Content uploaded by Vlctoria V Lunyak
Author content
All content in this area was uploaded by Vlctoria V Lunyak on Jul 14, 2015
Content may be subject to copyright.
Oncotarget1
www.impactjournals.com/oncotarget
www.impactjournals.com/oncotarget/ Oncotarget, Advance Publications 2015
Transcriptional proling of interleukin-2-primed human adipose
derived mesenchymal stem cells revealed dramatic changes in
stem cells response imposed by replicative senescence
Ping Niu1,*, Aibek Smagul2,*, Lu Wang3, Aiman Sadvakas2, Ying Sha3, Laura M.
Pérez4, Aliya Nussupbekova2, Aday Amirbekov2, Akan A. Akanov2, Beatriz G.
Gálvez4, I. King Jordan3,5 and Victoria V. Lunyak6
1 Department of Pediatrics, Renmin Hospital of Wuhan University, Wuhan, China
2 S.D. Asfendiyarov Kazakh National Medical University, Almaty, Kazakhstan
3 School of Biology, Georgia Institute of Technology, Atlanta, GA, USA
4 Cardiac Development and Repair Department, National Center for Cardiovascular Research (CNIC), Madrid, Spain
5 PanAmerican Bioinformatics Institute, Santa Marta, Magdalena, Colombia
6 Aelan Cell Technologies, Inc, San Francisco, CA, USA
* These authors have contributed equally to this work
Correspondence to: Victoria V. Lunyak, email: vlunyak@aelanct.com
Keywords: mesenchymal stem cells, IL-2, aging, cancer, immunomodulation
Received: April 17, 2015 Accepted: June 11, 2015 Published: July 14, 2015
This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use,
distribution, and reproduction in any medium, provided the original author and source are credited.
ABSTRACT
Inammation is a double-edged sword with both detrimental and benecial
consequences. Understanding of the mechanisms of crosstalk between the
inammatory milieu and human adult mesenchymal stem cells is an important basis
for clinical efforts. Here, we investigate changes in the transcriptional response of
human adipose-derived stem cells to physiologically relevant levels of IL-2 (IL-2
priming) upon replicative senescence. Our data suggest that replicative senescence
might dramatically impede human mesenchymal stem cell (MSC) function via global
transcriptional deregulation in response to IL-2. We uncovered a novel senescence-
associated transcriptional signature in human adipose-derived MSCs hADSCs after
exposure to pro-inammatory environment: signicant enhancement of the expression
of the genes encoding potent growth factors and cytokines with anti-inammatory
and migration-promoting properties, as well as genes encoding angiogenic and anti-
apoptotic promoting factors, all of which could participate in the establishment of
a unique microenvironment. We observed transcriptional up-regulation of critical
components of the nitric oxide synthase pathway (iNOS) in hADSCs upon replicative
senescence suggesting, that senescent stem cells can acquire metastasis-promoting
properties via stem cell-mediated immunosuppression. Our study highlights
the importance of age as a factor when designing cell-based or pharmacological
therapies for older patients and predicts measurable biomarkers characteristic of an
environment that is conducive to cancer cells invasiveness and metastasis.
INTRODUCTION
Transplanted mesenchymal stem cells (MSCs)
are consistently exposed to tissue signals, immune cells
and mediators that could inuence their behavior. The
mechanisms by which this environment inuences
potential therapeutic outcomes in MSC clinical
applications remain poorly understood, however, over the
past decade MSCs themselves have been shown to possess
a broad spectrum of signaling capabilities, affecting both
Oncotarget2
www.impactjournals.com/oncotarget
adaptive and innate immunity by the secretion of growth
factors and chemokines to induce cell proliferation,
angiogenesis, interactions with the immune system and
mediation of anti-apoptotic events [1, 2]. Based on these
remarkable properties, the MSCs are considered to have
therapeutic potential to treat broad spectrum of diverse
human diseases, including cancer [3].
The most favorable way of using the full potential
of MSCs as a therapeutic is the clinical utilization of
autologous (patient specic) or syngeneic (genetically
similar) cells. To date, little is known regarding the extent
to which the benecial properties of MSC change with the
age of the patient or upon MSCs expansion and passaging
ex-vivo, where the length of expansion period, culture
methods and the patient’s clinical history can all lead to
a gradual accumulation of replicatively senescent cells.
Replicative senescence is characterized by a growth arrest,
apoptosis resistance, morphological and cell-size changes,
high levels of expression of the tumor suppressors P16,
P21, P53 and/or RB, increased activity of senescence-
associated beta galactosidase (SA-β-gal) and loss of the
ability to synthesize and repair DNA [4, 5]. Numerous
reports indicate that the replicative aging of stem cells
and MSCs, in particular, can inuence their biological
properties, including their ability to secrete benecial
factors [6-9].
The primary trophic property of MSCs is secretion
of mitogenic growth factors such as transforming growth
factor-alpha (TGF-α), TGF-β, hepatocyte growth factor
(HGF), epithelial growth factor (EGF), basic broblast
growth factor (FGF-2), vascular endothelial growth factor
(VEGF) and insulin-like growth factor-1 (IGF-1). All of
these factors, when present in the systemic milieu, have
shown to increase broblasts along with epithelial and
endothelial cell division or differentiation [3, 10-13].
This provides evidence that the MSC-triggered cellular
communication circuitry is necessary for tissue or organ
remodeling and regeneration. Interestingly, the secretion
of a wide array of growth factor and anti-inammatory
proteins by MSCs could also be modulated in response
to inammatory molecules, such as interlukin-1 (IL-
1), IL-2, IL-12, tumor necrosis factor-alpha (TNF-α)
and interferon-gamma (INF-γ) (see for review [3]),
thereby providing complex signaling guidance to many
inammatory cells, including T-cells, natural killer
cell, B-cells, monocytes, macrophages and endritic
cells [3, 14-17]. Previous reports have demonstrated
that pro-inammatory cytokines were able to increase
the migration of human MSCs as well as to induce the
production of chemokines and chemotactic factors that
permit MSCs to suppress immune reactions [18-20]. The
best documented immune-modulatory effect of MSCs is
their ability to impose G0/G1 phase arrest in the activated
T-cells, thus inhibiting T-cell proliferation [19, 20] [21,
22]. Despite the notion that the secretion by MSCs of a
number of the soluble factors (IL-6, IL-10, indoleamine,
2,3-dioxygenase, iNOS and PGE2) could assist injury
through the modulation of the regenerative environment
via anti-inammatory and immunomodulatory pathways,
the exact molecular mechanism by which this modulation
takes place is only partially understood and seemingly
contradictive, in part due to lack of data that clearly
articulates how adult stem cell aging in-vivo or ex-vivo
contributes to immunomodulatory properties.
This study was conducted to evaluate the impact of
replicative senescence on the transcriptional activity of
human adipose-derived MSCs (hADSCs) in response to
IL-2 signaling. Our results uncovered signicant changes
imposed by replicative senescence on biological pathways
related to stem cell response to IL-2 priming, and suggest
that such changes might dramatically inuence outcomes
of clinical application of hADSCs by affecting their
immunomodulatory and migration properties as well as
their ability to inuence the regenerative environment.
RESULTS
Characterization of the MSC senescent phenotype
Mesenchymal stem cells (MSCs) are mesoderm-
derived cells that reside in the stroma of solid organs and
function as precursors of non-hematopoietic connective
tissues with the capacity to differentiate into mesenchymal
and non-mesenchymal cell lineages. Adipose-derived
MSCs (ADSCs) are more accessible, compared to bone
marrow BM-MSCs, more abundant, and equally capable of
differentiating into cells and tissues of mesodermal origin
[23]. ADSCs also share some of the immunomodulatory
properties that characterize BM-MSCs. Reported data
indicate that ADSCs could effectively down-regulate
excessive immunologic reactions and have a protective
effect on acute graft-versus-host disease, as well as in
animal models of experimental arthritis [24, 25]. hADSCs
were isolated and cultured as described in the Materials
and Methods and in [7]. Ex-vivo replicative senescence
led to decreased proliferation, accumulation of DNA
damage and observed typical morphological changes:
hADSCs became much larger with irregular and at shape,
and nuclei became more circumscribed in phase contrast
microscopy with the granular cytoplasm appearance of
many inclusions and aggradations [6, 7]. The growth
curves of hADSCs obtained from two different patients
are shown in Figure 1A. Typical staining for senescence-
associated SA-β galactosidase activity for either hADSCs
in linear growth rate, self-renewing state (SR) or when
cell lines cease their proliferation, senescent state (SEN) is
shown in Figure 1B and described in detail in [7].
Oncotarget3
www.impactjournals.com/oncotarget
Table 1: Biological pathways enriched for genes up-regulated upon IL-2 treatment in self-replicating (SR) and/or
senescent (SEN) hADSCs.
Enriched pathways are shown along with the individual IL-2+ up-regulated genes belonging to the pathway and the pathway enrichment
signicance levels. Pathways with gene members up-regulated in SR are shown in the left column, and pathways with gene members up-
regulated in SEN are shown in the right column. Pathways with gene members up-regulated in both SR and SEN are shown in the top row
followed by pathways with gene members up-regulated only in SEN, and nally pathways with gene members up-regulated only in SR.
Networks are shown relating pathways that are up-regulated in SR (left column) and pathways that are up-regulated in SEN (right column).
The network nodes represent pathways, and the sizes of the nodes correspond to the number of up-regulated genes in that pathway. Pathway
nodes are connected by edges if the pathways share up-regulated genes, and edge-weights correspond to the number of up-regulated genes
shared between the pathways.
