in the tumorigenesis. Our findings may
offer novel therapeutic strategies for especially patients
with SF3B1-mutated LMNs. The role of BAP1 in the
pathogenesis of primary LMNs is less clear, immunohis-
tochemistry suggests that BAP1 mutation is infrequent
in tumors with disomy for chromosome 3. However,
more detailed analysis is needed for further elucidation
of the role of BAP1 in the oncogenesis of primary
LMNs. Demonstration of BAP1 mutations in primary
LMNs would potentially have therapeutic relevance as
well, as epigenetic modulators are now being evalu-
ated in patients with BAP1-mutant UMs. All in all,
this study thus underscores the genetic resemblance
of primary LMNs and UMs and provides some add-
itional clues for the diagnosis of and therapeutic
interference with these tumors.
Abbreviations
CNS: Central nervous system; CM: Cutaneous melanoma; FFPE: Formalin
fixed and paraffin embedded; HDAC: Histone deacetylase inhibitors;
LM: Leptomeningeal; LMN: Leptomeningeal melanocytic neoplasms;
UM: Uveal melanoma.
Competing interests
The authors declare that they have no competing interest.
Authors’contribution
HK, CP, WB, PW, BK, and PG contributed substantially to conception and
design of the study. All authors contributed substantially to acquisition of
data, and analysis and interpretation of data. HK wrote and edited the
Küsters-Vandevelde et al. Acta Neuropathologica Communications (2016) 4:5 Page 9 of 11
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

manuscript. All authors contributed in drafting the manuscript and revising it
for intellectual content. MJ carried out the molecular genetic analyses. CP
supervised the molecular genetic analyses. DC, VW, WB, BK, and HK
supervised and scored the BAP1 immunohistochemistry. HK revised
histology. All authors read and approved the final version of the manuscript.
Acknowledgments
We thank Pieter Vandevelde for technical assistance with the lay-out of the
figures.
Author details
1
Department of Pathology, Canisius Wilhelmina Hospital, P.O. Box
90156500GS, Nijmegen, The Netherlands.
2
Department of Pathology, Ghent
University Hospital, De Pintelaan 185, 9000 Ghent, Belgium.
3
Department of
Pathology, Radboud University Medical Center, P.O. Box 91016500HB,
Nijmegen, The Netherlands.
4
Department of Pathology, Maastricht University
Medical Center, P.O. Box 58006202AZ, Maastricht, The Netherlands.
5
Department of Pathology, VU University Medical Center, P.O. Box
70571007MB, Amsterdam, The Netherlands.
Received: 6 December 2015 Accepted: 4 January 2016
References
1. Brat DJ, Perry A. Melanocytic lesions. In: Louis DN, Ohgaki H, Wiestler OD,
Cavenee WK, editors. WHO classification of tumours of the central nervous
system. Lyon: IARC; 2007. p. 181–3.
2. Kusters-Vandevelde HV, Klaasen A, Kusters B, Groenen PJ, van Engen-van
Grunsven IA, van Dijk MR, et al. Activating mutations of the GNAQ gene: a
frequent event in primary melanocytic neoplasms of the central nervous
system. Acta Neuropathol. 2010;119:317–23. doi:10.1007/s00401-009-0611-3.
3. Van Raamsdonk CD, Bezrookove V, Green G, Bauer J, Gaugler L, O’Brien JM,
et al. Frequent somatic mutations of GNAQ in uveal melanoma and blue
naevi. Nature. 2009;457:599–602. doi:10.1038/nature07586.
4. Murali R, Wiesner T, Rosenblum MK, Bastian BC. GNAQ and GNA11
mutations in melanocytomas of the central nervous system. Acta
Neuropathol. 2012;123:457–9. doi:10.1007/s00401-012-0948-x.
5. Gessi M, van de Nes J, Griewank K, Barresi V, Buckland ME, Kirfel J, et al.
Absence of TERT promoter mutations in primary melanocytic tumours of
the central nervous system. Neuropathol Appl Neurobiol. 2014;40:794–7.
doi:10.1111/nan.12138.
6. Dono M, Angelini G, Cecconi M, Amaro A, Esposito AI, Mirisola V, et al.
Mutation frequencies of GNAQ, GNA11, BAP1, SF3B1, EIF1AX and TERT in
uveal melanoma: detection of an activating mutation in the TERT gene
promoter in a single case of uveal melanoma. Br J Cancer. 2014;110:1058–65.
doi:10.1038/bjc.2013.804.
7. Van Raamsdonk CD, Griewank KG, Crosby MB, Garrido MC, Vemula S,
Wiesner T, et al. Mutations in GNA11 in Uveal Melanoma. N Engl J Med.
