Article

Genetic tagging of free-ranging Black and Brown Bears

September 1999
Wildlife Society Bulletin 27(3):616-627

September 1999
27(3):616-627

Authors:

Ministry of Forests

Identification of individuals in a free-ranging animal population is potentially hampered by a lack of distinguishing features (e.g., scars, unique color patterns), poor visibility (e.g., densely forested environments), cost and invasiveness of physical capture, and mark loss. Advances in DNA-analysis technology offer alternative methods of individual identification that may overcome several of these problems. We investigated the genetic variability of American black bears (Ursus americanus) and brown (grizzly) bears (Ursus arctos) in the Columbia River basin of British Columbia, Canada, and developed a method to obtain genetic samples from free-ranging bears. We established the background genetic variability using microsatellite genotyping at 9 loci using tissue and blood samples from captured bears. In 3 field trials, we tested methods to obtain hair from free-ranging bears. Although all methods collected hair suitable for DNA analysis, the barbed-wire enclosure hair-trap was superior. We extracted DNA from hair roots and identified sample species with a species-specific mitochondrial DNA (mtDNA) test and sample sex from a Y-chromosome test. Using 6 microsatellite loci from nuclear DNA (nDNA), we screened all hair samples for individual identity and developed match probability functions based on scenarios of random sampling (P(random)), the likely presence of parent-offspring groupings in the samples (P(par-offs)), and the likely presence of siblings in the samples (P(sib)). We applied the P(sib) to each hair sample (match criteria at P(sib)<0.05) and illustrated how these microsatellite genotypes can be used as genetic tags in mark recapture bear censuses. The ability to identify species, sex, and individuality of free-ranging bears has numerous potential applications in field studies.

Community-led non-invasive polar bear monitoring in the Eeyou Marine Region of James Bay, Canada: insights on distribution and body condition during the ice-free season

Article

Full-text available

Jul 2023

Wildlife conservation is informed by detailed understanding of species demographics, habitat use, and interactions with environmental drivers. Challenges to collecting this information, particularly in remote places and on widely ranging species, can contribute to data deficiencies that detract from conservation status assessment and the effectiveness of management actions. Polar bears in James Bay face rapidly changing environmental conditions at the southern edge of their global range, but studying their ecology has been limited by community concerns about the methods typically used in polar bear research. Using a community-led and non-invasive approach, we deployed hair snare and camera trap sampling stations across 400 km of the Eeyou Marine Region in eastern James Bay. Stations collected >100 hair samples and thousands of photographs in one eight-week period that allowed for a novel investigation of this population’s distribution and body condition during the ice-free season. Polar bears were in average to above average body condition, and model selection of detections at stations revealed distance to mainland as a significant predictor of polar bear presence. Given its high potential, we suggest community-based monitoring using this method become a standard protocol to expand the scope and local leadership of polar bear research across the North.

Microsatellite Characterization and Panel Selection for Brown Bear (Ursus arctos) Population Assessment

Article

Full-text available

Nov 2022

An assessment of the genetic diversity and structure of a population is essential for designing recovery plans for threatened species. Italy hosts two brown bear populations, Ursus arctos marsicanus (Uam), endemic to the Apennines of central Italy, and Ursus arctos arctos (Uaa), in the Italian Alps. Both populations are endangered and occasionally involved in human–wildlife conflict; thus, detailed management plans have been in place for several decades, including genetic monitoring. Here, we propose a simple cost-effective microsatellite-based protocol for the management of populations with low genetic variation. We sampled 22 Uam and 22 Uaa individuals and analyzed a total of 32 microsatellite loci in order to evaluate their applicability in individual identification. Based on genetic variability estimates, we compared data from four different STR marker sets, to evaluate the optimal settings in long-term monitoring projects. Allelic richness and gene diversity were the highest for the Uaa population, whereas depleted genetic variability was noted for the Uam population, which should be regarded as a conservation priority. Our results identified the most effective STR sets for the estimation of genetic diversity and individual discrimination in Uam (9 loci, PIC 0.45; PID 2.0 × 10−5), and Uaa (12 loci, PIC 0.64; PID 6.9 × 10−11) populations, which can easily be utilized by smaller laboratories to support local governments in regular population monitoring. The method we proposed to select the most variable markers could be adopted for the genetic characterization of other small and isolated populations.

Review of Field Methods for Monitoring Asian Bears

Article

Full-text available

Mar 2022

Efficient and effective monitoring methods are required to assess population status and gauge efficacy of conservation actions for threatened species. Here we review the spectrum of field methods useful for monitoring distribution, occupancy, abundance, and population trend for the five species of Asian terrestrial bears. Methods reviewed include expert opinion, local knowledge, bear sign, visual observations, camera traps, DNA-based methods (hair and scat derived), and radio telemetry. We examine the application of each method in terms of realizing specific monitoring objectives, their assumptions, challenges, and advantages. Our goal is to assist researchers in matching appropriate field methods with sought-after project objectives and to highlight shortfalls and trade-offs. Methods vary greatly in terms of cost, logistics, required number and expertize of staff, and the reliability of the data they provide. Many Asian bear population assessments have relied on expert opinion, local interviews, and sign surveys to provide estimates of distribution, abundance, and trend, in part because these are inexpensive and relatively easy to employ. However, increasing use of camera traps and DNA-based methods now allow for better monitoring via occupancy or rigorous capture–recapture population estimation, with the caveat that these methods may be restricted by inadequate budgets or logistical constraints. For distribution monitoring, camera traps and DNA yield the most definitive records of presence, but in low density bear populations, sign and local knowledge may be more effective. For occupancy, camera traps and DNA are advantageous in providing definitive detections in known time periods. For abundance/density or population trend monitoring in relatively small areas (

Noninvasive Genetics Knowledge from the Brown Bear Populations to Assist Biodiversity Conservation

Article

Full-text available

Feb 2022
Diversity

Genetic monitoring has proven helpful in estimating species presence and abundance, and detecting trends in genetic diversity, to be incorporated in providing data and recommendations to management authorities for action and policy development. We reviewed 148 genetics research papers conducted on the bear species worldwide retrieved from Web of Science, SCOPUS, and Google Scholar. This review aims to reveal sampling methodology and data collection instructions, and to unveil innovative noninvasively genetic monitoring techniques that may be integrated into the genetic monitoring of a large bear population. In North American studies, hair samples were collected more often than faeces, whereas in Europe, both faeces and hair samples surveys are recommended, usually focusing on faeces. The use of the Isohelix sample collection method, previously tested locally and, if suitable, applied at the national level, could generate numerous advantages by reducing shortcomings. Additionally, dogs trained for faeces sampling could be used in parallel with hunting managers, foresters, and volunteers for sample collection organised during autumn and winter. It was stated that this is the best period in terms of cost-efficiency and high quality of the gathered samples. We conclude that large-scale noninvasive genetic monitoring of a large bear population represents a challenge; nevertheless, it provides valuable insights for biodiversity monitoring and actions to respond to climate change.

