Content uploaded by Kylie Rock
Author content
All content in this area was uploaded by Kylie Rock on Jan 22, 2023
Content may be subject to copyright.
Developmental toxicity of the PBDE Metabolite 6-OH-BDE-47 in
Zebrafish and the Potential Role of Thyroid Receptor β
Laura J Macaulay, Albert Chen, Kylie Rock, Laura Dishaw, Wu Dong, David E Hinton, and
Heather M Stapleton*
Nicholas School of the Environment, Duke University, Durham, NC 27708 USA
Abstract
6-hydroxy-2,2′,4,4′-tetrabromodiphenyl ether (6-OH-BDE-47) is both a polybrominated diphenyl
ether (PBDE) flame retardant metabolite and a marine natural product. It has been identified both
as a neurotoxicant in cell-based studies and as a developmental toxicant in zebrafish.
Hydroxylated PBDE metabolites are also considered thyroid hormone disruptors due to their
structural similarity to endogenous thyroid hormones. The purpose of this study was to evaluate
the effects of 6-OH-BDE-47 on a developmental pathway regulated by thyroid hormones in
zebrafish. Morphological measurements of development (head trunk angle, otic vesicle length, and
eye pigmentation) were recorded in embryos at 30 hours post fertilization (hpf) and detailed
craniofacial morphology was examined in 4 day old larvae using cartilage staining. Exposure to 6-
OH-BDE-47 resulted in severe developmental delays. A 100 nM concentration resulted in a 26%
decrease in head trunk angle, a 54% increase in otic vesicle length, and a 42% decrease in eye
pigmentation. Similarly, altered developmental morphology was observed following: Thyroid
Receptor β morpholino knockdown;, exposure to the thyroid hormone triiodothyronine (T3) and to
thyroid disrupting chemicals (TDC; iopanoic acid and propylthiouracil). The threshold for lower
jaw deformities and craniofacial cartilage malformations was at doses greater than 50 nM. Of
interest, these developmental delays and effects were rescued by microinjection of TRβ mRNA
during the 1–2 cell stage. These data indicate that OH-BDEs can adversely affect early life
development of zebrafish and suggest they may be impacting thyroid hormone regulation in vivo
through downregulation of the thyroid hormone receptor.
Keywords
PBDE; OH-BDE; zebrafish; metabolite; development; Thyroid Receptor
*Correspondence to: Nicholas School of the Environment Duke University Box 90328 LSRC A220 Durham, NC 27708. Tel.:
919-613-8717; fax: (919) 684-8741; heather.stapleton@duke.edu.
4.2 Supplementary Data Description
Supplemental information regarding the physicochemical information and overt toxicity screen of 11 other HPCs, detailed dose
response information, morpholino knockdown experiments, and a table summarizing PBDE effects on thyroid receptor can be found
in the supplemental material. In addition, discussion of other minor endpoints (pigmentation, cartilage analysis) is also found in the
supplemental information.
The authors declare no competing financial interest.
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our
customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of
the resulting proof before it is published in its final citable form. Please note that during the production process errors may be
discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
HHS Public Access
Author manuscript
Aquat Toxicol. Author manuscript; available in PMC 2016 November 01.
Published in final edited form as:
Aquat Toxicol. 2015 November ; 168: 38–47. doi:10.1016/j.aquatox.2015.09.007.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript
1.1 Introduction
Hydroxylated polybrominated diphenyl ethers (OH-BDEs) may be produced from either
natural (e.g. marine algae) or anthropogenic sources (Nomiyama et al., 2011; Wan et al.,
2009). In mammals, OH-BDEs are formed by oxidative metabolism of polybrominated
diphenyl ether (PBDE) flame retardants by cytochrome p450s, particularly CYP2B6
(Erratico et al., 2011; Feo et al., 2013). Both PBDEs and OH-BDEs persist in the
environment, where they bioaccumule, and their universal occurrence in environmental
media and human tissues (Chen et al., 2013; Kelly et al., 2008; Sun et al., 2013) are well
established.
PBDEs affect estrogen, androgen, and thyroid hormone regulation in vitro (Kojima et al.,
2009; Meerts et al., 2001; Ren et al., 2013), and in vivo. For example, rodents showed
reduced circulating thyroid hormone levels, as well as altered reproductive and metabolic
functioning following exposure to specific BDE congeners or the commercial mixtures
(Stoker et al., 2004; Szabo et al., 2009; Zhou et al. 2002). Some investigators hypothesized
that endocrine effects of PBDEs observed in vivo result from exposure to the OH-
metabolites, rather than the parent compounds (Dingemans et al., 2008; Dingemans et al.
2011). OH-BDEs share a strong structural resemblance to endogenous thyroid hormones and
in vitro studies show disruption of thyroid hormone signaling by competitive binding to
serum thyroid transporter proteins and nuclear receptors (Hamers et al., 2008; Meerts et al.,
2000; Ren et al., 2013). OH-BDEs inhibit the activity of thyroid sulfotransferase and
deiodinase enzymes, critical for maintaining thyroid hormone levels in peripheral tissues
(Butt and Stapleton, 2013; Butt et al., 2011). However, epidemiological studies in humans
have observed conflicting associations between PBDE serum levels and thyroid hormone
levels (Abdelouahab et al., 2013; Chevrier et al., 2011; Stapleton et al., 2011; Zota et al.,
2011). Sources of such differences may be related to the specific population characteristics
(i.e. age, pregnancy), methods used to measure thyroid hormone levels, or differences in
metabolism. Alternatively, PBDE metabolites may be responsible for driving some of the
observed associations; but metabolites are infrequently measured in epidemiological studies.
The PBDE metabolite, 6-OH-BDE-47, is both a naturally produced chemical and a result of
in vivo metabolism of PBDEs. 6-OH-BDE-47 disrupts thyroid hormone and causes
developmental toxicity in zebrafish (Liu et al., 2015; Usenko et al., 2012; van Boxtel et al.,
2008). When the relative acute toxicity of various BDE-47 isomers was assessed in
zebrafish, 6-OH-BDE-47 proved the most potent isomer tested (Usenko et al., 2012). We
evaluated overt toxicity of eleven halogenated phenolic compounds (HPC) including
chlorinated and brominated phenols, and also found 6-OH-BDE-47 to be the most acutely
toxic compound in zebrafish embryos (see supporting information Table S1 and Figure S1).
Because 6-OH-BDE-47 has been detected in maternal serum and umbilical cord blood,
concern for human developmental exposures has followed (Chen et al., 2013; Stapleton et
al., 2011; Zhao et al., 2013; Zota et al., 2011). Fetuses and infants are undergoing rapid
development and therefore may be more sensitive to chemical exposures. Furthermore, the
maintenance of thyroid homeostasis is during pregnancy and early neurodevelopmental
Macaulay et al. Page 2
Aquat Toxicol. Author manuscript; available in PMC 2016 November 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript
periods (Howdeshell, 2002) underscore the need for assessing developmental impacts of
OH-BDEs.
Based on previous work from our laboratory (Dong et al., 2014, 2013) providing evidence of
altered deiodinase and thyroid receptor expression after exposure to 6-OH-BDE-47, we
sought to further study these pathways by determining their role in developmental
morphology including larval cartilage formation. The objectives of the present study were to
examine how early-life exposure to 6-OH-BDE-47 affects developmental morphology
relative to native thyroid hormones and thyroid disrupting chemicals in embryo-larval
zebrafish. Secondly, we sought to determine whether co-exposure with thyroid hormones or
overexpression of the thyroid receptor would recover the observed developmental delays
and adverse effects observed after 6-OH-BDE-47 exposures.
2.1 Materials & Methods
2.1.1 Fish Husbandry
Adult wild-type (Tropical 5D) zebrafish were used. We obtained these from a population in
Dr. David Volz’s laboratory, University of South Carolina, Columbia, SC, USA. Adult fish
were housed at 28 ± 0.5°C on a 14:10 light/dark photoperiod in a recirculating AHAB
system (Aquatic Habitats) and fed brine shrimp and Ziegler’s Adult Zebrafish Complete
Diet (Aquatic Ecosystems, Apopka, FL). Embryos were collected from breeder tanks by 2
hours post-fertilization (hpf) and maintained in embryo medium (5 mM NaCl, 0.17 mM
KCl, 0.33 mM CaCl2, 0.33 mM MgSO4) within incubators (at 28°C) under identical
conditions as adults. Adult care and reproductive techniques were non-invasive and
approved by the Duke University Institutional Animal Care & Use Committee.