2010;363:2191–9. doi:10.1059/NEJMoa1000584.
8. Griewank KG, Murali R, Puig-Butille JA, Schilling B, Livingstone E, Potrony M,
et al. TERT promoter mutation status as an independent prognostic factor in
cutaneous melanoma. J Natl Cancer Inst. 2014;106:doi:10.1093/jnci/dju246.
9. Harbour JW, Onken MD, Roberson ED, Duan S, Cao L, Worley LA, et al.
Frequent mutation of BAP1 in metastasizing uveal melanomas. Science.
2010;330:1410–3. doi:10.1126/science.1194472.
10. Ewens KG, Kanetsky PA, Richards-Yutz J, Purrazzella J, Shields CL, Ganguly T,
et al. Chromosome 3 status combined with BAP1 and EIF1AX mutation
profiles are associated with metastasis in uveal melanoma. Invest
Ophthalmol Vis Sci. 2014;55:5160–7. doi:10.1167/iovs.14-14550.
11. Scheuermann JC, de Ayala Alonso AG, Oktaba K, Ly-Hartig N, McGinty RK,
Fraterman S, et al. Histone H2A deubiquitinase activity of the Polycomb
repressive complex PR-DUB. Nature. 2010;465:243–7. doi:10.1038/nature08966.
12. Koopmans AE, Verdijk RM, Brouwer RW, van den Bosch TP, van den Berg
MM, Vaarwater J, et al. Clinical significance of immunohistochemistry for
detection of BAP1 mutations in uveal melanoma. Mod Pathol. 2014;27:
1321–30. doi:10.1038/modpathol.2014.43.
13. Field MG, Harbour JW. Recent developments in prognostic and predictive
testing in uveal melanoma. Curr Opin Ophthalmol. 2014;25:234–9. doi:10.
1097/ICU.0000000000000051.
14. Abdel-Rahman MH, Pilarski R, Cebulla CM, Massengill JB, Christopher BN,
Boru G, et al. Germline BAP1 mutation predisposes to uveal melanoma,
lung adenocarcinoma, meningioma, and other cancers. J Med Genet. 2011;
48:856–9. doi:10.1136/jmedgenet-2011-100156.
15. Carbone M, Ferris LK, Baumann F, Napolitano A, Lum CA, Flores EG, et al.
BAP1 cancer syndrome: malignant mesothelioma, uveal and cutaneous
melanoma, and MBAITs. J Transl Med. 2012;10:179. doi:10.1186/1479-5876-10-179.
16. de la Fouchardiere A, Cabaret O, Petre J, Aydin S, Leroy A, de Potter P,
et al. Primary leptomeningeal melanoma is part of the BAP1-related cancer
syndrome. Acta Neuropathol. 2015;129:921–3. doi:10.1007/s00401-015-1423-2.
17. Martin M, Masshofer L, Temming P, Rahmann S, Metz C, Bornfeld N, et al.
Exome sequencing identifies recurrent somatic mutations in EIF1AX and
SF3B1 in uveal melanoma with disomy 3. Nat Genet. 2013;45:933–6.
doi:10.1038/ng.2674.
18. Harbour JW, Roberson ED, Anbunathan H, Onken MD, Worley LA, Bowcock
AM. Recurrent mutations at codon 625 of the splicing factor SF3B1 in uveal
melanoma. Nat Genet. 2013;45:133–5. doi:10.1038/ng.2523.
19. Furney SJ, Pedersen M, Gentien D, Dumont AG, Rapinat A, Desjardins L, et
al. SF3B1 mutations are associated with alternative splicing in uveal
melanoma. Cancer Discov. 2013;3:1122–9. doi:10.1158/2159-8290.cd-13-0330.
20. Kong Y, Krauthammer M, Halaban R. Rare SF3B1 R625 mutations in
cutaneous melanoma. Melanoma Res. 2014;24:332–4. doi:10.1097/cmr.
0000000000000071.
21. Casparie M, Tiebosch AT, Burger G, Blauwgeers H, van de Pol A, van Krieken
JH, et al. Pathology databanking and biobanking in The Netherlands, a
central role for PALGA, the nationwide histopathology and cytopathology
data network and archive. Cell Oncol. 2007;29:19–24.
22. Kusters-Vandevelde HV, van Engen-van Grunsven IA, Coupland SE, Lake SL,
Rijntjes J, Pfundt R, et al. Mutations in g protein encoding genes and
chromosomal alterations in primary leptomeningeal melanocytic neoplasms.
Pathol Oncol Res. 2015;21:439–47. doi:10.1007/s12253-014-9841-3.