Oncotarget4
www.impactjournals.com/oncotarget
Replicative senescence ADSCs demonstrate a
higher propensity for migration
One of the important characteristics of MSCs
is their ability to migrate to sites of damaged tissue
[26]. To investigate whether or not ex-vivo replicative
senescence affects the migratory potential of hADSCs, we
have performed migration assays with a set of common
cytokines and relevant growth factors using the Transwell
system as described in the Materials and Methods. We
observed that SEN hADSCs showed signicantly higher
basal migration capacity than their SR counterparts (Figure
1C). In addition, the response of SEN hADSCs to different
cytokine chemo-attractants was measured. The factors IL-
2, IL-6, IL-8 as well as TNF-α and HMGB1 have been
Figure 1: Replicative senescence impairs migratory properties of the hADSCs. A. Growth curve of the hADSCs is represented
as cumulative population doubling over day in culture. Two patient-specic cell lines were used for the study (Female, 32 years old,
*-Female 45 years old ). Linear proliferation stage for both lines shown in blue (SR) and stages when hADSC enter senescence shown in
red (SEN) B. Colometric detection of senescence-associated β-galactosidase (10x) in self-renewing (SR) and senescent (SEN) hADSCs . C.
Ex-vivo migration assays for self-renewing (SR-blue) and senescent (SEN-red) hADSCs were performed in complete DMEM-F12 media.
The black lines indicate the median values, and the whiskers indicate the range of values. Statistical difference was evaluated by t- test with
P-value (p) as depicted. D. Self-renewing SR (blue) and senescence SEN (red) hADSCs were induced to migrate in the presence of different
cytokines (50 ng/ml IL-2, IL-6, IL-8, HMGB1; 30 ng/ml TNF). The graphic represents the mean of ten independent experiments (n = 10).
P-values (p) related to experimental measurements are listed under the graphs.
Oncotarget5
www.impactjournals.com/oncotarget
previously reported as potent chemo-attractants inducing
migration of different stem cell types [27, 28]. Our data
indicate that hADSCs at late passages have an increased
ability to migrate in comparison to early passages (Figure
1D), indicating that replicative senescence increases
the migratory properties of hADSCs in response to the
tested chemo-attractants. Interestingly, upon senescence
of hADSCs interleukin-2 (IL-2) became the most potent
chemo-taxis stimulant whereas the TNF-α is less potent
among the tested chemo-attractants in these experiments
(Figure 1D).
Collectively, these data indicate that replicative
senescence can modify the migratory properties of
hADSCs and may possibly inuence hADSCs response
to the inammatory environment as well as their
immunomodulation output ex-vivo.
Differential response to IL-2 stimulation in
human adipose-derived MSCs upon replicative
senescence
IL-2 is a ligand used by cells expressing either the
intermediate-afnity receptor dimer of IL2Rβ (CD122)
and the common IL2Rγ (CD132), or the high-afnity
trimeric IL2R comprising IL2Rα (CD25) in addition to
the IL2Rβ and IL2Rγ isoforms (shown in Figure 2A).
The intermediate-afnity IL-2 receptor is more broadly
expressed on T-cells, natural killer cells and monocytes
[29]. The high-afnity IL-2 receptor is constitutively
expressed on regulatory T-cells (Treg). Information about
the role of IL-2 signaling in non-T-cells is limited, but
nevertheless suggests the existence of similar stimulatory
receptor representations in other cell types [30-32].
Currently, it is unknown how hADSCs are affected by
therapeutic doses of IL-2, and whether or not there are
changes that occur in IL-2 receptor composition or IL-2
receptor signaling upon ex-vivo replicative senescence of
this type of human MSCs.
Assessment of the IL-2 receptor isoforms expression
by qPCR demonstrated dramatic changes in expression of
the IL2Rα isoform in comparison to IL2Rγ and IL2Rβ upon
replicative senescence ex-vivo (Figure 2B). Notably, the
increased accumulation of the IL2Rβ and IL2Rγ transcripts
was recorded after IL-2 treatment in both SR and SEN
hADSCs, whereas IL2Rα expression was severely
abrogated when senescent cells were subjected to similar
treatments (Figure 2B). However, our data indicate that on
the protein level, the cellular membrane-associated IL2Rα
receptor shows the opposite pattern (Figure 2C). Although
the transcriptional status of IL-2 receptor isoforms does
vary between the two different cell states (SR and SEN),
it does not seem to be dependent upon IL-2 priming as
measured by the ELISA assay (described in the Materials
and Methods). Interestingly, our data also demonstrate
that protein encoding IL-2 receptor α chain is far less
abundant than the IL2Rβ isoform (compare 120 pg/ml of
IL2Rα and 350 pg/ml IL2Rβ to 150 pg/ml of IL2Rα and
440 pg/ml IL2Rβ upon replicative senescence ex-vivo)
as shown in Figure 2C. These data suggest that hADSCs
response to IL-2 stimulation occurs, by and large, through
the intermediate-afnity receptor dimer composed of
IL2Rβ (CD122) and the common IL2Rγ (CD132). These
data also caution against over-interpretation of receptor-
signaling pathway dynamics based on transcriptional
assays only.
IL-2 signals via JAK1 and JAK3 to activate
STAT5A and STAT5B, and additionally uses Ras-MAP
kinase and phosphoinositol 3-kinase dependent signaling
pathways (Figure 2A) [33, 34]. The expression of
downstream target of IL-2, STAT5, is shown in Figure
3A and 3B and Supplementary Table 1. In hADSCs, both
STAT5A and STAT5B gene transcription follows the IL-2/
STAT5 signaling axis previously described for T-cells (for
review see [35]), thus prompting us to investigate in detail
how IL-2 and its downstream target STAT5 may effect
transcriptional outcomes in hADSCs upon their replicative
senescence ex-vivo.
Priming with IL-2 results in altered gene
expression in human ADSCs upon replicative
senescence
To address how the transcriptional response to
the IL-2/STAT5 axis changes upon replicative aging of
hADSCs ex-vivo, we performed RNA-seq transcriptome
analysis using the Ion Proton
TM
System as described in the
Material and Methods and shown in Supplementary Figure
1A. We compared gene expression levels in hADSCs
across four conditions (libraries): self-renewal upon
normal ex-vivo culture (SR IL-2–), self-renewal upon 24
hrs recombinant IL-2 stimulation (SR IL-2+), replicative
senescence upon normal ex-vivo culture (SEN IL-2–),
and replicative senescence upon 24 hrs recombinant IL-2
stimulation (SEN IL-2+). Distributions of the total read
counts for the four libraries representing each condition
are shown in Supplementary Figure 1B and 1C.
We used beta-actin expression levels to normalize
gene expression levels between conditions (see Materials
and Methods). This approach was taken to allow for the
fact that overall gene expression levels are likely to change
upon IL-2 treatment, and using a global normalization
method to bring the overall expression distributions
for each condition into register would remove this
biological signal. Indeed, beta-actin normalized gene
expression distributions reveal overall up-regulation of
gene expression upon IL-2 treatment in both SR and SEN
states (Supplementary Figure 1D). However, comparison
of individual gene expression levels among the four
conditions suggests that IL-2 treatment more dramatically
affects senescent (SEN) compared to self-renewing
Oncotarget6
www.impactjournals.com/oncotarget
Figure 2: Gene expression of IL-2 receptor isoforms and their association with membrane in self-renewing (SR) and
senescent (SEN) hADSCs primed with IL-2. A. Three classes of IL-2 receptors (high-afnity, intermediate afnity, and low afnity),
with receptor composition and associated JAK kinases are shown as cartoon. Trans-presentation of IL-2Rα expressed by MSCs to immune
cells that expresses IL-2Rβ and IL-2Rγ has been depicted separately. The soluble IL-2 receptor (soluble sIL-2Rα) with bound IL-2 is not
shown in the gure. B. IL-2 receptors α, β, γ assessed by quantitative PCR in un-stimulated (IL-2-) senescent (red) and self-renewing
(blue) hADSCs and upon stimulation with 20ug/ml of recombinant IL-2 (IL-2+). Data shown as fold change ΔΔCT Mean +SD from three
independent experiments is show. Position of the q-PCR primers off line are depicted graphically C. Cellular membrane associated levels
of IL-2Rα and IL-2Rβ were quantied by ELISA in un-stimulated (IL-2-) senescent (SEN-red) and self-renewing (SR-blue) hADSCs and
upon stimulation with 20ug/ml of recombinant IL-2( IL-2+). Data are expressed as picogram per milliliter. Results are the mean of three
independent experiments (mean ± SD). Statistical signicance was estimated by t- test, where ***p < 0.001, **p < 0.01, *p < 0.05.
Oncotarget7
www.impactjournals.com/oncotarget
Table 2: Biological pathways enriched for genes down-regulated upon IL-2 treatment in self-replicative (SR) and/or
senescent (SEN) hADSCs.
Enriched pathways are shown along with the individual IL-2+ down-regulated genes belonging to the pathway and the pathway enrichment
signicance levels. Pathways with gene members down-regulated in SR are shown in the left column, and pathways with gene members
down-regulated in SEN are shown in the right column. Pathways with gene members down-regulated in both SR and SEN are shown in the
top row followed by pathways with gene members down-regulated only in SEN, and nally pathways with gene members down-regulated
only in SR. A network is shown relating pathways that are down-regulated in SEN (left column). The network nodes represent pathways,
and the sizes of the nodes correspond to the number of SEN down-regulated genes in that pathway. Pathway nodes are connected by edges
if the pathways share SEN down-regulated genes, and edge-weights correspond to the number of down-regulated genes shared between
the pathways.