2.1.2 Chemicals & Exposure Solutions
6-OH-BDE-47 was purchased neat from Accustandard (New Haven, CT) and were >99.5%
purity. Triiodothyronine (T3) and thyroxine (T4) were purchased from Sigma-Aldrich (St.
Louis, MO) and were > 97% purity. Iopanoic acid (IOP) (purity of > 98%) was purchased
from TCI Chemicals (Portland, OR). Propylthiouracil (PTU) was purchased from Sigma
Aldrich (purity of >97%). Methyl cellulose and alcian blue powder were also purchased
from Sigma Aldrich. Dimethyl sulfoxide (DMSO) was purchased from EMD Millipore
(>99.9% purity). Chemical information for the other eleven halogenated phenols tested in
the overt toxicity assay can be found in the supplemental information. Concentrated stocks
of all exposure chemicals were prepared in DMSO in amber vials. Exposure solutions were
prepared from the concentrated stocks via serial dilution with embryo media water. All
resultant exposure media contained ≤0.4% DMSO. A summary of the chemical properties
and concentration ranges tested can be found in Table 1 and Table S2, respectively.
2.1.3 6 dpf Overt Toxicity
To assess the overt-toxicity of 6-OH-BDE-47, we conducted a 6 dpf overt toxicity assay in
embryo-larval zebrafish (ten other halogenatic phenolic compounds were also evaluated for
overt toxicity, see Table S1). Zebrafish embryos (sphere to 30% epiboly stage) (according to
Kimmel et al., 1995) were placed in a 96-well plate (1 embryo/well insert; Laboratory
Macaulay et al. Page 3
Aquat Toxicol. Author manuscript; available in PMC 2016 November 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript
Supply Distributors, Millville, NJ) containing 500 μL glass inserts (0.4% DMSO). The glass
inserts were baked at 450°C for 4 hours prior to use to reduce possible chemical
contamination. Each well contained 250 μL embryo medium dosed with 1 μL of a
concentrated 6-OH-BDE-47 stock solution (Final concentration = 1 nM - 10 μM). Each plate
contained a range of log-concentrations of 6-OH-BDE-47 (1 nM-10 μM) and included a
vehicle control and control receiving only embryo media (n = 12–14 fish/dose, 5 doses/plate,
4 plates). Due to difficulties renewing media in the glass wells without damaging embryos,
exposures were static.
Embryos were evaluated daily for abnormalities, hatching success, and lethality.
Abnormalities were assessed by observing embryos under a dissecting microscope and
recording spinal deformities, craniofacial abnormalities, edema of the pericardial/abdominal
regions, and changes in pigmentation. Death was defined as the absence of a heartbeat or
coagulation of the egg. Percent mortality and LC50 were calculated (Table S1, Figure S1).
2.1.4 Chemical Effects on Larval Morphology at 30 hpf
Developmental morphometrics (for detailed description, see (Kimmel et al., 1995)) are
robust staging tools for embryonic development and include the head-trunk-angle (HTA),
otic-vesicle length (OVL), and eye pigmentation (Figure 1A). These morphometric analyses
were regarded as sensitive endpoints for thyroid disruption in zebrafish studies employing
morpholino knockdown of deiodinase enzymes (Heijlen et al., 2014; Walpita et al., 2010).
The HTA, OVL, and pigmentation enabled evaluation of developmental delays induced by
6-OH-BDE-47, thyroid disrupting chemicals, and native hormones. Briefly, thirty zebrafish
embryos (4–5 hpf) were dosed with either 6-OH-BDE-47 (10–250 nM), IOP (5–10 μM),
PTU (1 mM), or T3 (5–10 nM) by dissolving a determined amount of stock solution into 15
mL of embryo medium ([Final DMSO] ≤0.1%). IOP and PTU were selected as positive
controls due to their established thyroid disrupting properties (Bouzaffour et al., 2010;
Schmidt and Braunbeck, 2011). Range finding experiments and previous work in zebrafish
were used to identify appropriate concentrations for these thyroid disrupting agents (5 μM
and 10 μM IOP and 1mM PTU) (Bouzaffour et al., 2010; Schmidt and Braunbeck, 2011).
Similarly, concentrations of native thyroid hormones were based on range finding
experiments and previous studies using zebrafish (Brown, 1997; Liu and Chan, 2002;
Walpita et al., 2007).
Control embryos received clean DMSO (<0.1%). The dosed embryos were housed in glass
petri dishes (Pyrex, 100mm by 20mm) in an incubator until time of use. At 30 hpf, embryos
were euthanized in 300 mg/L MS-222 and manually dechorionated with watchmaker’s
forceps. Dechorionated embryos were then transferred to microscope slides, embedded in
3% methyl cellulose, positioned in lateral recumbency, and imaged for the morphometrics
described above. Rationale for this time point was based on previous work demonstrating
sensitivity of 30 hpf embryos to developmental delays mediated by thyroid hormones
(Walpita et al., 2009, 2007).
Embryo images were captured using a Nikon Eclipse E600 light microscope equipped with a
Nikon DXM 1200 digital camera and NIS Elements imaging software (Nikon, Melville, NY,
USA). Image J (NIH, Bethesda, MD) was used to quantify the HTA, OVL, and eye
Macaulay et al. Page 4
Aquat Toxicol. Author manuscript; available in PMC 2016 November 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript
pigmentation in each embryo image (illustrated in Figure 1A) (Heijlen et al., 2014; Kimmel
et al., 1995; Walpita et al., 2010, 2009) Briefly, the HTA is formed by a line between the
head and body axis (parallel to the notochord in the midtrunk region at somite 5). This angle
increases between 20 hpf and 70 hpf as a result of body straightening. OVL was calculated
by dividing the distance between the ipsilateral eye and inner ear (EED) by the diameter of
the otic vesicle (IED, at its widest point) such that the highest OVL corresponds to the least
developed embryo. Pigmentation was quantified in the eye of embryos by using integrated
density as a count of the pixel area of the eye, compared to the background in each image.
During developmental stages evaluated in this study, eye pigmentation is due to the density
of melanin in retinal pigment epithelium and overlying choroid (Dong et al., 2014). All
exposure experiments were performed in duplicate or triplicate, and represent n > 30
embryos.
2.1.5 Co-exposure to 6-OH-BDE-47 and THs
To determine whether observed developmental delays were mediated through decreased
thyroid hormone levels in peripheral tissues, we conducted co-exposure experiments with T3
(5 nM and 30 nM) or T4 (30 nM) in the presence of 100 nM 6-OH-BDE-47. This
concentration of the metabolite was identified in previous experiments to result in severe
developmental delays but not lethality. Embryo exposures were conducted in glass petri
dishes containing 30 embryos (4–5 hpf). Embryos were dosed simultaneously with 100 nM
6-OH-BDE-47 and T3 or T4 and then at 30 hpf were evaluated for effects on HTA, OVL,
and eye pigmentation as described in section 2.1.4. In this way we could determine whether
co-exposures with thyroid hormones recovered the developmental delays induced by 6-OH-
BDE-47 exposures.
Follow up experiments using the same methodology were designed to determine whether
cessation of exposure and/or hormone replacement ameliorated developmental effects.
Briefly, embryos were exposed to 6-OH-BDE-47 during early development (4–24 hpf) and
then removed from treatment, rinsed in triplicate, and transferred either to clean water or
media containing 5 nM or 30 nM T3 or 30 nM T4 (24 hpf – 30 hpf). HTA, OVL, and eye
pigmentation were examined at 30 hpf (data not shown). Table S2 contains a summary of
exposure conditions.
2.1.6 Thyroid Receptor Morpholino Microinjections
Since multiple mechanisms for thyroid disruption have been demonstrated, we chose to
investigate effects on the thyroid receptor to determine if downregulation of TRβ was
driving the observed phenotypes following exposure to 6-OH-BDE-47. Thyroid hormone
receptor translation blocking (GCAGTATGTCAGAGCAAGCAGACAA, THR-MO) and 5-
bp mismatch control (GgAGaATGTCtGAGCtAGCtGACAA; Control-MO) morpholinos
were designed with Gene Tools, LLC. Morpholinos were diluted in sterile dH2O to a stock
concentration of 100 mM and further diluted to 10 mM. One nL TRβ-MO or Control-MO
morpholino was injected into the 1–2 cell stage embryo (1 hpf) as previously described
(Dong et al., 2014). At 30 hpf, fish were euthanized, dechorionated, and imaged for
developmental morphology (HTA, OVL, and eye pigmentation) as described in section
2.1.4. Morphological evaluations were conducted in duplicate (n=20).
Macaulay et al. Page 5
Aquat Toxicol. Author manuscript; available in PMC 2016 November 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript
2.1.7 TRβ mRNA overexpression
To evaluate the potential of recovering the observed developmental delays from TRβ
knockdown, we evaluated the ability of TRβ mRNA overexpression to rescue the phenotype.