23. Kusters-Vandevelde HV, van Engen-van Grunsven IA, Kusters B, van Dijk MR,
Groenen PJ, Wesseling P, et al. Improved discrimination of melanotic
schwannoma from melanocytic lesions by combined morphological
and GNAQ mutational analysis. Acta Neuropathol. 2010;120:755–64.
doi:10.1007/s00401-010-0749-z.
24. van Dongen JJ, Langerak AW, Bruggemann M, Evans PA, Hummel M,
Lavender FL, et al. Design and standardization of PCR primers and protocols
for detection of clonal immunoglobulin and T-cell receptor gene
recombinations in suspect lymphoproliferations: report of the BIOMED-2
Concerted Action BMH4-CT98-3936. Leukemia. 2003;17:2257–317.
doi:10.1038/sj.leu.2403202.
25. van Engen-van Grunsven AC, Baar MP, Pfundt R, Rijntjes J, Kusters-
Vandevelde HV, Delbecq AL, et al. Whole-genome copy-number analysis
identifies new leads for chromosomal aberrations involved in the
oncogenesis and metastastic behavior of uveal melanomas. Melanoma Res.
2015;25:200–9. doi:10.1097/CMR.0000000000000152.
26. Kalirai H, Dodson A, Faqir S, Damato BE, Coupland SE. Lack of BAP1 protein
expression in uveal melanoma is associated with increased metastatic risk
and has utility in routine prognostic testing. Br J Cancer. 2014;111:1373–80.
doi:10.1038/bjc.2014.417.
27. Shah AA, Bourne TD, Murali R. BAP1 protein loss by immunohistochemistry:
a potentially useful tool for prognostic prediction in patients with uveal
melanoma. Pathology. 2013;45:651–6. doi:10.1097/pat.0000000000000002.
28. van Essen TH, van Pelt SI, Versluis M, Bronkhorst IH, van Duinen SG,
Marinkovic M, et al. Prognostic parameters in uveal melanoma and their
association with BAP1 expression. Br J Ophthalmol. 2014;98:1738–43.
doi:10.1136/bjophthalmol-2014-305047.
29. Landreville S, Agapova OA, Matatall KA, Kneass ZT, Onken MD, Lee RS, et al.
Histone deacetylase inhibitors induce growth arrest and differentiation
in uveal melanoma. Clin Cancer Res. 2012;18:408–16. doi:10.1158/1078-
0432.ccr-11-0946.
30. Yoshida K, Ogawa S. Splicing factor mutations and cancer. Wiley Interdiscip
Rev RNA. 2014;5:445–59. doi:10.1002/wrna.1222.
31. Biankin AV, Waddell N, Kassahn KS, Gingras MC, Muthuswamy LB, Johns AL,
et al. Pancreatic cancer genomes reveal aberrations in axon guidance
pathway genes. Nature. 2012;491:399–405. doi:10.1038/nature11547.
32. Maguire SL, Leonidou A, Wai P, Marchio C, Ng CK, Sapino A, et al. SF3B1
mutations constitute a novel therapeutic target in breast cancer. J Pathol.
2015;235:571–80. doi:10.1002/path.4483.
33. Wang L, Lawrence MS, Wan Y, Stojanov P, Sougnez C, Stevenson K, et al.
SF3B1 and other novel cancer genes in chronic lymphocytic leukemia.
N Engl J Med. 2011;365:2497–506. doi:10.1056/NEJMoa1109016.
Küsters-Vandevelde et al. Acta Neuropathologica Communications (2016) 4:5 Page 10 of 11
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

34. Malcovati L, Papaemmanuil E, Bowen DT, Boultwood J, Della Porta MG,
Pascutto C, et al. Clinical significance of SF3B1 mutations in myelodysplastic
syndromes and myelodysplastic/myeloproliferative neoplasms. Blood. 2011;
118:6239–46. doi:10.1182/blood-2011-09-377275.
35. Pedersen M, Kusters-Vandevelde HV, Viros A, Groenen PJ, Sanchez-Laorden
B, Gilhuis JH, et al. Primary melanoma of the CNS in children is driven by
congenital expression of oncogenic NRAS in melanocytes. Cancer Discov.
2013;3:458–69. doi:10.1158/2159-8290.CD-12-0464.
36. Kinsler VA, Thomas AC, Ishida M, Bulstrode NW, Loughlin S, Hing S, et al.
Multiple congenital melanocytic nevi and neurocutaneous melanosis are
caused by postzygotic mutations in codon 61 of NRAS. J Invest Dermatol.
2013;133:2229–36. doi:10.1038/jid.2013.70.