Optimal barbed wire height for brown bear hair sample collection

Article

Jan 2022

Hair samples obtained from barbed wire can identify bears from DNA, assess trophic position from stable isotopes, and yield other data. For brown bears (Ursus arctos), a wire height of 50 cm has become standard protocol, but the efficacy of this height has not been evaluated. Here, we briefly review this protocol, and use data from wires across small streams in Alaska to calculate the probability that barbs at a given height obtained samples. We obtained 1,939 hair samples between 2012 and 2019 for an overall daily sampling success rate per barb of 1.55%. Samples were obtained over the range of barb heights (697.5 cm), but daily success rate varied from 0.2% at the lowest and highest barbs to 2% from 40 to 70 cm in height. Thus, 50 cm was an effective height and a wider range yielded similar success rates, though wire height may be selective for bears with respect to size and other traits.

First core microsatellite panel identification in Apennine brown bears (Ursus arctos marsicanus): a collaborative approach

Article

Full-text available

Aug 2021
BMC GENOMICS

Background The low cost and rapidity of microsatellite analysis have led to the development of several markers for many species. Because in non-invasive genetics it is recommended to genotype individuals using few loci, generally a subset of markers is selected. The choice of different marker panels by different research groups studying the same population can cause problems and bias in data analysis. A priority issue in conservation genetics is the comparability of data produced by different labs with different methods. Here, we compared data from previous and ongoing studies to identify a panel of microsatellite loci efficient for the long-term monitoring of Apennine brown bears ( Ursus arctos marsicanus ), aiming at reducing genotyping uncertainty and allowing reliable individual identifications overtimes. Results We examined all microsatellite markers used up to now and identified 19 candidate loci. We evaluated the efficacy of 13 of the most commonly used loci analyzing 194 DNA samples belonging to 113 distinct bears selected from the Italian national biobank. We compared data from 4 different marker subsets on the basis of genotyping errors, allelic patterns, observed and expected heterozygosity, discriminatory powers, number of mismatching pairs, and probability of identity. The optimal marker set was selected evaluating the low molecular weight, the high discriminatory power, and the low occurrence of genotyping errors of each primer. We calibrated allele calls and verified matches among genotypes obtained in previous studies using the complete set of 13 STRs (Short Tandem Repeats), analyzing six invasive DNA samples from distinct individuals. Differences in allele-sizing between labs were consistent, showing a substantial overlap of the individual genotyping. Conclusions The proposed marker set comprises 11 Ursus specific markers with the addition of cxx20, the canid-locus less prone to genotyping errors, in order to prevent underestimation (maximizing the discriminatory power) and overestimation (minimizing the genotyping errors) of the number of Apennine brown bears. The selected markers allow saving time and costs with the amplification in multiplex of all loci thanks to the same annealing temperature. Our work optimizes the available resources by identifying a shared panel and a uniform methodology capable of improving comparisons between past and future studies.

Variation in density of grizzly bears and American black bears in relation to habitat covariates and co-occurrence in Jasper National Park, Alberta, Canada

Article

Jan 2024

American black (Ursus americanus) and grizzly bears (U. arctos) are sympatric throughout much of the grizzly bear's range, but information on how they share the landscape is lacking because distribution usually is not estimated simultaneously for both species. Here we analyze DNA data from noninvasively collected hair (using hair snags and rub trees) in a spatially explicit capture–recapture framework to study factors affecting the distribution of density for both black and grizzly bears in south Jasper National Park, Alberta, Canada, in 2014. Ninety-three black bears and 32 grizzly bears were detected. Black bears and grizzly bears showed different rates of detection for hair snags and rub trees, with hair snags being more effective in sampling both species. Female black bear density was greatest close to the town of Jasper, near roads, and in areas of higher amounts of closed canopy cover. Male black bear density was greatest at lower elevations with high canopy closure, and close to roads. Female grizzly bear density was greatest further from gravel roads, while male grizzly bear density was highest away from gravel roads and at medium canopy cover. We tested grizzly bears density as a predictor for black bear density and found that although habitat was the primary factor influencing black bear distribution, there was also a minor effect of grizzly bear density on male black bear density, and a slightly greater effect of grizzly bear density on female black bear density. The distribution of black bears within this study area puts them at a higher risk of conflict with humans. Our findings that grizzly bears prefer areas further from roads supports the use of habitat security thresholds to reduce human disturbance of grizzly bears.

LINEAR DENSITY ESTIMATION FOR POPULATION MONITORING OF GRIZZLY BEAR ALONG THE TAKU RIVER, BRITISH COLUMBIA

Technical Report

Nov 2006

Paul C. Griffin

Grizzly bears (Ursus arctos horribilus) seasonally congregate to forage on Pacific salmon (Oncorhynchus spp.) along the Taku River in remote northwestern British Columbia, Canada. We took advantage of this seasonal activity to develop a noninvasive DNA sampling design that overcomes key challenges facing capture-recapture population monitoring in remote regions. A linear array of hair snares along the river corridor was monitored within two study areas: Upper River (UR) and Lower River (LR). DNA analyses of hair identified individual grizzly bears, and the capture and recapture histories of these individuals were used in closed population models. Resulting annual abundance estimates (+SE) in the LR were 19.8 (+11.1), 19.5 (+9.0) and 25.0 (+3.8) and abundance estimates for the UR were 52.3 (+32.5), 62.6 (+11.9) and 84.2 (+30.7) for the sampling years of 2000, 2001 and 2003, respectively. We used estimated bear movement distances along the river corridor to calculate a linear density estimate, which ranged from 0.34 – 0.44 grizzly bears/kilometer and 1.08 – 1.45 grizzly bears/kilometer for the LR and UR, respectively. The consistent difference in population densities was unexpected and potential causes are explored. The linear density methodology alleviates significant logistical barriers to using robust techniques for population monitoring in remote landscapes.