TRβ mRNA was synthesized with SP6 polymerase and capped using a G(5′)ppp(5′)A RNA
cap structure analog (New England Biolabs) as described previously (Dong et al., 2014).
Embryos received microinjections of ~ 3 nL TRβ mRNA (~ 265 ng/μL) during the 1–2 cell
stage. Phenol red (0.05%) was used to track injections as described previously (Dong et al.,
2014).
Approximately 3 hours after injection, embryos that showed normal development were
placed in dosing solutions (100 nM or 250 nM 6-OH-BDE-47) within glass petri dishes.
TRβ mRNA injections were also performed in unexposed embryos (Co-TRβ mRNA) to
monitor for potential adverse effects of overexpression of the receptor during early
development. In addition, we evaluated recovery of TRβ morpholino knockdown by also
administering TRβ mRNA injections. For these experiments, embryos were first injected
with TRβ-MO and then separately injected with TRβ mRNA (TRβ-MO + TRβ mRNA). In
each experiment, embryos were euthanized, dechorionated, and imaged for developmental
morphology at 30 hpf (HTA, OVL, and eye pigmentation) as described in section 2.1.4.
Injection exposure experiments were conducted in duplicate (Co-TRβ mRNA, 250 nM 6-
OH-BDE-47 +TRβ mRNA, n=20) or triplicate (100 nM 6-OH-BDE-47 + TRβ mRNA and
Co-Mo, n=30).
2.1.8 Whole-mount Cartilage Staining Using Alcian Blue in 4 dpf Larvae
To examine effects of 6-OH-BDE-47 exposure on developmental morphology of the larval
cartilage skeleton, alcian blue dye was used to stain cartilaginous structures in 96 hpf larvae
(Walker and Kimmel, 2007). This age was chosen based on previous work showing that
craniofacial cartilage development in zebrafish is sensitive to thyroid hormones during the
embryo-to-larva transition (Liu and Chan, 2002; Strecker et al., 2013). Briefly, thirty
embryos received a static exposure to 50 nM or 100 nM 6-OH-BDE-47 (15 mL embryo
media) from 4–96 hpf in glass petri dishes. At 96 hpf larvae were euthanized in MS-222
fixed in 10% neutral buffered formalin overnight at -20°C and resultant intact individuals
were stained overnight in fresh alcian blue solution at room temperature in one well of a 12-
well plate. Alizarin red staining for bone was also performed, but we were unable to detect
any bone formation at this early age.
Following staining, specimens were washed in 95% ethanol for 30 minutes on a shaker table
and rehydrated by passage through graded solutions of 75%, 50%, and 25% ethanol in 1x
phosphate buffered saline (PBS). To aid imaging, soft tissues were then digested by trypsin
(10 mg/mL) in 30% saturated sodium tetraborate solution at 4°C for several hours until
cartilage was clearly visible. Specimens were then washed in 0.5% KOH three times,
bleached with 3% H2O2 to remove pigment and transferred through a graded series of
increasing ratios of 0.5% KOH:glycerol (3:1, 1:1, 1:3 0:1). Once in 100% glycerol, tissues
were stored at 4°C until time of imaging. Larvae were placed on depression slides, oriented
in dorsal recumbency, and imaged for craniofacial morphology using a Nikon SMZ-1500
Stereoscope.
Macaulay et al. Page 6
Aquat Toxicol. Author manuscript; available in PMC 2016 November 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript
Craniofacial development was examined in 20 larvae per treatment. We determined forward
protrusion of Meckel’s (l1) and ceratohyal (l2) cartilage structures (illustrated in Figure 2)
according to previous methods (Mukhi and Patiño, 2007). Briefly, the cartilage complexes
form a U- or V-shape that approximate an isosceles triangle. Thus, by measuring the side
and base of each cartilage complex of the pharyngeal skeleton, the forward protrusion length
was estimated using the Pythagorean theorem (L= square root (s2 - b2/4) as performed
previously (Mukhi and Patiño, 2007).
2.1.9 Statistical Analysis
Graphpad Prism 6 software was used for statistical analysis (v 6.01 Graphpad Software Inc).
For the overt toxicity data, dose-response survival curves were analyzed using a log-rank
test and statistical significance was determined using a Bonferroni correction for multiple
curves. Morphological data are normalized as percent relative to control (mean ± SEM; n >
30 across 2–3 experiments) and were analyzed using a one-way ANOVA with Dunnet’s
post-hoc test. No differences between experimental replicates were observed for any test.
For morpholino and mRNA injection experiments, data were analyzed using a two-way
ANOVA to check for effects of injection and dose, followed by least squared means (n= 20–
30 across 2–3 experiments). Tukey’s post-hoc test was used to determine significant
differences between groups. A p-value <0.05 was considered statistically significant.
3.1 Results
3.1.1 Overt Toxicity Assessment at 6 dpf
A concentration-dependent increase in percent mortality was observed with exposure to 6-
OH-BDE-47 from 4 hpf to 6 dpf (Figure S1). Importantly, of 11 halogenated phenolic
compounds tested, 6-OH-BDE-47 had the lowest LC50 value at 134 nM (for dose response
curves of all tested chemicals, see Figure S2). 6-OH-BDE-47 was also more toxic than the
parent compound, BDE-47 (LC50> 10 μM) and the other hydroxylated isomers of BDE-47
(Figure S3). We observed no mortality in the DMSO or embryo water controls. Mortality (to
6dpf) was the same in both the 6-OH-BDE-47 exposed and co-exposed (6-OH-BDE-47 and
T3 or T4) experiments (data not shown)).
3.1.2 Chemical Effects on Larval Morphology
Altered phenotypes were observed following 6-OH-BDE-47 treatments, including spinal
curvature, pericardial edema, craniofacial abnormalities, reduced pigmentation, and failure
of the swim bladder to inflate. Pronounced developmental delays were also observed,
particularly with increasing concentrations of 6-OH-BDE-47. Exposure to 100 nM and 250
nM 6-OH-BDE-47 significantly delayed development, decreased yolk sac absorption, and
reduced pigmentation in the embryos. In the 100 nM 6-OH-BDE-47 exposure, the average
HTA decreased 26%, the average OVL increased by 54%, and the average eye pigmentation
was reduced by 42% relative to DMSO controls (Figure 1B–D). In addition, different
exposure durations were also examined to look for 6-OH-BDE-47 effects on development.
No significant differences for OVL, HTA, or eye pigmentation were observed between
exposures to 6-OH-BDE-47 from 4–24 hpf (20 hour exposure; with recovery in clean media
Macaulay et al. Page 7
Aquat Toxicol. Author manuscript; available in PMC 2016 November 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript
until morphometric analysis at 30hpf) and a longer exposure from 4–30 hpf (26 h exposure;
data not shown).
Positive controls, including the endogenous thyroid hormone T3, PTU, and IOP induced
similar morphological delays (Figure 1B–D), including significant decreases in eye
pigmentation and HTA, and increases in OVL. The 10 nM T3 exposure reduced the average
pigmentation by 21%, decreased the HTA by 12%, and increased the OVL by 28%.
Exposure to 10 μM IOP reduced eye pigmentation by 51%, decreased HTA by 13%, and
increased the OVL by 80%.
3.1.3 Co-exposures of 6-OH-BDE-47 with Thyroid Hormones
No significant differences in HTA, OVL, or eye pigmentation were observed between co-
exposed embryos (6-OH-BDE-47 and T3 or T4) and embryos receiving only 6-OH-BDE-47
treatment. Additionally, no significant differences in morphometric endpoints were detected
between embryos receiving a 26 h exposure versus those receiving shorter exposure periods
(20 hpf) or with recovery in TH supplemented media.
3.1.4 TRβ Morpholino Knockdown
In the TRβ morpholino knockdown embryos, the average HTA decreased 12%, the average
OVL increased by 20%, and the average eye pigmentation was reduced by 27% relative to
DMSO controls (Figure S4). These developmental delays are consistent with phenotypes
from exposure to 6-OH-BDE-47 and thyroid disrupting agents. TRβ knockdown was
rescued by subsequent injection with TRβ mRNA, and no significant differences in
developmental morphology were observed between non-injected embryos, embryos
receiving control mismatched TRβ morpholino (Co-Mo), or TRβMO + TRβ mRNA,
indicating normal development.