Oncotarget8
www.impactjournals.com/oncotarget
(SR) hADSCs (Figure 4A). The SR IL-2– and SR IL-2+
conditions group closely together when individual gene
expression levels are compared followed by the SEN IL-
2– condition. The SEN IL-2+ condition is a clear outlier
amongst the four conditions showing a substantially
divergent pattern of individual gene expression levels. This
suggests the possibility that the biological response to IL-2
treatment in hADSCs upon senescence might dramatically
impede MSC function via global transcriptional de-
regulation in response to IL-2.
Expression levels were further compared between
conditions in order to identify individual genes that are
differentially expressed, up- and down-regulated, in
response to IL-2 treatment in both SR and SEN states
(Figure 4B). There are far more genes that are up-
regulated (8,866) compared to down-regulated (2,296)
upon IL-2 treatment in both SR and SEN hADSCs. There
is also a substantially higher proportion of genes that
are up-regulated in both SR and SEN hADSCs (35%)
compared to genes that are down-regulated in both states
(4%). The greatest asymmetry is seen for genes that are
down regulated in SEN hADSCs upon IL-2 treatment
(1,739); there are many more such genes than seen for
the SR IL-2+ condition (649). This difference suggests
that the overall divergence of the SEN IL-2+ condition is
largely attributed to genes that are down-regulated upon
IL-2 treatment, which is an unexpected result given the
overall up-regulation across both SR and SEN upon IL-2
treatment (Figure 4B, 4C, 4D and Supplementary Figure
1D).
Taken together, these data suggest the possibility
that SEN hADSCs have lost the ability to generate a
response to IL-2 treatment to the same extent as actively
proliferating cells. The greater number of up-regulated
genes seen for SR IL-2+, compared to SEN IL-2+, is
consistent with this interpretation.
Trophic properties of the hADSCs after
interleukin-2 priming are susceptible to
replicative aging ex-vivo
The secretion of a broad range of bioactive
molecules is now believed to be the main mechanism
by which MSCs achieve their therapeutic effects. MSCs
secrete an array of growth factors and anti-inammatory
proteins with complex feedback mechanisms among
the many types of immune cells [3]. Our data indicate
that the expression of growth factors in hADSCs upon
stimulation with IL-2 is subjected to dramatic changes
upon replicative senescence ex-vivo. While the priming
of actively proliferating (SR) hADSCs with IL-2 results
in increased expression of mitogenic proteins such
as stromal cell-derived factor-2 (SDF2) and SDFL2,
and prostaglandin E synthetase-2 (PTGES2), both SR
and SEN ADSCs are marked by drastic increases of
Figure 3: Stimulation of the self-renewing and
senescent hADSCs with IL-2 upregulates mRNA of
a mediator of IL-2 signaling STAT5 gene. STAT5A and
STAT5B mRNA expression was assessed by quantitative RT-PCR
in un-stimulated (IL-2-) senescent (red) and self-renewing (blue)
hADSCs and upon stimulation with 20ug/ml of recombinant
IL-2 (IL-2+). Data shown as fold change ΔΔCT Mean ± SD
from three independent experiments is shown. Position of the
qPCR primers are depicted graphically. Statistical signicance
was estimated by t- test, where ***p < 0.001, **p < 0.01.
Oncotarget9
www.impactjournals.com/oncotarget
transforming growth factors alpha and beta (TGFα,
TGFβ1 and TGFβ2), transforming growth factor beta
receptor TGFBR2 and transforming growth factor
beta receptor-associated protein TGFBRAP1, as well
as transforming growth factor beta-induced (TGFBI),
which are known to increase broblast, epithelial and
endothelial cell division when secreted in systemic milieu
(Figure 5A and Table S1 ) [3, 36]. In addition, both SR
and SEN IL-2 stimulated hADSCs are marked by up-
regulation of colony stimulating factor-1 (CSF-1), LIF,
IL-11, IL-17D, IL-1β and tumor necrosis factor (ligand)
superfamily TNFSF13B, a cytokine encoding gene that
stimulates B- and T-cell function (Figure 5A, 5B and
Supplementary Table1). Taking into account that paracrine
IL-17D induces expression of IL-6, IL-8, and GM-CSF
genes in endothelial cells, and IL-1β stimulates broblast
growth factor activity (TGFα, TGFβ1 and TGFβ2 genes
are notably up-regulated in IL-2-primed hADSCs) in
autocrine and paracrine fashion, along with thymocyte
and B-cell proliferation and maturation by inducing
release of IL-2 from these cells, our data suggest that the
transcriptional status of both SR and SEN hADSCs may
point to enhanced immunomodulatory properties of these
cells after IL-2 priming via a complex regulatory feed-
back loop.
In addition, we also noted essential differences in
the IL-2 dependent expression of growth factors upon
senescence of hADSCs that have not been observed in
SR cells. This includes up-regulation of only a subset of
broblast growth factor family members (FGF1, FGF11,
FGF14) accompanied by down-regulation of other
members, such as FGF2, FGF5, FGF7, (Figure 5A and
Supplementary Table1). Surprisingly, IL-2 primed SEN
hADSCs are marked by EGF mRNA up-regulation, but
down-regulation of mRNA to its receptor EGFR, together
with decrease in expression of the serum response factor
SRF and the secreted modulator of WNT signaling
SFRP1. Interestingly, the expression of both a potent
mitogen for cells of mesenchymal origin that promotes
wound healing, PDGFA, and its receptor, PDGFRA, is
drastically suppressed in SEN hADSCs in comparison to
SR cells subjected to IL-2 priming (Figure 5A, Table 1 and
Supplementary Table 1).
These data revealed essential senescence-related
differences in the nature of IL-2 mediated transcriptional
response in hADSCs that might impede their
immunomodulatory properties ex-vivo and, ultimately, in-
vivo.
Anti-inammatory and immunomodulatory
properties of IL-2 primed human MSC
Next, we investigated how exposure to the IL-2
pro-inammatory environment, when imposed on
replicative aging, affects the expression of the genes
assigned to provide immunomodulatory properties
of hADSCs. Published data indicated that MSCs can
prevent proliferation and promote differentiation of
many inammatory immune cells, including T-cells,
natural killer cells, B-cells, monocytes, macrophages and
dendritic cells through the secretion of paracrine factors
in response to inammatory environment [20]. Our data
demonstrate that this capacity for immunomodulation
could be severely affected by replicative aging of the
human adipose-derived MCS during ex-vivo passaging
(Figure 5B) and Supplementary Table 1.
IL-2 priming in SEN hADSCs activates distinct
set of genes attributed to T-cell regulation. IL-2 priming
of self-renewing hADSCs results in up-regulation
of genes, such as TNFRSF21 (involved in T-cells
differentiation), IL12A (T-cell activator), ILF2 (potent
regulator of transcription of the IL-2 gene during T-cell
activation), IL33 (paracrine inducer of T-helper type 2
associated cytokines) and down-regulation of CCL28
(chemotactic factor for CD4+, CD8+ T-cells), CD320
(receptor molecule with autocrine and paracrine function
to augment the proliferation of plasma cells) shown in
Figure 5B and Supplementary Table 1. Contrary to that,
IL-2 primed senescent hADSCs are characterized by
drastic transcriptional up-regulation of CD320, a number
of integrins which could be involved in modulation
of T-cell function (ITG11, ITGAV, ITFG1), and genes
encoding important regulatory molecules such as: the
T-cell adhesion receptor (CD99), a factor attributed to the
maintenance of naïve T-cells (CHST3), T-cell activators
(HIVEP1 and HIVEP2), a gene involved in T-cell
signaling pathway (CMIP) and an autocrine/paracrine
factor, PTGER1, involved in inhibition of CD+ cell
proliferation (Figure 5B and Supplementary Table1). Our
data also demonstrate that SR hADSCs exposed to IL-2
trigger down-regulation of transcriptional activities of the
genes encoding surface receptors that play a role in B-cell
proliferation and differentiation (CD72) and homing
macrophages (CD68). Both of these genes are signicantly
transcriptionally up-regulated in senescent cells upon
similar treatment (Figure 5B and Supplementary Table 1).
In addition, IL-2 treated SEN hADSCs are set
apart from similarly treated SR cells by transcriptional
down-regulation of the genes required for pro-B to
pre-B transitioning, the LRRC8A and PEAR1 genes, that
regulate a number of non-adherent myeloid progenitors. In
contrast, the genes involved in lymphocyte activation and
homeostasis (CD83 and TNFRSF25) as well as leukocyte
transmigration (CERCAM), and the genes responsible
for endothelial cell-leukocyte interaction (ESM1), and a
gene important for the control of monocytes/macrophage
mediated immunological process (TNFSF13), are up-
regulated in SEN hADSCs (Figure 5B and Supplementary
Table 1).
These observations, together with IL-2 dependent
differential transcriptional expression of cytokines in
Oncotarget10
www.impactjournals.com/oncotarget
Figure 4: Comparison of gene expression levels between self-renewing and senescence hADSCs upon IL-2 treatment.
A. Hierarchical clustering showing the pairwise distance between conditions based on comparison of condition-specic gene expression
proles. B. Venn diagram showing the numbers of genes, which are up-regulated and down-regulated upon IL-2 treatment. C. & D.
Heatmap showing the expression levels of genes that are up-regulated C. and down-regulated D. upon IL-2 treatment. Normalized gene
expression levels are color coded as shown in the legend (red = high & green = low). Groups correspond to genes that are up- or down-
regulated in SR-only, SEN-only or both conditions.
Oncotarget11
www.impactjournals.com/oncotarget
SEN hADSCs (up-regulation of IL-32, IL-6, PLAU
genes; down-regulation of CCL2, CLEC11A, ILF3,
IRAK3, KIF14, MYL9 genes) and in SR hADSCs (up-
regulation of IL12A, IL7R, IRAK1, NOS3 genes; down-
regulation of IL16, CSF1R genes), indicate that the
putative immunomodulatory properties of hADSCs are
susceptible to senescence imposed changes and suggest
novel biological pathways and gene targets that can be
further explored ex-vivo and in-vivo.