Density and genetic diversity of grizzly bears at the northern edge of their distribution

Article

Full-text available

Jun 2023

Abstract Species at the periphery of their range are typically limited in density by poor habitat quality. As a result, the central–marginal hypothesis (CMH) predicts a decline in genetic diversity of populations toward the periphery of a species' range. Grizzly bears (Ursus arctos) once ranged throughout most of North America but have been extirpated from nearly half of their former range, mainly in the south. They are considered a species at risk even in Canada's remote North, where they occupy the northernmost edge of the species' continental distribution in a low‐productivity tundra environment. With climate change, one of their main prey species in the tundra (caribou), which has always shown yearly fluctuations, is declining, but simultaneously, grizzlies appear to be expanding their range northward in the same tundra environment. Yet, a lack of population density estimates across the North is hindering effective conservation action. The CMH has implications for the viability of peripheral populations, and the links between population fluctuations, potential bottlenecks, and genetic diversity need to be determined to contribute to species' conservation. Using noninvasive genetic sampling from 2012 to 2014 and autosomal DNA genotyping (via microsatellites), we estimated bear density using a spatial capture–recapture framework and analyzed genetic diversity using observed heterozygosity (Ho), allelic richness (AR), and expected heterozygosity (He). We compared our findings to other studies that used comparable methodologies on grizzly bears and a related species (black bears; Ursus americanus). We found densities of grizzly bears that were low for the species but characteristic for the region (5.9 ± 0.4 bears/1000 km2), but with high Ho (0.81 ± 0.05), AR (7 ± 0.78), and He (0.71 ± 0.03), despite a signal of recent bottlenecks. In both species, peripherality was not correlated with Ho but was negatively correlated with density. We suggest that the apparent growth of this expanding population of grizzlies offsets the negative impacts of recent bottlenecks on Ho. Indigenous knowledge provides historical context (on the order of centuries, e.g., arctic large mammal fluctuations, grizzly bear bottlenecks) for the current bear population dynamics (on the order of decades, e.g., climate change, northern grizzly bear expansion).

Black bear density and habitat use variation at the Sierra Nevada‐Great Basin Desert transition

Article

Jan 2023

In the first 2 decades of the twenty‐first century, American black bear ( Ursus americanus ) populations rebounded with range expansions into areas where the species was previously extirpated. While there are a number of factors that limit range expansion, habitat quality and availability are among the most important. Such factors may be particularly important in western Nevada, USA, at the transition zone of the Sierra Nevada and the Great Basin Desert. We deployed a multi‐faceted data collection system including motion‐sensitive cameras, noninvasive hair sampling and genotyping, and global positioning system (GPS) tracking. We analyzed data using spatial capture‐recapture to estimate population density and dynamic occupancy models to estimate habitat use. Black bear habitat use and density were substantially higher in the Sierra Nevada than the Great Basin Desert and had strong positive relationships with the presence of conifer land cover in the transition zone. The average black bear density was >4 times higher in the mixed‐conifer forests of the Sierra Nevada (12.4 bears/100 km ² ) than in desert mountain ranges with piñon ( Pinus monophylla )‐juniper ( Juniperus spp.) woodland (2.7 bears/100 km ² ). The low‐elevation shrub and grassland portions of the study area had even lower estimated black bear density (0.6 bears/100 km ² ) and probability of use (0.03, 95% CI = 0.00–0.09). Across these spatially variable configurations in black bear density, we estimated the population size to be 418 individuals (95% CI = 239–740). Declining density towards the range edge, coupled with a relatively stable range of black bears in Nevada observed since 2000, suggests that further species range expansion into the western Great Basin may be limited by habitat quality and availability.

Development of Genetic Markers for Sex and Individual Identification of the Japanese Giant Flying Squirrel (Petaurista leucogenys) by an Efficient Method Using High-Throughput DNA Sequencing

Article

Oct 2022

DNA markers that detect differences in the number of microsatellite repeats can be highly effective for genotyping individuals that lack differences in external morphology. However, isolation of sequences with different microsatellite repeat numbers between individuals has been a time-consuming process in the development of DNA markers. Individual identification of Japanese giant flying squirrels (Petaurista leucogenys) has been challenging because this species is arboreal and nocturnal and exhibits little to no morphological variation between individuals. In this study, we developed DNA markers for sex and individual identification of this species by an efficient method using high-throughput DNA sequence data. Paired-end 5 Gb (2 × 250 bp) and 15 Gb (2 × 150 bp) genome sequences were determined from a female and a male Japanese giant flying squirrel, respectively. We searched SRY and XIST genes located on Y and X chromosomes, respectively, from high-throughput sequence data and designed primers to amplify these genes. Using these primer sets, we succeeded to identify the sex of individuals. In addition, we selected 12 loci containing microsatellites with different numbers of repeats between two individuals from the same data set, and designed primers to amplify these sequences. Twenty individuals from nine different locations were discriminated using these primer sets. Furthermore, both sex and microsatellite markers were amplified from DNA extracted non-invasively from single fecal pellet samples. Based on our results for flying squirrels, we expect our efficient method for developing non-invasive high-resolution individual- and sex-specific genotyping to be applicable to a diversity of mammalian species.

Estimates of Abundance and Harvest Rates of Female Black Bears Across a Large Spatial Extent

Article

Full-text available

Sep 2021

American black bears (Ursus americanus) are an iconic wildlife species in the southern Appalachian highlands of the eastern United States and have increased in number and range since the early 1980s. Given an increasing number of human‐bear conflicts in the region, many management agencies have liberalized harvest regulations to reduce bear populations to socially acceptable levels. Wildlife managers need reliable population data for assessing the effects of management actions for this high‐profile species. Our goal was to use DNA extracted from hair collected at barbed‐wire enclosures (i.e., hair traps) to identify individual bears and then use spatially explicit capture‐recapture methods to estimate female black bear density, abundance, and harvest rate. We established 888 hair traps across 66,678 km2 of the southern Appalachian highlands in Georgia, North Carolina, South Carolina, and Tennessee, USA, in 2017 and 2018, arranged in 174 clusters of 2–9 traps/cluster. We collected 9,113 hair samples from those sites over 6 weeks of sampling, of which 1,954 were successfully genotyped to 462 individual female bears. Our spatially explicit estimator included a percent forest covariate to explain inhomogeneous bear density across the region. Densities ranged up to 0.410 female bears/km2 and regional abundance was 5,950 (95% CI = 4,988–7,098) female bears. Based on hunter kill data from 2016 to 2018, mean annual harvest rates for females were 12.7% in Georgia, 17.6% in North Carolina, 17.6% in South Carolina, and 22.8% in Tennessee. Our estimated harvest rates for most states approached or exceeded theoretical maximum sustainable levels, and population trend data (i.e., bait‐station indices) indicated decreasing growth rates since about 2009. These data suggest that the increased harvest goals and poor hard mast production over a series of prior years reduced bear population abundance in many states. We were able to obtain reasonable population abundance and density estimates because of spatially explicit capture‐recapture methods, cluster sampling, and a large spatial extent. Continued monitoring of bear populations (e.g., annual bait‐station surveys and periodic population estimation using spatially explicit methods) by state jurisdictions would help to ensure that population trajectories are consistent with management goals. © 2021 The Wildlife Society. We estimated abundance of female black bear populations in the southern Appalachian highlands of Georgia, North Carolina, South Carolina, and Tennessee (5,950 bears, 95% CI = 4,988–7,098) with spatially explicit capture‐recapture methods and cluster sampling. Estimated harvest rates for most states approach or exceed theoretical maximum sustainable levels; continued monitoring would help state jurisdictions assess whether population trajectories are consistent with management goals.