3.1.5 Phenotype Rescue with TRβ mRNA overexpression
To further examine the potential role of TRβ downregulation in 6-OH-BDE-47-mediated
effects, we evaluated the ability of TRβ mRNA overexpression to rescue the phenotype.
There were three sets of controls: embryos receiving no injections (Control-NI; Figure 3A),
embryos that received only TRβ mRNA injections (Co + TRβ mRNA; Figure 3B) and
embryos that received an injection control morpholino (Co-Mo; Figure 3C). There were no
significant differences in HTA, OVL, or PI between non-injected control embryos and Co-
Mo injected embryos (data not shown). There was a slight but significant increase in HTA in
the Co- TRβ mRNA injected embryos (7%) relative to the Co-Mo injected embryos, but no
significant differences in OVL or PI, indicating no adverse developmental effects from TRβ
mRNA microinjections. Overall, TRβ mRNA injections alone did not adversely affect
zebrafish development.
Interestingly, exposed embryos (100 nM 6-OH-BDE-47) that also received TRβ mRNA
injections recovered the developmental delays observed in embryos treated with 100 nM 6-
OH-BDE-47 alone (Figure 3D, E). These TRβ mRNA rescued embryos recovered
pigmentation and evidence from morphometric evaluations indicated rescue of normal
development (Figure 3E), unlike the embryos exposed to 6-OH-BDE-47 only (Figure 3D).
Macaulay et al. Page 8
Aquat Toxicol. Author manuscript; available in PMC 2016 November 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript
Of note, TRβ mRNA injections with exposure to 250 nM 6-OH-BDE-47 (greater than the
LC50) provided partial rescue of developmental delays (Figure 3F,G). Unfortunately
morphometrics (HTA, OVL) could not be calculated in those animals receiving the highest
concentration (250 nM) as few embryos had appreciable otic vesicle development
precluding this aspect of staging. However, eye pigmentation was partially restored (Figure
3G) when compared to similarly aged control individuals.
3.1.6 Effects on Larval Cartilage Development
Given the developmental delays observed in 6-OH-BDE-47 exposed embryos, we further
examined effects on cartilage skeletal development in larval stages (Figure 4). Qualitatively,
fish treated with 6-OH-BDE-47 had reduced head cartilage formation at 4 dpf relative to
control animals (Figure 4C–F). Specifically, the forward protrusion (length) of the Meckel’s
(m, l1) and ceratohyal (ch, l2) cartilage complexes were reduced by 23% and 21%,
respectively, indicating alterations in the lower mandible (Figure 5). In some fish,
malformations affected the entire pharyngeal skeleton, for example the angles between
individual ceratohyals were malformed and Meckel’s cartilage was smaller and misshapen
(Figure 4C–F).
4.1 Discussion
In this study, we used specific developmental staging metrics (HTA, OVL, eye
pigmentation) to describe the developmental delays observed from exposure to 6-OH-
BDE-47 or TDCs (Heijlen et al., 2014; Kimmel et al., 1995; Walpita et al., 2010, 2009).
Additionally, positive control chemicals with known modes of action (IOP, PTU) were
utilized to further examine their impacts on developmental morphology via thyroid hormone
disruption Propylthiouracil targets thyroid peroxidase, and may inhibit DI 2 in fish species
(Orozco et al. 2000; Sanders et al., 1997; Visser et al.1983). Iopanoic acid targets DI 1 and
DI 2, inhibiting peripheral conversion of T4 to T3 in target tissues (Bouzaffour et al., 2010).
Perturbations of the thyroid system during development can elicit neurological and
physiological impairments in amphibians, mammals, and fish, implicating the importance of
studying chemical impacts on these early life stages (Brown, 1997; McMenamin and
Parichy, 2013; Morvan-Dubois et al., 2013; Porazzi et al., 2009).
The present work demonstrated that exposure to 6-OH-BDE-47 resulted in dramatic
developmental delays, and, at higher doses, lethality in zebrafish embryos. We initially
hypothesized that these delays were a result of thyroid disruption, specifically, that 6-OH-
BDE 47 exposure was reducing circulating TH levels via inhibition of deiodinase activity
(and thereby limiting peripheral T3 levels). Indeed, studies employing morpholino
knockdown of DI 1, 2, and 3 in embryonic zebrafish have shown delays in morphological
development similar to those observed in the present study (e.g., decreased HTA, increased
OVL, and decreased pigmentation) (Heijlen et al., 2014; Walpita et al., 2010, 2009). To test
this hypothesis, T3 and 6-OH-BDE-47 co-exposures were conducted to evaluate potential
for recovery with external TH supplementation. However, co-exposure to 6-OH-BDE-47
with either T3 or T4 did not rescue developmental delays, suggesting that DI inhibition was
not occurring and tissue T4 and T3 levels were not being impacted. However, in these co-
exposure experiments, the concentrations of OH-BDEs were higher than the TH
Macaulay et al. Page 9
Aquat Toxicol. Author manuscript; available in PMC 2016 November 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript
concentrations. TH concentrations could not be increased further due to resultant toxicity
(exposure to ≥50 nM T3 proved lethal). Treatment with exogenous THs during development
appears to have mixed effects, with some studies reporting developmental toxicity and
others reporting accelerated pigment formation and growth (Brown, 1997; Heijlen et al.,
2014; Liu and Chan, 2002; Walpita et al., 2007). These discrepancies are likely attributable
to differences in developmental stage of exposure, route of exposure, and species (Brown,
1997; Jegstrup and Rosenkilde, 2003; Liu and Chan, 2002), but more work is needed to
resolve these issues.
While rescue experiments with T3 and T4 did not restore normal morphological
development following 6-OH-BDE-47 exposures, overexpression of the thyroid receptor
beta proved successful in restoring normal developmental features. The thyroid nuclear
receptor is encoded by two genes, TRα and TRβ. TR isoform expression varies dependent
upon the tissue, developmental stage, and species (reviewed in Darras et al., 2011; Nelson
and Habibi, 2009) TRα is expressed earlier and at higher levels than TRβ, but both are
present at the midblastula stage and subsequent stages examined in this study (Essner et al.,
1997; Liu et al., 2000; Power et al., 2001)
Multiple studies evaluating PBDE/OH-BDE toxicity have observed reduced transcription of
thyroid receptors. For example, fathead minnows exposed to BDE-47 via the diet showed
reduced transcription of both TRα and TRβ in a tissue and sex specific manner (Lema et al.,
2008). Another study in zebrafish embryos using 200 μg/L 6-OH-BDE-47 (~398 nM)
observed a 2 fold reduction in TRα and 3 fold reduction in TRβ mRNA expression (Zheng
et al. 2012). Additional work from our research group has also demonstrated downregulation
of TRβ mRNA expression from 6-OH-BDE-47 exposure using both RT-PCR and whole-
mount in-situ hybridization in zebrafish (Dong et al., 2014). In addition, studies in TRβ
knockout rodents have observed auditory/inner ear deficits and problems with regulation of
the HPT axis (Abel et al., 1999; Forrest et al., 1996; Gauthier et al., 1999). For these
reasons, we further examined the role of TRβ in mediating the developmental delays
observed from 6-OH-BDE-47 exposures. Given the structural similarity between 6-OH-
BDE-47 and thyroid hormones, 6-OH-BDE-47 could be acting as a T3 mimic, causing the
appearance of surplus ligand and subsequent downregulation of the nuclear receptor.
Morpholino knockdown of the thyroid receptor beta during early development induced
similar developmental delays to those observed from exposure to 6-OH-BDE-47 (Figure S4,
S5). These delays could be rescued by subsequent injection with TRβ mRNA, indicating the
importance of the receptor during early development. Previous studies examining the
impacts of TRα knockdown in zebrafish found effects on cranial neural crest migration,
proliferation, survival, and differentiation (Bohnsack and Kahana, 2013). This same study
also found that TRα knockdown induced malformations of Meckel’s and ceratohyal
cartilages, similar to results reported herein. However, it is important to note that in the
present report we only examined TRβ and so can make no direct comparisons relating to
TRα in our results.
If exposure to 6-OH-BDE-47 downregulates expression of TRβ, this would lead to reduced
binding of T3 and reduced transcription of essential growth and developmental pathways.
Macaulay et al. Page 10
Aquat Toxicol. Author manuscript; available in PMC 2016 November 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript
This provides an explanation for why T3 / T4 co-exposures failed to rescue the toxicity.