Anti-apoptotic and metastasis promoting
properties of IL-2-primed hADSCs upon
replicative senescence
Another important clinical property of MSCs is the
ability to rescue apoptotic cell death induced by traumatic
exposures to hypoxia, chemicals/acidity, mechanical
damage and radiation. For example, MSCs have been
proven to assist reversal of apoptosis in cardiomyoblasts
after ischemia, as well as damaged neurons and lung
broblasts [37,38]. Recently, stanniocalcin-1 (STC1) was
identied as an essential factor capable of potent apoptotic
reversal in broblasts damaged by UV and acidity [39].
Our data indicate that IL-2 priming transcriptionally
upregulates both STC1 and STC2 genes, and such
activation is not dependent on the replicative aging of
hADSCs, at least ex-vivo (Supplementary Table1). In
addition, paracrine effectors such as VEGF and TGFβ1
have been implicated in the reversal of apoptosis in
endothelial cells [40]. The expression of genes encoding
both of these factors is up-regulated in SR and SEN
hADSCs upon IL-2 treatment (Figure 5C, Figure 6 and
Supplementary Table 1). However, transcriptional activity
of VEGFA is notably higher in senescence then in actively
proliferating cells as further veried by qPCR analysis
shown in Figure 6. Notably, the SIVA1 gene encoding a
pro-apoptotic factor and a potent inducer of T-lymphocytes
apoptosis [41] is signicantly down-regulated in senescent
cells upon IL-2 treatment in comparison to proliferating
hADSCs (Figure 5C and Supplementary Table1). In
addition, recently published data indicate that SIVA1 is not
a strictly pro-apoptotic factor, but also a potent suppressor
of tumor metastasis [42]. Importantly, a number of the
factors responsible for invasive growth and metastasis are
signicantly up-regulated in SEN hADSCs primed with
IL-2 in comparison with similarly treated SR cells (Figure
5C). This includes PLEKHA1, PLEKHA6, CTSB, CRMP1,
FERMT1 genes.
These data indicate that pre-treatment/priming
of hADSCs with IL-2 may enhance the anti-apoptotic
properties of these cells in general, and such enhancement
is effected by replicative senescence, at least in culture. On
the other hand, it should be noted that down-regulation of
specic genes, such as SIVA1 (and probably many others)
and up-regulation of genes encoding potent metastasis-
associated factors in SEN hADSCs, is indicative of a
troublesome phenomenon: IL-2 priming of senescent cells
or exposure of the senescent cells to a pro-inammatory
environment might be critical in shifting the balance
from immunomodulation to an environment promoting
metastatic transformation and invasive growth.
Transcriptional proling suggests gene targets
regulating enhanced migration and angiogenesis
in IL-2 stimulated hADSCs upon replicative
senescence
Further analysis of the transcriptional response
indicates that IL-2 stimulation of senescent hADSCs
profoundly enhances the expression of genes involved
in vascular development and remodeling related to
angiogenesis. We observed drastic up-regulation of
the VEGFA, VEGFB, FBLN5, FBLN7, PGF, ANGPT1,
ANGPT2, ANGPTL2, ANGPTL6, TNFSF12, PRKCA,
PIK3CA, HRAS genes as well as a gene encoding a
potent modulator of endothelial cell-leukocyte adhesion,
ESM1 (Figure 5D, Table 1 and Supplementary Table 1).
The vascular endothelial growth factor, VEGF, released
by MCSs enables recruitment of endothelial lineage
cells and initiation of vascularization as was previously
reported [43]. We have further demonstrated that up-
regulation of VEGFA gene expression in SEN hADSCs
can be detected by quantitative RT-PCR analysis and
IL-2 priming results in a statistically signicant increase
of VEGFA gene transcription in SR and SEN hADSCs
(Figure 6). Interestingly, we further observed that in
response to IL-2 priming, a group of genes responsible
for cell motility, migration and invasive growth are
drastically up-regulated only in the hADSCs undergoing
replicative senescence: CGNL1, CGREF1, CRMP1,
FGD6, TNK2, PTGS1, TNFAIP8, CTSB, CTSO, FAP,
FERMT1, PLEKHA1, PLEKHA6, ROCK1, ROCK2. In
concert with this observation, our data indicate that a
set of genes promoting cell adhesion, such as CHD24,
CYR61, ILK, NEDD9, MYL9, PPAP2B, RELN and TLN2
are down-regulated (Figure 5D and Supplementary Table
1). These data further support the experimental evidence
for the enhanced migration capacity of senescent hADSCs
shown in Figure 1C and Figure 1D.
Equally important, IL-2 priming results in the
differential expression of a number of cytokines and
factors critical for chemotaxis (shown in Figure 5B). For
instance, SR hADSCs are marked by up-regulation of
IL-33, IL-12A, IL10RB, IL1RAP, IL7R, ILF2 and NOS3
genes, while IL-16 and CSF1R genes are down-regulated
in these cells. In SEN hADSCs treated under similar
conditions with IL-2, the genes encoding cytokines IL-32,
IL-6, IL1RN, IL20RB, IL21R and inducers of inammation
TNFSF13 and TNFSF12, as well as the gene encoding
extracellular matrix remodeler PLAU are up-regulated
Oncotarget12
www.impactjournals.com/oncotarget
Figure 5: Gene expression levels for self-renewing and senescence hADSCs upon IL-2 treatment among functionally
coherent sets of genes. Expression levels are shown for sets of genes characterized as A- trophic factors, B- anti-inammatory and
immunomodulatory, C- anti-apoptotic and metastasis promoting, and D. migration and angiogenesis promoting. Normalized gene
expression levels are color coded as shown in the legend (red = high & green = low).
Oncotarget13
www.impactjournals.com/oncotarget
(Table 1 and Supplementary Table 1). At the same time,
several factors that are essential for cytokinesis such
as MYL9, KIF14, IRAC3, as well as the gene encoding
chemotactic factor that attracts monocytes and basophils
(CCL2) and the CLEC11A gene regulating proliferation
and differentiation of hematopoietic precursor cells, are
down-regulated (Figure 5B). Similar down-regulation is
also found for several interleukin receptor encoding genes
IL7R, IL1R1, IL15RA, and interleukin enhancer binding
factors ILF2 and ILF3. Interestingly, TNFSF13(APRIL), a
novel death-inducing secreted ligand, has been previously
reported as both a cell proliferation-inducing [44] and cell
death triggering ligand [45], thus cautioning that the role
of the individual factors should be further investigated in
a context-dependent manner.
All together, these data support the hypothesis
that senescent mesenchymal stem cells, when subjected
to inammatory environment, might have decreased
retention at the delivery site due to increased mobility.
These same senescent cells may also play a role in tumor
progression by promoting angiogenesis and metastasis.
Our data also point to numerous biological targets
critical for these events that can be prioritized for further
experimental studies with in-vivo models and in clinical
settings.
DISCUSSION
hADSCs are currently one of the primary sources
of stem cells with direct clinical relevance [46]. Human
MSCs may be able to both sense and respond to their
immediate environment, which make these cells ideal to
tune the response to injury and/or inammation. It has
been rightfully suggested that MSCs should be called
Medicinal Signaling Cells as it was suggested in [47, 48].
The emerging evidence from studies of autoimmune
disorders and models of tumorigenesis indicates that the
immunomodulatory properties of adult mesenchymal
stem cells can be susceptible to the presence of IL-2 in
an inammatory environment [49]. In addition, MSCs
themselves can produce therapeutic cytokines, such
as IFN-β [50] and interleukin-2 [51, 52] to provide for
benecial anti-tumor effects. IL-2 is a potent cytokine that
is also proven to boost the immune system to ght cancer.
There are several FDA approved therapies currently on the
market that make use of IL-2 to ght metastatic melanoma
and renal cell carcinoma [53]. However, intravenous
administration of IL-2 may have an impact on numerous
tissues and organs in the body, including MSCs. Indeed,
recent data indicate that MSCs in general, and MSCs
derived from the adipose tissue, in particular, possess an
Figure 6: Interleukin-2 upregulates transcription of the VEGFA gene upon replicative senescence of hADSCs. VEFGA
gene expression was assessed by quantitative qPCR in unstimulated (IL-2-) senescent (red) and self-renewing (blue) hADSCs and upon
stimulation with 20ug/ml of recombinant IL-2 ( IL-2+). Data shown as fold change ΔΔCT Mean ± SD from three independent experiments
is show. The position of the q-PCR primers are depicted graphically. Statistical signicance was estimated by t - test, where ***p < 0.001,
**p < 0.01.
Oncotarget14
www.impactjournals.com/oncotarget
intrinsic preferential property to migrate actively toward
some tumor types upon their systemic administration [54-
56]. What remains unclear is how adult mesenchymal stem
cells may be affected by therapeutic doses of IL-2 and
what, if any, changes in transcriptional outcomes occur
with aging in response to IL-2 signaling. Our genome-
wide transcriptomic analysis of hADSCS subjected to IL-2
exposure/priming ex-vivo demonstrates that senescence
of stem cells substantially effects their transcriptional
response.