Gaining insight into the assimilated diet of small bear populations by stable isotope analysis

Article

Full-text available

Jul 2021

Apennine brown bears (Ursus arctos marsicanus) survive in an isolated and critically endangered population, and their food habits have been studied using traditional scat analysis. To complement current dietary knowledge, we applied Stable Isotope Analysis (SIA) to non-invasively collected bear hairs that had been individually recognized through multilocus genotyping. We analysed carbon (δ13C) and nitrogen (δ15N) stable isotopes of hair sections and bear key foods in a Bayesian mixing models framework to reconstruct the assimilated diet on a seasonal basis and to assess gender and management status effects. In total, we analysed 34 different seasonal bear key foods and 35 hair samples belonging to 27 different bears (16 females and 11 males) collected during a population survey in 2014. Most bears showed wide δ15N and δ13C ranges and individual differences in seasonal isotopic patterns. Vegetable matter (herbs, fleshy fruits and hard mast) represented the major component of the assimilated diet across the dietary seasons, whereas vegetable crops were rarely and C4 plants (i.e., corn) never consumed. We confirmed an overall low consumption of large mammals by Apennine bears consistently between sexes, with highest values in spring followed by early summer but null in the other seasons. We also confirmed that consumption of fleshy fruits peaked in late summer, when wild predominated over cultivated fleshy fruits, even though the latter tended to be consumed in higher proportion in autumn. Male bears had higher δ 15N values than females in spring and autumn. Our findings also hint at additional differences in the assimilated diet between sexes, with females likely consuming more herbs during spring, ants during early summer, and hard mast during fall compared to males. In addition, although effect sizes were small and credibility intervals overlapped considerably, management bears on average were 0.9‰ lower in δ 13C and 2.9‰ higher in δ 15N compared to non-management bears, with differences in isotopic values between the two bear categories peaking in autumn. While non-management bears consumed more herbs, wild fleshy fruits, and hard mast, management bears tended to consume higher proportions of cultivated fruits, ants, and large mammals, possibly including livestock. Although multi-year sampling and larger sample sizes are needed to support our findings, our application confirms that SIA can effectively integrate previous knowledge and be efficiently conducted using samples non-invasively collected during population surveys.

Banff Wildlife Crossings Project: Integrating Science and Education in Restoring Population Connectivity Across Transportation Corridors

Technical Report

Full-text available

Jun 2009

Monitoring of the Pasvik-Inari brown bear (Ursus arctos) population in 2023 using hair traps

Research

Full-text available

Feb 2024

Repeated summer seasons of collecting bear hair by special traps in Pasvik-Inari contributes monitoring the brown bear population in the very North-Eastern part of Fennoscandia. During summer 2023 new hairs and faeces were collected and DNA-analysed. Several females and males were new in the registration and others were registered again.

Monitoring of the Pasvik-Inari brown bear Ursus arctos population in 2023 using hair traps.

Technical Report

Full-text available

Feb 2024

Since 2005, the population of the trans-border brown bear (Ursus arctos) in Trilateral Park Pasvik-Inari (Norway-Finland-Russia) has been monitored by using genetic analyses of hair and faeces collected randomly in the field. A more systematic method using hair traps every fourth year was initiated in 2007 to collect brown bear hairs for genetic analysis. The method consisted of 56 hair traps in Norway, Finland and Russia in a 5 x 5 km2 grid cell system (ca 1400 km2). The project was repeated in 2011, 2015, 2019 and now in 2023. This season’s sampling was carried out in Pasvik (Norway) - Inari (Finland) area (43 squares, 1075 km2), using the same methodology as in the previous studies. A total of 97 samples were collected, where 45 samples came from Finland and 52 samples from Norway. In the bear specific analysis, 71 (73 %) of the 97 hair samples were positive. A complete DNA profile could be determined for 63 of the positive samples. In total, 22 different bear individuals were detected (10 females and 12 males). Of these 22 bears, 12 bears were detected in previous years, while 10 were previously unknown bears. In total, 13 bears were detected in Finland and 11 bears in Norway. This year’s sampling has the 2nd highest success rate in number of individuals detected per grid square, with 0,51 individual per grid square compared to 0,81 individuals in 2019 (highest success rate), 0,49 in 2015, 0,35 in 2011 and 0,42 in 2009. Our results showed that even with a smaller study area, the hair trap project every 4th year provides valuable information on the brown bear individuals in addition to a random sampling in the field (The National Monitoring Program for brown bears in Norway).

Ecology of Fear: Acclimation and Adaptations to Hunting by Humans

Article

Full-text available

Jan 2024

Humans greatly influence the ecosystems they live in and the lives of a wide range of taxa they share space with. Specifically, human hunting and harvesting has resulted in many species acclimating via diverse behavioral responses, often quite rapidly. This review provides insights into how hunting and harvesting can elicit behavioral changes. These responses emerge from a species’ previous and evolving ability to assess risk imposed by hunters and respond accordingly; a predator–prey game thus ensues, where both players may change tactics over time. If hunting is persistent, and does not result in the taxa’s extirpation, species are expected to develop adaptations to cope with hunting via natural selection by undergoing shifts in morphology and behavior. This review summarizes the various ways that human hunting intentionally and incidentally alters such evolutionary changes. These changes in turn can influence other species interactions and whole ecosystems. Additionally, alterations in behaviors can provide useful indicators for conservation and evolutionarily enlightened management strategies, and humans should use them to gain insights into our own socio-economic circumstances.