Alternatively, 6-OH-BDE-47 may downregulate TRs independently of T3 mimicry by
altering local hormone action. Changes in nuclear receptor expression could also occur
through antagonism of other TRs, interference with the ability of TRs to bind to TREs, or
interfering with co-activator recruitment following TH binding, or through other unknown
mechanisms (Darras et al., 2014). Select PBDEs were able to promote dissociation of the
thyroid receptor from the thyroid response element (targeting the DNA Binding Domain) in
one study (Ibhazehiebo et al., 2011). More recently, Ren et al. (2013) demonstrated that
binding affinity of OH-BDEs for human TRα and TRβ increased with the degree of
bromination, likely due to increased hydrophobic interactions in the ligand binding pocket.
Ren et al. also demonstrated that 6-OH-BDE-47, 5-OH-BDE-47, and other OH-BDEs were
human TRβ agonists. Additional studies are necessary to define OH-BDE-thyroid receptor
interactions, enhance our understanding of the mechanism of action, and explore the role of
TRα.
In addition to impacts on the thyroid nuclear receptor, 6-MeO-BDE-47 and 6-OH-BDE-47
have been shown to interfere with multiple other nuclear hormone signaling pathways
(including aryl hydrocarbon receptor, estrogen receptor, mineralocorticoid receptor,
glucocorticoid receptor, and thyroid hormone receptor (Liu et al., 2015)). 6-OH-BDE-47 has
also been shown to impact oxidative phosphorylation and energy metabolism in-vitro (van
Boxtel et al., 2008), and more recently OH-BDE mixtures found in marine environments
have been shown to exhibit strong synergistic toxicity, creating concerns for environmental
exposures (Legradi et al., 2014). Therefore, it is possible that other mechanisms independent
of endocrine disruption may also be contributing to the observed developmental delays from
6-OH-BDE-47 exposure.
Growing evidence of disrupted thyroid homeostasis by flame retardants (and their
metabolites) exists through interactions with nuclear receptors (reviewed in Ren & Guo,
2013). With regard to the thyroid nuclear receptor, the in vitro effects are inconsistent, with
differences in activity reported even for the same compound (effects across studies
summarized in Table S3). Some reports regard OH-BDEs/PBDEs as thyroid receptor
antagonists, and others as receptor agonists. Much of this may be explained on the basis of
differing compounds evaluated, cell lines used, and assay conditions (Kitamura et al., 2008;
Kojima et al., 2009; Li et al., 2010; Ren et al., 2013; Ren & Guo, 2013; Schriks et al. 2007;
Zhang et al., 2014). Furthermore, a recent report examining tetrabromobisphenol-A
(TBBPA) toxicity in amphibians observed differential toxicity depending on the
developmental stage of the organism at testing, with TBBPA acting as an antagonist during
periods of elevated endogenous TH levels and an agonist during other periods (Zhang et al.,
2014). In both fish and amphibians, thyroid hormone surges occur as part of normal
development (Liu and Chan, 2002; Miwa et al., 1988; Tata, 2006), therefore, testing
different developmental stages (with different levels of endogenous THs) could also
contribute to the reported differences in activity.
In conclusion, 6-OH-BDE-47 exposures adversely impacts early life development of
zebrafish. These effects may be resulting from altered thyroid hormone regulation in vivo
through downregulation of the thyroid hormone receptor. Early life exposures to OH-BDEs
Macaulay et al. Page 11
Aquat Toxicol. Author manuscript; available in PMC 2016 November 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript
are important to consider because plasma levels of PBDEs in US pregnant women are
several fold higher than those in other countries, and PBDEs can cross the placenta and can
be transferred to the developing fetus (Zhao et al. 2013). Although concentrations used in
this study are higher than would be anticipated in the environment and in humans, 6-OH-
BDE-47 was measured in maternal serum and umbilical cord blood at concentrations
ranging between 78–336 pM and, in some cases, at higher levels in cord blood than in serum
(Chen et al., 2013; Stapleton et al., 2011). In cell-based studies, 6-OH-BDE-47 impacts
multiple aspects of neurogenesis, including cytotoxicity, proliferation, and neuronal/
oligodendrocyte differentiation of adult mice neural stem progenitor cells (Li et al., 2013).
Studies by Dingemans et al, also demonstrated increased toxicity of 6-OH-BDE-47 relative
to BDE-47, and found impaired calcium homeostasis and disrupted neurotransmitter release
(Dingemans et al., 2011, 2010, 2008). These observations raise concern for maternal
exposure to PBDEs/OH-BDEs and resultant endocrine disruption during pregnancy and
early fetal development.
Supplementary Material
Refer to Web version on PubMed Central for supplementary material.
Acknowledgments
The funding for this research was provided by a grant from the National Institutes of Environmental Health
Sciences [P42ES010356]. We would also like to acknowledge Dr. Erin Kollitz for reviewing the manuscript and
providing helpful comments.
Abbreviations
HPC Halogenated Phenolic Compound
dpf Days Post Fertilization
CNC Cranial Neural Crest
DI Deiodinase Enzyme
DMSO Dimethyl Sulfoxide
FR Flame Retardant
hpf Hours Post Fertilization
IOP Iopanoic Acid
MO Morpholino
OH-BDE Hydroxylated Polybrominated Diphenyl Ether
PBDE Polybrominated Diphenyl Ether
TH Thyroid Hormone
TDC Thyroid Disrupting Chemical
PTU Propylthiouracil
Macaulay et al. Page 12
Aquat Toxicol. Author manuscript; available in PMC 2016 November 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript
T4Thyroxine
T3Triiodothyronine
TR Thyroid receptor
References
Abdelouahab N, Langlois MF, Lavoie L, Corbin F, Pasquier JC, Takser L. Maternal and cord-blood
thyroid hormone levels and exposure to polybrominated diphenyl ethers and polychlorinated
biphenyls during early pregnancy. Am J Epidemiol. 2013; 178:701–13.10.1093/aje/kwt141
[PubMed: 23924579]
Abel ED, Boers ME, Pazos-Moura C, Moura E, Kaulbach H, Zakaria M, Lowell B, Radovick S,
Liberman MC, Wondisford F. Divergent roles for thyroid hormone receptor beta isoforms in the
endocrine axis and auditory system. J Clin Invest. 1999; 104:291–300.10.1172/JCI6397 [PubMed:
10430610]
Bohnsack BL, Kahana A. Thyroid hormone and retinoic acid interact to regulate zebrafish craniofacial
neural crest development. Dev Biol. 2013; 373:300–9.10.1016/j.ydbio.2012.11.005 [PubMed:
23165295]
Bouzaffour M, Rampon C, Ramaugé M, Courtin F, Vriz S. Implication of type 3 deiodinase induction
in zebrafish fin regeneration. Gen Comp Endocrinol. 2010; 168:88–94.10.1016/j.ygcen.2010.04.006
[PubMed: 20403357]
Brown DD. The role of thyroid hormone in zebrafish and axolotl development. Proc Natl Acad Sci U
S A. 1997; 94:13011–6. [PubMed: 9371791]
Butt C, Stapleton HM. Inhibition of thyroid hormone sulfotransferase activity by brominated flame
retardants and halogenated phenolics. Chem Res Toxicol. 2013; 26(11):1692–1702.10.1021/
tx400342k [PubMed: 24089703]
Butt CM, Wang D, Stapleton HM. Halogenated phenolic contaminants inhibit the in vitro activity of
the thyroid-regulating deiodinases in human liver. Toxicol Sci. 2011; 124(2):339–47.10.1093/
toxsci/kfr117 [PubMed: 21565810]
Chen A, Park JS, Linderholm L, Rhee A, Petreas M, DeFranco Ea, Dietrich KN, Ho SM.
Hydroxylated polybrominated diphenyl ethers in paired maternal and cord sera. Environ Sci
Technol. 2013; 47:3902–8.10.1021/es3046839 [PubMed: 23506475]
Chevrier J, Harley KG, Bradman A, Sjödin A, Eskenazi B. Prenatal exposure to polybrominated
diphenyl ether flame retardants and neonatal thyroid-stimulating hormone levels in the
CHAMACOS study. Am J Epidemiol. 2011; 174:1166–74.10.1093/aje/kwr223 [PubMed:
21984658]
Darras VM, Houbrechts AM, Van Herck SLJ. Intracellular thyroid hormone metabolism as a local
regulator of nuclear thyroid hormone receptor-mediated impact on vertebrate development.
