Content uploaded by Jitendra K Biswal
Author content
All content in this area was uploaded by Jitendra K Biswal on Nov 18, 2015
Content may be subject to copyright.
Marker vaccine potential of foot-and-mouth disease virus with large
deletion in the non-structural proteins 3A and 3B
Jitendra K. Biswal
a
,
*
, Saravanan Subramaniam
a
, Rajeev Ranjan
a
, Gaurav K. Sharma
a
,
Jyoti Misri
b
, Bramhadev Pattnaik
a
,
*
a
ICAR-Project Directorate on Foot-and-Mouth Disease, Mukteswar, Nainital 263138, India
b
Indian Council of Agricultural Research, Krishi Bhavan, New Delhi 110 001, India
article info
Article history:
Received 15 May 2015
Received in revised form
30 June 2015
Accepted 10 July 2015
Available online 8 August 2015
Keywords:
Marker FMD virus
DIVA
3A and 3B NSP
Reverse genetics
abstract
Foot-and-mouth disease (FMD) is a highly contagious, economically important disease of transboundary
importance. Regular vaccination with chemically inactivated FMD vaccine is the major means of con-
trolling the disease in endemic countries like India. However, the traditional inactivated vaccines may
sometimes contain traces of FMD viral (FMDV) non-structural protein (NSP), therefore, interfering with
the NSP-based serological discrimination between infected and vaccinated animals. The availability of
marker vaccine for differentiating FMD infected from vaccinated animals (DIVA) would be crucial for the
control and subsequent eradication of FMD in India. In this study, we constructed a negative marker
FMDV serotype O virus (vaccine strain O IND R2/1975), containing dual deletions of amino acid residues
93e143 a nd 10 e37 in the non-structural proteins 3A and 3B, respectively through reverse genetics
approach. The negative marker virus exhibited similar growth kinetics and plaque morphology in cell
culture as compared to the wild type virus. In addition, we also developed and evaluated an indirect
ELISA (I-ELISA) targeted to the deleted 3AB NSP region (truncated 3AB) which could be used as a
companion differential diagnostic assay. The diagnostic sensitivity and specificity of the truncated 3AB
I-ELISA were found to be 95.5% and 96%, respectively. The results from this study suggest that the
availability negative marker virus and companion diagnostic assay could open a promising new avenue
for the application of DIVA compatible marker vaccine for the control of FMD in India.
©2015 The International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights
reserved.
1. Introduction
Foot-and-mouth disease is an extremely contagious viral dis-
ease of cloven hoofed domesticated and wild ungulates. The dis-
ease is endemic in Asia, Africa and parts of the South America
where it has a high negative economic impact on animal health,
productivity and international trade [1]. The etiological agent, FMD
virus (FMDV) is the prototype member of the genus Aphthovirus in
the family Picornaviridae [2]. The positive sense single stranded
RNA genome of FMDV is protected by an icosahedral capsid con-
taining 60 copies of each of the four structural proteins, VP4, VP2,
VP3 and VP1. The viral genome encodes a single polyprotein that is
post-translationally cleaved by virus-encoding proteases to yield
four structural and 10 non-structural proteins (NSP) (L, 2A, 2B, 2C,
3A, 3B
1e3
, 3C and 3D) [3].
FMD is controlled primarily by vaccination. The current vaccine
against FMD consists of chemically inactivated whole virus prepa-
ration that is formulated with either mineral oil or aluminium
hydroxide adjuvant depending upon the target species [4].
Although the current vaccines can prevent the clinical signs and
limit further spread of the disease, they do not induce sterile im-
munity [5,6]. Therefore, the possibility of FMD infection in the
vaccinated population necessitates methods to identify these ani-
mals. Currently this is achieved by NSP-antibody based serological
assays which permit differentiation of infected from vaccinated
animals [7]. However, vaccine preparations, depending upon their
sources, can contain traces of NSPs, which makes it difficult to
detect infection in repeatedly vaccinated populations [8e10].
An alternative approach resides in the concept of marker vac-
cine against FMDV which could be engineered to exclude one or
*Corresponding authors. ICAR-Project Directorate on Foot and Mouth Disease,
Mukteswar, Nainital 263138, Uttarakhand, India. Fax: þ91 5942 286307.
E-mail addresses: jkubiswal@gmail.com (J.K. Biswal), pattnaikb@gmail.com
(B. Pattnaik).
Contents lists available at ScienceDirect
Biologicals
journal homepage: www.elsevier.com/locate/biologicals
http://dx.doi.org/10.1016/j.biologicals.2015.07.004
1045-1056/©2015 The International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.
Biologicals 43 (2015) 504e511
more viral non-structural proteins or parts thereof (negative
marker vaccine). By use of the negative marker vaccine, infected
animals would therefore generate serological profiles different to
those of the vaccinated animals, which would permit the identifi-
cation of infected animals through a companion diagnostic assay
(DIVA tests). Marker vaccines and companion DIVA tests have been
used successfully for the control and eradication of numerous an-
imal diseases [11e13].
In India, a vaccination-based FMD-control programme was
launched in 2003e04 with an aim of creating disease-free zones
[14]. In this context, in order to have information on the level of
FMDV infection in domesticated large ruminants, irrespective of
vaccination, national FMD serosurveillance is being carried out by
determining seroconversion against 3AB3 NSP using an in-house
3AB3 protein-based indirect ELISA [15]. Considering this back-
ground, the current study was undertaken to generate a negative
marker vaccine strain against FMDV containing dual deletions of
amino acid residues 93e143 and 10e37 in the non-structural
protein 3A and 3B respectively, using a full-genome length infec-
tious cDNA clone for FMDV serotype O vaccine strain O IND R2/
1975. The marker virus exhibited similar growth kinetics, plaque
morphology in BHK-21 cell culture as compared to the wild type
virus. In addition, we also developed and evaluated an indirect
ELISA targeted to the deleted 3AB NSP region (truncated 3AB)
which could differentiate animals infected with the wild type vi-
ruses from those vaccinated with the new negative marker
vaccines.
