Content uploaded by Lenka Štenclová
Author content
All content in this area was uploaded by Lenka Štenclová on Apr 12, 2019
Content may be subject to copyright.
MOLECULAR AND MORPHOLOGICAL DELIMITATION AND GENERIC CLASSIFICATION
OF THE FAMILY OOCYSTACEAE (TREBOUXIOPHYCEAE, CHLOROPHYTA)
1
Lenka
Stenclova
2
Faculty of Science, University of South Bohemia, Brani
sovsk
a 31,
Cesk
e Bud
ejovice 37005, Czech Republic
Karolina Fucıkova
Department of Natural Sciences, Assumption College, 500 Salisbury St., Worcester, Massachusetts 01609, USA
Jan Kastovsky, and Marie Pazoutov a
Faculty of Science, University of South Bohemia, Brani
sovsk
a 31,
Cesk
e Bud
ejovice 37005, Czech Republic
The family Oocystaceae (Chlorophyta) is a group of
morphologically and ultrastructurally distinct green
algae that constitute a well-supported clade in the class
Trebouxiophyceae. Despite the family’s clear
delimitation, which is based on specific cell wall
features, only a few members of the Oocystaceae have
been examined using data other than morphological.
In previous studies of Trebouxiophyceae, after the
establishment of molecular phylogeny, the taxonomic
status of the family was called into question. The
genus Oocystis proved to be paraphyletic and some
species were excluded from Oocystaceae, while a few
other species were newly redefined as members of this
family. We investigated 54 strains assigned to the
Oocystaceae using morphological, ultrastructural and
molecular data (SSU rRNA and rbcL genes) to clarify
the monophyly of and diversity within Oocystaceae.
Oonephris obesa and Nephrocytium agardhianum
clustered within the Chlorophyceae and thus are no
longer members of the Oocystaceae. On the other
hand, we transferred the coenobial Willea vilhelmii to
the Oocystaceae. Our findings combined with those of
previous studies resulted in the most robust definition
of the family to date. The division of the family into
three subfamilies and five morphological clades was
suggested. Taxonomical adjustments in the genera
Neglectella,Oocystidium,Oocystis, and Ooplanctella were
established based on congruent molecular and
morphological data. We expect further taxonomical
changes in the genera Crucigeniella,Eremosphaera,
Franceia,Lagerheimia,Oocystis, and Willea in the
future.
Key index words: Chlorophyceae; Crucigenioideae;
morphology; Oocystaceae; phylogeny; rbcL; Scenedes-
maceae; SSU; Trebouxiophyceae; Ultrastructure
Abbreviations: BI, Bayesian inference; BLAST, Basic
Local Alignment Search Tool; MCMC, Markov chain
Monte Carlo; MgCl
2
, Magnesium chloride; ML,
maximum likelihood; NCBI, National Centre for
Biotechnology Information; PEG, polyethylene gly-
col; PVPP, polyvinilpolypyrolidone; rbcL, RuBisCO
large subunit; SDS, sodium dodecyl sulphate; TBE
buffer, Tris-borate-ethylenediaminetetraacetic acid
buffer; Tm, melting temperature
Green algae with a coccal thallus were associated
with the order Chlorococcales for decades. With the
introduction of molecular phylogenetics, green algal
taxonomy has undergone significant changes. The
order Chlorococcales dissolved and subsequently
most coccal Chlorophytes were distributed in the
classes Chlorophyceae and Trebouxiophyceae, along
with the multicellular green algae (e.g., Lewis et al.
1992).
Traditional definitions of the families, genera and
species have been based on morphology. Micro-
scopic coccal green algae possess only a limited
number of morphological traits, some of which
occurred far more than once in the evolutionary
history of the group. In some cases, more detailed
ultrastructural examination can help to recognize
monophyletic and polyphyletic origins of some fea-
tures(e.g., spines; Hegewald and Schnepf 2002,
Pr€
oschold et al. 2010). However, other features are
doubtful (e.g., cell shape; Luo et al. 2010). There-
fore, the morphological species (and generic) con-
cept can hardly work for the unicellular algae.
Biological species concept by Mayr (1942), the most
frequently used criterion for species delimitation in
eukaryotes, cannot be applied either, because many
of the coccal green algae are considered asexual,
especially in Trebouxiophyceae. Cryptic sexual
reproduction, however, was found in some cases in
Trebouxiophyceae, through genome analyses (Blanc
et al. 2010, Fu
c
ıkov
a et al. 2015). Nevertheless, only
a few species were directly observed to propagate
sexually (Iyengar and Ramanathan 1940, Gonzalves
and Mehra 1959, Kies 1967, Iyengar and Rama-
nathan 1974, summarized in Fu
c
ıkov
a et al. 2015)
and the required circumstances are not understood.
1
Received 1 November 2016. Accepted 28 July 2017.
2
Author for correspondence: e-mail: stenclova.lenca@gmail.com.
Editorial Responsibility: C. Lane (Associate Editor)
J. Phycol. *, ***–*** (2017)
©2017 Phycological Society of America
DOI: 10.1111/jpy.12581
1
The phylogenetic species concept based on the
reconstruction of evolutionary relationships, estab-
lished by Mishler and Theriot (2000), has proved to
be useful for systematics of asexual green coccal
algae. Molecular phylogeny is currently an essential
part of the modern polyphasic approach in algal
taxonomic research (Pr€
oschold and Leliaert 2007,
Leliaert et al. 2012).
The traditional morphological delimitation and
generic classification of the family Oocystaceae var-
ied in several previous studies (Smith 1950, Fott
1976, Kom
arek 1979, Kom
arek and Fott 1983,
Melkonian 1983). The family Oocystaceae according
to Kom
arek (1979) and Kom
arek and Fott (1983)
included species with typically oval or elliptical,
sometimes (atypical) spherical, rhombic, spindle-
shaped, bean-shaped or slightly irregular cell shape.
Each cell possesses one, a few or many chloroplasts,
mostly cup-shaped or girdle–shaped, sometimes
radial or spongiomorph, with or without a pyrenoid.
Oocystacean algae reproduce by autospores and
daughter cells usually stay enclosed in the mother
cell wall for a prolonged period. Cell wall, often
with polar thickenings, can be smooth or bear warts
or spines. The surface of the cell wall, together with
the dimensions of the cell and number of chloro-
plasts, were traditionally used as determination traits
for distribution of the oocystean algae into subfami-
lies: Eremosphaeroideae with large cells, numerous
chloroplast and smooth cell wall, small-celled and
few-chloroplasts containing Lagerheimioideae with
spiny cell walls, and Oocystoideae with smooth cell
walls (Kom
arek 1979, Kom
arek and Fott 1983).
The above-described definition was broad and
corresponded with 31 genera. Kom
arek (1979) and
Kom
arek and Fott (1983) identified as the most
characteristic attribute the cell wall ultrastructure
that is multi-layered with cellulose fibrils in each
layer perpendicular to those of the adjoining layer.
However, out of numerous oocystacean genera,
ultrastructural data are available only for five tradi-
tional genera (Eremosphaera,Franceia,Lagerheimia,
Neglectella,Oocystis) and for seven genera recently
included in Oocystaceae (Amphikrikos,Ecballocystis,
Ecballocystopsis,Makinoella, and Siderocystopsis; Bowen
1965, Crawford and Heap 1978, Hegewald et al.
1978, 1980, 1999, Quader et al. 1978, Schnepf et al.
1980, Schagerl 1993, Xia et al. 2013).
More helpful for the definition of the Oocys-
taceae was the establishment of the molecular phy-
logeny that showed the morphology-based generic
concept of Oocystaceae (Kom
arek and Fott 1983) to
be inaccurate and the family’s internal taxonomic
structure was called into question. Four species with
atypical or irregular cell shape, included in the fam-
ily by Kom
arek and Fott (1983), Elakatothrix viridis,
Nephrochlamys subsolitaria,Rhombocystis complanata,
and the spherical and spiny Trochiscia hystrix were
transferred to the class Chlorophyceae (Buchheim
et al. 2001, Krienitz et al. 2011). On the other hand,
a cell shape similar to Oocystis is found in the
recently included Amphikrikos sp., Quadricoccus ellipti-
cus,Schizochlamydella capsulata (Hepperle et al. 2000,
Wolf et al. 2003, Krienitz and Bock 2011), and
Coenochloris planoconvexa (now known as Ooplanctella
planoconvexa;Pazoutov
a et al. 2010), which are new
to the expanded family. These taxonomic changes
suggest that the shape of the cell is rather specific
and potentially characteristic of the family.
The inclusion of the coenobial strains Crucigeniella
rectangularis (recently Willea rectangularis; John et al.
2014), Makinoella tosaensis,Tetrachlorella alternans
from the Scenedesmaceae subfamily Crucigenoideae
and the pseudo-filamentous Ecballocystis hubeiensis
and Ecballocystopsis dichotomus from the Botryococ-
caceae, newly redefined as members of the family
(Hepperle et al. 2000, Krienitz et al. 2003, Krienitz
and Bock 2011, Xia et al. 2013) indicates that the
family Oocystaceae has a wider definition with more
variable cell arrangement than previously expected
(Krienitz et al. 2003), and suggests that there may
be additional candidates for moving into Oocys-
taceae. So far some authors considered including
the coenobial genus Tetrastrum, previously Cru-
cigenoideae (Kom
arek 1974, Kom
arek and Fott
1983), which was shown to phylogenetically cluster
at the base of the oocystean tree (Bock et al. 2013),
as well as the difficult-to-classify, simply filamentous
Planctonema lauterbornii (Krienitz and Bock 2011).
The most controversial finding of the oocystean
molecular phylogeny was the polyphyletic status of
the morphologically well-defined genus Oocystis
(Hepperle et al. 2000). Only four sequences of the
numerous Oocystis species were analyzed so far, and
they formed three lineages (Krienitz and Bock
2011). A new genus, Elongatocystis (Krienitz and
Bock 2011), was erected to accommodate the for-
mer Oocystis ecballocystiformis, but the remaining two
Oocystis-like lineages were not taxonomically treated.
All previous studies have brought new insights to
the phylogeny and systematics of the Oocystaceae,
but the main questions about diversity, delimitation
and generic classification of the family Oocystaceae
remained unresolved. A comprehensive study using
multi-approach taxonomical revision of the family is
still needed.
The present study focused on the delimitation of
the family Oocystaceae through a polyphasic
approach and the provision of a coherent definition
of Oocystaceae. We also aimed to describe the mor-
phological and molecular variability inside the fam-
ily and to compare it with the within-family
structure proposed by Kom
arek and Fott (1983).
We considered the importance of the following
morphological characters: spines, mucilage covers
with or without projections, granules on the surface
of the cell wall, coenobial character of cell arrange-
ment, cell dimension and number of chloroplasts,
for the structure of Oocystaceae and also the
generic concept in the family.
2LENKA
STENC L O V
AETAL.
MATERIALS AND METHODS
Algae strains. We obtained 54 unialgal strains from the
public collections Culture Collection of Autotrophic Organ-
isms at the Academy of Sciences of the Czech Republic in
T
rebo
n (CCALA), National Centre for Marine Algae and
Microbiota (NCMA formerly CCMP), Culture Collection of
Algae of the Charles University of Prague (CAUP), Culture
Collection of Algae at the University of Gottingen (SAG),
Coimbra Collection of Algae (ACOI), Culture Collection of
Algae and Protozoa (CCAP) and the private collections of
Marvin W. Fawley, Christina Bock and Lothar Krienitz. One
strain was isolated by the authors (Table S1 in the Supporting
Information). Unidentified strains from the private collec-
tions were taxonomically assigned following Kom
arek and
Fott (1983). Determined strains from the public collections
were morphologically verified according to Kom
arek and Fott
(1983). Appropriateness of the names of the investigated taxa
was checked by Index Nominum Algarum and the forms of
authors’ names by The International Plant Names Index
(IPNI). We kept strains in tubes with solid BBM medium
(Bischoff and Bold 1963; solidified with 1.5% agarose) under
standard cultivating conditions: irradiance 22 lmol m
2
s
1
and constant temperature 16°C. Selected strains were
additionally cultivated in a liquid medium, because of better
conservation of significant morphological traits: mucilage
covers and spines.