Biochim Biophys Acta. 2014; 1849:130–141.10.1016/j.bbagrm.2014.05.004 [PubMed: 24844179]
Darras VM, Van Herck SLJ, Heijlen M, De Groef B. Thyroid hormone receptors in two model species
for vertebrate embryonic development: chicken and zebrafish. J Thyroid Res. 2011;
2011:402320.10.4061/2011/402320 [PubMed: 21760979]
Dingemans MML, de Groot A, van Kleef RGDM, Bergman A, van den Berg M, Vijverberg HPM,
Westerink RHS. Hydroxylation increases the neurotoxic potential of BDE-47 to affect exocytosis
and calcium homeostasis in PC12 cells. Environ Health Perspect. 2008; 116:637–43.10.1289/ehp.
11059 [PubMed: 18470311]
Dingemans MML, van den Berg M, Bergman A, Westerink RHS. Calcium-related processes involved
in the inhibition of depolarization-evoked calcium increase by hydroxylated PBDEs in PC12 cells.
Toxicol Sci. 2010; 114:302–9.10.1093/toxsci/kfp310 [PubMed: 20044592]
Dingemans MML, van den Berg M, Westerink RHS. Neurotoxicity of brominated flame retardants:
(in)direct effects of parent and hydroxylated polybrominated diphenyl ethers on the (developing)
Macaulay et al. Page 13
Aquat Toxicol. Author manuscript; available in PMC 2016 November 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript
nervous system. Environ Health Perspect. 2011; 119:900–7.10.1289/ehp.1003035 [PubMed:
21245014]
Dong W, Macaulay LJ, Ferguson PLL, Hinton DE, Stapleton HM, Kwok KW, Hinton DE, Ferguson
PLL, Stapleton HM. The PBDE metabolite 6-OH-BDE 47 affects melanin pigmentation and
THRβ MRNA expression in the eye of zebrafish embryos. Endocr. Disruptors. 2014:e969072. in
press. 10.4161/23273739.2014.969072
Dong W, Macaulay LJ, Kwok KWH, Hinton DE, Stapleton HM. Using whole mount in situ
hybridization to examine thyroid hormone deiodinase expression in embryonic and larval
zebrafish: a tool for examining OH-BDE toxicity to early life stages. Aquat Toxicol. 2013; 132–
133:190–9.10.1016/j.aquatox.2013.02.008
Erratico, Ca; Moffatt, SC.; Bandiera, SM. Comparative oxidative metabolism of BDE-47 and BDE-99
by rat hepatic microsomes. Toxicol Sci. 2011; 123:37–47.10.1093/toxsci/kfr155 [PubMed:
21673328]
Essner JJ, Breuer JJ, Essner RD, Fahrenkrug SC, Hackett PB. The zebrafish thyroid hormone receptor
alpha 1 is expressed during early embryogenesis and can function in transcriptional repression.
Differentiation. 1997; 62:107–17.10.1046/j.1432-0436.1997.6230107.x [PubMed: 9447705]
Feo ML, Gross MS, McGarrigle BP, Eljarrat E, Barceló D, Aga DS, Olson JR. Biotransformation of
BDE-47 to Potentially Toxic Metabolites Is Predominantly Mediated by Human CYP2B6. Environ
Health Perspect. 2013; 121:440–446.10.1289/ehp.1205446 [PubMed: 23249762]
Forrest D, Erway LC, Ng L, Altschuler R, Curran T. Thyroid hormone receptor beta is essential for
development of auditory function. Nat Genet. 1996; 13:354–7.10.1038/ng0796-354 [PubMed:
8673137]
Gauthier K, Chassande O, Plateroti M, Roux JP, Legrand C, Pain B, Rousset B, Weiss R, Trouillas J,
Samarut J. Different functions for the thyroid hormone receptors TRalpha and TRbeta in the
control of thyroid hormone production and post-natal development. EMBO J. 1999; 18:623–
31.10.1093/emboj/18.3.623 [PubMed: 9927422]
Hamers T, Kamstra JH, Sonneveld E, Murk AJ, Visser TJ, Van Velzen MJM, Brouwer A, Bergman A.
Biotransformation of brominated flame retardants into potentially endocrine-disrupting
metabolites, with special attention to 2,2′,4,4′-tetrabromodiphenyl ether (BDE-47). Mol Nutr Food
Res. 2008; 52:284–98.10.1002/mnfr.200700104 [PubMed: 18161906]
Heijlen M, Houbrechts AM, Bagci E, Van Herck SLJ, Kersseboom S, Esguerra CV, Blust R, Visser
TJ, Knapen D, Darras VM. Knockdown of type 3 iodothyronine deiodinase severely perturbs both
embryonic and early larval development in zebrafish. Endocrinology. 2014; 155:1547–
1559.10.1210/en.2013-1660 [PubMed: 24467742]
Howdeshell KL. A model of the development of the brain as a construct of the thyroid system. Environ
Health Perspect. 2002; 110(Suppl):337–48. [PubMed: 12060827]
Ibhazehiebo K, Iwasaki T, Kimura-Kuroda J, Miyazaki W, Shimokawa N, Koibuchi N. Disruption of
thyroid hormone receptor-mediated transcription and thyroid hormone-induced Purkinje cell
dendrite arborization by polybrominated diphenyl. Environ Health Perspect. 2011; 119:168–175.
[PubMed: 20870570]
Jegstrup IM, Rosenkilde P. Regulation of post-larval development in the European eel: thyroid
hormone level, progress of pigmentation and changes in behaviour. J Fish Biol. 2003; 63:168–
175.10.1046/j.1095-8649.2003.00138.x
Kelly BC, Blair JD, Gobas FAPC, Ikonomou MG. Hydroxylated and methoxylated polybrominated
diphenyl ethers in a Canadian Arctic marine food web. Environ Sci Technol. 2008; 42:7069–77.
[PubMed: 18939528]
Kimmel CB, Ballard WW, Kimmel SR, Ullmann B, Schilling TF. Stages of embryonic development
of the zebrafish. Dev Dyn. 1995; 203:253–310.10.1002/aja.1002030302 [PubMed: 8589427]
Kitamura S, Shinohara S, Iwase E, Sugihara K, Uramaru N, Shigematsu H, Fujimoto N, Ohta S.
Affinity for thyroid hormone and estrogen receptors of hydroxylated polybrominated diphenyl
ethers. J Heal Sci. 2008; 54:607–614.
Kojima H, Takeuchi S, Uramaru N, Sugihara K, Yoshida T, Kitamura S. Nuclear hormone receptor
activity of polybrominated diphenyl ethers and their hydroxylated and methoxylated metabolites in
Macaulay et al. Page 14
Aquat Toxicol. Author manuscript; available in PMC 2016 November 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript
transactivation assays using Chinese hamster ovary cells. Environ Health Perspect. 2009;
117:1210–8.10.1289/ehp.0900753 [PubMed: 19672399]
Legradi J, Dahlberg AK, Cenijn P, Marsh G, Asplund L, Bergman A, Legler J. Disruption of
Oxidative Phosphorylation (OXPHOS) by Hydroxylated Polybrominated Diphenyl Ethers (OH-
PBDEs) Present in the Marine Environment. Environ Sci Technol. 2014; 48:14703–11.10.1021/
es5039744 [PubMed: 25422162]
Lema SC, Dickey JT, Schultz IR, Swanson P. Dietary exposure to 2,2′,4,4′-tetrabromodiphenyl ether
(PBDE-47) alters thyroid status and thyroid hormone-regulated gene transcription in the pituitary
and brain. Environ Health Perspect. 2008; 116:1694–9.10.1289/ehp.11570 [PubMed: 19079722]
Li F, Xie Q, Li X, Li N, Chi P, Chen J, Wang Z, Hao C. Hormone activity of hydroxylated
polybrominated diphenyl ethers on human thyroid receptor-beta: in vitro and in silico
investigations. Environ Health Perspect. 2010; 118:602–6.10.1289/ehp.0901457 [PubMed:
20439171]
Li T, Wang W, Pan YW, Xu L, Xia Z. A hydroxylated metabolite of flame-retardant PBDE-47
decreases the survival, proliferation, and neuronal differentiation of primary cultured adult neural
stem cells and interferes with signaling of ERK5 MAP kinase and neurotrophin 3. Toxicol Sci.