2. Materials and methods
2.1. Cells, viruses and plasmid
FMDV susceptible cell line BHK-21 was propagated in Glasgow
minimum essential medium (GMEM, Sigma, USA) supplemented
with 10% foetal bovine serum (FBS). Virus stocks were prepared and
titrated in BHK-21 cells using the plaque assay [16].
FMDV serotypes O vaccine strain O IND R2/1975 was obtained
from the national FMD virus repository maintained at ICAR-Project
Directorate on Foot-and-mouth disease, Mukteswar, India.
FMDV serotype O IND R2/1975 infectious cDNA clone (pO
R2/1975
)
was used as donor plasmid for the engineering of negatively
marked FMDV. The construction of full-length infection cDNA clone
for FMDV O IND R2/1975 has been described earlier [17].
2.2. Construction of genome-length infectious cDNA clone
containing dual deletions in 3A and 3B NSP coding regions
An inverse-PCR mediated site-directed mutagenesis experiment
[18] was conducted on the donor plasmid pO
R2/1975
to delete the
coding region corresponding to the amino acid residues 93e143 of
the NSP 3A. After the PCR, an aliquot of the reaction mixture was
used to transform chemically competent Escherichia coli (E. coli)
XL1 blue cells (Agilent Technologies, U.K.) and ampicillin-resistant
colonies were screened for recombinant plasmid. Positive clones
were characterised by nucleotide sequencing (ABI 3130 Genetic
analyzer, Applied Biosystems, CA, USA). The resultant recombinant
plasmid was designated as pO
R2/1975-
DD
3A
. A second round of
inverse-PCR mediated site-directed mutagenesis experiment was
conducted on the plasmid pO
R2/1975-
D
3A
to delete the coding region
corresponding to the amino acid residues 10e37 of the NSP 3B. The
final mutated genome-length cDNA clone was designated as pO
R2/
1975-
D
3Ae
D
3B
. All the site-directed mutagenesis experiments were
conducted using the Q5 Site-directed mutagenesis kit (NEB, USA),
as per the manufacturer's instruction. The primers used for the
deletion of the coding regions in the NSP 3A and 3B are listed in
Table 1.
2.3. Transfection and rescue of mutant virus from the infectious
cDNA clone
The plasmid pO
R2/1975-
D
3Ae
D
3B
was linearised at the NotI site
following the poly (A) tract and used as a template for RNA syn-
thesis using T7 high yield RNA synthesis kit (NEB, USA), according
to the manufacturer's protocol. BHK-21 cells were transfected with
these synthetic RNA by chemical transfection method as described
previously [19]. The transfected BHK-21 cell monolayer was
washed and GMEM with 2% FBS was added, and incubated up to
48 h at 37
C. After successive passages in BHK-21 cells, mutant
virus stock was prepared and the deletion of coding sequence
corresponding to the amino acid residues 93e143 of the NSP 3A
and 10e37 of the NSP 3B was verified through nucleotide
sequencing.
2.4. Identification and characterisation of rescued mutant virus
Rescued mutant virus was identified using the serotype specific
antigen-ELISA as described earlier [20].Affinity purified bovine
polyclonal antibody specific for the truncated 3AB (t3AB) protein
was purified from the bovine convalescent serum by immune-
affinity chromatography (explained below) and used in Western
blot, immunocyto-chemistry and immune-fluorescent assay to
analyse the expression of marker antigen expression of mutant
FMDV.
For Western blot assay, cell-culture supernatant of wild-type
and mutated viruses (both at 10th passage) were separated by
SDS-PAGE and transferred onto 0.45
m
m nitro-cellulose membrane.
Subsequently, the membrane was incubated with affinity purified
t3AB specific bovine antiserum (1:200). Following incubation with
rabbit anti-cow immunoglobulin/HRP conjugate (DAKO, Denmark),
the membrane was developed with DAB substrate solution.
For immune-cytochemistry, BHK-21 cell monolayers grown on
glass coverslips were infected either with wild type or mutated
FMDV (both at 10th passage) at a multiplicity of infection (m.o.i) of
5. The infected cells were fixed with cold acetone:methanol (1:1)
mixture for 20 min at room temperature, after 7e8 h of infection.
After washing the fixed cells twice with PBS, affinity purified t3AB
specific bovine antibody and rabbit anti-cow immunoglobulin/HRP
Table 1
List of Oligonucleotide primers used in this study.
Primers designation Nucleotides sequence (5
0
-3
0
) Nucleotide position
a
Purpose
3A
D
93e144 F AAACCCGTGGAGGAACAAC 5650e5668 For deletion of amino acid residues 93e144 of NSP 3A
3A
D
93e144 R CTCATTCACTGCGTCATCC 5631e5649 For deletion of amino acid residues 93e144 of NSP 3A
3B
D
10e37 F GTGAAAGCAAAAGCCCCGGTC 5707e5727 For deletion of amino acid residues 10e37 of NSP 3B
3B
D
10e37 R ACGCTCAAGTGGCCCGGC 5689e5706 For deletion of amino acid residues 10e37 of NSP 3B
a
Nucleotide position is relative to the FMDV serotype O IND R2/1975 full-genome length infection clone with deletion of amino acid residues 93e143 and 10e37 in the non-
structural protein 3A and 3B, respectively (GenBank accession number KR139753).