Morphology. All strains were repeatedly observed using the
light microscope Olympus BX, equipped with an Olympus
DP71 camera and DP software (Olympus, Center Valley, PA,
USA), to capture all stages of their life cycle. Magnifications
of 4009without and 1,0009with immersion oil were used.
We stained the strains with methylene blue to detect poten-
tially ornamented cell walls and mucilage covers. Pic-
ture plates were constructed using CorelDraw X6 (Corel
Corporation, Ottawa, Canada).
Ultrastructure. Twelve strains of species with no ultrastruc-
tural data from previous studies were chosen for transmission
electron microscopy, to observe cell wall ultrastructure. Sam-
ples were prepared by staff at the Electron Microscopy Labo-
ratory, Institute of Parasitology, Academy of Sciences, Czech
Republic. Samples were washed with 0.05 M phosphate buffer
and postfixed with 2% osmium tetroxide in 0.05 M phos-
phate buffer at room temperature for 2 h. Samples were then
repeatedly washed with 0.05 M phosphate buffer. Cells were
dehydrated with a concentration gradient of isopropanol
solutions and embedded in the Spurr’s resin (Spurr 1969)
afterward, with propylene oxide as an intermediate stage.
Thin sections were stained with uranyl acetate and lead
citrate. We observed the prepared samples in a Jeol JEN 1010
transmission electron microscope (JEOL, Peabody, MA, USA)
at an accelerating voltage of 80 kV. Results of the examina-
tion are documented and figure plates created in CorelDraw
X6.
Molecular analyses. DNA was extracted using Invisorb
â
Spin Plant Mini DNA extraction kit (Invitek, Berlin, Ger-
many) following the manufacturer’s instructions, and by mod-
ified xanthogenate-SDS buffer extraction protocol with the
addition of 3% PVPP and PEG-MgCl2 precipitation (Yilmaz
et al. 2009). We chose the SSU rRNA gene and the rbcL gene
for molecular analysis. Both genes are considered housekeep-
ing genes, and therefore conserved and appropriate for fam-
ily and genus level phylogenetics. There are also a large
number of sequences of the SSU rRNA gene in the public
database GenBank, NCBI. For the rbcL gene, the database
GenBank, NCBI contains a fair amount of data as well.
We amplified both genes with PCR reactions consisting of
10 ng of the template DNA with 2.5 pmol of forward and
reverse primer and 10 lL Plain PP Master Mix (Top Bio, Ves-
tec, Czech Republic) using cyclers XP Cycler - Bioer T 300
Thermocycler (Biometra, G€ottingen, Germany). The primer
combination for amplification SSU rRNA was NS1F –ITS4R
or 1650R when obtaining the entire gene was possible, and
the combination of NS1F –1150R and 1170F –ITS4 or
1650R, if the first attempt was not successful. Program for
PCR reaction was started by initial denaturation (95°C,
1 min), followed by 35 cycles of denaturation (95°C, 1 min),
annealing (52°C–55°C, 1 min) and elongation (72°C, 3 min)
and completed by final elongation (72°C, 10 min). The
annealing temperature was estimated from the Tm of the
used pair of primers (Checked by OligoAnalyzer 3.1; Inte-
grated DNA Technologies). We used the combination of
newly designed primers ORB1F and ORB1R for the amplifica-
tion of the rbcL gene. The program started with an initial
denaturation step (95°C, 1 min), continued with 35 cycles
consisting of denaturation (95°C, 1 min), annealing (52°C,
1 min) and elongation (72°C, 3 min), and was concluded by
elongation (72°C, 10 min). Successfully amplified DNA was
verified by gel electrophoresis on a 1% agarose gel in TBE
buffer. DNA stained by GEL RED was visualized by UV transil-
luminator ULTRA LUM. INC –gel imager with software
Scion VisiCapture (Scion Corporation, Frederick, MD, USA).
PCR products were refined JetQuick PCR Purification Kit -
Genomed (Qiagen, Hilden, Germany). The manufacturer’s
instructions were followed. Samples for sequencing were ana-
lyzed by the Laboratory of Genomics, Biology Centre of the
Academy of Sciences of the Czech Republic,
Cesk
e
Bud
ejovice (using the sequence analyzer ABI PRISM 3130
XL; Applied Biosystems, Life Technologies Corporation, Fos-
ter City, CA, USA) or processed by commercial companies
Macrogen (Seoul, Korea) and SeqMe (Dobris, Czech Repub-
lic). Primer information is listed (Table 1).
We assembled the reads of each gene sequence using
SeqAssem (Hepperle 2004). The approximate phylogenetic
affinity of each strain was checked by BLAST against all
sequences contained in the database GenBank - NCBI. All
new sequences were posted in the public database GenBank -
NCBI and the accession numbers were assigned (Table 2).
Alignments consisted of authors’ sequences and sequences
obtained from the public database GenBank - NCBI. Align-
ments of Chlorophyceae - for taxa that our study excluded
from Oocystaceae - were assembled following previous studies
(Sphaeropleales –Fu
c
ıkov
a et al. 2011, Fu
c
ıkov
a and Lewis
2012, Fu
c
ıkov
a et al. 2014, Volvocales –Buchheim et al.
2001, Nakada et al. 2008) to select suitable sequences that
cover the main lineages of each examined group and reason-
able outgroup. SSU rRNA gene was sufficient to determine
the approximate positions of these taxa. The alignment of
the family Oocystaceae was assembeld using all suitable avail-
able sequences from GenBank - NCBI, longer than 1,500 bp
except introns in case of SSU rRNA gene (Table S2 in the
Supporting Information) and longer than 1,000 bp in case of
rbcL gene, to cover the phylogenetic diversity of the family.
BLAST search of all newly obtained sequences and also
sequences from previous studies was used for finding all suit-
able sequences. The concatenated SSU rRNA +rbcL data set
was combined of both sequences of the Oocystacea taxa, if
both are available. Members of Chlorellaceae were used as
outgroup. All analyzed sequences are listed (Tables 2–4).
Data sets were aligned using ClustalW (Larkin et al. 2007)
and edited manually in Mega 5.2.2 (Tamura et al. 2011). All
alignments were tested by jModelTest 2 (Darriba et al. 2012)
to find the optional evolution model for the phylogenetic
analyses. For all four alignments generalized time-reversible
(Tavar
e 1986) model of evolution with gamma distribution
and invariable sites (GTR+Γ+I) was determined. The gamma
shape parameter a, as well as the proportion of invariable
DELIMITATION OF OOCYSTACEAE 3
sites were estimated from the data set. The phylogenetic trees
were inferred for all data sets using Maximum Likelihood
(ML) in PHYML 3.0 (Guindon et al. 2010). Nonparametric
bootstrap support was calculated (1,000 repetitions) to deter-
mine ML branch support. Secondly, we used Bayesian infer-
ence using Mr. Bayes 3.2.2. (Ronquist et al. 2012). Two runs
with four MCMC chains each were executed with default
parameters for 2,000,000 (simple data set) or 3,000,000 (con-
catenated data set) generations. Two analyses of concatenated
alignment were executed: the first without partitions and the
second with partitions. For the second one, four partitions
were established, one for 18S and three for rbcL, separated by
codon position. Posterior probabilities of branches were
recorded.
RESULTS
Morphology. Names of five strains: CCALA 396,
SAG 2085, SAG 81.80, SAG 1194 and CAUP H 1110,
were revealed as incorrect when authenticated
according to Kom
arek and Fott (1983) and appro-
priate corrections were made (Table S1). Three
names were completed by determining the correct
specific epithet (SAG 30.96, SAG 2074 and CCALA
515) and nine unknown strains were identified
(AN9-1, AN2/29-4, CB 99, CB 210, MP STE7, Tow
6/3 P-1ou, W Twin SlisT, MDL6-7 and As7-C;
Table S1). Three strains (SAG 81.80, CAUP H 1110
and CCALA 396) were identified only to genus
level, when one or more determining traits were
missing or uncertain (Table S1). Two picture plates
were constructed: first documents the morphology
of individual morphological clades (Fig. 1) and sec-
ond includes taxa to which we pay particular atten-
tion in this study because they are subject to
taxonomic changes (Fig. 2). Tables with relevant
morphological characteristics were made to enable
synoptical comparisons of the strains for spiny and
granulated clades (Tables 5 and 6).
Ultrastructure. The cell wall ultrastructure of
twelve strains representing taxa not previously exam-
ined ultrastructurally was observed with a transmis-
sion electron microscope (Fig. 3). Cell walls of
strains SAG 34.81 Nephrocytium agardhianum and
CCALA 398 Oonephris obesa possessed clearly differ-
ent fine structure than expected in Oocystaceae
(Fig. 3). The cell wall of Planctonema lauterbornii was
composed of several layers. However, no characteris-
tic arrangement of fibrils was detected. The cell
walls of Tetrastrum formed three layers, inner, mid-
dle and outer, also without the regular arrangement
of the cellulose fibrils (Fig. 3). All remaining investi-
gated strains (SAG 2081 Willea rectangularis,SAG
56.81 Granulocystis verrucosa), Tow 6/3 P-1ou Oocystis
parva, SAG 42.81 Tetrachlorella alternans and CCALA
515 Willea vilhelmii possessed the Oocystis-like ultra-
structure (Fig. 3).
Molecular phylogeny. In total, we obtained 30 new
sequences of the SSU rRNA gene and 45 new
sequences of rbcL (Table S1). The remaining
sequences were retrieved from the public database
GenBank (Tables 2–4). Overall, five data sets were
aligned. One SSU alignment of the Sphaeropleales
(1,661 bp) and one of the Volvocales (1,710 bp) were
analyzed to classify two taxa excluded from the family
Oocystaceae. Three data sets were made of sequences
of Oocystaceae. The final alignment of SSU rRNA gene
included 1,568 bp, the rbcL alignment 1,108 bp and
the concatenated alignment of both genes 2,676 bp.
Phylogenetic trees were constructed for each data set,
and phylogenetic position of all strains was deter-
mined. Sample sorting and level of resolution differed
between the two genes, yet topologies did not strongly
conflict except for the base of the trees. Therefore, the
concatenated tree likely shows the best representation
of relationships in Oocystaceae.
Phylogenetic delimitation of Oocystaceae. Two of the
examined strains turned out to be phylogenetically
distant from the family Oocystaceae. The strain SAG
34.81 Nephrocytium agardhianum was placed in the
Sphaeropleales incertae sedis as sister to the taxon
Pseudomuriella sp. (Fig. 4). The strain CCALA 398
O. obesa clustered as a sister to Cylindrocapsa geminella
within the volvocalean Treubarinia clade sensu
Nakada et al. (2008) (Fig. 5). All remaining strains
composed a monophyletic group with strong sup-
port according to all three trees based on the SSU
rRNA data, the rbcL data, and the concatenated
alignment of both genes (Fig. 6, Figs. S1 and S2 in
the Supporting Information).
Definition of the family Oocystaceae. Molecular phy-
logeny excluded members with different shape of
TABLE 1. Primers used in the present study. Primers used only for sequencing are marked by an asterisk. Melting tempera-
ture (TM) was checked by OligoAnalyzer 3.1 (Integrated DNA Technologies).
Gene Name Sequence F/R TM References
rbcL ORB1F CCACAAACTGAAACAAAAGCA F 48.5 Present study
rbcL ORB1R CTGGAGCATTACCCCAAGG R 53.2 Present study
SSU NS1F GTAGTCATATGCTTGTCTC F 47.2 Friedl unpublished
SSU 402F*GCTACCACATCCAAGGAAGGCA F 59.5 Katana et al. (2001)
SSU 1150R ACGCCTGGTGGTGCCCTTCCGT R 68.1 Pazoutov
a et al. (2010)
SSU 1170F CTGTGGCTTAATTTGACTCAACACG F 56.6 Pazoutov
a et al. (2010)
SSU 1500AF*GCGCGCTACACTGATGC F 57.3 Helms et al. (2001)
SSU 1650R vivi TCACCAGCACACCCAAT R 54.2 Kipp (2004)
ITS ITS1F*TCCGTAGGTGAACCTGCGG F 59.5 White et al. (1990)
ITS ITS4R TCCTCCGCTTATTGATATGC R 52.1 White et al. (1990)
4LENKA
STENC L O V
AETAL.