Sources of bias in applying close‐kin mark–recapture to terrestrial game species with different life histories

Article

Full-text available

Jan 2024
ECOLOGY

Close‐kin mark–recapture (CKMR) is a method analogous to traditional mark–recapture but without requiring recapture of individuals. Instead, multilocus genotypes (genetic marks) are used to identify related individuals in one or more sampling occasions, which enables the opportunistic use of samples from harvested wildlife. To apply the method accurately, it is important to build appropriate CKMR models that do not violate assumptions linked to the species’ and population's biology and sampling methods. In this study, we evaluated the implications of fitting overly simplistic CKMR models to populations with complex reproductive success dynamics or selective sampling. We used forward‐in‐time, individual‐based simulations to evaluate the accuracy and precision of CKMR abundance and survival estimates in species with different longevities, mating systems, and sampling strategies. Simulated populations approximated a range of life histories among game species of North America with lethal sampling to evaluate the potential of using harvested samples to estimate population size. Our simulations show that CKMR can yield nontrivial biases in both survival and abundance estimates, unless influential life history traits and selective sampling are explicitly accounted for in the modeling framework. The number of kin pairs observed in the sample, in combination with the type of kinship used in the model (parent–offspring pairs and/or half‐sibling pairs), can affect the precision and/or accuracy of the estimates. CKMR is a promising method that will likely see an increasing number of applications in the field as costs of genetic analysis continue to decline. Our work highlights the importance of applying population‐specific CKMR models that consider relevant demographic parameters, individual covariates, and the protocol through which individuals were sampled.

DNA-overvåkning av brunbjørn i Tana ved bruk av hårfeller NIBIO rapport 2023

Technical Report

Full-text available

Dec 2023

Ane-Sofie B. Hansen m.fl. Divisjon for miljø og naturressurser, NIBIO Svanhovd NIBIO RAPPORT | VOL. 9 | NR. 159 | 2023 DNA-overvåking av brunbjørn i Tana 2023 ved bruk av hårfeller

Conservation genetics of the muriqui: past, present and future

Article

Full-text available

Dec 2005

Valéria Fagundes

Our understanding of the genetics of the muriqui have increased in recent decades. In the mid 1980’s the first data was obtained from polymorphisms of allozymes of 10 individuals of B. hypoxanthus (northern muriqui) from Minas Gerais, and two individuals of B. arachnoides (southern muriqui) from São Paulo. All specimens were considered to be of a single species. The DNA was extracted from blood samples, which required capture and anesthesia of animals. We can now extract mitochondrial DNA from feces samples. Analyzing more than 120 individuals of the northern muriqui from two populations, we are now able make inferences about genetic variability, population distinctiveness as well as intra- and interpopulation gene flow. DNA sampling through feces is reliable, efficient, and economic, and does not risk the physical integrity of the animals, and furnishes enough DNA that is easily reproducible for PCR amplification. Using this method it is possible to sample a greater number of individuals in nature than would be possible if live capture were necessary. A muriqui feces and DNA bank has been set up, and currently has samples of 230 individuals from seven of the twelve known populations of northern muriqui. The samples resulted from field studies, but more coordinated and systematic efforts among fieldworkers at the different muriqui sites are needed to improve representation across populations and species. Future perspectives include the use of new genetic markers (nuclear and mitochondrial DNA) to identify parents, offspring, and closely related individuals in captive and wild populations; to define units for conservation and the gene flow between them; to quantify genetic variability in the populations; to assess the rate at which genetic variation has been lost over time; to estimate the degree of inbreeding in the population; and to understand better the genetic differentiation of the two species.

Assessing the harvest sustainability of black bears on central Vancouver Island

Research

Full-text available

Aug 2023

Black bears (Ursus americanus) serve an ecological role in the coastal temperate ecosystems on Vancouver Island. They are valued by Indigenous communities, and sightings are part of the Vancouver Island experience for residents and tourists alike. Harvest management of black bears in British Columbia (B.C.) has relied on harvest data, though this data does not allow for a direct assessment of harvest sustainability. Prior to this project, field-based population inventories focussed on black bears have not been conducted on Vancouver Island, nor anywhere in B.C. We undertook a field-based, mark-recapture program in Wildlife Management Units (WMUs) 1-4 and 1-5 in central Vancouver Island in 2021. Our objectives were to provide guidance for the design of future spatial mark-recapture inventories for black bears in coastal B.C., estimate the population size of black bears in WMUs 1-4 and 1-5, and assess the sustainability of licensed black bear harvest and conflict mortality in these areas by calculating a putative harvest rate and conflict kill rate. We had 267 black bear detections at unique site-session combinations, resulting in the identification of 177 individual bears (112 males and 65 females). We assessed spatial covariate (vegetation, road density, access/land ownership) relationships with density and determined that these pilot data were too sparse to produce reliable relationships between covariates and density. Our estimate of black bear density was 569 bears per 1,000 km 2 (95% CI: 404-800), which is higher than many black bear densities along the west coast of North America. Average harvest rates (3% and 8%) and percent females in the harvest (23%) were similar to other areas in B.C., within the ranges of neighboring jurisdictions, and generally within reported sustainable limits. The recorded conflict mortality rates for black bears were low at 0.3% of the estimated population in both management units. The overall mortality (harvest + conflict kill) rates remained below mortality rate thresholds, though we suspect there are localized areas around communities where the mortality rate exceeds sustainable levels. This source-sink dynamic is created when areas in and around communities attract bears because unnatural food is abundant and risk of mortality from other bears is low. We suggest future coastal black bear inventories use 2.5-3 km trap spacing (~9 km 2 grid cells) with 3x5 trap cluster configuration. Trap clusters should be spaced > 40 km apart and cover areas with known or suspected differences in bear density and mortality. We recommend combining future black bear inventories on Vancouver Island with this study to more precisely estimate black bear density and evaluate the sustainability of human-caused mortality at several scales.