J.K. Biswal et al. / Biologicals 43 (2015) 504e511 505
conjugate (DAKO, Denmark) was used for detection as per the
method described before [21,22].
For indirect-immunofluorescent assay, BHK-21 cells grown on
glass coverslips were mock infected or either infected with wild-
type or mutated FMDV serotype O for 7e8hat37
C. After this
time point, cells were fixed with cold acetone:methanol (1:1),
permeabilized with 0.1% Triton-X-100 and blocked with 3% BSA.
The cells were then probed with affinity purified bovine t3AB
specific antiserum followed by rabbit anti-bovine IgG-FITC (Sigma,
USA) secondary antibody with multiple PBS washes after each
antibody treatment. Finally the coverslips were mounted onto the
glass slides with DAPI supplemented Prolong gold mounting agent
(Invitrogen, USA) and examined using a fluorescent microscope
(Leica DM2500).
To determine the replication kinetics of the rescued mutated
and wild-type virus, one-step growth curves analysis was con-
ducted. For this, BHK-21 cell monolayers were infected either with
recombinant mutated or wild-type FMDV at an m.o.i of 2, washed
extensively at 1 h post-infection with PBS (pH: 6), and then incu-
bated at 37
C for 4, 8, 12, 16 and 20 h. The titres at various time
points after post infection were determined by plaque assay [16].
2.5. Molecular cloning, expression and purification of recombinant
truncated 3AB (r-t3AB) protein
2.5.1. Construction of r-t3AB gene expression vector
FMDV serotype O IND R2/1975 infectious cDNA clone (pO
R2/1975
)
was used as a template for the amplification of the truncated coding
region of the 3AB by PCR using an upstream primer t3AB-F
(CGCGAACAGATTGGAGGTTACATCGAGAAAGCA) and a down-
stream primer t3AB-R (GTGGCGGCCGCTCTATTA
TTTCAGTGGTTTTTG). In order to perform enzyme free cloning with
the pETiteTM plasmid vector (Lucigen, Middleton, USA), the up-
stream and downstream primers contained an 18 nucleotides
sequence (bold and underlined) that add sequences identical to the
ends of the cloning vector adjacent to the cloning site. The PCR was
carried out using a Q5
®
Hot Start High-Fidelity DNA Polymerase kit
(NEB, Ipswich, MA, USA).
Consequently, the agarose gel purified t3AB amplicon was
mixed with the pETite N-6xHis-SUMO plasmid vector (Lucigen,
Middleton, USA) and transformed directly into chemically compe-
tent HI-Control 10G E. coli cells (Lucigen, Middleton, USA). Ho-
mologous recombination [23] within the host E. coli cells
seamlessly joined the t3AB insert with the vector to generate the
recombinant plasmid pETite N-His SUMO-t3AB. In this recombi-
nant plasmid, the t3AB coding sequence was ligated in frame with
the 6xHis-SUMO tag. The resultant recombinant clones were
selected on the kanamycin agar plates and screened by plasmid
PCR. The positive recombinant clones were re-transformed into HI-
Control BL21 (DE3) cells (Lucigen, Middleton, USA) for expression of
the cloned t3AB gene from the T7 promoter. The nucleotide
sequence of the insert was confirmed using PCR with gene-specific
primers and analysed with an ABI 3130 automated DNA sequencer
(Applied Biosystems, CA, USA). Positive clones were subsequently
subjected to protein expression screening.
2.5.2. Purification and immunological characterisation of
recombinant t3AB protein
Expression and affinity purification of the recombinant 6xHis-
SUMO-t3AB fusion protein was performed according to a method
described earlier [24]. The purity of the r-t3AB protein was assessed
by SDS-PAGE [25]. The immunoreactivity of the purified r-t3AB
protein was analysed by Western blot using the bovine convales-
cent serum (BCS) collected from known FMDV infected cattle.
2.5.3. Purification of r-t3AB monospecific polyclonal antibodies
from BCS using immunoaffinity chromatography
r-t3AB monospecific polyclonal antibodies were isolated from
BCS by immunoaffinity chromatography on Ni-NTA agarose
matrices immobilised with r-t3AB protein. For purification of r-
t3AB monospecific polyclonal antibody, Gentle Ag/Ab Binding and
Elution Buffer Kit (Pierce, Thermo Scientific) was used as per the
manufacturer's instruction. Briefly, BCS collected from FMDV
infected cattle was diluted with equal volume of Tris-buffered sa-
line (TBS), and added to the antigen column containing r-t3AB
bound to the Ni-NTA agarose beads. After washing the antigen
column with 5e10 gel-bed volumes of TBS, the r-t3AB monospecific
antibody was eluted (three fractions of 1.5 ml each) by adding
Gentle Ag/Ab Elution Buffer. The fractions were collected, pooled
and dialysed against phosphate-free buffered solution.
2.6. Serology
2.6.1. Serum samples
Serum samples used in this study were collected either from
cattle and buffalo, and the term bovine in this manuscript implies
both of them. Serum samples collected from naïve, uninfected-
vaccinated and infected animals were obtained from the serum
repository maintained at ICAR-Project Directorate on Foot-and-
mouth Disease, Mukteswar, India. This study complied with the
international standards for animal welfare.
A total 180 serum samples collected from clinically healthy
bovine population and found negative for anti-FMDV structural
protein antibodies in liquid-phase blocking ELISA were used in this
study.
Serum samples (n¼240) were collected from an FMD free dairy
cattle herd that was vaccinated routinely at six months intervals
with a trivalent inactivated vaccine. These samples were collected
at 180 days post-vaccination (dpv). Samples (n¼60) were also
collected at 21 dpv from cattle that were used in FMD vaccine
potency studies. All of these 300 serum samples collected from
vaccinated, uninfected animals along with the serum samples from
naïve bovines (n¼180) were used for the determination of the cut-
off value and diagnostic specificity of t3AB indirect ELISA (I-ELISA).