TABLE 2. Sequences of the SSU rRNA and rbcL genes used for molecular analysis of Oocystaceae in present study. New
sequences published in present study are highlighted by bold font. The column marked as C bears information whether
both sequences were included into the concatenated alignment.
Strain Name SSU rRNA RbcL Ctree
SAG 96 Amphikrikos nanus –KY710891 –
SAG 2074 Amphikrikos nanus AF228690*KY710892 YES
SAG 37.93 Echinocoleum elegans FM881776 KY710878 YES
CCAP 274/3 Elongatocystis ecballocystiformis HQ008713 ––
ACOI 1819 Eremosphaera gigas KY013478 KY710899 YES
SAG 228-1 Eremosphaera viridis KY006556 KY710888 YES
SAG 39.92 Eremosphaera viridis KY006557 KY710889 YES
SAG 10.81 Franceia amphitricha KY013473 KY710893 YES
SAG 56.81 Granulocystis verrucosa KY006562 KY710867 YES
SAG 33.81 Granulocystopsis coronata –KY710868 –
SAG 11.94 Lagerheimia ciliata KY013469 KY710885 YES
SAG 2083 Lagerheimia ciliata KY013470 KY710886 YES
SAG 48.94 Lagerheimia genevensis AY122336 KY710866 YES
SAG 11.92 Lagerheimia hindakii –KY710884 –
SAG 57.81 Lagerheimia longiseta KY013471 KY710887 YES
CCALA 365 Lagerheimia marssonii KY006561 KY710858 YES
SAG 2084 Lagerheimia subsalsa KY047577 KY710897 YES
SAG 28.97 Makinoella tosaensis KY006566 KY710890 YES
CCALA 961 Makinoella tosaensis AF228691 KY710879 YES
SAG 37.96 Neglectella peisonis KY013476 KY710898 YES
SAG 83.80 Neglectella solitaria AF228686 KY710862 YES
CAUP H 1106 Neglectella solitaria KY014642 KY710876 YES
SAG 3.96 Oocystella oogama KY013474 ––
CAUP H 5502 Oocystidium planoconvexum FM881777 KY710877 YES
AN9-1 Oocystidium polymammilatum KY006565 KY710873 YES
AN2/29-4 Oocystidium polymammilatum AY195966 KY710874 YES
SAG 81.80 Oocystidium sp. KY006559 KY710863 YES
CB 99 Oocystis bispora KY013467 ––
SAG 1.99 Oocystis heteromucosa AF228689 KY7108 YES
CB 210 Oocystis heteromucosa KY013466 KY710880 YES
SAG 2085 Oocystis cf. marssonii KY014640 KY710900 YES
MP STE7 Oocystis naegelii KY047576 KY710882 YES
CCALA 397 Oocystis nephrocytioides –KY710860 –
SAG 82.80 Oocystis parva KY006560 KY710864 YES
Tow 6/3 P-1ou Oocystis parva AY197635 KY710869 YES
W Twin SlisT. Oocystis rhomboidea KY006563 KY710870 YES
CAUP H 1110 Oocystis sp. KY038331 KY710875 YES
SAG 11.95 Planctonema lauterbornii –––
SAG 68.94 Planctonema lauterbornii KY013475 KY710896 YES
MDL6-7 Quadricoccus verrucosus AY197626 KY710871 YES
As7-C Quadricoccus verrucosus KY006564 KY710872 YES
CCMP 245 Schizochlamydella capsulata KY013468 KY710881 YES
SAG 28.81 Siderocystopsis punctifera KY014641 KY710901 YES
CCALA 396 Siderocystopsis sp. –KY710859 –
SAG 24.81 Tetrastrum heteracanthum JQ356709 KY710894 YES
SAG 45.81 Tetrastrum staurogeniiforme JQ356703 KY710895 YES
KR 1996/3 Tetrastrum staurogeniiforme JQ356702 KY710883 YES
SAG 42.81 Tetrachlorella alternans AF228687 KY710865 YES
SAG 2081 Willea rectangularis AH012990 ––
CCALA 515 Willea vilhelmii KY006555 KY710857 YES
GenBank
J.C.Han 32 Amphikrikos sp. KP013378 ––
J.C.Han 43 Amphikrikos sp. KP013379 ––
NIES 3911 Chlorella sp. LC129521 ––
NIES 3912 Chlorella sp. LC129522 ––
–Ecballocystis hubeiensis JX018185 JX018187 YES
–Ecballocystopsis dichotomus JX018184 JX018186 YES
CCAC 0071 Eremosphaera viridis HE610127 ––
UTEX LB 34 Eremosphaera viridis AF387154 ––
NIES 382 Lagerheimia ciliata LC192142 ––
KMMCC 15441544544 Lagerheimia longiseta JQ315525 ––
CCAP 222/49 Oocystidium sp. HQ008711 ––
LN1 Oocystis borgeii KU720481 ––
KRI. 96/10 Oocystis marssonii AF228688 ––
(continued)
DELIMITATION OF OOCYSTACEAE 5
the cell and in turn included coenobial strains. The
new delimitation requires an emended definition of
the family, reflecting the newly included taxa and
their characteristics:
Cells solitary or arranged in 2–4–8–16–32-celled
groups or coenobia or connected in pseudofila-
ments. Cells oval to elliptical or spindle-shaped,
sometimes nearly spherical, or slightly asymmetrical.
One, a few or numerous chloroplasts present in a
single cell, parietal or nearly so, with pyrenoid that
is sometimes not clearly visible. Cell wall smooth,
with or without thickened ends, or covered with
granules or spines. Cell wall characterized by special
ultrastructure (multilayered with several layers of
crystalline cellulose microfibrils arranged in each
layer perpendicularly to the next layer). Mucilage
cover may be present. Propagation by autospores,
sometimes by oogamy. Daughter cells usually remain
inside mother cell wall for a prolonged amount of
time, sometimes for several generations.
Internal structure of Oocystaceae. The phylogeny of
the family Oocystaceae shows the distribution of its
taxa to three subfamilies Eremosphaeroideae,
Oocystoideae, and Makinoelloideae subf. nov. Fig-
ure 6, Figures S1 and S2.
Makinoelloideae subf. nov.
Stenclov
a (newly
defined)
Diagnosis: Cells relatively small (width 3–18 lm,
length 4–30 lm), oval to elliptical to elongated,
arranged in pairs or tetrads to multicellular coeno-
bia or pseudofilaments. Cells with 1–4 parietal
chloroplast with a big clearly visible pyrenoid. Two
to four autospores remain inside the mother cell
wall for a prolonged time. Cell wall is smooth.
Type genus: Makinoella Okada
Eremosphaeroideae (emended)
Diagnosis: Cells oval to elliptical, occurring soli-
tary or in pairs or tetrads (less commonly in 8-celled
colonies). Each cell with 8 to more than 20 chloro-
plasts each with one pyrenoid. Propagation by 2, 4,
8, or 16 autospores, which sometimes stay in mother
cell wall for a few generations. Autospores with 2–8
chloroplasts. Dimensions of the cells are up to sev-
eral times larger than those of other subfamilies
(width 4, 9–200 lm, length 12–200 lm). The cell
wall is smooth.
Oocystoideae (emended)
Diagnosis: Cells usually small (width 1.5–22 lm,
length 3.2–40 lm), oval to elliptical. Cells are found
solitary or in pairs or tetrads or 8–16 celled colo-
nies. Each cell with 1–2–4–8 chloroplasts. Propaga-
tion by 2–4–8 autospores, which sometimes remain
in the mother cell wall for a longer time. Cell wall
can bear diverse ornamentation, such as spines or
granules and can produce wide mucilage covers.
The subfamily Oocystoideae is divided into five
well-supported clades (Fig. 6, Figs. S1 and S2).
Distinguishing of these clades is well supported by
morphological and molecular data (see Discussion
below).
Generic concept. The following taxonomic changes
are based on a combination of phylogenetic, ultra-
structural, and morphological analyses presented in
this study.
Neglectella solitaria (Wittrock)
Stenclov
a&Ka
stovsky
comb. nov.
Basionym: Oocystis solitaria Wittrock in Wittrock &
Nordsted, Botaniska Notiser 1879, p. 24, figs 1-5,
1879). Homotypic synonym: Oocystella solitaria (Wit-
trock) Hind
ak, Heterotypic Synonyms: O. solitaria
var. notabile West & G.S.West, Oocystis crassa Wittrock,
Heterotypic synonym: (established in the present
study) O. solitaria var. major (Wille) P.M.Tsarenko.
Oocystidium planoconvexum (Hind
ak)
Stenclov
a&
Pazoutov
acomb. nov.
Basionym: C. planoconvexa Hind
ak, Studies of the
chlorococcal algae (Chlorophyceae). I. –Biol. pr ace, Veda,
Bratislava, p. 22, pl. 5 fig. 1, 1977. Epitype: The
strain CAUP H5502 permanently cryopreserved at
the Culture Collection of Algae of the Charles
TABLE 2. (continued)
Strain Name SSU rRNA RbcL Ctree
KMMCC 443 Oocystis parva JQ315649 ––
KMMCC 356 Oocystis sp. JQ315800 ––
FACHB 1429 Oocystis sp. KF928745 ––
FACHB 1427 Oocystis sp. KJ522683 ––
GR35 Planctonema lauterbornii –EF113462 –
M110-1 Planctonema sp. AF387148 EF113463 YES
CCAP 286/1 Quadricoccus ellipticus HQ008712 ––
NKS72 Uncultured Chlorophyta clone JX296619 ––
KRL03E76 Uncultured eukaryote clone KC315825 ––
KRL03E42 Uncultured eukaryote clone KC315819 ––
KRL01E35 Uncultured eukaryote clone HQ008711 ––
NKS72 Uncultured Chlorophyta lone JX296619 ––
Outgroup (GenBank)
–Auxenochlorella protothecoides FN29893 EU038285 YES
–Chlorella variabilis AB206549 AB260903 YES
–Chlorella vulgaris FR865658 AB260909 YES
–Micractinium pusillum AF364101 EF113451 YES
6LENKA
STENC L O V
AETAL.
University in Prague, Czech Republic (CAUP;
Pazoutov
a et al. 2010). Homotypic synonym:
O. planoconvexa (Hind
ak) Pazoutov
a,
Skaloud &
Nemjov
a.
DISCUSSION
Delimitation of the family Oocystaceae. Two exam-
ined taxa SAG 2082 Nephrocytium agardhianum and
CCALA 398 Oonephris obesa were excluded from the
family based on the molecular phylogeny.
Nephrocytium agardhianum was placed in the Sphaero-
pleales incertae sedis as the sister to the strain “Pseudo-
muriella” sp. These two taxa represent a distinct
lineage within Sphaeropleales and are not closely
related to the genus Pseudomuriella (Fig. 4). Our
results are consistent with Vieira et al. (2016), whose
phylogenetic study recently also placed Nephrocytium
in Sphaeropleales based on a different chloroplast
gene, tufA. Cell characteristics of N. agardhianum are
similar to the other Sphaeropleales. Oonephris obesa
clusters as a sister taxon to C. geminella within the
volvocalean clade Treubarinia, a peculiar, morpho-
logically heterogeneous group with disproportion-
ately long branches in the phylogeny of 18S rRNA
gene (Nakada et al. 2008). Oonephris obesa and
C. geminella both possess very similar cell characteris-
tics and differ from each other by cell arrangement.