Recent and current bear studies in Interior and Arctic Alaska

Article

Full-text available

Feb 2012

Comparing abundance estimates of a cryptic carnivore in southern Patagonia using two experimental methods

Article

Full-text available

Oct 2023
ANIM CONSERV

Determining the abundance of cryptic carnivores is central to building successful conservation management to mitigate conflicts and support coexistence strategies. For these reasons, there is considerable investment in developing reliable, cost‐effective tools for estimating the abundance of wildlife. Nevertheless, field‐based comparisons of abundance methods remain uncommon, even while essential to refining methods and coming to consensus around best practices. Here, we compare two approaches still being tested in real‐world application for an emblematic puma (Puma concolor) population in the Torres del Paine UNESCO Biosphere Reserve in southern Chile: (1) the unmarked estimator, space‐to‐event model (STE), which utilizes photographs gathered with camera traps, and (2) the genotype spatial partial identity model (gSPIM), which is an adaptation of the more established spatially explicit genetic capture‐recapture method (SECR) based on genetic data extracted from scats collected in systematic surveys. We show the tremendous variation in resulting STE estimates depending upon the start time of the analysis and length of the sampling window, and showcase a refined iterative sampling approach in a Bayesian framework to both utilize the full camera data and to stabilize density estimates for a given sampling window. Across all sampling, estimates from the STE model ranged from 3.19 (1.6–5.1 representing 10th and 90th percentile of credible intervals) to 7.38 (3.3–11.6) independent pumas 100 km⁻². By comparison, our gSPIM model estimated 5.1 independent pumas 100 km⁻² (excluding kittens) (with credible intervals of 2.2–10.3). Neither method was compared with any known density to determine their accuracy. Nevertheless, we provide initial density estimates to guide conservation strategies for wildlife agencies and local communities overseeing and hosting nascent puma tourism and livestock ranching, as well as guidelines for the use of these methods for any wildlife species.

Landscape genetic analysis of population structure and barriers to gene flow in a managed forest range of boreal woodland caribou (Rangifer tarandus caribou)

Preprint

Full-text available

Sep 2023

Reductions in gene flow due to anthropogenic habitat fragmentation are often associated with reduced genetic diversity and increased population structuring in wildlife populations. We assessed fine-scale population structure and barriers to gene flow in threatened boreal woodland caribou ( Rangifer tarandus caribou ) in one of their southernmost ranges that contains both actively managed and unmanaged forests. A total of 763 non-invasively collected fecal DNA samples were genotyped at 12 microsatellite loci. Genetic clustering algorithms failed to identify a biologically meaningful pattern of population substructure, consistent with the observed pattern of isolation by distance (IBD). Population graphs identified two sites at the southern range periphery as genetically isolated from the remainder of the range. At the range level, genetic differentiation among sampling locations was best predicted by a combination of wildfire disturbance and geographic distance. Overall, this study suggests that woodland caribou are weakly genetically differentiated across the Brightsand Range, with both isolation by distance and isolation by resistance contributing to variation in allele frequencies.

Spatial variation in density of American black bears in northern Yellowstone National Park

Article

Sep 2023

The quality and availability of resources are known to influence spatial patterns of animal density. In Yellowstone National Park, relationships between the availability of resources and the distribution of grizzly bears ( Ursus arctos ) have been explored but have yet to be examined in American black bears ( Ursus americanus ). We conducted non‐invasive genetic sampling during 2017–2018 (mid‐May to mid‐July) and applied spatially explicit capture‐recapture models to estimate density of black bears and examine associations with landscape features. In both years, density estimates were higher in forested vegetation communities, which provide food resources and thermal and security cover preferred by black bears, compared with non‐forested areas. In 2017, density also varied by sex, with female densities being higher than males. Based on our estimates, the northern range of Yellowstone National Park supports one of the highest densities of black bears (20 black bears/100 km ² ) in the northern Rocky Mountains (6–12 black bears/100 km ² in other regions). Given these high densities, black bears could influence other wildlife populations more than previously thought, such as through displacement of sympatric predators from kills. Our study provides the first spatially explicit estimates of density for black bears within an ecosystem that contains the majority of North America's large mammal species. Our density estimates provide a baseline that can be used for future research and management decisions of black bears, including efforts to reduce human–bear conflicts.

Identifying sex and individual from faecal DNA of the Asian elephant using a single multiplex PCR for population monitoring

Article

Full-text available

Sep 2023

Information on the sex- and individual-specific space use by a species elucidates demography, resource selection and individual life history. However, traditional field surveys often lack information on sex and individual identity, thereby not maximizing the potential of the effort put in. Recent advances in genetic non-invasive sampling provide cost-effective approaches to determine identity and sex from faecal DNA with high accuracy, which are advantageous for tracking individuals compared to field observations. Therefore, we describe the first single multiplex-based sex and individual identification protocol using faecal samples of the wild Asian elephant (Elephas maximus) collected from the vicinity of Rajaji Tiger Reserve, Uttarakhand, India. We co-amplified fluorescence-labelled microsatellites (n = 5) and a Y chromosome-linked sex marker in four replicates from faecal DNA extracts (n = 149). The mean per genotype allelic drop-out rate was 0.11 ± 0.02, while the false allele rate was 0.05 ± 0.01. The mean null allele frequency across the markers was 0.15 ± 0.02. We obtained 74.1% consensus genotypes across microsatellites and dropped samples with more than one-locus missing genotype from further analyses. The remaining dataset comprised 105 samples, 30.5% of which were females. We identified 51 unique individuals (25 males and 26 females) with a maximum of one-locus mismatch. With low genotyping error rates and adequate misidentification probabilities (PID = 4.2 × 10⁻⁴; PIDSib = 3.0 × 10⁻²), the described panel provides a cost-effective method (US$ 18/sample) for molecular sexing and individual identification. Hence, the suggested multiplex panel would provide a thorough understanding of individual and sex-specific differences in habitat use across heterogeneous landscapes, facilitating effective conservation strategies.