Bovine serum samples (n¼800) from clinical cases of FMDV
field outbreaks were also included in this study. These samples
were collected at different time points during the outbreaks,
ranging from the acute phase to nearly one year post-outbreak.
Bovine serum samples (n¼1800) that had been collected at
random from different parts of the country were also analysed in
t3AB I-ELISA.
2.6.2. Development of recombinant truncated t3AB-based indirect
ELISA
During the development of the t3AB indirect ELISA (I-ELISA), the
concentrations of the various components of the assay were opti-
mised by the checker-board titration method. Briefly, 96-well, flat-
bottom polystyrene plates (Nunc, Denmark) were coated with pu-
rified recombinant t3AB protein diluted in carbonate-bicarbonate
buffer and incubated at 4
C overnight. Plates were washed three
times with PBS containing 0.05% Tween-20 (PBST) and test serum
samples, positive and negative control sera were diluted (1:20) in
the dilution buffer (PBST, 3% skim milk, 10% normal horse serum
and 0.02% E. coli sonicate) and added to the plates in duplicate. The
positive and negative sera were included as internal controls, while
dilution buffer without any serum was included as a conjugate
control to determine any background activity. After incubating the
plates at 37
C for 1 h and subsequently, after washing with PBST,
rabbit anti-cow immunoglobulin/HRP conjugate (DAKO, Denmark)
diluted 1:2000 in the dilution buffer was added and the ELISA
J.K. Biswal et al. / Biologicals 43 (2015) 504e511506
plates were incubated at 37
C for 1 h. Finally, substrate solution
containing orthophenylene diamine/hydrogen peroxide was added
and allowed to stand for 12 min for colour to develop. The reaction
was stopped by using 1 M H
2
SO
4.
The optical density (O.D) values
were measured at 492 nm using the ELISA plate reader (Tecan,
Switzerland).
The corrected mean OD values of the positive control (mOD
Pos
),
the negative control (mOD
Neg
), and the test samples (mOD
Sample
)
were determined after subtracting the mean OD value of the
background control wells (mOD
Bg
). The OD for each test serum
sample was expressed as a percentage of the positive control using
the following formula:
Percent of positive control ðPPÞ¼hmOD
Sample
i100=½mOD
POS
2.6.3. r3AB3 indirect ELISA
In order to determine the concordance between t3AB I-ELISA
and the in-house r3AB3 I-ELISA, an arbitrarily selected set of serum
samples (n¼2720) from the serum panel as described in the
Section 2.6.1 were also tested by r3AB3 I-ELISA as described earlier
[15].
3. Results
3.1. Generation of negatively marked FMDV O IND R2/1975
In order to introduce a negative marker into the full-genome
length cDNA clone of FMDV serotype O IND R2/1975 (pO
R2/1975
), a
Q5 Site-directed mutagenesis kit enabled inverse-PCR was con-
ducted. The inverse-PCR utilised robust Q5 Hot Start high-fidelity
DNA polymerase enzyme along with custom mutagenic primers to
introduce deletions in the NSP 3A (amino acid residues 93e143)and
3B (amino acid residues 10e37). Subsequently, the modified FMDV
full-genome length cDNA clone was designatedas pO
R2/1975-
D
3Ae
D
3B.
Nucleotides sequence analysis revealed that the deletion mutant
construct pO
R2/1975-
D
3Ae
D
3B
contains the expected amino acid resi-
dues deletions in the NSP 3A and 3B and no other amino acid residue
changes. The GenBank accession number for the mutant construct
pO
R2/1975-
D
3Ae
D
3B
is KR139753. The in vitro synthesised RNA tran-
scripts from the mutated plasmid pO
R2/1975-
D
3Ae
D
3B
were trans-
fected into BHK-21 cell monolayer and viable negatively marked
FMDV O IND R2/1975 was recovered. The negatively marked re-
combinant virus was designated as vO
R2/1975-
D
3Ae
D
3B
. The genetic
stability of the amino acid residues deletions in the NSP 3A and 3B
was also examined by nucleotide sequence analysis, and the result
showed that engineered deletions was retained up to 10 serial
passages of mutated virus in BHK-21 cell monolayer.
3.2. In vitro characterisation of negatively marked vaccine
To determine the possible effect of the deletion of amino acid
residues in the NSP 3A and 3B on virus growth, in vitro growth
kinetics of the negative marker virus and wild-type virus were
determined on BHK-21 cell monolayers at an m.o.i of 2. The one-
step growth curves revealed no significant differences of growth
kinetics between these viruses, and both the viruses yielded high
and comparable titer at 16e20 h post infection (Fig. 1a). Further-
more, the negative marker virus produced a plaque phenotype
similar to the wild-type virus in BHK-21 cell (Fig. 1b). These results
suggest that large deletions of amino acid residue in the NSP 3A and
3B do not affect the virus replication and virus yield in BHK-21 cells.
In order to determine the antigenic profile of mutant versus the
wild-type viruses, FMDV serotype O infected BHK-21 cells were
analysed by Western blot assay (Fig. 2a), Immunocytochemistry
(Fig. 2b) and Immunofluorescence assays (Fig. 2c). As shown in
Fig. 2, BHK-21 cells infected with the wild type FMDV were
immunoreactive with the affinity purified monospecific polyclonal
antibody against the t3AB NSP, while the negative marker virus
failed to react with antibody specific for the t3AB protein. Failure of
marker virus to react with the monospecific polyclonal antibody
specific for the t3AB protein indicates that the deletion of amino
acid residues 93e143 an d 10e37 in the NSP 3A and 3B, respectively
abolished the ability of the marker virus to be recognised by the
specific antibody.