TABLE 4. Sequences of the SSU rRNA gene used for
molecular analysis of Volvocales. A new sequence pub-
lished in present study is highlighted by bold font.
VOLVOCALES
Carteria crucifera D86501
Carteria eugametos U70595
Carteria lunzensis JN904001
Carteria radiosa D86500
Characiochloris sasae AB360741
Characiosiphon rivularis AF395437
Chlamydomonas culleus U70594
Chlamydomonas fimbriata U70784
Chlamydomonas monadina JN903976
Chlamydomonas noctigama AB701503
Chlamydomonas reinhardtii N903984
Chlorogonium euchlorum AB278610
Chloromonas brevispina AF517092
Chloromonas reticulata GU117583
Chlorosarcinopsis arenicola AB218701
Cylindrocapsa geminella U73471
Cylindrocapsa geminella AF387159
Dunaliella lateralis DQ009762
Dunaliella salina EU589200
Elakatothrix viridis AY008844
Golenkinia longispicula JN968588
Hafniomonas conica AB248251
Hafniomonas reticulata AB248250
Lobocharacium coloradoense AF395436
Lobochlamys culleus AJ410461
Lobochlamys segnis AB701525
Oogamochlamys ettlii AJ410469
Oogamochlamys gigantea AJ410466
Oogamochlamys zimbabwiensis AJ410472
CCALA 398 Oonephris obesa KY006558
Phacotus lenticularis AY009897
Polytoma uvella U22943
Tetracystis aeria U41175
Tetracystis pampae JN903997
Tetracystis vinatzeri JN903998
Treubaria schmidlei U73474
Treubaria setigera U73475
Trochiscia hystrix AF277651
OUTGROUP
Bracteacoccus minor JQ259943
Bracteacoccus ruber JQ259919
Scenedesmus obliquus AJ249515
Pediastrum duplex JQ315560
TABLE 3. Sequences of the SSU rRNA gene used for
molecular analysis of Sphaeropleales. A new sequence
published in present study is highlighted by bold font.
SPHAEROPLEALES
Ankistrodesmus bibraianus Y16938
Ankistrodesmus fusiformis X97352
Ankistrodesmus gracilis Y16937
Asterarcys-quadricellulare AF388375
Bracteacoccus aerius JQ259915
Bracteacoccus minor JQ259944
Bracteacoccus pseudominor JQ259953
Bracteacoccus ruber JQ259919
Bracteacoccus sp. JQ259940
Chlorella zofingiensis X74004
Chlorotetraedron bitridens AY663043
Coelastrum astroideum var. rugosum AF388377
Coelastrum morus AF388374
Coelastrum sphaericum AF388376
Dictyococcus schumacherensis HM852439
Dictyococcus schumacherensis HQ292769
Enallax acutiformis AB037089
Follicularia texensis JN630516
Graesiella emersonii FR865687
Graesiella vacuolata FR865685
Hydrodictyon reticulatum HE610123
Kirchneriella obesa HM483513
Monoraphidium contortum AY846382
Monoraphidium saxatile AY846385
Mychonastes zofingiensis GU827478
Neochloris vigenis M74496
SAG 34.81 Nephrocytium agardhianum KY013477
Pediastrum duplex JQ315560
Planktosphaeria gelatinosa AY044648
Polyedriopsis spinulosa AY780667
Pseudomuriella aurantiaca AB005748
Pseudomuriella cubensis HQ292770
Pseudomuriella engadinensis HM852442
‘Pseudomuriella’ sp. AY195974
Pseudoschroederia antillarum AF277649
Radiococcus polycoccus AF388378
Selenastrum bibraianum HM483514
Scenedesmus bajacalifornicus HQ246321
Scenedesmus obliquus X56103
Scenedesmus regularis FR865732
Scenedesmus rubescens X74002
Schizochlamys gelatinosa AY781662
Sorastrum spinulosum AY663041
Schizochlamys gelatinosa AY781662
Sorastrum spinulosum AY663041
OUTGROUP
Characium vacuolatum M63001
Chlamydomonas reinhardtii JX888472
Chlamydomonas monadina JN903976
Dunaliella salina EU589200
DELIMITATION OF OOCYSTACEAE 7
The cells of O. obesa occur in spherical colonies
whereas the cells of C. geminella are stacked in rows
and form pseudofilaments. The phylogenetic place-
ment of N. agardhianum and O. obesa outside of
Oocystaceae is also supported by their cell wall ultra-
structure, which is not Oocystis-like (Fig. 3).
All other examined strains clustered as a mono-
phyletic clade sister to Chlorellaceae inside Tre-
bouxiophyceae. Near the base of the phylogeny, two
lineages crystallized: the monotypic genus Planc-
tonema and the genus Tetrastrum with two analyzed
species T. heteracanthum and T. staurogeniiforme.
FIG. 1. Morphological traits characteristic for each subfamily and morphological clade. (A–C) Eremosphaeroideae –large cells with
numerous chloroplasts. (A) ACOI 1819 Eremosphaera gigas, (B) SAG 37.96 Neglectella peisonis, (C) SAG 83.80 Neglectella solitaria.(D–F) Maki-
noelloideae –coenobia. (D) SAG 28.97 Makinoella tosaensis, (E) CCALA 397 “Oocystis”nephrocytioides, (F) CCAP 274/3 Elongatocystis ecballo-
cystiformis.(G–I) Oocystoideae –spines. (G) SAG 57.81 Lagerheimia longiseta, (H) SAG 48.94 Lagerheimia genevensis, (I) CCALA 365
Lagerheimia marssonii.(J–L) Oocystoideae –granules. (J) SAG 56.81 Granulocystis verrucosa, (K) SAG 3.96 Oocystella oogama, (L) CB 99 “Oocys-
tis”bispora.(M–O) Oocystoideae –mucilage covers (stained with methylene blue). (M) AN9-1 Oocystidium polymammilatum, (N) SAG 81.80
Oocystidium sp., (O) CAUP H 5502 Oocystidium planoconvexum comb. nov.(P–R) Oocystoideae –Oocystis s.l. (P) SAG 2085 Oocystis cf. marsso-
nii, (Q) SAG 82.80 Oocystis parva, (R) SAG 42.81 Tetrachlorella alternans. The scale bars indicate 20 lm.
8LENKA
STENC L O V
AETAL.
Whether to include these two deeply diverging gen-
era into the family Oocystaceae remains unclear,
because they do not exhibit the characteristic ultra-
structure (Fig. 3). Accordingly, there is no reason
other than phylogenetic to assign them to the fam-
ily Oocystaceae as suggested in Bock et al. (2013),
and they may thus become incertae sedis. Both gen-
era also exhibit gross morphological differences
from Oocystaceae. Planctonema lauterbornii has a fila-
mentous thallus and does not reproduce by
autospores but rather by fragmentation of the fila-
ment (Schmidle 1903). Its parietal chloroplast and
cylindrical cell shape are, however, in agreement
with the definition of Oocystaceae. In contrast, Tet-
rastrum species propagate via autospores and make
crucigenoid coenobia similar to some taxa in the
coenobial clade of Oocystaceae. The arrangement
of the cells is similar to the rest of crucigenoid algae
sensu Kom
arek (1979), Kom
arek and Fott (1983),
and morphology is Chlorella-like with one parietal
FIG. 2. Morphology of taxa subject to taxonomic changes in the present study. (A–C) SAG 34.81 Nephrocytium agardhianum,(D–F)
CCALA 398 Oonephris obesa,(G–I) CCALA 515 Willea vilhelmii,(J–L) SAG 83.80 Neglectella solitaria comb. nov.,(M–O) CAUP H5502 Oocystid-
ium planoconvexum comb. nov,(P–R) ACOI 1819 Eremosphaera gigas. The scale bars indicate 20 lm.
DELIMITATION OF OOCYSTACEAE 9
chloroplast filling the cell and containing one small
rounded pyrenoid. In our study, phylogenetic posi-
tions of both genera differed depending on the
genes used: SSU rRNA gene analysis showed Tetra-
strum closer to the family Oocystaceae than Planc-
tonema, whereas rbcL gene and concatenated trees
proposed Planctonema closer than Tetrastrum (Fig. 6,
Figs. S1 and S2). These differences may be resulting
from long branch attraction or other phylogenetic
artifacts.
The rest of the strains constitute a well-supported
Oocystaceae clade. We newly included the coenobial
W. vilhelmii originally placed in Scenedesmaceae
(Kom
arek and Fott 1983). Its ultrastructure of the
cell wall together with the cell and chloroplast
shape, both similar to the typical members of the
Oocystaceae, and grant strong support to the posi-
tion of Willea vilhelmii (Figs. 2–4). All studied strains
of Oocystaceae had the multi-layered structure with
cellulosic fibrils arranged crosswise to those in the
adjoining layer (Fig. 3). It is evident that the num-
ber of wall layers corresponds with cell dimensions;
cell wall of large-celled taxa such as Eremosphaera,
O. solitaria (Quader et al. 1978) and Neglectella peiso-
nis Schagerl (Schagerl 1993) are composed of larger
numbers of layers than cell walls of small-celled
algae such as W. vilhelmii or G. verrucosa and espe-
cially O. parva (Fig. 3), and Amphikrikos nanus (Craw-
ford and Heap 1978).
Definition of the family Oocystaceae. In accordance
with previous molecular studies (Buchheim et al.
2001, Krienitz et al. 2011), changes presented in
this study indicate that the definition of the family
regarding the shape of the cell is rather robust. All
analyzed members of the family possess lemon-like,
oval, cylindrical, or nearly spherical cell shape. No
irregular-shaped taxa stayed inside the family, so far.
Conversely, coenobial and pseudo-filamentous mem-
bers, new to the family, show a larger diversity of
cell arrangement than accommodated by the previ-
ous definition of the family. Oocystacean algae
remain variable in traits like cell dimensions and
number of chloroplasts. However, such traits seem
to be informative for internal classification within
the family.
Structure of the family Oocystaceae. Traditional mor-
phological studies proposed that the family con-
sisted of up to four subfamilies (Smith 1950, Fott
1976, Kom
arek and Fott 1983, Melkonian 1983).
Fott (1976) included the subfamily Scotiellop-
sioideae. However, his proposition was rejected by
molecular studies that proved its members close to
Scenedesmaceae spp. (Hanagata 1998). Kom
arek
and Fott (1983) divided the family Oocystaceae into
the subfamilies Eremosphaeroideae, Lager-
heimioideae, and Oocystoideae and tentatively Glau-
cocystoideae, which was more recently recognized as
a separate phylum (Bhattacharya et al. 1995). In the
present study, molecular phylogeny combined with
cell morphology support a concept comprising
three subfamilies: Eremosphaeroideae, Makinoel-
loideae subf. nov., and Oocystoideae.
TABLE 5. Morphological characteristics of investigated strains of spiny clades. Aut =number of chloroplast before
autosporulation, C =clade, ? =uncertain position.
Strain Name C Dimensions (lm) Chloroplasts Spin. number Spin. position
SAG 10.81 Franceia amphitricha S1 4–897–13 1-2-(4-aut) Numerous All surface
SAG 1194 Lagerheimia ciliata S1 7–15 98–17 1-2-(4-aut) 4–5 On each pole
SAG 2083 Lagerheimia ciliata S1 6–15 97–17 1-2-(4-aut) 4–5 On each pole
SAG 57.81 Lagerheimia longiseta S1 6–11 97–15 1-2-(4-aut) 6–8 On each pole
SAG 2084 Lagerheimia subsalsa S1 3–798–15 1-2-(4-aut) 3–4 On each pole
SAG 48.94 Lagerheimia genevensis S2 2–693–11 1-(4-aut) 2+2 Slightly subpolarly
SAG 11.92 Lagerheimia hindakii S2 2–493–7 1-(4-aut) 2+2 Slightly subpolarly
CCALA 365 Lagerheimia marssonii ?4–896–12 1-(2-4-aut) 1,1+3–4 On poles +equatorial
TABLE 6. Morphological characteristics of investigated strains of granulated clades. C =clade, G2? =uncertain position, ? =
missing information.