Assessing the harvest sustainability of black bears on central Vancouver Island

Preprint

Full-text available

Aug 2023

Genetic diversity, gene flow, and source-sink dynamics of cougars in the Pacific Northwest

Article

Full-text available

Jun 2023
CONSERV GENET

Conservation and management of wide-ranging carnivores like cougars (Puma concolor), which occur across human-altered landscapes can benefit from an in-depth understanding of their genetic status. Here, we apply the largest collection of multi-locus genotypes currently available for cougars (n = 1,903) to provide a comprehensive assessment of genetic diversity, gene flow, and source-sink dynamics for cougars occurring across Washington, United States and south-central British Columbia, Canada. We found that cougars in the Olympic, Cascade, Kettle, Selkirk, and Blue Mountains ecosystems are genetically differentiated into two clusters with varying degrees of admixture, indicating moderate levels of gene flow across the area with the exception of the Olympic Peninsula and the Blue Mountains which form more distinct genetic groups. We detected several first-generation migrants confirming long-distance movements within our study system, but also observed that migration rates between areas were asymmetrical, which is an indication of genetic source-sink dynamics. Genetic diversity and inbreeding followed a clinal east-to-west pattern with Olympic Peninsula cougars having the lowest genetic diversity and highest inbreeding coefficients among all sites. Spatial autocorrelation results for cougars did not follow sex-specific patterns suggesting that anthropogenic pressures such as habitat fragmentation and/or mortality sources may have an impact on their spatial dynamics. As cougar habitat in the northwestern United States continues to be affected by rising levels of urbanization and anthropogenic activities, long-term regional genetic monitoring represents a critical decision-support tool for formulating effective cougar conservation and management actions to prevent further genetic decline and promote long-term persistence of cougar populations.

Broad‐scale genetic monitoring suggests density‐dependent dispersal in a large carnivore

Article

Full-text available

May 2023

Characterizing patterns and drivers of dispersal is fundamental to our understanding of animal ecology and ultimately informing species conservation and management strategies. In this study, we used microsatellite data from 3941 individual black bears Ursus americanus occupying 73 spatially distinct sampling areas across a large heterogeneous landscape to characterize dispersal via gene flow directionality. We fit spatial models to quantified gene flow to test hypotheses regarding drivers of putative dispersal patterns. Specifically, we tested the relative influence of food productivity gradients, bear density, and bear harvest on dispersal. We also evaluated differences in gene flow patterns within and between sexes to assess sex‐biased dispersal. We found evidence suggestive of positive density‐dependent, male‐biased dispersal. Our data show evidence of a relationship between dispersal and broad food productivity gradients. Specifically, male bears displayed preferential dispersal towards mixed deciduous forests with higher food productivity relative to less productive boreal forests. Given the dense sampling scheme across a continuous population, occupying a large heterogeneous landscape, these results provide key insight as to the likely drivers of dispersal patterns in a wide‐ranging mammal.

DNA primer design for sex identification of Sumatran tiger body samples

Article

Full-text available

Jun 2022

Many reports of cases of illegal trade in animal body parts have resulted in more and more samples of animal body parts being seized. Seized sample from illegal trade needs to be identified with the help of molecular methods to ensure the profile of the seized samples including the determination of their sex. At the molecular level, amelogenin gene amplifications are used to determine the sex of mammals. Previous studies using primers for amelogenin gene amplification found that amelogenin X (AMELX) and amelogenin Y (AMELY) bands in male samples were difficult to distinguish due to very small differences, 20 base pairs(bp). The difficulty of distinguishing these bands resulted in errors in detecting male and female individual samples. Therefore, it was to design a more specific primer as a way to avoid this error. The purpose of this study was to design a DNA primer for the sex identification of the Sumatran tiger (Panthera tigris sumatraePocock, 1929). The research was carried out using descriptive methods and molecular observation of the AMELX and AMELY Sumatran tiger sequences. The primer design results in this study were 100% able to identify the sex of the Sumatran tiger sample. The present primer design(F= 5’TCGGTTAACAATTCCCTGGGC’3 and R= 5’AGGCCAAATAGGAGTGTGCT’3)is more specific than the primers previously reported

DNA-monitoring of brown bear in Karasjok (Northern Norway) 2022 by hairsnares (in Norwegian).

Technical Report

Full-text available

Dec 2022

Report written in Norwegian with English summary dealing the results of brown bear hairsnares in the Karasjok area during the summer 2022.

Estimation of breeding population size using DNA‐based pedigree reconstruction in brown bears

Article

Full-text available

Sep 2022

Robust estimates of demographic parameters are critical for effective wildlife conservation and management but are difficult to obtain for elusive species. We estimated the breeding and adult population sizes, as well as the minimum population size, in a high‐density brown bear population on the Shiretoko Peninsula, in Hokkaido, Japan, using DNA‐based pedigree reconstruction. A total of 1288 individuals, collected in and around the Shiretoko Peninsula between 1998 and 2020, were genotyped at 21 microsatellite loci. Among them, 499 individuals were identified by intensive genetic sampling conducted in two consecutive years (2019 and 2020) mainly by noninvasive methods (e.g., hair and fecal DNA). Among them, both parents were assigned for 330 bears, and either maternity or paternity was assigned to 47 and 76 individuals, respectively. The subsequent pedigree reconstruction indicated a range of breeding and adult (≥4 years old) population sizes: 128–173 for female breeders and 66–91 male breeders, and 155–200 for female adults and 84–109 male adults. The minimum population size was estimated to be 449 (252 females and 197 males) in 2019. Long‐term continuous genetic sampling prior to a short‐term intensive survey would enable parentage to be identified in a population with a high probability, thus enabling reliable estimates of breeding population size for elusive species. This study estimated the breeding and adult population sizes, as well as the minimum population size, in a high‐density brown bear population on the Shiretoko Peninsula, in Hokkaido, Japan, using DNA‐based pedigree reconstruction. This study showed that combination of a short‐term intensive genetic survey and long‐term continuous genetic sampling prior to it enables parentage to be identified in a population with a high probability, thus enabling reliable estimates of breeding population size for elusive species.

Genetic Analysis and Status of Brown Bear Sub-Populations in Three National Parks of Greece Functioning as Strongholds for the Species’ Conservation

Article

Full-text available

Aug 2022

In order to optimize the appropriate conservation actions for the brown bear (Ursus arctos L.) population in Greece, we estimated the census (Nc) and effective (Ne) population size as well as the genetic status of brown bear sub-populations in three National Parks (NP): Prespa (MBPNP), Pindos (PINDNP), and Rhodopi (RMNP). The Prespa and Pindos sub-populations are located in western Greece and the Rhodopi population is located in eastern Greece. We extracted DNA from 472 hair samples and amplified through PCR 10 microsatellite loci. In total, 257 of 472 samples (54.5%) were genotyped for 6–10 microsatellite loci. Genetic analysis revealed that the Ne was 35, 118, and 61 individuals in MBPNP, PINDNP, and RMNP, respectively, while high levels of inbreeding were found in Prespa and Rhodopi but not in Pindos. Moreover, analysis of genetic structure showed that the Pindos population is genetically distinct, whereas Prespa and Rhodopi show mutual overlaps. Finally, we found a notable gene flow from Prespa to Rhodopi (10.19%) and from Rhodopi to Prespa (14.96%). Therefore, targeted actions for the conservation of the bears that live in the abovementioned areas must be undertaken, in order to ensure the species’ viability and to preserve the corridors that allow connectivity between the bear sub-populations in Greece.