3.3. Development and evaluation of recombinant t3AB I-ELISA as
marker antibody assay
Truncated 3AB (t3AB) coding sequence was cloned and
expressed as soluble 6xHis-SUMO tagged recombinant t3AB pro-
tein as described in the materials and methods. SDS-PAGE analysis
revealed a protein band of approximately 30 kDa (Fig. 3a), which
corresponds to the calculated molecular weight of 6xHis-SUMO-
t3AB protein. The immunoreactivity of recombinant t3AB protein
was confirmed by Western blotting with the bovine convalescent
serum collected from FMDV infected cattle (Fig. 3b).
For the standardisation of recombinant t3AB-based I-ELISA
protocol, the concentration of recombinant antigen and test serum
dilutions were fixed after conducting checker-board titration.
Serum dilution was selected to attain an acceptable signal-to-noise
ratio at the minimum concentration of recombinant antigen. The
Fig. 1. One-step growth kinetics and plaque morphologies of wild-type (wt) and negative marker (
D
3Ae
D
3B) FMDV serotype O IND R2/1975. (a) One-step growth curves for wt and
D
3Ae
D
3B FMDV O IND R2/1975. Samples were frozen at selected time intervals and titrated on BHK-21 cells. Each data point represents the mean (þSD) of three wells, (b) similarity
in plaque morphology of the wt and
D
3Ae
D
3B FMDV O IND R2/1975 obtained using the BHK-21 cell monolayer.
J.K. Biswal et al. / Biologicals 43 (2015) 504e511 507
optimal coating antigen concentration and serum dilution were
finalised at 60 ng per well of the ELISA plate and 1:20, respectively
(Fig. 4). Further, to ensure the validity of the assay following criteria
were chosen:
(i) The corrected mean absorbance of the positive control
should be between 1.2 and 1.6.
(ii) The PP values of the negative and conjugate control should
not exceed 20% and 10%, respectively.
The normalised PP values of the serum samples (n¼1280),
consisting of samples from naïve (n¼180), uninfected-vaccinated
(n¼300) and infected (n¼800) animals were used for the
Fig. 2. In vitro characterisation of negative marker virus. (a) Western blot analysis of whole cell lysates of BHK-21 cells either mock infected or infected with wild-type (wt) or
negative marker (
D
3Ae
D
3B) FMDV serotype O IND R2/1975. The blot was probed with affinity purified t3AB mono-specific antibody for the presence or absence of 3A and/or 3AB
protein bands. Analysis of marker epitope expression by (b) immuno-cytochemistry, and (c) indirect immune-fluorescence assays. BHK-21 cells grown on coverslips were either
mock infected or infected with wt or
D
3Ae
D
3B FMDV O IND R2/1975 for 7e8 h, and subsequently probed with affinity purified t3AB mono-specific antibody. In case of immuno-
cytochemistry assay, the arrows denotes BHK-21 cells with FMDV 3A and/or 3AB antigeneantibody complex, while in case of immune-fluorescence assays, the arrows indicates the
punctuated distribution of 3A and/or 3AB protein around the nucleus of infected BHK-21 cells.
Fig. 3. SDS-PAGE profile (a), and Western blot (b) analysis of expressed recombinant
t3AB protein. Lane M, protein marker; lane 1, un-induced E. coli lysates; lane 2, su-
pernatant fraction of IPTG-induced E. coli sonicate; lane 3 &4, affinity purified t3AB
protein fractions-1 &-2. For Western blot analysis un-induced E. coli lysates and af-
finity purified t3AB protein fraction-2 were separated by SDS-PAGE and the nitro-
cellulose blot was subsequently probed using the bovine convalescent serum (BCS)
collected from known FMDV infected cattle.
Fig. 4. Checkerboard titration to optimise recombinant t3AB protein concentration
and serum dilution. Various dilutions of positive control serum indicated by different
markers are shown at one side of the plot. The arrow indicates the optimum con-
centration of t3AB protein antigen and serum dilution.
J.K. Biswal et al. / Biologicals 43 (2015) 504e511508
determination of the cut-off value of t3AB I-ELISA by ROC and TG-
ROC analysis (Fig. 5). At the cut-off value of 50 PP, a diagnostic
specificity of 96% (95% confidence interval, 92.3e97.4) and a diag-
nostic sensitivity of 95.5% (95% confidence interval, 92.4e97.4)
were achieved (Table 2).
As mentioned in the introduction section of the manuscript, the
in-house r3AB3 I-ELISA has been used extensively throughout India
for differentiation of the FMDV-infected from the vaccinated pop-
ulation. Therefore, it was necessary to compare the newly devel-
oped t3AB I-ELISA with that of the 3AB3 I-ELISA. For making this
comparison, serum samples were selected arbitrarily, representing
various epidemiological situations (Section 2.6.1). The highest level
of concordance was observed for naïve serum samples, while the
lowest level of concordance was observed in serum samples
collected from field outbreaks (Table 3). The overall concordance
between these two I-ELISAs was found to be 96.58% (Table 3).