IL-2 signals via specic receptors, with three classes
of cell surface receptors formed by various combinations
of three IL-2R subunits: IL2Rα (CD25), IL2Rβ (CD122)
and IL2Rγ (CD132) [57]. Our experimental results
indicate that hADSCs transcriptionally express all three
receptors, however protein expression of the IL2Rα
in hADSCs is far lower than seen for IL2Rβ. These
observations suggest that an IL-2 receptor composition
consisting of IL2Rβ and IL2Rγ isoforms might mediate
the predominant form of IL-2 cytokine recognition
by hADSCs. The receptor composition changes only
slightly upon replicative aging of the hADSCs (Figure 2),
indicating that responsiveness of hADSCs to IL-2 does
not change upon their senescence. Alternatively, a slight
increase in membrane-bound IL2Rα upon replicative
senescence may reect the activation state or ability to
trans-present IL2Rα rather than responsiveness to IL-
2, similar to what was previously reported for myeloid
dendritic cells [58]. In our current study, we cannot
discriminate between these events. In addition, our data
also point out to the interesting phenomenon, that the
production of IL2Rα drastically declines on transcriptional
level with replicative senescence of adipose-derived
MSCs. In accord with a previous report that in addition
to cell surface IL-2Rα, IL-2Rα can exist in a soluble
form (sIL-2Rα), which could be released from the cell
surface [59], we speculate that our data might provide an
indication of a less available soluble form of IL2Rα upon
replicative aging of hADSCs.
In our current study, we also attempted to interrogate
biochemical gene signaling networks activated in IL-2
primed SR and SEN hADSCs in order to gain insights into
impact of the replicative senescence on adipose-derived
MSCs function. Differential gene expression analysis,
comparing IL-2 treated versus untreated SR and SEN cells,
allowed us to uncover a number of individual genes that
are up- or down-regulated upon IL-2 stimulation. However,
the biological response to IL-2 treatment of hADSCs is
not likely to be orchestrated by individual genes acting
alone. Rather, this response is more likely to be based
on multiple co-regulated genes that function together in
integrated pathways. Furthermore, the biological pathways
that are affected by IL-2 treatment are also likely to be
functionally interconnected in the sense that they work
together to execute cellular responses to stimulation by IL-
2. We analyzed genes designated as up- or down-regulated
in IL-2 treated SR and SEN hADSCs using an integrated
gene-set enrichment and pathway network approach in an
attempt to capture the biological reality of coordinated
cellular responses to IL-2 stimulation. To do this, we rst
identied pathways that were statistically enriched for
up- or down-regulated genes, and then we related these
pathways based on the differentially expressed genes
that they have in common (Table 1 and Table 2). We also
weighted the pathway network representation based on the
numbers of differentially expressed genes in each pathway
and the extent to which different pathways share sets of
differentially expressed genes. This approach allowed
us to elucidate a highly connected network structure
with numerous functionally related pathways as well as
functionally relevant network substructures.
Notably, upon senescence of hADSCs IL-2 is less
stimulatory for the gene pathways promoting proliferation
(cell cycle pathway, q-value = 1.54 e-5), imposing
G2 checkpoint (G2 pathway, q-value = 5.94e-4), p53
pathway (q-value = 1.18e-2), major signal transduction
MAPK pathway (MAPK, q-value = 2.42e-4) and its
major subgroup ERK pathway (ERK, q-value = 2.62e-
2), which regulate important cellular function such as
survival, migration and proliferation [60]. Our analysis
further corroborates the previous nding that PDGF-
induced AKT and ERK pathways regulate opposing fate
decisions of proliferation and differentiation in order to
promote MSC self-renewal [61]. Activation of the genes
representing these pathways was observed only after
ex-vivo IL-2 priming of actively self-renewing human
ADSCs but not their senescent counterparts (Table
1, left side). Apparently, a different arm of the AKT
pathway (including up-regulated FOXO1, FOXO3 and
FOXO4 genes) acts upon exposure of SEN hADSCs to
inammatory environment (Table 1, right side), which
could potentially be tumorigenic. The AKT pathway may
be important to promote IL-6 secretion (both the gene and
its biological pathway targets are transcriptionally up-
regulated in senescence Table1 and Figure 5B), which in
turn has been shown to contribute to the establishment of
the inammatory environment and promote the resistance
of broblasts to apoptosis [62-64].
Our data also provide insights into the functionality
of MSCs in carcinogenic settings. Both SR and SEN
hADSCs primed by IL-2 are marked by drastic increases in
expression of transforming growth factors alpha and beta
(TGF
α
, TGFβ1 and TGFβ2), transforming growth factor
beta receptor TGFBR2 and transforming growth factor
beta receptor-associated protein TGFBRAP1, as well as
transforming growth factor beta-induced (TGFBI) genes
(Figure 5A). Secreted TGFβ is believed to be important
in regulation of the immune system by promoting
differentiation of CD4+ T-cells and inhibiting immune-
surveillance, thereby imposing immunosuppression [65].
However, the higher level of TGFβ expression in hADSCs
after exposure to IL-2 might promote carcinogenesis.
Oncotarget15
www.impactjournals.com/oncotarget
Since parts of the TGFβ signaling pathway are shown to
be mutated in cancer cells (see for the details in [66]), this
allows cancer cells to escape TGFβ-induced cell cycle
block, differentiation or apoptosis, while the surrounding
stromal, immune, endothelial and smooth muscle cells
still read the TGFβ signaling as a potent suppressor
of proliferation and trigger of differentiation causing
immunosuppression and angiogenesis in the cancer cell
microenvironment. Cancer cells exploit this environmental
condition to their advantage. In the absence of the
effector T-cells, which normally attack cancer, cancer
cells become more invasive [66-68]. Based on these
observations, we speculate that therapeutic delivery of
MSCs subjected either to prolonged expansion in culture,
or into the patients burdened by chronic inammation,
are likely to create a microenvironment conducive to
cancer progression and metastasis. Similarly, systemic
administration of IL-2 as the treatment for cancer [69,70]
should take into consideration the age of the patient, since
aging might diminish MSCs similar to what is seen for
their ex-vivo replicative aging.
In support of this hypothesis, in IL-2 treated SEN
hADSCs prominent up-regulated genes are enriched for
pathways associated with inammation (IL-6 pathway,
q-value = 5.55e-3) and EGF signaling (q-value = 2.33e-
4) that have been proven to provide a survival advantages
to mesenchymal stem cells [71]. The SEN hADSCs
primed with IL-2 are also marked by increased expression
of IL-1β, IL-6 and IL-12 (Figure 5B), cytokines known
to stimulate IL-17 from lymphocytes [72-74]. Our
data also indicate that lymphocytes are the only source
of IL-17D production, and those mesenchymal stem
cells, particularly upon their senescence, display high
transcriptional activity of IL-17 when subjected to a pro-
inammatory environment (Figure 5A). We hypothesize
that the MCS-derived IL-17D together with MCS-derived
CSF-1 might induce systemic neutrophil expansion and
macrophages inltration similar to studies indicating
a critical role for these factors in promoting cancer
progression and metastasis [75-77] as well as in a number
of inammatory diseases including psoriasis [73].
The observed connection to the angiogenic VEGF
pathway (q-value = 5.24e-3) (Table 1, right side and
Figure 5D) and the enhanced capacity of SEN hADSCs to
migration (Figure 1C, 1D) may suggest that IL-2 primed
SEN mesenchymal stem cells could acquire properties
necessary to support a tumorigenic environment and
metastasis. In addition, up-regulation of the genes included
in nitric oxide synthase pathway (iNOS) NOS1 pathway
(q-value = 8.32e-2) in hADSC upon replicative senescence
once again support the hypothesis that mesenchymal stem
cells undergoing senescence can acquire metastasis-
promoting properties via immunosuppression.
In the current study, we further corroborated that
aging poses a signicant threat to adult MSC function
[78-80] [7] by providing evidence that critical pathways
essential for support of proliferation and DNA repair are
down-regulated in hADCSs upon senescence: Cell Cycle
pathway (q-value = 2.52e-5), MCM pathway (q-value =
1.62e-8), RB pathway (q-value = 6.97e-5) ATM pathway
(q-value = 3.28e-2), p53 pathway (q-value = 1.86 e-2)
shown in Table 2. Overall, our data indicate that there
are more biological pathways subjected to IL-2 triggered
down-regulation in senescence then in self-renewal and
these biological pathways are interconnected (Table 2),
further linking together a physiological impairment of
IL-2 response upon replicative aging of hADSCs, thus
suggesting that such impairment might be an integral to
adipose-derived stem cell deviated function in vivo and
upon clinical applications.
Our results, in concert with previously published
data, should raise awareness that replicative aging
of adult adipose-derived stem cells can impair their
immunomodulatory, angiogenic and antioxidative
functions, and in part, can explain several contradicting
studies related to either tumor-promoting [81-83] or
tumor-suppressive properties [55,84] of adipose-derived
MSCs. Our data also help to dene biological pathways
and gene targets for in depth exploration of functional
activities of adipose-derived MSC therapeutic approaches
and further renement of their application in clinical
settings.
MATERIALS AND METHODS
Isolation, culture and characterization of MSCs
MSCs used in this research were isolated from
human adipose tissues obtained from healthy adult female
donors age 32 and 45 undergoing routine liposuction
procedures at the UCSD medical center, San Diego, CA.
The MSC isolation protocol was approved by the local
ethics committee and performed as previously described
[7]. Isolated adipose-derived stem cell lines were grown in
DMEM/F12 medium (Life Technologies). In accordance
with the MSC minimal denition criteria set by the
International Society for Cellular Therapy [85], ow
cytometric analysis showed that hADSCs express CD29,
CD73, CD90 and CD105 but do not express CD11b,
CD14, CD19, CD34, CD45, CD80, CD86 (antibodies
from eBiosciense, USA). Morphological analysis showed
that the cells present a broblast-like morphology, were
plastic adherent and capable of adipogenic, chondrogenic
and osteogenic differentiation under in vitro conditions
using commercially available differentiation mediums
(Invitrogen, USA). Cumulative population doublings
(PD) were calculated as PD = log(N/N0) x 3.33 across
the multiple passages as a function of the number of days
of growth in culture as described in [7], where N0 is the
number of cells plated in the ask and N is the number
Oncotarget16
www.impactjournals.com/oncotarget
of cells harvested at this passage. hADSCs PD 4 or PD 6
for self-renewing populations (SR) and PD 41 and 38 for
senescent populations (SEN) were used in all experiments.