Strain Name C Dimensions (lm) Chloroplasts Gr. number Gr. position
SAG 56.81 Granulocystis verrucosa G1 4–15 97–21 1–2 Numerous All surface
SAG 3.96 Oocystella oogama G1 4–696–91–2 Numerous All surface
SAG 28.81 Siderocystopsis punctifera G1 3–495–7 1 Numerous All surface
CCALA 396 Siderocystopsis sp. G1 3–996–15 1–4 Numerous All surface
SAG 30.96 Amphikrikos nanus G2 2–493–7 1 Several Slightly subpolarly
SAG 2074 Amphikrikos nanus G2 2–493–6 1 Several Slightly subpolarly
CB 99 Oocystis bispora G2 2–494–7 1 Several Slightly subpolarly
MDL6-7 Quadricoccus verrucosus G2 2–494–61–2 Several Mainly on poles
As7-C Quadricoccus verrucosus G2 3–494–81–2 Several Mainly on poles
CCMP 245 Schizochlamydella capsulata G2 ? ? ? ?
SAG 33.81 Granulocystopsis coronata G2? 3–595–8 1 Several Slightly subpolarly
10 LENKA
STENC L O V
AETAL.
FIG. 3. Ultrastructure of the cell wall of 12 investigated strains (transmission electron microscopy). (A) SAG 34.81 Nephrocytium agardhi-
anum, (B) CCALA 398 Oonephris obesa, (C) SAG 11.95 Planctonema lauterbornii, (D) SAG 68.94 Planctonema lauterbornii, (E) SAG 24.81 Tetra-
strum heteracanthum, (F) KR 1996/3 Tetrastrum staurogeniiforme, (G) SAG 45.81 T. staurogeniiforme, (H) SAG 2081 Willea rectangularis, (I) SAG
56.81 verrucosa, (J) Tow 6/3 P-1ou Oocystis parva, (K) SAG 42.81 Tetrachlorella alternans, (L) CCALA 515 Willea vilhelmii.
DELIMITATION OF OOCYSTACEAE 11
FIG. 4. Phylogenetic analyses of SSU rRNA gene sequences of members of Sphaeropleales with Volvocales as an outgroup. Topology
represents the best ML tree. A new sequence of Nephrocytium agardhianum is highlighted. Numbers at the branches indicate bootstrap sup-
port from maximum likelihood (ML, 1,000 replicates) and Bayesian posterior probabilities (BI). Support ≥50% for ML and ≥0.95 for MB
is shown. ML/BI. Drawing of N. agardhianum according to Hortob
agyi (1973) is shown.
12 LENKA
STENC L O V
AETAL.
Among the three subfamilies, a large dispropor-
tion of branch lengths is visible especially in the
case of the SSU rRNA tree (Fig. S1). Basal taxa of
the family Oocystaceae affiliated with the subfamily
Eremosphaeroideae are placed on apparently long
branches, which is probably caused by incomplete
taxon sampling. Therefore, relations among the
subfamilies have still not been resolved with cer-
tainty. The SSU rRNA tree showed all subfamilies as
a paraphyletic grade, whereas trees of rbcL gene and
concatenated data set showed them as mono-
phyletic. However, neither state was well supported.
Long branches (suggesting high substitution rates)
entail numerous homoplasies and therefore a long
branch attraction may have affected the constructed
phylogenetic tree, especially in the ML analyses.
Additional taxon selection would be useful to break
the long branches and provide more explicit results.
The whole clade of the subfamily Makinoelloideae
is subtended by an extremely long branch. In con-
trast, the branches inside Oocystoideae are multiple
times shorter and exhibit low molecular variability
among some strains in both SSU rRNA and rbcL,as
well as the concatenated tree. A more variable
molecular marker such as the ITS region or another
chloroplast housekeeping gene may provide addi-
tional resolution inside Oocystoideae.
The newly defined subfamily Eremosphaeroideae
contains genera with large cells and numerous
chloroplasts (Fig. 1). The subfamily Eremo-
sphaeroideae sensu Kom
arek and Fott (1983)
included only three genera: Eremosphaera,Excentro-
sphaera, and Oocystaenium, notwithstanding the simi-
lar morphology of genus Neglectella described in
Vodenicarov and Benderliev (1971). According to
the molecular phylogeny, the Neglectella clade is clo-
sely related to the Eremosphaera spp. clade. Mono-
phyly of the subfamily is not significantly supported,
and mutual relations among genera poorly resolved,
possibly because of limited species sampling and
long branch attraction. Therefore, sequencing of
additional taxa is recommended, though finding
candidate strains may be problematic. However, the
subfamily is clearly morphologically delimited based
FIG. 5. Phylogenetic analyses of SSU rRNA gene sequences of members of Volvocales with Sphaeropleales as an outgroup. Topology
represents the best ML tree. A new sequence of Oonephris obesa is highlighted. Numbers at the branches indicate bootstrap support from
maximum likelihood (ML, 1,000 replicates) and Bayesian posterior probabilities (BI). Support ≥50% for ML and ≥0.95 for MB is shown.
ML/BI. Drawing of O. obesa according to Skuja (1964) is shown.
DELIMITATION OF OOCYSTACEAE 13
on the presence of numerous chloroplasts and large
size of the cells, which distinguish the subfamily as a
separate classification unit.
Subfamily Makinoelloideae is well supported by
molecular phylogeny (Fig. 6, Figs. S1 and S2). Three
of its taxa were previously classified as members of
the scenedesmacean subfamily Crucigenoideae
(W. rectangularis,M. tosaensis, and Willea wilhelmii;
Kom
arek and Fott 1983) typical by its crucigenoid
coenobial morphology (Fig. 1). Another one ex-
crucigenoid coenobial alga SAG 42.81 T. alternans
was not classified as a member of the coenobial clade
but is closely related to species of the genus Oocystis
(Hepperle et al. 2000, present study). The genus
Tetrachlorella differs from all taxa in Makinoelloideae
by its spindle-shaped cells; the rest of the strains pos-
sess oval to elliptical cells with rounded ends. In addi-
tion to the coenobial strains, four noncoenobial
strains with similar cell characteristic were included
into the subfamily Makinoelloideae based on
FIG. 6. Phylogenetic analyses concatenated data set of SSU rRNA and rbcL sequences of members of Oocystaceae with Chlorellaceae as
an outgroup. Topology represents the best ML tree. Sequences are highlighted by bold font, when one sequence is new and underlined,
when both sequences are new. Numbers at the branches indicate bootstrap support from maximum likelihood (ML, 1,000 replicates) of
unpartitioned alignment and Bayesian posterior probabilities of unpartitioned (BI) and partitioned (PBI) alignment. Support ≥50% for
ML and ≥0.95 for MB is shown ML/BI/PBI.
14 LENKA
STENC L O V
AETAL.
phylogenetic results: Ecballocystis hubeiensis,
Ecballocystis dichotomus,Elongatocystis ecballocystiformis,
and Oocystis nephrocytioides. All four strains possess
long cylindrical cell organized in tetrads and
enclosed in the mother cell wall (Krienitz and Bock
2011, Xia et al. 2013). The tetrads of E. hubeiensis and
E. dichotomus are arranged into simple filaments (Xia
et al. 2013).
The newly defined monophyletic subfamily Oocys-
toideae consisted of previously included Oocystoideae
(except Neglectella), as well as Lagerheimioideae sensu
Kom
arek and Fott (1983) and received significant sup-
port (Fig. 6, Figs. S1 and S2). The subfamily was
divided into five morphologically and phylogenetically
well-defined clusters: spiny clades 1 and 2, granulated
clade 1 and 2 and Oocystidium clade, accompanied by
Oocystis spp. and T. alternans arranged into the Oocystis
group (Fig. 6, Figs. S1 and S2).
Spiny clades: All spiny strains of Oocystaceae were
traditionally associated with the subfamily Lager-
heimioideae (Kom
arek and Fott 1983), which com-
prised 11 genera. Molecular phylogeny excluded the
genera Trochiscia (now placed in Treubarinia; Buch-
heim et al. 2001), and Diacanthos (now Chlorel-
laceae; Krienitz et al. 2004, Pr€
oschold et al. 2010)
and confirmed the genera Lagerheimia and Franceia
(Krienitz et al. 2003, this study) as members of the
family. Spine ultrastructure of both Lagerheimia and
Franceia also differs from spines of other algae in
their unique composition where a fibrillary axis is
covered by amorphous matter. (Hegewald et al.
1980). Some analyses show spiny strains investigated
here as monophyletic (Fig. S1), others as para-
phyletic (Fig. 6, Fig. S2) and neither state is well
supported. The spineless mucilaginous Oocystidium
clade clusters inside or sister to the former Lager-
heimioideae (Fig. 6, Figs. S1 and S2).
We propose two spiny clades that differ in the
number and position of the spines. Four species
Franceia amphitricha,Lagerheimia ciliata,L. subsalsa,
and L. longiseta cluster together as spiny clade 1.
These taxa form a monophyletic clade according to
all three trees (Fig. 6, Figs. S1 and S2). The clade is
characterized by plurality of spines, and different
species are distinguished by their length, number,
and placement. Spiny clade 2 consisted of Lager-
heimia genevensis and L. hindakii (Fig. S2). The
clade’s synapomorphy is the arrangement of spines,
two on each pole of the cell placed subpolar. The
placement of Lagerheimia marssonii received poor
support. This alga differs from both spiny clades by
a few spines arranged polarly and equatorially
(Fig. 1; Table 5). It is clear that the apparently para-
phyletic genus Lagerheimia will require further revi-
sions (see Discussion below).
Granulated clades: Only two granulated genera,
Granulocystis and Granulocystopsis, belong to the fam-
ily Oocystaceae according to Kom
arek and Fott
(1983). Additionally, Hind
ak (1988) described a
granulated species Oocystella oogama and Heynig
(1991) established a new genus Oocystopsis on the
basis of the granulated species Oocystis granulata
inside the family. Siderocystopsis previously in the
Micractiniaceae, Amphikrikos, previously in the
Chlorellaceae Siderocelidoideae, and Quadricoccus
the Botryococcaceae (Kom
arek and Fott 1983) were
assigned to the family by molecular phylogeny
(Hepperle et al. 2000, Pr€
oschold et al. 2010, Krien-
itz and Bock 2011) and ultrastructure (Crawford
and Heap 1978, Schnepf et al. 1980). Granulated
strains inside Oocystaceae formed two monophyletic
clades differentiated by the type of granulation,
therefore the type of granulation is a systematically
informative trait for Oocystaceae (Table 6; Fig. 6,
Figs. S1 and S2). Granulated clade 1 consisted of
strains with spindle-shaped or elliptical cells with
granule irregularly arranged on all cell surfaces
(Table 6). This clade included granulated genera
Siderocystopsis and Granulocystis, together with two
granulated species Oocystis bispora and O. oogama.
Further taxonomical changes in this group are
expected in the future. The monophyly of the clade
is not supported by ML analysis of rbcL (Fig. S2).
Bayesian inference put the three strains CCALA 396
Siderocystopsis sp., SAG 28.81 Siderocystopsis punctifera,
and SAG 56.81 G. verrucosa together with the poste-
rior probability of 0.97. Differences may be caused
by long branch attraction as a result of poor taxon
sampling. Granulated clade 2 consisted of strains
with oval to nearly spherical shape of the cell and
subpolar arrangement of granules (Table 6). It
contained three strains of the genus Quadricoccus,
two strains of the species A. nanus and CCMP 245
S. capsulata with strong support. Strain CCMP 245
S. capsulata was not authenticated. Description of
the species does not mention granule on the sur-
face of the cell visible on the photo of the strain
from NCMA (CCMP). The clear morphological affil-
iation of the strain SAG 33.81 Granulocystopsis coro-
nata to the clade stays without molecular support.