4. Discussion
The development of marked vaccines against viral diseases of
veterinary importance has achieved in the past using various ap-
proaches. Pseudorabies virus and bovine herpes virus marked
vaccines were among the first to be developed and deployed in the
field [26,27]. These vaccines were followed by the development of
negative marked vaccines for RNA viruses, such as classical swine
fever virus [28], Newcastle disease virus [29], and Equine Arteritis
virus [30] through epitopes deletion strategy. These studies on RNA
viruses provided insight into the development of negative marker
vaccine against FMDV. FMDV serotype specific negative marker
vaccine and companion DIVA assay was developed and evaluated
by the partial deletion of the VP1 G-H loop [31]. However, in an
endemic country, with the circulation of multiple FMDV serotypes,
it could be recommended that the negative marker vaccine should
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
0.9
1
0 50 100 150 200 250 300
Sens itivity / Spe cificity
PP Values
Sensitivity
Specificity
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
0.9
1
00.20.40.60.81
True positive rate (Sensitivity)
False positive rate (1 - Specificity)
ROC Curve / Test / AUC=0.981
ab
Fig. 5. ROC and TG-ROC analysis for determination of the cut-off value of the t3AB I-ELISA. (a) Sensitivity over 1-specificity at different cut-off values. Each point on ROC plot
represents sensitivity and specificity pair for a particular cut-off value, (b) curves of the relative sensitivity and specificity of t3AB I-ELISA produced by TG-ROC analysis.
Table 2
Diagnostic sensitivity and diagnostic specificity for recombinant t3AB I-ELISA at different cut-off points as determined by the ROC analysis. The cut-off points were depicted as
percentage of positivity. The selected cut-off point (50 PP) has been highlighted.
Cut-off values Sensitivity 95% Confidence interval Specificity 95% Confidence interval LRþLR
Lower bound Upper bound Lower bound Upper bound
10.0 1.00 0.984 1.000 0.311 0.260 0.367 1.452 0.000
20.0 0.993 0.973 1.000 0.545 0.488 0.602 2.185 0.013
30.3 0.983 0.959 0.994 0.776 0.724 0.821 4.392 0.022
40.0 0.959 0.928 0.977 0.885 0.842 0.917 8.309 0.047
50.0 0.955 0.924 0.974 0.960 0.923 0.974 21.017 0.047
60.1 0.873 0.829 0.906 0.979 0.954 0.991 41.606 0.130
70.0 0.790 0.740 0.833 0.990 0.968 0.998 75.349 0.212
80.0 0.660 0.603 0.712 0.990 0.968 0.998 62.900 0.344
90.0 0.553 0.496 0.609 0.993 0.973 1.000 79.117 0.450
100.1 0.467 0.411 0.525 0.993 0.973 1.000 66.832 0.536
LRþ¼likelihood-ratio for a positive test result; LR¼likelihood-ratio for a negative test result.
Table 3
Comparison of the performance of t3AB I-ELISA with that of r3AB3 I-ELISA.
Sera Total number tested t3AB I-ELISA r3AB3 I-ELISA (no. concordance) Concordance rate
Positive Negative Positive Negative
Unvaccinated Naïve samples 120 0 120 0 120 (120) 100% (120/120)
Vaccinated Uninfected samples 200 8 192 10 (8) 190 (186) 97% (194/200)
Samples from Field Outbreak 600 559 41 568 (545) 32 (28) 95.5% (573/600)
Random Samples 1800 718 1082 734 (704) 1066 (1032) 96.4% (1736/1800)
Total 2720 1285 1435 1312 (1257) 1408 (1366) 96.43%
2623/2720
J.K. Biswal et al. / Biologicals 43 (2015) 504e511 509
be designed by deletion or modification of epitopes present in the
NSP [32]. Recently, attenuated antigenically marked FMDV vaccine
featuring the deletion of leader protein have been produced by
modification of specific B-cell epitopes in the NSP 3B and 3D [33].
Nevertheless, a potential bottleneck of live-attenuated FMDV vac-
cine is that the virus could be too attenuated to induce consistent
and protective immune response against infection [34]. Consid-
ering these observations, the stated goal of our current endeavour
is to test a concept designed to negatively marked vaccine against
FMDV with large deletion of epitopes present in the NSP 3A and 3B.
Earlier studies [35,36] and our B-cell epitope prediction analysis
(data not shown) revealed the presence of immunodominant epi-
topes on the C-terminal of the NSP 3A and on the NSP 3B1 and 3B2.
Previous reports have shown that the FMDV 3A NSP can tolerate
large deletion in the amino acid residues 93e143 without affecting
the replication abilities in BHK-21 cell line [37,38]. Furthermore,
FMDV with deletions [39] or domain disruption [40] in the NSP 3B1
and 3B2 can also be recovered from the full-length infectious cDNA
clones. Although, FMDV featuring the above deletions in the NSP 3A
and 3B have been rescued and characterised in detailed, the po-
tential marker vaccine capabilities of these viruses have not been
considered. Therefore, in the current study we generated nega-
tively marked FMDV containing large deletions of amino acid res-
idues in the NSP 3A (93e143) and 3B (10e37). This study revealed
that marker FMDV O IND R2/1975 had similar growth kinetics and
plaque morphology as compared to the wild type virus in BHK-21
cell monolayer. Furthermore, the marker virus was genetically
stable until 10 serial passages in BHK-21 cells, indicating its po-
tential use in the production of vaccine against FMDV. In addition,
the results from the Western blot analysis, immuno-fluorescent
and immuno-cytochemistry assay showed that the affinity puri-
fied monospecific antibody against the t3AB protein, had high
reactivity with the wild type virus, but failed to react with 3Ae3B
deleted FMDV. Therefore, the 3Ae3B NSP deleted virus could be
deployed as chemically inactivated FMDV negative marker vaccine
in the field along with a companion DIVA diagnostic assay.
Along with the generation of negative marker virus, we have
also developed and evaluated a companion differential diagnostic I-
ELISA based on the recombinant truncated 3AB protein targeted to
the deleted regions of the NSP 3A and 3B. At a fixed cut-off value of
50 PP, a sensitivity of 95.5% and specificity of 96% were determined
for the t3AB I-ELISA. Furthermore, during the current analysis, a
good overall concordance was observed between the earlier vali-
dated r3AB3 I-ELISA and the current t3AB assay. Therefore, the t3AB
assay could be used along with negative marker vaccine for na-
tional FMD serosurveillance, which is being carried out in India.