Treatment with recombinant IL-2 (Peprotech, USA) was
performed as described in [86]. 20U/ml of IL-2 was added
to the culturing media for 24 hours at 37oC.
Senescence–associated SA-β galactosidase assay
The assay for monitoring the expression of pH-
dependent senescence-associated β-galactosidase activity
(SA-βGal) was performed as described in manufacturer’s
kit (BioVision) and previously published in [7]. The
cultured hADSCs were xed with xative solution for
15 minutes at room temperature, washed with twice
with PBS and stained with X-Gal containing supplement
overnight at 37°C. The cells were washed twice with PBS,
and the images were captured using a microscope (Nikons,
TE300, DXM1200 Digital Camera, Japan).
Migration and invasion assay
Transwell lters were from Corning Incorporated
(Acton, MA, USA) and all the cytokines in use were
obtained from Peprotech Inc. (Rocky Hill, NJ, USA).
The migration assay was performed as described in [27]
using 8mm thick Transwell chambers. For the Transwell
migration assay, 1.0 x 104 cells were suspended in 80μl
of serum-free α-MEM and seeded in the upper chamber
of 24-well Transwell plates containing 8 mm pore size
lters (Corning, Costar, USA). In the lower chamber, 600
μl of DMEM or medium containing cytokines: IL-2, IL-
6, IL-8, TNF-α, HMGβ1 was added. The concentrations
used were: 50ng/ml IL-2, IL-6, IL-8 and HMGβ1; 30ng/
ml TNF-α as described in [27]. hADSCs were incubated
at 37°C for 16h. The cells retained in the upper chamber
were removed by swab and those that had migrated
through the lter were xed with 4% paraformaldehyde
for 20 minutes at room temperature and stained overnight
with 5% toluidine blue. The cells were counted at the
lower side; in ve different randomly selected 10x elds
using a bright-eld microscope (NikonTE300, DXM1200
Digital Camera, Japan). These experiments were done
with hADSCs of two female donors age 32 and 45, either
self-renewing (SR) or senescent (SEN) populations, with
each donor sampled more than three times.
Enzyme-linked immunosorbent assays (ELISA)
hADSCs (SR or SEN) were plated at a density of
105 cells per 10 cm2 dish and treated with 20 U/mL of
IL-2 for 24 hour, with untreated controls as previously
described in [86]. Then, cell membrane-associated protein
fractions were prepared using Mem-PER Plus #89842
(ThermoFisher Scientic) following the manufacturer’s
protocol. Measurements of the concentrations of IL-2
receptors alpha and beta were obtained using human
IL-2R alpha and human IL-2R beta ELISA kits #ELH-
IL2Ra and #ELH-IL2Rb (RayBiotech, Inc) respectively.
The optical densities for the standards (recombinant IL-2
receptors alpha and beta) as well as the experimental
samples were measured at 450 nm by SPECTRA Max Plus
(Molecular Devices) and concentrations were calculated
as described in the manufacturer’s protocol.
Real-time quantitative polymerase chain reaction
Total RNA was isolated from hADSCs using the
RNeasy Mini Kit (Qiagen, Germany). cDNA was then
synthesized using the RevertAid First Strand cDNA
Synthesis Kit (Fermentas, USA). Real-time quantitative
polymerase chain reaction (qPCR) was performed using
TaqMan instrument. The expression levels were calculated
as 2− ∆∆Ct, where relative expression was determined by
normalization to beta-actin gene expression. All assays
were conducted in triplicates and negative control samples
without cDNA were used.
IL-2 Receptor Alpha chain (IL2Rα) For: 5’-
CTGCCACTCGGAACACAAC-3’ and Rev: 5’-
TGGTCCACTGGCTGCATT-3’.
IL-2 Receptor Beta chain (IL2Rβ) For: 5’-
ACTCGAGAGCCAACATCTCC-3’ and Rev: 5’-
TCCGAGGATCAGGTTGCAG-3’.
IL-2 Receptor Gamma 1 chain (IL2Rγ1) For:
5’- TGGATGGGCAGAAACGCTA-3’ and Rev: 5’-
GGCTTCCAATGCAAACAGGA-3’.
STAT 5A For: 5’- ACGCAGGACACAGAGAATGA
-3’
and Rev: 5’- CTGGGCAAACTGAGCTTGG-3’.
STAT 5B For: 5’- ACACAGCTCCAGAACACGT
-3’ and
Rev: 5’- TGTTGGCTTCTCGGACCAA-3’.
VEGF A For: 5’- GGAGGAGGGCAGAATCATCA
-3’ and
Rev: 5’- ATCAGGGGCACACAGGATG-3’.
Transcriptomic analysis
Transcriptomic analysis was performed with
IL-2 treated and untreated (control group) SR and SEN
hADSCs as previously described in [86]. The two
genotypes shown in Figure 1A were used for the analysis
of four different conditions: self-renewal (SR), replicative
senescence (SEN) without or with IL-2 stimulation
respectively. Cells were seeded in DMEMF12 (106)
media for each experimental condition, and IL-2 treatment
was performed by adding 20U/ml of recombinant IL-2
(Peprotech, USA) directly into the media for 24 hours
as previously described in [86]. Total RNA was isolated
Oncotarget17
www.impactjournals.com/oncotarget
from samples using TRIzol reagent (Invitrogen, USA)
according to the manufacturer’s instructions. Samples
from two different patients were combined together for
the relevant conditions and RNA concentrations were
measured with the Qubit 2.0 uorometer using the RNA
HS Assay kit (Invitrogen, Life technologies, USA).
100ng of total RNA from each sample was used to
construct the libraries for sequencing on the Ion Proton
TM
System (Life technologies, USA) following manufacturers
instructions. Prior to rRNA depletion and RNA-seq
library construction, the ERCC RNA Spike-In Control
mix (Ambion, Life Technologies) was added to total RNA
for quality control analysis. The ERCC RNA Spike-In
control mix contains 92 transcripts 250-2000 nt in length
that mimic natural eukaryotic mRNAs. According to the
protocol provided by manufacturer, for 100 ng of total
RNA was added to 2ul of Mix1 in dilution 1:1000 of
spike-in. Afterwards, rRNA depletion was performed with
the Low Input Ribominus Eukaryote System v2 (Ambion,
Life technologies, USA). cDNA libraries were constructed
with Ion total RNA-seq kit v2 (Ambion, Life technologies,
USA), and barcoded with Ion Xpress RNA-seq barcode
(Ambion, Life technologies). The size distribution and
quantication of the libraries were performed on a
Bioanalyzer 2100 (Agilent technologies, USA). Library
sequencing was performed on the Ion ProtonTM System
with P1 chip, and each library was sequenced 3 times.
RNA-seq data analysis
RNA-seq reads from individual Ion ProtonTM
System sequencing runs were combined for each of
the four libraries. Sequence reads were mapped to the
reference human genome assembly hg19 (GRCh37)
using the Torrent Mapping Alignment Program (TMAP,
Life technologies). The quality of the four condition-
specic combined RNA-seq runs was evaluated by
comparing the expected counts of ERCC spike-in RNA
sequences, obtained from the manufacturer’s website,
against the observed counts of RNA-seq tags that map
to the same sequences (Supplementary Figure 2). Initial
gene expression levels were taken as the sum of exon-
mapped reads for individual NCBI RefSeq gene models
(c), and lowly expressed genes (read counts per million
< 1) were removed from subsequent analyses. For each
library, individual gene expression levels were normalized
using the beta-actin (ACTB) expression levels (cACTB)
and the total exon length l of each gene. For library j,
the beta-acting normalization factor sj was calculated
as , and the nal normalized
expression value for gene i in library j was calculated as
. Differential gene expression analysis
between pairs of libraries was performed using the
program GFOLD v1.1.3 [87]. GFOLD was chosen based
on its demonstrated superior performance in characterizing
differentially expressed genes in the absence of replicate
data sets. GFOLD analysis yields a score that measures the
extent of differential gene expression between conditions;
the recommended GFOLD score cut-off of ±0.01 was used
to dene differentially expressed genes here. Functional
enrichment analysis for differentially expressed genes
between pairs of libraries was performed using the
program GSEA v2.1.0 [88]. Specically, individual
pathways containing multiple genes that are up-regulated
or down-regulated upon IL-2 treatment in SR, SEN or
both were identied using GSEA. Individual pathways
for specic sets of differentially regulated genes (IL-2+
up-regulated in SR and/or SEN and IL-2+ down-regulated
in SR and/or SEN) were related using networks where the
nodes correspond to pathways and the edges correspond to
the presence of shared genes between pathways.
ACKNOWLEDGMENTS
LM and BGG was supported by grants from
the Spanish Ministry of Science and Innovation (SAF
2010-15239) to BGG and. LMP are supported by
FPI fellowships from the Spanish Ministry, and BGG
acknowledges support from the “Ramon y Cajal” tenure
track programme from the Spanish Ministry of Science
and Innovation (RYC2009-04669). AS and AA are fellows
of Bolashak International Scholarship, AA, AN, AS are
sponsored by KazNMU sponsored program.
CONFLICTS OF INTEREST
There is no conict of interest.
REFERENCES
1. Singer NG, Caplan AI (2011) Mesenchymal stem cells:
mechanisms of inammation. Annual review of pathology
6: 457-478.