Oocystidium clade: The well-supported (Fig. 6,
Figs. S1 and S2.) Oocystidium clade includes species
of the genus Oocystidium and O. planoconvexa. Their
remarkably close relationship predicted by Krienitz
and Bock (2011) and confirmed by our analyses
and the distinct separation of the clade from the
rest of the Oocystaceae suggests that this clade rep-
resents a single genus and we propose the name
Ooplanctella to recognize as synonymous to Oocystid-
ium (Fig. 6, Figs. S1 and S2.). The representatives of
the clade are characterized by wide mucilaginous
envelopes (Korshikov 1953) that can be structured
in several layers (Hortob
agyi 1973) or can make
projections (Pazoutov
a et al. 2010). The strain SAG
37.93 Echinocoleum elegans possesses a similar
mucilaginous envelope (Pazoutov
a et al. 2010) and
cell characteristics as Oocystidium. Therefore, its
unresolved relationship with the Oocystidium clade is
surprising. Similar to Pazoutov
a et al. (2010) we
could not determine the position of E. elegans
DELIMITATION OF OOCYSTACEAE 15
despite the phylogenetic analyses based on
sequences of two genes. Analyses of SSU rRNA gene
show its position close to the Oocystidium clade
(Fig. S1), though without significant bootstrap sup-
port and the result of the rbcL phylogeny does not
support this placement (Fig. S2). Similar mucilage
cover with projections was also described for mate-
rial labeled as Oocystis lacustris (
Reh
akov
a 1969) and
L. ciliata (Hind
ak 1978). Lagerheimia strains are
close to the Oocystidium clade according to the
molecular phylogeny, however, we did not see any
mucilage covers during our observations of L. ciliata
(SAG 1194 and SAG 2083). The relationship
between O. lacustris and the genus Oocystidium has
not been investigated yet.
Oocystis group: The remaining strains were
assigned to the Oocystis sensu lato group. This
assemblage contains Oocystis strains sensu Kom
arek
and Fott (1983) with one strain of the genus Tetra-
chlorella (Hepperle et al. 2000, present study). Most
of the branches are missing bootstraps (i.e., the val-
ues were below 50%; Fig. 6, Figs. S1 and S2.). The
relationships between the strains remain unclear
except two clades: Oocystis heteromucosa clade and
O. parva clade (Fig. S1). The first clade contains the
sister strains SAG 82.80 O. parva and Tow 6/3 P-1ou
O. parva. The latter cluster consisted of four strains.
Two strains designated as O. parva and Oocystis sp.
(NCBI) cluster together with two strains of O. hetero-
mucosa. This clade contained the authentic strain
SAG 1.99 and therefore can represent O. heteromu-
cosa.
Generic issues. Neglectella: The genus Neglectella
was established by Vodenicarov and Benderliev
(1971) to define the large-celled algae with oval cell
shape and numerous chloroplasts arranged periph-
erally and radially. Subsequently, Neglectella was
divided into the genera Neglectella,Neglectellopsis, and
Skujaster (Vodenicarov 1989). In the present study,
N. peisonis and O. solitaria cluster together in Eremo-
sphaeroideae (Fig. 6, Figs. S1 and S2.). The close
relationship of the two taxa proposed by molecular
phylogeny is in agreement with shared morphologi-
cal characteristics such as numerous chloroplasts,
large cell dimensions, the lemon-like shape of the
cells and daughter cells remaining for a prolonged
time in the mother cell wall (Schagerl 1993, Hep-
perle et al. 2000). The ecology of O. solitaria -
littoral of acidic freshwaters - is also closer to that of
Neglectella (also littoral of acidic freshwater) than to
the freshwater planktonic Oocystis (Schagerl 1993).
The new combination as N. solitaria is proposed.
N. solitaria differs from other Neglectella species by
relatively smaller cells and smaller number of
peripheral chloroplasts which are loosely organized
and not radially arranged.
Eremosphaera: Eremosphaera, a traditional genus
of extremely large oocystoid algae with numerous
chloroplasts, has not been shown as monophyletic
in any of our analyses (Fig. 6, Figs. S1 and S2.).
Long branch attraction is a potential problem caus-
ing the uncertain placement of the strain ACOI
1819 Eremosphaera gigas. Its position varied according
to the type of analyses, but was always widely sepa-
rated from other Eremosphaera strains. ML analysis
assigned it to the Makinoelloideae but without boot-
strap support; BI to Neglectella with moderate sup-
port. None of the analysis suggested being related
to the type species of Eremosphaera -E. viridis cluster-
ing on the very base of the family Oocystaceae. The
cell structure, especially chloroplast arrangement, of
the two original Eremosphaera species differs. Cells of
E. viridis contain a large central vacuole traversed by
radial strands of cytoplasm with chloroplasts which
connect the central nucleus to the peripheral part
of the cell with numerous irregularly dispersed
chloroplasts (De Bary 1858). No such structure was
found in E. gigas whose arrangement of the chloro-
plast is rather Neglectella-like: stacked in the surface
layer of the cell (Schagerl 1993). Simultaneously,
E. gigas differ from Neglectella by its nearly spherical
to widely oval cell shape - unlike the clearly elliptical
Neglectella (Figs. 1 and 2) - and its enormous cell
dimensions (up to 130 lm according to Kom
arek
and Fott 1983).
Eremosphaera gigas, as described by Archer (1877),
currently does not have a type strain designated.
Several strains bearing this name exist in culture
collections and match E. gigas morphologically and
ecologically, including the strain ACOI 1819. None
of the available strains are authentic, and it is
unknown whether they form a monophyletic group
- a question that will be addressed in future studies,
which may result in the description of further new
taxa. This study should comprise more strains of the
genus Eremosphaera, primarily all available strains of
the species E. gigas accompanied by a new isolate
from the type locality in Ireland (Archer 1877).
Crucigeniella: The strains of former Scenedes-
maceae members C. rectangularis and W. vilhelmii
cluster inside Oocystaceae as sister taxa with moder-
ate support and both share similar cell morphology
and arrangement into crucigenoid coenobia. Our
results support their close relationship proposed by
John et al. (2014) who transferred seven Crucige-
niella species including C. rectangularis (as W. rectan-
gularis) into the genus Willea. The status of the
remaining six renamed Crucigeniella species stays
speculative because Crucigeniella is polyphyletic:
C. apiculata together with some Crucigenia species
have been placed inside Scenedesmaceae (Chloro-
phyceae; Bock et al. 2013). The entangled taxon-
omy of the genera Crucigeniella and Crucigenia has
yet to be resolved through a prospective study, likely
one including the key type species Crucigenia lunaris.
Lagerheimia: The spine-bearing genus Lager-
heimia, which currently comprises twenty accepted
species (Guiry and Guiry 2016), is not monophyletic
and should be split into two or three genera. This
would be in agreement with a recent trend to
16 LENKA
STENC L O V
AETAL.
establish small genera that differ from each other
only in a handful of features and include a small
number of species (Luo et al. 2010). Spiny clade 2
contains the type species of Lagerheimia (L. geneven-
sis) therefore, it will remain Lagerheimia. Spiny clade
1 represents another genus, presumably Franceia,
according to one of the included strains (SAG 10.81
F. amphitricha). Sequencing more species of both
genera Lagerheimia and Franceia, including the type
species Franceia ovalis, is recommended for the reso-
lution of this taxonomical issue. More data can also
help to resolve the position of L. marssonii (Fig. S2;
Table 5). According to our preliminary results, the
redefined monophyletic units will also share mor-
phological synapomorphies, namely in the number
and position of spines (Table 5).
Oocystidium: Korshikov (1953) described new
genus Oocystidium with the type species O. ovale for
Oocystis-like algae with a wide mucilage cover around
the cell. Hortob
agyi (1973) considered the shape
and structure of the cover taxonomically important
and distinguished O. ovale with a smooth and ellipti-
cal cover and O. polymammilatum with irregular-
shaped and structured mucilage. On the basis of
the molecular phylogeny and morphological similar-
ity of the cell structure and wide mucilage covers,
we suggest a new combination, O. planoconvexum.
Genus Ooplanctella and species O. planoconvexa as
well as C. planoconvexa is proposed to be recognized
as synonymous to Oocystidium and O. planoconvexum
respectively. Inside the clade, two strains of O. poly-
mammilatum clustered together with two strains
labeled as Oocystidium sp. Therefore, we rejected the
suggested combination of O. polymammilatum into
the genus Echinocoleum as Echinocoleum polymammila-
tum (Hind
ak and Horeck
a 1987) and we recom-
mend the original combination O. polymammilatum.
Oocystis: Oocystis previously proved to be a wide
genus with enormous variability including all lemon-
shaped algae Kom
arek and Fott (1983). Its delimita-
tion has been subject to changes since the genus
was established; therefore, species originally
assigned to Oocystis are now scattered in various gen-
era, e.g., Eremosphaera,Skujaster,Franceia,Lagerheimia,
Granulocystis,Granulocystopsis,Siderocelis,Elongatocystis
(Kom
arek and Fott 1983, Krienitz and Bock 2011).
A large albeit somewhat mechanical reorganization
was suggested by Hind
ak (1988), who followed the
concept of Lemmermann (1903) and proposed to
split the genus on the basis of presence/absence
into the pyrenoid-bearing Oocystella (type species
O. natans) and the pyrenoid-less Oocystis (type spe-
cies O. naegelii). Hind
ak (1988) took into account
the original description of O. naegelii, which men-
tioned chloroplasts without pyrenoid (Braun 1855)
and transferred 13 Oocystis species that possessed a
pyrenoid to Oocystella. However, the step is contro-
versial, because the type material of (Braun 1855)
was re-examined by Skuja (1964), who found chloro-
plasts with a pyrenoid. Therefore, in some later
literature (e.g., John and Tsarenko 2002) only Oocys-
tis is still recognized.
The present study classified O. solitaria outside
the genus Oocystis, in accord with previous studies
(Schagerl 1993, Hepperle et al. 2000). Hepperle
et al. (2000) suggested to exclude O. solitaria on the
basis of distant phylogenetic position from other
Oocystis species and different morphology, namely
the marked morphological dissimilarity with the
type species of Oocystis,O. naegelii. Here, we have
transferred O. solitaria into the genus Neglectella.
Additionally, we found that O. bispora,O. nephrocy-
tioides and also O. oogama do not cluster with most
other Oocystis species. Our study does not have
enough data to come to a definitive taxonomic con-
clusion regarding the complex problems of Oocystis,
and therefore the taxonomic treatment of such
putative Oocystis-affiliated taxa will be subject of
future studies.
For the future revision of the genus Oocystis,we
found that the strain MP STE 7 may be of special
interest. Its characteristics correspond to the charac-
teristics of O. naegelii, which is still recognized as the
type of the genus Oocystis, although
Reh
akov
a
(1969) suggested O. lacustris as a new type for the
genus. Subsequent studies, namely Kom
arek and
Fott (1983) recognize O. naegelii as the type, advo-
cating the thorough examinations of Skuja (1964).
The position of O. lacustris remains to be verified
with molecular data, especially its relationship with
the morphologically close genus Oocystidium.
CONCLUSIONS
Green coccal algae comprise a wide diversity of
numerous described (and undescribed) species.
Only a fraction of them has been examined with
molecular phylogenetic data so far. With the aid of
molecular tools, monophyletic units can be defined,
natural taxa better delimited, and informative mor-
phological traits that correspond to the phylogeny
can be determined. In the present study, an
updated suite of morphological characteristics was
set for the definition of the family Oocystaceae as
well for its internal taxonomic structure. The most
remarkable result of molecular phylogenetics in sys-
tematics of green algae is the recognition of only
monophyletic units, resulting in the establishment
of fairly small genera. Current oocystacean genera
will likely be further divided into smaller taxa as
demonstrated here on the genera Eremosphaera,
Lagerheimia and Oocystis.
The phylogenetic approach has its drawbacks,
however. Long branch attraction and other artifacts
resulting from systematic error in the data are some
of the most problematic, as many green algal groups
suffer from incomplete sampling and long
branches. It may be hard to distinguish whether
long branches are a result of poor sampling or a
reflection of reality –accelerated rates of evolution.