The large deletions of epitopes in the non-structural proteins 3A
and 3B could simplify the downstream processing during com-
mercial FMD vaccine production, making it needless to remove
NSPs from the vaccine antigens. This will not only reduce the costof
vaccine production, but could also potentially increase the potency
of the FMD vaccine since it is often hypothesised that presence of
NSPs is desirable for the induction of a stronger and cross-reactive
immune response to FMD [6,33].
In conclusion, our study indicates that genetically defined FMDV
serotype O IND R2/1975 with the large deletions of amino acid
residues in the NSP 3A and 3B, could be potentially useful as a
negative marker vaccine for the application of DIVA compatible
vaccine to control FMD in endemic settings. In future, we intend to
study the growth characteristics of the negative marker virus in
suspension culture of BHK-21. Further studies are also required, to
experimentally challenge the cattle immunised with such a nega-
tive marker vaccine in order to determine the level of protection
the vaccine could offer and to validate the efficacy of the t3AB re-
combinant protein based I-ELISA for differential diagnosis.
Acknowledgements
This work was supported by Indian Council of Agricultural
Research (ICAR) under the project number-IXX10079. Assistance of
P. Bisht, Research Associate, in ELISA work is appreciated.
References
[1] Paton DJ, Sumption KJ, Charleston B. Options for control of foot-and-mouth
disease: knowledge, capability and policy. Philos Trans R Soc Lond Ser B
Biol Sci 2009;364:2657e67.
[2] Belsham GJ. Distinctive features of foot-and-mouth disease virus, a member of
the picornavirus family; aspects of virus protein synthesis, protein processing
and structure. Prog Biophys Mol Biol 1993;60:241e60.
[3] Grubman MJ, Baxt B. Foot-and-mouth disease. Clin Microbiol Rev 2004;17:
465e93.
[4] Doel TR. FMD vaccines. Virus Res 2003;91:81e99.
[5] Doel TR, Williams L, Barnett PV. Emergency vaccination against foot-and-
mouth disease: rate of development of immunity and its implications for
the carrier state. Vaccine 1994;12:592e600.
[6] Parida S. Vaccination against foot-and-mouth disease virus: strategies and
effectiveness. Expert Rev Vaccines 2009;8:347e65.
[7] Uttenthal A, Parida S, Rasmussen TB, Paton DJ, Haas B, Dundon WG. Strategies
for differentiating infection in vaccinated animals (DIVA) for foot-and-mouth
disease, classical swine fever and avian influenza. Expert Rev Vaccines 2010;9:
73e87.
[8] Mackay DK, Forsyth MA, Davies PR, Salt JS. Antibody to the nonstructural
proteins of foot-and-mouth disease virus in vaccinated animals exposed to
infection. Vet Q 1998;20(Suppl. 2):S9e11.
[9] Lee F, Jong MH, Yang DW. Presence of antibodies to non-structural proteins of
foot-and-mouth disease virus in repeatedly vaccinated cattle. Vet Microbiol
2006;115:14e20.
[10] Sorensen KJ, Madsen KG, Madsen ES, Salt JS, Nqindi J, Mackay DK. Differen-
tiation of infection from vaccination in foot-and-mouth disease by the
detection of antibodies to the non-structural proteins 3D, 3AB and 3ABC in
ELISA using antigens expressed in baculovirus. Arch Virol 1998;143:1461e76.
[11] Cattoli G, Terregino C, Brasola V, Rodriguez JF, Capua I. Development and
preliminary validation of an ad hoc N1eN3 discriminatory test for the control
of avian influenza in Italy. Avian Dis 2003;47:1060e2.
[12] Lee CW, Senne DA, Suarez DL. Generation of reassortant influenza vaccines by
reverse genetics that allows utilization of a DIVA (differentiating infected from
vaccinated animals) strategy for the control of avian influenza. Vaccine
2004;22:3175e81.
[13] van Oirschot JT, Kaashoek MJ, Rijsewijk FA, Stegeman JA. The use of marker
vaccines in eradication of herpesviruses. J Biotechnol 1996;44:75e81.
[14] Subramaniam S, Pattnaik B, Sanyal A, Mohapatra JK, Pawar SS, Sharma GK,
et al. Status of foot-and-mouth disease in India. Transbound Emerg Dis
2013;60:197e203.
[15] Mohapatra JK, Pandey LK, Sanyal A, Pattnaik B. Recombinant non-structural
polyprotein 3AB-based serodiagnostic strategy for FMD surveillance in bo-
vines irrespective of vaccination. J Virol Methods 2011;177:184e92.
[16] Bachrach HL, Callis JJ, Hess WR, Patty RE. A plaque assay for foot-and-mouth
disease virus and kinetics of virus reproduction. Virology 1957;4:224e36.
[17] Biswal JK, Bisht P, Subramaniam S, Ranjan R, Sharma JK, Pattnaik B. Engi-
neering foot-and-mouth disease virus serotype O IND R2/1975 for one-step
purification by immobilized metal affinity chromatography. Biologicals
2015;43:390e8. http://dx.doi.org/10.1016/j.biologicals.2015.06.001.
[18] Erster O, Liscovitch M. A modified inverse PCR procedure for insertion,
deletion, or replacement of a DNA fragment in a target sequence and its
application in the ligand interaction scan method for generation of ligand-
regulated proteins. Methods Mol Biol 2010;634:157e74.
[19] Biswal JK, Mohapatra JK, Bisht P, Subramaniam S, Sanyal A, Pattnaik B.