2. Kim YY, Ku SY, Huh Y, Liu HC, Kim SH, et al. (2013)
Anti-aging effects of vitamin C on human pluripotent stem
cell-derived cardiomyocytes. Age (Dordr) 35: 1545-1557.
3. Murphy MB, Moncivais K, Caplan AI (2013) Mesenchymal
stem cells: environmentally responsive therapeutics for
regenerative medicine. Exp Mol Med 45: e54.
4. Kuilman T, Michaloglou C, Mooi WJ, Peeper DS (2010)
The essence of senescence. Genes Dev 24: 2463-2479.
5. Duggal S, Brinchmann JE (2011) Importance of serum
source for the in vitro replicative senescence of human bone
marrow derived mesenchymal stem cells. J Cell Physiol
226: 2908-2915.
6. Wagner W, Horn P, Castoldi M, Diehlmann A, Bork S, et
al. (2008) Replicative senescence of mesenchymal stem
Oncotarget18
www.impactjournals.com/oncotarget
cells: a continuous and organized process. PLoS One 3:
e2213.
7. Wang J, Geesman GJ, Hostikka SL, Atallah M, Blackwell
B, et al. (2011) Inhibition of activated pericentromeric
SINE/Alu repeat transcription in senescent human adult
stem cells reinstates self-renewal. Cell cycle 10: 3016-3030.
8. Tollervey JR, Lunyak VV (2011) Adult stem cells: simply a
tool for regenerative medicine or an additional piece in the
puzzle of human aging? Cell Cycle 10: 4173-4176.
9. Estrada JC, Torres Y, Benguria A, Dopazo A, Roche E,
et al. (2013) Human mesenchymal stem cell-replicative
senescence and oxidative stress are closely linked to
aneuploidy. Cell Death Dis 4: e691.
10. O’Cearbhaill ED, Punchard MA, Murphy M, Barry FP,
McHugh PE, et al. (2008) Response of mesenchymal stem
cells to the biomechanical environment of the endothelium
on a exible tubular silicone substrate. Biomaterials 29:
1610-1619.
11. Bai L, Lennon DP, Caplan AI, DeChant A, Hecker J, et al.
(2012) Hepatocyte growth factor mediates mesenchymal
stem cell-induced recovery in multiple sclerosis models.
Nat Neurosci 15: 862-870.
12. Holgate ST, Davies DE, Lackie PM, Wilson SJ,
Puddicombe SM, et al. (2000) Epithelial-mesenchymal
interactions in the pathogenesis of asthma. J Allergy Clin
Immunol 105: 193-204.
13. Chen PM, Liu KJ, Hsu PJ, Wei CF, Bai CH, et al. (2014)
Induction of immunomodulatory monocytes by human
mesenchymal stem cell-derived hepatocyte growth factor
through ERK1/2. J Leukoc Biol 96: 295-303.
14. Uccelli A, Moretta L, Pistoia V (2008) Mesenchymal stem
cells in health and disease. Nat Rev Immunol 8: 726-736.
15. Ben-Ami E, Berrih-Aknin S, Miller A (2011) Mesenchymal
stem cells as an immunomodulatory therapeutic strategy for
autoimmune diseases. Autoimmun Rev 10: 410-415.
16. Ichim TE, Alexandrescu DT, Solano F, Lara F, Campion
Rde N, et al. (2010) Mesenchymal stem cells as anti-
inammatories: implications for treatment of Duchenne
muscular dystrophy. Cell Immunol 260: 75-82.
17. Yi T, Song SU (2012) Immunomodulatory properties of
mesenchymal stem cells and their therapeutic applications.
Arch Pharm Res 35: 213-221.
18. Ren G, Zhang L, Zhao X, Xu G, Zhang Y, et al. (2008)
Mesenchymal stem cell-mediated immunosuppression
occurs via concerted action of chemokines and nitric oxide.
Cell Stem Cell 2: 141-150.
19. Glennie S, Soeiro I, Dyson PJ, Lam EW, Dazzi F (2005)
Bone marrow mesenchymal stem cells induce division
arrest anergy of activated T cells. Blood 105: 2821-2827.
20. Aggarwal S, Pittenger MF (2005) Human mesenchymal
stem cells modulate allogeneic immune cell responses.
Blood 105: 1815-1822.
21. Benvenuto F, Ferrari S, Gerdoni E, Gualandi F, Frassoni
F, et al. (2007) Human mesenchymal stem cells promote
survival of T cells in a quiescent state. Stem Cells 25: 1753-
1760.
22. Xue Q, Luan XY, Gu YZ, Wu HY, Zhang GB, et al. (2010)
The negative co-signaling molecule b7-h4 is expressed by
human bone marrow-derived mesenchymal stem cells and
mediates its T-cell modulatory activity. Stem Cells Dev 19:
27-38.
23. Zhu Y, Liu T, Song K, Fan X, Ma X, et al. (2008) Adipose-
derived stem cell: a better stem cell than BMSC. Cell
Biochem Funct 26: 664-675.
24. Puissant B, Barreau C, Bourin P, Clavel C, Corre J, et al.
(2005) Immunomodulatory effect of human adipose tissue-
derived adult stem cells: comparison with bone marrow
mesenchymal stem cells. Br J Haematol 129: 118-129.
25. Yanez R, Lamana ML, Garcia-Castro J, Colmenero
I, Ramirez M, et al. (2006) Adipose tissue-derived
mesenchymal stem cells have in vivo immunosuppressive
properties applicable for the control of the graft-versus-host
disease. Stem Cells 24: 2582-2591.
26. Sohni A, Verfaillie CM (2013) Mesenchymal stem cells
migration homing and tracking. Stem Cells Int 2013:
130763.
27. Perez LM, Bernal A, San Martin N, Galvez BG (2013)
Obese-derived ASCs show impaired migration and
angiogenesis properties. Arch Physiol Biochem 119: 195-
201.
28. Galvez BG, San Martin N, Rodriguez C (2009) TNF-alpha
is required for the attraction of mesenchymal precursors to
white adipose tissue in Ob/ob mice. PLoS One 4: e4444.
29. David D, Bani L, Moreau JL, Demaison C, Sun K, et al.
(1998) Further analysis of interleukin-2 receptor subunit
expression on the different human peripheral blood
mononuclear cell subsets. Blood 91: 165-172.
30. Amu S, Gjertsson I, Brisslert M (2010) Functional
characterization of murine CD25 expressing B cells. Scand
J Immunol 71: 275-282.
31. Clausen J, Vergeiner B, Enk M, Petzer AL, Gastl G, et al.
(2003) Functional signicance of the activation-associated
receptors CD25 and CD69 on human NK-cells and NK-like
T-cells. Immunobiology 207: 85-93.
32. Simon HU, Plotz S, Simon D, Seitzer U, Braathen LR, et
al. (2003) Interleukin-2 primes eosinophil degranulation in
hypereosinophilia and Wells’ syndrome. Eur J Immunol 33:
834-839.
33. Lin JX, Leonard WJ (2000) The role of Stat5a and Stat5b
in signaling by IL-2 family cytokines. Oncogene 19: 2566-
2576.
34. Liao W, Lin JX, Wang L, Li P, Leonard WJ (2011)
Modulation of cytokine receptors by IL-2 broadly regulates
differentiation into helper T cell lineages. Nat Immunol 12:
551-559.
35. Mahmud SA, Manlove LS, Farrar MA (2013) Interleukin-2
and STAT5 in regulatory T cell development and function.
JAKSTAT 2: e23154.
Oncotarget19
www.impactjournals.com/oncotarget
36. Haynesworth SE, Baber MA, Caplan AI (1996) Cytokine
expression by human marrow-derived mesenchymal
progenitor cells in vitro: effects of dexamethasone and IL-1
alpha. J Cell Physiol 166: 585-592.
37. Cselenyak A, Pankotai E, Horvath EM, Kiss L, Lacza Z
(2010) Mesenchymal stem cells rescue cardiomyoblasts
from cell death in an in vitro ischemia model via direct cell-
to-cell connections. BMC Cell Biol 11: 29.
38. Kim SY, Lee JH, Kim HJ, Park MK, Huh JW, et al. (2012)
Mesenchymal stem cell-conditioned media recovers lung
broblasts from cigarette smoke-induced damage. Am J
Physiol Lung Cell Mol Physiol 302: L891-908.
39. Block GJ, Ohkouchi S, Fung F, Frenkel J, Gregory C,
et al. (2009) Multipotent stromal cells are activated to
reduce apoptosis in part by up-regulation and secretion of
stanniocalcin-1. Stem Cells 27: 670-681.
40. Rehman J, Traktuev D, Li J, Merfeld-Clauss S, Temm-
Grove CJ, et al. (2004) Secretion of angiogenic and
antiapoptotic factors by human adipose stromal cells.
Circulation 109: 1292-1298.
41. Py B, Slomianny C, Auberger P, Petit PX, Benichou
S (2004) Siva-1 and an alternative splice form lacking
the death domain, Siva-2, similarly induce apoptosis in
T lymphocytes via a caspase-dependent mitochondrial
pathway. J Immunol 172: 4008-4017.
42. Mei Y, Wu M (2012) Multifaceted functions of Siva-1:
more than an Indian God of Destruction. Protein Cell 3:
117-122.
43. Chen L, Tredget EE, Wu PY, Wu Y (2008) Paracrine
factors of mesenchymal stem cells recruit macrophages and
endothelial lineage cells and enhance wound healing. PLoS
One 3: e1886.
44. Hahne M, Kataoka T, Schroter M, Hofmann K, Irmler M, et
al. (1998) APRIL, a new ligand of the tumor necrosis factor
family, stimulates tumor cell growth. J Exp Med 188: 1185-
1190.