2013; 134:111–24.10.1093/toxsci/kft083 [PubMed: 23564643]
Liu H, Tang S, Zheng X, Zhu Y, Ma Z, Liu C, Hecker MM, Saunders DMV, Giesy JP, Zhang X, Yu
H. Bioaccumulation, biotransformation and toxicity of BDE-47, 6-OH-BDE-47 and 6-MeO-
BDE-47 in early life-stages of zebrafish (Danio rerio). Environ Sci Technol. 2015; 49:1823–
33.10.1021/es503833q [PubMed: 25565004]
Liu YW, Chan WK. Thyroid hormones are important for embryonic to larval transitory phase in
zebrafish. Differentiation. 2002; 70:36–45.10.1046/j.1432-0436.2002.700104.x [PubMed:
11963654]
Liu YW, Lo LJ, Chan WK. Temporal expression and T3 induction of thyroid hormone receptors
alpha1 and beta1 during early embryonic and larval development in zebrafish, Danio rerio. Mol
Cell Endocrinol. 2000; 159:187–95. [PubMed: 10687864]
Mazdai A, Dodder NG, Abernathy MP, Hites RA, Bigsby RM. Polybrominated diphenyl ethers in
maternal and fetal blood samples. Environ Health Perspect. 2003; 111:1249–52. [PubMed:
12842781]
McMenamin SK, Parichy DM. Metamorphosis in teleosts. Curr Top Dev Biol. 2013; 103:127–
65.10.1016/B978-0-12-385979-2.00005-8 [PubMed: 23347518]
Meerts, Ia; Letcher, RJ.; Hoving, S.; Marsh, G.; Bergman, a; Lemmen, JG.; van der Burg, B.;
Brouwer, a. In vitro estrogenicity of polybrominated diphenyl ethers, hydroxylated PDBEs, and
polybrominated bisphenol A compounds. Environ Health Perspect. 2001; 109:399–407. [PubMed:
11335189]
Meerts IA, van Zanden JJ, Luijks EA, van Leeuwen-Bol I, Marsh G, Jakobsson E, Bergman A,
Brouwer A. Potent competitive interactions of some brominated flame retardants and related
compounds with human transthyretin in vitro. Toxicol Sci. 2000; 56:95–104. [PubMed: 10869457]
Miwa S, Tagawa M, Inui Y, Hirano T. Thyroxine surge in metamorphosing flounder larvae. Gen
Comp Endocrinol. 1988; 70:158–163.10.1016/0016-6480(88)90105-0 [PubMed: 3131186]
Morvan-Dubois G, Fini JB, Demeneix BA. Is thyroid hormone signaling relevant for vertebrate
embryogenesis? Curr Top Dev Biol. 2013; 103:365–96.10.1016/B978-0-12-385979-2.00013-7
[PubMed: 23347526]
Mukhi S, Patiño R. Effects of prolonged exposure to perchlorate on thyroid and reproductive function
in zebrafish. Toxicol Sci. 2007; 96:246–54.10.1093/toxsci/kfm001 [PubMed: 17205975]
Nelson ER, Habibi HR. Thyroid receptor subtypes: structure and function in fish. Gen Comp
Endocrinol. 2009; 161:90–6.10.1016/j.ygcen.2008.09.006 [PubMed: 18840444]
Nomiyama K, Eguchi A, Mizukawa H, Ochiai M, Murata S, Someya M, Isobe T, Yamada TK, Tanabe
S. Anthropogenic and naturally occurring polybrominated phenolic compounds in the blood of
cetaceans stranded along Japanese coastal waters. Environ Pollut. 2011; 159:3364–73.10.1016/
j.envpol.2011.08.035 [PubMed: 21903310]
Macaulay et al. Page 15
Aquat Toxicol. Author manuscript; available in PMC 2016 November 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript
Orozco A, Linser P, Valverde-R C. Kinetic characterization of outer-ring deiodinase activity (ORD) in
the liver, gill and retina of the killifish Fundulus heteroclitus. Comp Biochem Physiol Part B
Biochem Mol Biol. 2000; 126:283–290.10.1016/S0305-0491(00)00186-3
Porazzi P, Calebiro D, Benato F, Tiso N, Persani L. Thyroid gland development and function in the
zebrafish model. Mol Cell Endocrinol. 2009; 312:14–23.10.1016/j.mce.2009.05.011 [PubMed:
19481582]
Power DM, Llewellyn L, Faustino M, Nowell Ma, Björnsson BT, Einarsdottir IE, Canario aV,
Sweeney GE. Thyroid hormones in growth and development of fish. Comp Biochem Physiol C
Toxicol Pharmacol. 2001; 130:447–59. [PubMed: 11738632]
Ren XM, Guo LH. Molecular toxicology of polybrominated diphenyl ethers: nuclear hormone receptor
mediated pathways. Environ Sci Process Impacts. 2013; 15:702–8.10.1039/c3em00023k [PubMed:
23467608]
Ren XM, Guo LH, Gao Y, Zhang BT, Wan B. Hydroxylated polybrominated diphenyl ethers exhibit
different activities on thyroid hormone receptors depending on their degree of bromination.
Toxicol Appl Pharmacol. 2013; 268:256–263.10.1016/j.taap.2013.01.026 [PubMed: 23402801]
Sanders JP, Van der Geyten S, Kaptein E, Darras VM, Kühn ER, Leonard JL, Visser TJ.
Characterization of a propylthiouracil-insensitive type I iodothyronine deiodinase. Endocrinology.
1997; 138:5153–60.10.1210/endo.138.12.5581 [PubMed: 9389495]
Schmidt F, Braunbeck T. Alterations along the Hypothalamic-Pituitary-Thyroid Axis of the Zebrafish
(Danio rerio) after Exposure to Propylthiouracil. J Thyroid Res. 2011; 376243:1–
17.10.4061/2011/376243
Schriks M, Roessig JM, Murk AJ, Furlow JD. Thyroid hormone receptor isoform selectivity of thyroid
hormone disrupting compounds quantified with an in vitro reporter gene assay. Environ Toxicol
Pharmacol. 2007; 23:302–7.10.1016/j.etap.2006.11.007 [PubMed: 21783772]
Stapleton HM, Eagle S, Anthopolos R, Wolkin A, Miranda ML. Associations between polybrominated
diphenyl ether (PBDE) flame retardants, phenolic metabolites, and thyroid hormones during
pregnancy. Environ Health Perspect. 2011; 119:1454–9.10.1289/ehp.1003235 [PubMed:
21715241]
Stoker TE, Laws SC, Crofton KM, Hedge JM, Ferrell JM, Cooper RL. Assessment of DE-71, a
commercial polybrominated diphenyl ether (PBDE) mixture, in the EDSP male and female
pubertal protocols. Toxicol Sci. 2004; 78:144–55.10.1093/toxsci/kfh029 [PubMed: 14999130]
Strecker R, Weigt S, Braunbeck T. Cartilage and bone malformations in the head of zebrafish (Danio
rerio) embryos following exposure to disulfiram and acetic acid hydrazide. Toxicol Appl
Pharmacol. 2013; 268:221–31.10.1016/j.taap.2013.01.023 [PubMed: 23391615]
Sun J, Liu J, Liu Q, Ruan T, Yu M, Wang Y, Wang T, Jiang G. Hydroxylated polybrominated
diphenyl ethers (OH-PBDEs) in biosolids from municipal wastewater treatment plants in China.
Chemosphere. 2013; 90:2388–95.10.1016/j.chemosphere.2012.10.034 [PubMed: 23141840]
Szabo DT, Richardson VM, Ross DG, Diliberto JJ, Kodavanti PRS, Birnbaum LS. Effects of perinatal
PBDE exposure on hepatic phase I, phase II, phase III, and deiodinase 1 gene expression involved
in thyroid hormone metabolism in male rat pups. Toxicol Sci. 2009; 107:27–39.10.1093/toxsci/
kfn230 [PubMed: 18978342]
Tata JR. Amphibian metamorphosis as a model for the developmental actions of thyroid hormone. Mol
Cell Endocrinol. 2006; 246:10–20.10.1016/j.mce.2005.11.024 [PubMed: 16413959]
Usenko CY, Hopkins DC, Trumble SJ, Bruce ED. Hydroxylated PBDEs induce developmental arrest
in zebrafish. Toxicol Appl Pharmacol. 2012; 262:43–51.10.1016/j.taap.2012.04.017 [PubMed:
22546086]
Van Boxtel AL, Kamstra JH, Cenijn PH, Pieterse B, Wagner JM, Antink M, Krab K, van der Burg B,
Marsh G, Brouwer A, Legler J. Microarray analysis reveals a mechanism of phenolic
polybrominated diphenylether toxicity in zebrafish. Environ Sci Technol. 2008; 42:1773–9.