A positively charged lysine residue at VP2 131 position allows for the
enhanced adaptability of foot-and-mouth disease virus serotype A in BHK-21
cells. Biol J Int Assoc Biol Stand 2015;43:71e8.
[20] Bhattacharya S, Pattnaik B, Venkataramanan R. Development and application
of sandwich enzyme linked immune sorbent assay (ELISA) for type identifi-
cation of foot-and-mouth disease virus in direct field materials. Indian J Anim
Sci 1996;66:1e9.
[21] Arzt J, Gregg DA, Clavijo A, Rodriguez LL. Optimization of immunohisto-
chemical and fluorescent antibody techniques for localization of foot-and-
mouth disease virus in animal tissues. J Vet Diagn Investig Off Publ Am
Assoc Vet Lab Diagn Inc 2009;21:779e92.
[22] Ramos-Vara JA, Kiupel M, Baszler T, Bliven L, Brodersen B, Chelack B, et al.
Suggested guidelines for immunohistochemical techniques in veterinary
diagnostic laboratories. J Vet Diagn Investig Off Publ Am Assoc Vet Lab Diagn
Inc 2008;20:393e413.
[23] Bubeck P, Winkler M, Bautsch W. Rapid cloning by homologous recombina-
tion in vivo. Nucleic Acids Res 1993;21:3601e2.
[24] Biswal JK, Bisht P, Mohapatra JK, Ranjan R, Sanyal A, Pattnaik B. Application of
a recombinant capsid polyprotein (P1) expressed in a prokaryotic system to
J.K. Biswal et al. / Biologicals 43 (2015) 504e511510
detect antibodies against foot-and-mouth disease virus serotype O. J Virol
Methods 2015;215e216:45e51.
[25] Laemmli UK. Cleavage of structural proteins during the assembly of the head
of bacteriophage T4. Nature 1970;227:680e5.
[26] van Engelenburg FA, Kaashoek MJ, Rijsewijk FA, van den Burg L, Moerman A,
Gielkens AL, et al. A glycoprotein E deletion mutant of bovine herpesvirus 1 is
avirulent in calves. J Gen Virol 1994;75(Pt 9):2311e8.
[27] Stegeman A, Van Oirschot JT, Kimman TG, Tielen MJ, Hunneman WA,
Berndsen FW. Reduction of the prevalence of pseudorabies virus-infected
breeding pigs by use of intensive regional vaccination. Am J Vet Res
1994;55:1381e5.
[28] Wehrle F, Renzullo S, Faust A, Beer M, Kaden V, Hofmann MA. Chimeric
pestiviruses: candidates for live-attenuated classical swine fever marker
vaccines. J General Virol 2007;88:2247e58.
[29] Peeters BP, de Leeuw OS, Verstegen I, Koch G, Gielkens AL. Generation of a
recombinant chimeric Newcastle disease virus vaccine that allows serological
differentiation between vaccinated and infected animals. Vaccine 2001;19:
1616e27.
[30] Castillo-Olivares J, Wieringa R, Bakonyi T, de Vries AA, Davis-Poynter NJ,
Rottier PJ. Generation of a candidate live marker vaccine for equine arteritis
virus by deletion of the major virus neutralization domain. J Virol 2003;77:
8470e80.
[31] Fowler VL, Bashiruddin JB, Maree FF, Mutowembwa P, Bankowski B, Gibson D,
et al. Foot-and-mouth disease marker vaccine: cattle protection with a partial
VP1 GeH loop deleted virus antigen. Vaccine 2011;29:8405e11.
[32] Li P, Lu Z, Bai X, Li D, Sun P, Bao H, et al. Evaluation of a 3A-truncated foot-and-
mouth disease virus in pigs for its potential as a marker vaccine. Vet Res
2014;45:51.
[33] Uddowla S, Hollister J, Pacheco JM, Rodriguez LL, Rieder E. A safe foot-and-
mouth disease vaccine platform with two negative markers for differenti-
ating infected from vaccinated animals. J Virol 2012;86:11675e85.
[34] Martin WB, Edwards LT. A field trial in South Africa of an attenuated vaccine
against foot-and-mouth disease. Res Vet Sci 1965;6:196e201.
[35] Hohlich BJ, Wiesmuller KH, Schlapp T, Haas B, Pfaff E, Saalmuller A. Identifi-
cation of foot-and-mouth disease virus-specific linear B-cell epitopes to
differentiate between infected and vaccinated cattle. J Virol 2003;77:8633e9.
[36] Shen F, Chen PD, Walfield AM, Ye J, House J, Brown F, et al. Differentiation of
convalescent animals from those vaccinated against foot-and-mouth disease
by a peptide ELISA. Vaccine 1999;17:3039e49.
[37] Knowles NJ, Davies PR, Henry T, O'Donnell V, Pacheco JM, Mason PW.
Emergence in Asia of foot-and-mouth disease viruses with altered host range:
characterization of alterations in the 3A protein. J Virol 2001;75:1551e6.
[38] Pacheco JM, Henry TM, O'Donnell VK, Gregory JB, Mason PW. Role of
nonstructural proteins 3A and 3B in host range and pathogenicity of foot-and-
mouth disease virus. J Virol 2003;77:13017e27.
[39] Falk MM, Sobrino F, Beck E. VPg gene amplification correlates with infective
particle formation in foot-and-mouth disease virus. J Virol 1992;66:2251e60.
[40] Pacheco JM, Piccone ME, Rieder E, Pauszek SJ, Borca MV, Rodriguez LL. Domain
disruptions of individual 3B proteins of foot-and-mouth disease virus do not
alter growth in cell culture or virulence in cattle. Virology 2010;405:149e56.
J.K. Biswal et al. / Biologicals 43 (2015) 504e511 511