37. Kusters-Vandevelde HV, Kusters B, van Engen-van Grunsven AC, Groenen PJ,
Wesseling P, Blokx WA. Primary melanocytic tumors of the central nervous
system: a review with focus on molecular aspects. Brain Pathol. 2015;25:
209–26. doi:10.1111/bpa.12241.
38. Hunter SM, Anglesio MS, Ryland GL, Sharma R, Chiew YE, Rowley SM, et al.
Molecular profiling of low grade serous ovarian tumours identifies novel
candidate driver genes. Oncotarget. 2015;6:37663–77. doi:10.18632/
oncotarget.5438.
39. Kunstman JW, Juhlin CC, Goh G, Brown TC, Stenman A, Healy JM, et al.
Characterization of the mutational landscape of anaplastic thyroid
cancer via whole-exome sequencing. Hum Mol Genet. 2015;24:2318–29.
doi:10.1093/hmg/ddu749.
40. Chaudhuri J, Si K, Maitra U. Function of eukaryotic translation initiation
factor 1A (eIF1A) (formerly called eIF-4C) in initiation of protein synthesis.
J Biol Chem. 1997;272:7883–91.
• We accept pre-submission inquiries
• Our selector tool helps you to find the most relevant journal
• We provide round the clock customer support
• Convenient online submission
• Thorough peer review
• Inclusion in PubMed and all major indexing services
• Maximum visibility for your research
Submit your manuscript at
www.biomedcentral.com/submit
Submit your next manuscript to BioMed Central
and we will help you at every step:
Küsters-Vandevelde et al. Acta Neuropathologica Communications (2016) 4:5 Page 11 of 11
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

1.
2.
3.
4.
5.
6.
Terms and Conditions
Springer Nature journal content, brought to you courtesy of Springer Nature Customer Service Center GmbH (“Springer Nature”).
Springer Nature supports a reasonable amount of sharing of research papers by authors, subscribers and authorised users (“Users”), for small-
scale personal, non-commercial use provided that all copyright, trade and service marks and other proprietary notices are maintained. By
accessing, sharing, receiving or otherwise using the Springer Nature journal content you agree to these terms of use (“Terms”). For these
purposes, Springer Nature considers academic use (by researchers and students) to be non-commercial.
These Terms are supplementary and will apply in addition to any applicable website terms and conditions, a relevant site licence or a personal
subscription. These Terms will prevail over any conflict or ambiguity with regards to the relevant terms, a site licence or a personal subscription
(to the extent of the conflict or ambiguity only). For Creative Commons-licensed articles, the terms of the Creative Commons license used will
apply.
We collect and use personal data to provide access to the Springer Nature journal content. We may also use these personal data internally within
ResearchGate and Springer Nature and as agreed share it, in an anonymised way, for purposes of tracking, analysis and reporting. We will not
otherwise disclose your personal data outside the ResearchGate or the Springer Nature group of companies unless we have your permission as
detailed in the Privacy Policy.
While Users may use the Springer Nature journal content for small scale, personal non-commercial use, it is important to note that Users may
not:
use such content for the purpose of providing other users with access on a regular or large scale basis or as a means to circumvent access
control;
use such content where to do so would be considered a criminal or statutory offence in any jurisdiction, or gives rise to civil liability, or is
otherwise unlawful;
falsely or misleadingly imply or suggest endorsement, approval , sponsorship, or association unless explicitly agreed to by Springer Nature in
writing;
use bots or other automated methods to access the content or redirect messages
override any security feature or exclusionary protocol; or
share the content in order to create substitute for Springer Nature products or services or a systematic database of Springer Nature journal
content.
In line with the restriction against commercial use, Springer Nature does not permit the creation of a product or service that creates revenue,
royalties, rent or income from our content or its inclusion as part of a paid for service or for other commercial gain. Springer Nature journal
content cannot be used for inter-library loans and librarians may not upload Springer Nature journal content on a large scale into their, or any
other, institutional repository.
These terms of use are reviewed regularly and may be amended at any time. Springer Nature is not obligated to publish any information or
content on this website and may remove it or features or functionality at our sole discretion, at any time with or without notice. Springer Nature
may revoke this licence to you at any time and remove access to any copies of the Springer Nature journal content which have been saved.
To the fullest extent permitted by law, Springer Nature makes no warranties, representations or guarantees to Users, either express or implied
with respect to the Springer nature journal content and all parties disclaim and waive any implied warranties or warranties imposed by law,
including merchantability or fitness for any particular purpose.
Please note that these rights do not automatically extend to content, data or other material published by Springer Nature that may be licensed
from third parties.
If you would like to use or distribute our Springer Nature journal content to a wider audience or on a regular basis or in any other manner not
expressly permitted by these Terms, please contact Springer Nature at
onlineservice@springernature.com