45. Kelly K, Manos E, Jensen G, Nadauld L, Jones DA (2000)
APRIL/TRDL-1, a tumor necrosis factor-like ligand,
stimulates cell death. Cancer Res 60: 1021-1027.
46. Kucerova L, Altanerova V, Matuskova M, Tyciakova
S, Altaner C (2007) Adipose tissue-derived human
mesenchymal stem cells mediated prodrug cancer gene
therapy. Cancer Res 67: 6304-6313.
47. Caplan AI, Correa D (2011) The MSC: an injury drugstore.
Cell Stem Cell 9: 11-15.
48. Caplan AI (2010) What’s in a name? Tissue Eng Part A 16:
2415-2417.
49. Ben-Ami E, Miller A, Berrih-Aknin S (2014) T cells
from autoimmune patients display reduced sensitivity to
immunoregulation by mesenchymal stem cells: role of IL-
2. Autoimmun Rev 13: 187-196.
50. Studeny M, Marini FC, Champlin RE, Zompetta C, Fidler
IJ, et al. (2002) Bone marrow-derived mesenchymal stem
cells as vehicles for interferon-beta delivery into tumors.
Cancer Res 62: 3603-3608.
51. Nakamura K, Ito Y, Kawano Y, Kurozumi K, Kobune M,
et al. (2004) Antitumor effect of genetically engineered
mesenchymal stem cells in a rat glioma model. Gene Ther
11: 1155-1164.
52. Stagg J, Lejeune L, Paquin A, Galipeau J (2004)
Marrow stromal cells for interleukin-2 delivery in cancer
immunotherapy. Hum Gene Ther 15: 597-608.
53. Schwartzentruber DJ (2001) Guidelines for the safe
administration of high-dose interleukin-2. J Immunother
24: 287-293.
54. Nakamizo A, Marini F, Amano T, Khan A, Studeny M, et
al. (2005) Human bone marrow-derived mesenchymal stem
cells in the treatment of gliomas. Cancer Res 65: 3307-
3318.
55. Khakoo AY, Pati S, Anderson SA, Reid W, Elshal MF,
et al. (2006) Human mesenchymal stem cells exert potent
antitumorigenic effects in a model of Kaposi’s sarcoma. J
Exp Med 203: 1235-1247.
56. Hung SC, Deng WP, Yang WK, Liu RS, Lee CC, et al.
(2005) Mesenchymal stem cell targeting of microscopic
tumors and tumor stroma development monitored by
noninvasive in vivo positron emission tomography imaging.
Clin Cancer Res 11: 7749-7756.
57. Robb RJ, Munck A, Smith KA (1981) T cell growth
factor receptors. Quantitation, specicity, and biological
relevance. J Exp Med 154: 1455-1474.
58. Driesen J, Popov A, Schultze JL (2008) CD25 as an immune
regulatory molecule expressed on myeloid dendritic cells.
Immunobiology 213: 849-858.
59. Rubin LA, Galli F, Greene WC, Nelson DL, Jay G (1990)
The molecular basis for the generation of the human soluble
interleukin 2 receptor. Cytokine 2: 330-336.
60. Rosova I, Dao M, Capoccia B, Link D, Nolta JA (2008)
Hypoxic preconditioning results in increased motility and
improved therapeutic potential of human mesenchymal
stem cells. Stem Cells 26: 2173-2182.
61. Gharibi B, Ghuman MS, Hughes FJ (2012) Akt- and Erk-
mediated regulation of proliferation and differentiation
during PDGFRbeta-induced MSC self-renewal. J Cell Mol
Med 16: 2789-2801.
62. Gehmert S, Wenzel C, Loibl M, Brockhoff G, Huber M, et
al. (2014) Adipose tissue-derived stem cell secreted IGF-1
protects myoblasts from the negative effect of myostatin.
Biomed Res Int 2014: 129048.
63. Mitsiades CS, Mitsiades N, Poulaki V, Schlossman R,
Akiyama M, et al. (2002) Activation of NF-kappaB and
up-regulation of intracellular anti-apoptotic proteins via
the IGF-1/Akt signaling in human multiple myeloma cells:
therapeutic implications. Oncogene 21: 5673-5683.
64. Gnecchi M, He H, Noiseux N, Liang OD, Zhang L, et
al. (2006) Evidence supporting paracrine hypothesis for
Akt-modied mesenchymal stem cell-mediated cardiac
protection and functional improvement. FASEB J 20: 661-
Oncotarget20
www.impactjournals.com/oncotarget
669.
65. Sheng J, Chen W, Zhu HJ (2015) The immune suppressive
function of transforming growth factor-beta (TGF-beta) in
human diseases. Growth Factors: 1-10.
66. Akhurst RJ, Derynck R (2001) TGF-beta signaling in
cancer--a double-edged sword. Trends Cell Biol 11: S44-
51.
67. Massague J (2008) TGFbeta in Cancer. Cell 134: 215-230.
68. Oskarsson T, Batlle E, Massague J (2014) Metastatic stem
cells: sources, niches, and vital pathways. Cell Stem Cell
14: 306-321.
69. Payne R, Glenn L, Hoen H, Richards B, Smith JW, 2nd,
et al. (2014) Durable responses and reversible toxicity of
high-dose interleukin-2 treatment of melanoma and renal
cancer in a Community Hospital Biotherapy Program. J
Immunother Cancer 2: 13.
70. Moore MJ (2007) Interleukin-2 in the treatment of
unresectable or metastatic renal cell cancer: Time to write
the obituary? Can Urol Assoc J 1: 39.
71. Fan VH, Tamama K, Au A, Littrell R, Richardson LB, et
al. (2007) Tethered epidermal growth factor provides a
survival advantage to mesenchymal stem cells. Stem Cells
25: 1241-1251.
72. Chung Y, Chang SH, Martinez GJ, Yang XO, Nurieva
R, et al. (2009) Critical regulation of early Th17 cell
differentiation by interleukin-1 signaling. Immunity 30:
576-587.
73. Cai Y, Shen X, Ding C, Qi C, Li K, et al. (2011) Pivotal
role of dermal IL-17-producing gammadelta T cells in skin
inammation. Immunity 35: 596-610.
74. Schwarzenberger P, Huang W, Ye P, Oliver P, Manuel M,
et al. (2000) Requirement of endogenous stem cell factor
and granulocyte-colony-stimulating factor for IL-17-
mediated granulopoiesis. J Immunol 164: 4783-4789.
75. Chen WC, Lai YH, Chen HY, Guo HR, Su IJ, et al. (2013)
Interleukin-17-producing cell inltration in the breast
cancer tumour microenvironment is a poor prognostic
factor. Histopathology 63: 225-233.
76. Coffelt SB, Kersten K, Doornebal CW, Weiden J, Vrijland
K, et al. (2015) IL-17-producing gammadelta T cells and
neutrophils conspire to promote breast cancer metastasis.
Nature.
77. Escamilla J, Schokrpur S, Liu C, Priceman SJ, Moughon D,
et al. (2015) CSF1 Receptor Targeting in Prostate Cancer
Reverses Macrophage-Mediated Resistance to Androgen
Blockade Therapy. Cancer Res 75: 950-962.
78. Demidenko ZN, Blagosklonny MV (2009) Quantifying
pharmacologic suppression of cellular senescence:
prevention of cellular hypertrophy versus preservation of
proliferative potential. Aging (Albany NY) 1: 1008-1016.
79. Bonab MM, Alimoghaddam K, Talebian F, Ghaffari SH,
Ghavamzadeh A, et al. (2006) Aging of mesenchymal stem
cell in vitro. BMC Cell Biol 7: 14.
80. Shiloh Y (2003) ATM and related protein kinases:
safeguarding genome integrity. Nat Rev Cancer 3: 155-168.
81. Zimmerlin L, Donnenberg AD, Rubin JP, Basse P,
Landreneau RJ, et al. (2011) Regenerative therapy and
cancer: in vitro and in vivo studies of the interaction
between adipose-derived stem cells and breast cancer cells
from clinical isolates. Tissue Eng Part A 17: 93-106.
82. Prantl L, Muehlberg F, Navone NM, Song YH, Vykoukal
J, et al. (2010) Adipose tissue-derived stem cells promote
prostate tumor growth. Prostate 70: 1709-1715.
83. Yu JM, Jun ES, Bae YC, Jung JS (2008) Mesenchymal stem
cells derived from human adipose tissues favor tumor cell
growth in vivo. Stem Cells Dev 17: 463-473.
84. Grisendi G, Bussolari R, Cafarelli L, Petak I, Rasini V, et al.
(2010) Adipose-derived mesenchymal stem cells as stable
source of tumor necrosis factor-related apoptosis-inducing
ligand delivery for cancer therapy. Cancer Res 70: 3718-
3729.
85. Dominici M, Le Blanc K, Mueller I, Slaper-Cortenbach
I, Marini F, et al. (2006) Minimal criteria for dening
multipotent mesenchymal stromal cells. The International
Society for Cellular Therapy position statement.
Cytotherapy 8: 315-317.
86. Deenick EK, Gett AV, Hodgkin PD (2003) Stochastic
model of T cell proliferation: a calculus revealing IL-2
regulation of precursor frequencies, cell cycle time, and
survival. J Immunol 170: 4963-4972.
87. Feng J, Meyer CA, Wang Q, Liu JS, Shirley Liu X, et al.
(2012) GFOLD: a generalized fold change for ranking
differentially expressed genes from RNA-seq data.
Bioinformatics 28: 2782-2788.
88. Subramanian A, Tamayo P, Mootha VK, Mukherjee S,
Ebert BL, et al. (2005) Gene set enrichment analysis: a
knowledge-based approach for interpreting genome-wide
expression proles. Proc Natl Acad Sci U S A 102: 15545-
15550.