DELIMITATION OF OOCYSTACEAE 17
In Oocystaceae, especially at the deeper nodes, long
branches occurred - for example in Eremo-
sphaeroideae. Therefore, our molecular phylogeny
did not resolve the question of monophyly or para-
phyly of the subfamily. Despite the possibility that
Eremosphaeroideae is paraphyletic, we considered
the morphology of its members as diagnostic and
Eremosphaeroideae is recognized as a taxon in the
present study.
Phylogenetic relationships that remain uncertain
or unresolved will be subject to further studies.
Additional taxon sampling and data from multiple
more genes will help solidify the taxonomy within
Oocystaceae. We expect that new species and genera
will be erected in the future to accommodate the
phylogenetic diversity within the family.
Firstly, we thank Ji
r
ıKo
snar for his guidance in the molecu-
lar lab. We are grateful to the kind members of the Labora-
tory of Electron Microscopy for their assistance with the
transmission electron microscope. Special thanks belong to
Marvin W. Fawley, Christina Bock and Lothar Krienitz
for providing some Oocystaceae strains from their private
collections.
Archer, W. 1877. New species of Oocystis.Q. J. Micros. Sci.
217:104–5.
Bhattacharya, D., Helchen, T., Bebeau, C. & Melkonian, M. 1995.
Comparisons of nuclear-encoded small-subunit ribosomal
RNAs reveal the evolutionary position of Glaucocystophyta.
Mol. Biol. Evol. 12:415–20.
Bischoff, H. W. & Bold, H. C. 1963. Phycological studies IV. Some soil
algae from Enchanted Rock and related algal species. The Univer-
sity of Texas Publications, Austin, Texas, 95 pp.
Blanc, G., Duncan, G., Agarkova, I., Borodovsky, M., Gurnon, J.,
Kuo, A., Lindquist, E. et al. 2010. The Chlorella variabilis
NC64A genome reveals adaptation to photosymbiosis, coevo-
lution with viruses, and cryptic sex. Plant Cell 22:2943–55.
Bock, C., Luo, W., Kusber, W. H., Hegewald, E., Pazoutov
a, M. &
Krienitz, L. 2013. Classification of crucigenoid algae: phylo-
genetic position of the reinstated genus Lemmermannia,Tetra-
strum spp. Crucigenia tetrapedia, and C. lauterbornii
(Trebouxiophyceae, Chlorophyta). J. Phycol. 49:329–39.
Bowen, W. R. 1965. The fine structure of the unicellular green
algae Eremosphaera and Haematococcus.Diss. Abstr. 25:
4924–5.
Boyer, S. L., Johansen, J. R., Flechtner, V. R. & Howard, G. L.
2002. Phylogeny and genetic variance in terrestrial Micro-
coleus (Cyanophyceae) species based on sequence analysis of
the 16S rRNA gene and associated 16S–23S its region1. J.
Phycol. 38:1222–35.
Braun, A. 1855. Algarum unicellularium genera nova et minus cognita
praemissis observationibus de algis unicellularibus in genere. Apud
W. Engelmann, Leipzig, 114 pp.
Buchheim, M. A., Michalopulos, E. A. & Buchheim, J. A. 2001.
Phylogeny of the Chlorophyceae with special reference to
the Sphaeropleales: a study of 18S and 26S rDNA data. J.
Phycol. 37:819–35.
Crawford, R. M. & Heap, P. F. 1978. Transmission electron micro-
scopy X-ray microanalysis of two algae of the genera Scenedes-
mus and Siderocelis.Protoplasma 96:361–7.
Darriba, D., Taboada, G. L., Doallo, R. & Posada, D. 2012. JMo-
delTest 2: more models, new heuristics and parallel comput-
ing. Nat. Meth. 9:772.
De Bary, A. 1858. Untersuchungen €
uber die Familie der Conju-
gaten (Zygnemeen und Desmidieen). In Felix, A. [Ed.] Ein
Beitrag zur physiologischen und beschreibenden Botanik.F€orstner-
sche Buchhandlung, Leipzig, pp. 1–91.
Fott, B. 1967. Sinice a r asy. Akademie v
ed, Praha, 518 pp.
Fott, B. 1976. Scotiellopsis, eine neue Gattung aus der gleichnami-
gen Unterfamilie Scotiellopsidae (Oocystaceae, Chlorococ-
cales), nebst Bemerkungen zu den verwandten Gattungen.
Preslia 48:289–98.
Fott, B. & Kalina, T. 1962. €
Uber die Gattung Eremosphaera De Bary
und deren taxonomische Gliederung. Preslia 34:348–58.
Fu
c
ıkov
a, K. & Lewis, L. A. 2012. Intersection of Chlorella,Muriella
and Bracteacoccus: resurrecting the genus Chromochloris Kol et
Chodat (Chlorophyceae, Chlorophyta). Fottea 12:83–93.
Fu
c
ıkov
a, K., Lewis, P. O. & Lewis, L. A. 2014. Putting incertae
sedis taxa in their place: a proposal for ten new families and
three new genera in Sphaeropleales (Chlorophyceae, Chloro-
phyta). J. Phycol. 50:14–25.
Fu
c
ıkov
a, K., Pazoutov
a, M. & Rindi, F. 2015. Meiotic genes and
sexual reproduction in the green algal class Trebouxio-
phyceae (Chlorophyta). J. Phycol. 51:419–30.
Fu
c
ıkov
a, K., Rada, J. C. & Lewis, L. A. 2011. The tangled taxo-
nomic history of Dictyococcus,Bracteacoccus and Pseudomuriella
(Chlorophyceae, Chlorophyta) and their distinction based
on a phylogenetic perspective. Phycologia 50:422–9.
Gonzalves, E. A. & Mehra, K. R. 1959. Oocystaenium, a new genus
of the Chlorococcales. Hydrobiologia 13:201–6.
Guindon, S., Dufayard, J. F., Lefort, V., Anisimova, M., Hordijk,
W. & Gascuel, O. 2010. New algorithms and methods to esti-
mate maximum-likelihood phylogenies: assessing the perfor-
mance of PhyML 3.0. Syst. Biol. 59:307–21.
Guiry, M. D. & Guiry, G. M. 2016. AlgaeBase. World-wide elec-
tronic publication, National University of Ireland, Galway.
Available at http://www.algaebase.org.
Hanagata, N. 1998. Phylogeny of the subfamily Scotiellocystoideae
(Chlorophyceae, Chlorophyta) and related taxa inferred
from 18S ribosomal RNA gene sequence data. J. Phycol.
34:1049–54.
Hegewald, E., Aldave, A. & Schnepf, E. 1978. Investigations on
lakes of Peru and their phytoplankton. 2. Algae of pond la-
Laguna, Huanuco, with special reference to Scenedesmus inter-
medius and Scenedesmus armatus.Arch. Hydrobiol. 82:207–15.
Hegewald, E. & Schnepf, E. 2002. The ultrastructure and taxo-
nomic placement of Diacanthos belenophorus Kors. (Chloro-
phyta, Trebouxiophyceae, Micractiniaceae). Constancea
83:11.
Hegewald, E., Schnepf, E. & Aldave, A. 1980. Ivestigations on the
lakes of Peru and thein fytoplankton. 5. The algae of Laguna
Piuray and Laguna Huaypo, Cuzco, with special reference to
Franceia,Oocystis and Scenedesmus.Algol. Stud. 25:387–420.
Hegewald, E., Schnepf, E. & Jeon, S. L. 1999. Report on Maki-
noella tosaensis Okada (Chlorophyta, Oocystaceae), a new spe-
cies to Korea. Algae 14:87–90.
Helms, G., Friedl, T., Rambold, G. & Mayrhofer, H. 2001. Identi-
fication of photobionts from the lichen family Physciaceae
using algal-specific ITS rDNA sequencing. Lichenologist 33:73–
86.
Hepperle, D. 2004. SeqAssem©.A sequence analysis tool, contig
assembler and trace data visualization tool for molecular sequences.
Available at http://www.sequentix.de (accessed 8.6.2010,
11.12.2012, 21.10.2013).
Hepperle, D., Hegewald, E. & Krienitz, L. 2000. Phylogenetic posi-
tion of the Oocystaceae (Chlorophyta). J. Phycol. 36:590–5.
Heynig, H. 1991. Oocystopsis ng. –a new genus of Chlorophyceae
(Chlorellales, Oocystaceae). Protist 139:291–4.
Hind
ak, F. 1977. Studies of the chlorococcal algae (Chlorophyceae). I. –
Biol. prace. Veda, Bratislava, 190 pp.
Hind
ak, F. 1978. Genus Lagerheimia Chod and Lagerheimia-like
unicells in genus Scenedesmus Meyen (Chlorophyceae). Biolo-
gia 33:795–808.
Hind
ak, F. 1988. Studies on the chlorococcal algae (Chlorophyceae) IV.
–Biol. Prace. Veda, Bratislava, 263 pp.
Hind
ak, F. & Horeck
a, M. 1987. Echinocoleum polymammilalum
(Hortob
agyi) comb. nova (Chlorophvceae, Chlorococcales).
Biologia 42:827–34.
Hortobagyi, T. 1962. Algen aus den Fischteichen von Buzsak IV.
Nova Hedwigia 4:21–53.
18 LENKA
STENC L O V
AETAL.
Hortob
agyi, T. 1973. Microflora in the settling and subsoil water
enriching basins of the Budapest waterworks. Akad
emiai Kiado,
Budapest, 340 pp.
Index Nominum Algarum. University Herbarium, University of
California, Berkeley. Compiled by Paul Silva. Available at
http://ucjeps.berkeley.edu/CPD/ 19. 11. 2012, 5. 5. 2015.
Integrated DNA Technologies. OligoAnalyzer 3.1. Available at
http://eu.idtdna.com/analyzer/Applications/OligoAnalyzer/
Default.aspx 6. 12. 2012
Iyengar, M. O. P. & Ramanathan, K. R. 1940. On the reproduc-
tion of Anadyomene stellata.J. Ind. Bot. Soc. 19:175–6.
Iyengar, M. O. P. & Ramanathan, K. R. 1974. Contributions to
our knowledge of South Indian Algae VI. –Sexual reproduc-
tion in Crucigenia lauterbornii Schmidle. Proc. Indian Natl. Sci.
Acad. 79:227–9.
John, D. M. & Tsarenko, P. M. 2002. Order Chlorococcales. In
John, D. M., Whitton, B. A. & Brook, A. J. [Eds.] The Freshwa-
ter Algal Flora of the British Isles: An Identification Guide to Fresh-
water and Terrestrial Algae. Cambridge University Press,
Cambridge, pp. 327–409.
John, D. M., Wynne, M. J. & Tsarenko, P. M. 2014. Reinstatement
of the genus Willea Schmidle 1900 for Crucigeniella Lemmer-
mann 1900 nom. illeg. (Chlorellales, Trebouxiophyceae,
Chlorophyta). Phytotaxa 167:212–4.
Katana, A., Kwiatowski, J., Spalik, K., Zakrys, B., Szalacha, E. &
Szymanska, H. 2001. Phylogenetic position of Koliella
(Chlorophyta) as inferred from nuclear and chloroplast
small subunit rDNA. J. Phycol. 37:443–51.
Kies, L. 1967. Oogamie bei Eremosphaera viridis De Bary. Flora
157:1–12.
Kipp, V. 2004. Biodiversit€at und phylogenetische Stellung eukary-
otischer Algen in kalzifizierenden Biofilmen. Diploma thesis,
Universit€
at G€
ottingen, G€
ottingen, 100 pp.
Kom
arek, J. 1974. Morphology and taxonomy of crucigenioid
algae (Scenedesmaceae, Chlorococcales). Arch. Protistenkd.
116:1–73.
Kom
arek, J. 1979.
€
Anderungen in der Taxonomie der Chlorokok-
kalgen. Algol. Stud. 24:239–63.