[PubMed: 18441834]
Visser TJ, Kaplan MM, Leonard JL, Larsen PR. Evidence for two pathways of iodothyronine 5′-
deiodination in rat pituitary that differ in kinetics, propylthiouracil sensitivity, and response to
hypothyroidism. J Clin Invest. 1983; 71:992–1002. [PubMed: 6833498]
Macaulay et al. Page 16
Aquat Toxicol. Author manuscript; available in PMC 2016 November 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript
Walker MB, Kimmel CB. A two-color acid-free cartilage and bone stain for zebrafish larvae. Biotech
Histochem. 2007; 82:23–8.10.1080/10520290701333558 [PubMed: 17510811]
Walpita CN, Crawford AD, Darras VM. Combined antisense knockdown of type 1 and type 2
iodothyronine deiodinases disrupts embryonic development in zebrafish (Danio rerio). Gen Comp
Endocrinol. 2010; 166:134–41.10.1016/j.ygcen.2009.09.011 [PubMed: 19800339]
Walpita CN, Crawford AD, Janssens EDR, Van der Geyten S, Darras VM. Type 2 iodothyronine
deiodinase is essential for thyroid hormone-dependent embryonic development and pigmentation
in zebrafish. Endocrinology. 2009; 150:530–9.10.1210/en.2008-0457 [PubMed: 18801906]
Walpita CN, Van der Geyten S, Rurangwa E, Darras VM. The effect of 3,5,3′-triiodothyronine
supplementation on zebrafish (Danio rerio) embryonic development and expression of
iodothyronine deiodinases and thyroid hormone receptors. Gen Comp Endocrinol. 2007; 152:206–
14.10.1016/j.ygcen.2007.02.020 [PubMed: 17418841]
Wan Y, Wiseman S, Chang H, Zhang X, Jones PD, Hecker M, Kannan K, Tanabe S, Hu J, Lam
MHW, Giesy JP. Origin of hydroxylated brominated diphenyl ethers: natural compounds or man-
made flame retardants? Environ Sci Technol. 2009; 43:7536–42. [PubMed: 19848173]
Zhang YF, Xu W, Lou QQ, Li YY, Zhao YX, Wei WJ, Qin ZF, Wang HL, Li JZ.
Tetrabromobisphenol A disrupts vertebrate development via thyroid hormone signaling pathway in
a developmental stage-dependent manner. Environ Sci Technol. 2014; 48:8227–34.10.1021/
es502366g [PubMed: 24963557]
Zhao Y, Ruan X, Li Y, Yan M, Qin Z. Polybrominated diphenyl ethers (PBDEs) in aborted human
fetuses and placental transfer during the first trimester of pregnancy. Environ Sci Technol. 2013;
47:5939–46.10.1021/es305349x [PubMed: 23621775]
Zheng X, Zhu Y, Liu C, Liu H, Giesy JP, Hecker M, Lam MHW, Yu H. Accumulation and
Biotransformation of BDE-47 by Zebrafish Larvae and Teratogenicity and Expression of Genes
along the Hypothalamus-Pituitary-Thyroid Axis. Environ Sci Technol. 2012; 46:12943–
51.10.1021/es303289n [PubMed: 23110413]
Zhou T, Taylor MM, DeVito MMJ, Crofton KKMA. Developmental exposure to brominated diphenyl
ethers results in thyroid hormone disruption. Toxicol Sci. 2002; 66:105–16. [PubMed: 11861977]
Zota AR, Park JS, Wang Y, Petreas M, Zoeller RT, Woodruff TJ. Polybrominated diphenyl ethers,
hydroxylated polybrominated diphenyl ethers, and measures of thyroid function in second
trimester pregnant women in California. Environ Sci Technol. 2011; 45:7896–905.10.1021/
es200422b [PubMed: 21830753]
Macaulay et al. Page 17
Aquat Toxicol. Author manuscript; available in PMC 2016 November 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript
Figure 1.
Various anatomical features used to establish morphometrics are illustrated in embryo image
in Panel A. The HTA is formed by a line between the ear and the eye and by a line parallel
to the notochord extending caudally to somite 5. The otic vesicle length was calculated using
eye-ear-distance (EED- dashed white line) and inner ear diameter (IED- dashed black line)
at widest point; OVL=EED/IED. The eye region is also highlighted to show area used for
pigmentation measurement. Values for each parameter are shown for each experimental
group (Panel B- HTA, Panel C-OVL, Panel D-eye pigmentation). Increases in OVL,
decreases in pigmentation, and decreases in HTA are all indicative of developmental delays.
Data are normalized to control values and presented as mean ±SEM (n>30/treatment) with
statistical differences from controls denoted by an asterisk (One-way ANOVA, Dunnet’s
post-hoc p<0.05)
Macaulay et al. Page 18
Aquat Toxicol. Author manuscript; available in PMC 2016 November 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript
Figure 2.
Photomicrograph of head region showing the forward protrusion (length) of the Meckel’s
(l1) and the ceratohyal (l2) cartilage complexes in a 4dpf larval zebrafish stained with Alcian
Blue. The sides and base (b) were measured using Image J Analysis Software, and the length
(l) was calculated using the Pythagorean theorem, l=(s2-b2/4)1/2
Macaulay et al. Page 19
Aquat Toxicol. Author manuscript; available in PMC 2016 November 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript
Figure 3.
TR β mRNA injections rescue developmental delays (Panel I) caused by exposure to
increasing concentrations of 6-OH-BDE-47. Representative 30 hpf zebrafish embryos (Panel
II) that were treated with 100 nM 6-OH-BDE-47 (D,E), 250 nM 6-OH-BDE-47 (F,G) or
control (A,B,C) are shown. Noninjected embryos are control (A), 100 nM 6-OH-BDE-47
(D), and 250 nM 6-OH-BDE-47 (F). Embryos injected with control morpholino are in Panel
B. Embryos injected with TRB are control (C), 100 nM (E) or 250 nM 6-OH-BDE-47 (G).
Injection with TR βduring 6-OH-BDE-47 exposure (B,E,G) restored normal development,
as indicated by restored morphometric values. Quantification of developmental
morphometrics are presented as mean ±SEM (n>20/treatment) and statistical differences are
denoted by bars with different letters (One-way ANOVA, Dunnet’s post hoc p<0.05).
Macaulay et al. Page 20
Aquat Toxicol. Author manuscript; available in PMC 2016 November 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript
Figure 4.
6-OH-BDE-47 affects cartilage development in zebrafish (Danio rerio) larvae at 96hpf.
Compare control larvae (A,G), to that of 50 nM 6-OH-BDE-47 (B), and 100 nM 6-OH-
BDE-47 treated larvae (C–F, H). Photomicrographs of head region are shown with varying
orientations including ventral in A–D, dorsal in E–F, and lateral G–H. Panel A and G show
normal development. In panel B, slight malformation is seen with broadening of right and
left portions of Meckel’s (m) cartilage and the position and angle of the ceratohyals (ch) are
altered (B,C,D). Panels E and F show malformations of the entire larval pharyngeal
skeleton, with Meckel’s cartilage being smaller and misshapen. Note that the angle between
the paired ceratohyals is markedly altered. In H, note the severe lower jaw deformities. Note
absence of eyes (panel C) and variable eye pigmentation. This is an artifact of handling
arising from the repeated staining, bleaching, and rinsing steps involved with these fragile
specimens.
Macaulay et al. Page 21
Aquat Toxicol. Author manuscript; available in PMC 2016 November 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript
Figure 5.
Quantification of forward protrusion of cartilage complexes in 4dpf larval zebrafish.
Treatment with 50 nM or 100 nM 6-OH-BDE-47 signficantly reduced the length of the
Meckel’s and ceratohyal cartilage forward protrusions. These craniofacial abnormalities (see
Methods section above) can be mediated by disruption of thyroid hormones, critical for
pharyngeal cartilage and craniofacial development.
Macaulay et al. Page 22
Aquat Toxicol. Author manuscript; available in PMC 2016 November 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript
Author Manuscript Author Manuscript Author Manuscript Author Manuscript
Macaulay et al. Page 23
Table 1
Chemical Properties of compounds used in this study. Log Kow values were estimated using EPA’s EPISuite
software.
Thyroid Disrupting Agents and Native Thyroid Hormones
Chemical (CAS #) Structure Log Kow (MW g/mol) Name
6-OH-BDE -47 (n/a) 6.29 (501.8) 6-hydroxy, 2,2′,4,4′ tetrabromodiphenyl ether
PTU (0000051-52-5) 0.98 (170.2) 6-propyl-2-thiouracil
IOP (000096-83-3) 5.78 (570.9) Iopanoic Acid
T3 (00005-48-9) 2.96 (651.0) Triiodothyronine
T4 (000051-48-9) 4.12 (776.88) Thyroxine
Aquat Toxicol. Author manuscript; available in PMC 2016 November 01.