Komarek, J. & Fott, B. 1983. Chlorococcales. In Huber-Pestalozzi,
G. [Ed.] Das Phytoplankton des S€ußwassers. Band 7. –1. H€
alfte.
Schweizerbart’sche Verlagsbuchhandlung, Stuttgart, pp.
1044.
Korshikov, O. A. 1953. Pidklas Protokokovi (Protococcinae). Vyznacnyk
prisnovodnych vodorostej Ukrainskoj RSR. Akademia Nauk URSR,
Kyiv, 439 pp.
Krienitz, L. & Bock, C. 2011. Elongatocystis ecballocystiformis gen.
et comb. nov., and some reflections on systematics of
Oocystaceae (Trebouxiophyceae, Chlorophyta). Fottea
11:271–8.
Krienitz, L., Bock, C., Luo, W. & Pr€
oschold, T. 2010. Polyphyletic
origin of the Dictyosphaerium morphotype within chlorel-
laceae (Trebouxiophyceae). J. Phycol. 46:559–63.
Krienitz, L., Bock, C., Nozaki, H. & Wolf, M. 2011. SSU rRNA
gene phylogeny of morphospecies affiliated to the bioassay
alga “Selenastrum capricornutum” recovered the poly-
phyletic origin of crescent-shaped chlorophyta. J. Phycol.
47:880–93.
Krienitz, L., Hegewald, E. H., Hepperle, D., Huss, V. A. R., Rohr,
T. & Wolf, M. 2004. Phylogenetic relationship of Chlorella
and Parachlorella gen. nov. (Chlorophyta, Trebouxiophyceae).
Phycologia 43:529–42.
Krienitz, L., Hegewald, E. H., Hepperle, D. & Wolf, A. 2003. The
systematics of coccoid green algae: 18S rRNA gene semence
data versus morphology. Biologia 58:437–46.
Larkin, M. A., Blackshields, G., Brown, N. P., Chenna, R., McGet-
tigan, P. A., Mcwilliam, H., Valentin, F. et al. 2007. Clustal W
and Clustal X version 2.0. Bioinformatics 23:2947–8.
Leliaert, F., Smith, D. R., Moreau, H., Herron, M. D., Ver-
bruggen, H., Delwiche, C. F. & De Clerck, O. 2012. Phy-
logeny and molecular evolution of the green algae. Crit. Rev.
Plant Sci. 31:1–46.
Lemmermann, E. 1903. Brandenburgische Algen. Zeitschr. Fischerei
11:73–123.
Lewis, L. A., Wilcox, L. W., Fuerst, P. A. & Floyd, G. L. 1992. Con-
cordance of molecular and ultrastructural data in the study
of zoosporic chlorococcalean green algae. J. Phycol. 28:375–
80.
Luo, W., Pr€
oschold, T., Bock, C. & Krienitz, L. 2010. Generic con-
cept in Chlorella-related coccoid green algae (Chlorophyta,
Trebouxiophyceae). Plant Biol. 12:545–53.
Mayr, E. 1942. Systematics and the Origin of Species from the Viewpoint
of a Zoologist. Harvard University Press, Cambridge, Mas-
sachusetts, 372 pp.
Melkonian, M. 1983. Phylum Chlorophyta. In Margulis, L., Cor-
liss, J. O., Melkonian, M. & Chapman, D. J. [Eds.] Handbook
of Protoctista. Jones and Barlett, Boston, Massachusetts, pp.
597–660.
Mishler, B. D. & Theriot, E. 2000. The phylogenetic species
concept sensu Mishler and Theriot: monophyly, apo-
morphy, and phylogenetic species concepts. In Wheeler, Q.
D. & Meier, R. [Eds.] Species Concepts and Phylogenetic The-
ory: A Debate. Columbia University Press, New York, pp. 44–
54.
Nakada, T., Misawa, K. & Nozaki, H. 2008. Molecular systematics
of Volvocales (Chlorophyceae, Chlorophyta) based on
exhaustive 18S rRNA phylogenetic analyses. Mol. Phyl. Evol.
48:281–91.
Pazoutova, M. 2008. Phylogenetic diversity and generic concept in
the family Radiococcaceae, Chlorophyta. Masters thesis,
Charles University, Prague, 74 pp.
Pazoutov
a, M.,
Skaloud, P. & Nemjov
a, K. 2010. Phylogenetic
position of Ooplanctella planoconvexa gen. et comb. nova and
Echinocoleum elegans (Oocystaceae, Trebouxiophyceae,
Chlorophyta). Fottea 10:75–83.
Pr€oschold, T., Bock, C., Luo, W. & Krienitz, L. 2010. Poly-
phyletic distribution of bristle formation in Chlorellaceae:
Micractinium,Diacanthos,Didymogenes and Hegewaldia gen.
nov. (Trebouxiophyceae, Chlorophyta). Phycol. Res. 58:1–
8.
Pr€
oschold, T. & Leliaert, F. 2007. Unraveling the algae - the past,
present, and future of algal systematics. Syst. Association Spe-
cial 75:123.
Quader, H., Wagenbreth, I. & Robinson, D. G. 1978. Structure,
synthesis and orientation of microfibrils. V. On the recovery
of Oocystis solitaria from microtubule inhibitor treatment.
Cytobiologie 18:39.
Rehakova, H. 1969. Die Variabilit€at der Gattung Oocystis A. Braun.
In Fott, B. [Ed.] Studies in Phycology. Academia, Praha, pp.
145–98.
Ronquist, F., Teslenko, M., Van Der Mark, P., Ayres, D. L., Dar-
ling, A., H€
ohna, S., Larget, B., Liu, L., Suchard, M. A. &
Huelsenbeck, J. P. 2012. MrBayes 3.2: efficient Bayesian phy-
logenetic inference and model choice across a large model
space. Syst. Biol. 61:539–42.
Schagerl, M. 1993. Light-microscopy and ultrastructure of Neglect-
ella peisonis spec. nov. –a new alga (Oocystaceae) from Neu-
siedler See (Austria). Nova Hedwigia 56:61–74.
Schmidle, W. 1903. Bemerkungen zu einigen S€usswasseralgen.
Ber. Deut. Bot. Gess. 21:346–55.
Schnepf, E., Deichgr€aber, G., Glaab, M. & Hegewald, E. 1980.
Bristles and spikes in Chlorococcales: ultrastructural stud-
ies in Acanthosphaera,Micractinium,Pediastrum,Polyedriopsis,
Scenedesmus, and Siderocystopsis.J. Ultrastr. Res. 72:367–
79.
Skuja, H. 1956. Taxonomische und biologische Studien €u ber das Phyto-
plankton schwedischer Binnengew€asser. Almqvist & Wiksell,
Stockholm, Sweden, 404 pp.
Skuja, H. 1964. Grundz€uge der Algenflora und Algenvegetation
der Fjeldgegenden um Abisko in Schwedisch-Lappland. Nova
Acta 18:1–465.
Smith, G. M. 1950. The Freshwater Algae of the United States.
McGraw-Hill Book Company, New York, 719 pp.
Spurr, A. R. 1969. A low-viscosity epoxy resin embedding medium
for electron microscopy. J. Ultrastruct. Res. 26:31–43.
Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. &
Kumar, S. 2011. MEGA5: Molecular Evolutionary Genetics
DELIMITATION OF OOCYSTACEAE 19
Analysis using maximum likelihood, evolutionary distance,
and maximum parsimony methods. Mol. Biol. Evol. 28:2731–
9.
Tavar
e, S. 1986. Some probabilistic and statistical problems in the
analysis of DNA sequences. Lect. Math. Life. Sci. 17:57–86.
The International Plant Names Index (IPNI). Available at http://
www.ipni.org/index.html 19. 11. 2012, 5. 5. 2015.
Vieira, H. H., Bagatini, I. L., Guinart, C. M. & Vieira, A. A. H.
2016. TufA gene as molecular marker for freshwater Chloro-
phyceae. Algae 31:155–65.
Vodenicarov, D. & Benderliev, K. 1971. Neglectella gen. nov.
(Chlorococcales). Nova Hedwigia 21:801–12.
Vodenicarov, D. G. 1989. Die Gattung Neglectella Vodenic et
Benderl und zwei neue Gattungen: Neglectellopsis gen. nov.
und Skujaster gen. nov. (Chlorophyta, Chlorococcales). Arch.
Hydrobiol. 82:409–424.
White, T. J., Bruns, T., Lee, S. & Taylor, J. W. 1990. Amplifica-
tion and direct sequencing of fungal ribosomal RNA
genes for phylogenetics. In Innis, M. A., Gelfand, D. H.,
Sninsky, J. J. & White, T. J. [Eds.] PCR Protocols: A Guide
to Methods and Applications. Academic Press, New York, pp.
315–22.
Wittrock, V. B. & Nordstedt, C. F. O. 1879. Literatur-€
ofversigt.
Algae aquae dulcis exsiccatae praecipue Scandinavicae quas
adjectis algis marinis chlorophyllaceis et phycochromaceis.
Bot. Notiser 1879:20–7.
Wolf, M., Hepperle, D. & Krienitz, L. 2003. On the phylogeny of
Radiococcus,Planktosphaeria and Schizochlamydella (Radiococ-
caceae, Chlorophyta). Biologia 58:759–65.
Xia, S., Zhu, H., Cheng, Y. Y., Liu, G. X. & Hu, Z. Y. 2013. Phylo-
genetic position of Ecballocystis and Ecballocystopsis (Chloro-
phyta). Fottea 13:65–75.
Yilmaz, M., Phlips, E. J. & Tillett, D. 2009. Improved methods for
the isolation of cyanobacterial DNA from environmental
samples. J. Phycol. 45:517–21.
Supporting Information
Additional Supporting Information may be
found in the online version of this article at the
publisher’s web site:
Figure S1. Phylogenetic analyses of SSU rRNA
gene sequences of members of Oocystaceae with
Chlorellaceae as an outgroup. Topology repre-
sents the best ML tree. Taxa with a new sequence
are highlighted by bold font. Numbers at the
branches indicate bootstrap support from maxi-
mum likelihood (ML, 1,000 replicates) and Baye-
sian posterior probabilities (BI). Support ≥50%
for ML and ≥0.95 for MB is shown. ML/BI Draw-
ings according to Fott and Kalina (1962), Hind
ak
(1977), Hortob
agyi (1973), Skuja (1956, 1964)
demonstrate typical morphology of the subfami-
lies and of the individual clades.
Figure S2. Phylogenetic analyses of rbcL gene
sequences of members of Oocystaceae with
Chlorellaceae as an outgroup. Topology repre-
sents the best ML tree. Taxa with a new sequence
are highlighted by bold font. Numbers at the
branches indicate bootstrap support from maxi-
mum likelihood (ML, 1,000 replicates) and Baye-
sian posterior probabilities (BI). Support ≥50%
for ML and ≥0.95 for MB is shown. ML/BI. Draw-
ings according to Hortob
agyi (1962) and Skuja
(1956) demonstrate typical morphology of the
individual Lagerheimia lineages.
Table S1. Strains examinated in present study.
Mor. =morphology, Ultra =examined ultrastruc-
ture of the call wall, SSU =obtained SSU rRNA
sequence, rbcL =obtained rbcl gene sequence. P =
present study.
Table S2. All sequences belonging to the
Oocystaceae family used for molecular analyses of
SSU rRNA. Each newly obtained sequence (and
additionally the sequences from previous studies)
was checked by BLAST to find all sequences
belonging to the family Oocystaceae. For the final
analyses were chosen only sequence with required
quality (sufficient length without intrones, over
1,500 bp for SSU rRNA). Simultaneously we used
only one sequence of each taxa (strain or clone)
if more than one were available. We skipped
sequences of taxa examined in another paper (in
prep, in press). We covered as much molecular
variability in the Oocystaceae and some lineages
with uncertain positions (Planctonema, Tetrastrum)
as possible and used four species of Chlorellaceae
as outgroup. The closest relations of Chlorel-
laceae was confirmed by previous studies and also
by preliminary analyses made by authors.
20 LENKA
STENC L O V
AETAL.