Density, harvest rates, and growth of a reintroduced American black bear population

Article

Full-text available

Aug 2022

Less than 30% of all species reintroductions have been successful and it is important that factors associated with success or failure be identified. Officials experimentally translocated 14 adult female American black bears ( Ursus americanus ) from Great Smoky Mountains National Park, North Carolina and Tennessee, USA, to Big South Fork National River and Recreation Area in the Cumberland Plateau of Kentucky and Tennessee, USA, in 1996–1997. Since that time, the reintroduced bear population has continued to expand in size and range so our study objective was to use spatially explicit capture‐recapture methods across a wide spatial extent to estimate bear population abundance and growth. We constructed 440 (223 in KY, 217 in TN) hair traps in our primary sampling area in 2019 arranged in clusters of 4–9 traps/cluster, which we augmented with data from 138 hair traps in a secondary sampling area in Tennessee collected in 2018. We extracted and genotyped DNA from hair samples to construct spatially explicit capture histories, using spatial covariates to model inhomogeneous densities. Population abundance estimates across our 36,035‐km ² study area were 411 males and 406 females excluding cubs. Based on an initial standing population of 18 adult and subadult bears, the mean annual growth rate ( λ ) from 1998 to 2019 was 1.199. The mean annual harvest rate in Kentucky from 2013 to 2019 was 5.1% and in Tennessee from 2014 to 2019 was 13.2%. Based on simulations, the hunting seasons reduced mean λ from 1.217 to 1.199, but growth was rapid despite harvest. Genetic diversity was retained, with similar expected heterozygosity as in the source population. The lack of conspecifics, highly productive habitat, and an initial age and sex distribution that was skewed toward the most fecund members of the population likely contributed to the rapid growth and high levels of gene retention in this bear population.

Noninvasive genetic sampling with a spatial capture‐recapture analysis to estimate abundance of Roosevelt elk

Article

Jul 2022

Precise abundance estimates of large mammals are important for effective conservation, harvest, and conflict management. Determining abundance of wide‐ranging, herding ungulate species has presented a unique challenge to wildlife managers because of factors such as dense forest, elusive behavior, and heterogeneity in density across the landscape. Roosevelt elk ( Cervus canadensis roosevelti ) populations in Northern California, USA, are no exception to these challenges, and as the elk population has grown, so has human–wildlife conflict, necessitating the need for efficient and repeatable methods to determine population abundance for management decisions. We explored non‐invasive genetic sampling combined with spatial capture‐recapture (SCR) as an alternative for monitoring populations that are difficult to observe directly. We combined an SCR model with a binomial point process and an unstructured single survey search method to estimate elk abundance in Northern California via Bayesian inference. We searched open grassy hillsides for female‐calf groups and used a detection dog team to search forested areas to increase the number of detections of males and other solitary individuals. For the SCR analysis, we used sex and survey effort as detection covariates, and used a trap‐level random effect to account for overdispersion in the count data from the herding behavior of elk. Our population estimate ( N ± SD) for the study area was 618 ± 36.34 individuals (95% Bayesian credible interval = 551–693) with a mean density of 1.09 ± 0.06 elk/km ² . Our work demonstrates a potential method to estimate population size of ungulates in an area that is not conducive to traditional monitoring methods.

Application of UAS for Monitoring of Forest Ecosystems: A Review of Experience and Knowledge

Article

Full-text available

Apr 2022

In the last couple of years, there have been a great number of articles that cover and emphasize the advantages and possibilities that UAS (Unmanned Air System) offers in forest ecosystem research. In the available research, alongside UAS, the importance of developing sensors that are designed to be used with UAV (Unamnned Air Vehicle), a flight programming software and UAS collected data processing software have been pointed out. With the widespread use of high-precision sensors and accompanying software in forestry, it is possible to obtain accurate data in a short time that replaces long-term manpower in the field with equal or in some cases, such as windthrow calculation or wildlife counting, greater accuracy. The former practice of manual imagery processing is being partly replaced with automated approaches. The paper analyses studies that deal with some form of application of UAS in forestry, e.g. forest inventory, forest operations, ecological monitoring, forest pests and forest fires, and wildlife monitoring. In the forest inventory, a large number of studies deal with the possibilities of applying UAS in mapping vegetation and individual trees, morphological research of individual parts of trees, surface analysis, etc. The use of remote and proximal sensing technologies in forest engineering has mainly been focused on defining surface roughness and topology, road geometry, planning and maintenance, ground-based and cable-based harvesting and soil characteristics and displacement. Wildfire monitoring already relies heavily on the use of UAS and thermal cameras in operations, and it is similar to the mapping of windthrow or directions of the spread of certain insects important for forestry. In wildlife research, numerous studies deal with abundance research of individual terrestrial birds and mammals using UAS thermal imagery. With some drawbacks such as wildlife disturbance or limited UAV range, common to most of the processed studies are positive attitudes regarding the application of UAS in forestry sensing and monitoring, which is slowly becoming a common operative practice, with the scientists’ focus being on developing automated approaches in UAS imagery processing. Reducing the error by improving the technological characteristics of the sensors will in the long run reduce the number of people required to collect data important for forestry, reduce risks and in some cases increase accuracy.

Estimation of breeding population size using DNA-based pedigree reconstruction in brown bears

Preprint

Full-text available

Apr 2022

Robust estimates of demographic parameters are critical for effective wildlife conservation and management, but are difficult to obtain for elusive species. We estimated the breeding and adult population sizes, as well as the minimum population size, in a high-density brown bear population on the Shiretoko Peninsula, in Hokkaido, Japan, using DNA-based pedigree reconstruction. A total of 1,288 individuals, collected in and around the Shiretoko Peninsula between 1998 and 2020, were genotyped at 21 microsatellite loci. Among them, 499 individuals were identified by intensive genetic sampling conducted in two consecutive years (2019 and 2020) mainly by noninvasive methods (e.g., hair and fecal DNA). Among them, both parents were assigned for 330 bears, and either maternity or paternity was assigned to 47 and 76 individuals, respectively. The subsequent pedigree reconstruction indicated a range of breeding and adult (≥4 years old) population sizes: 128–173 for female breeders and 66–91 male breeders, and 155–200 for female adults and 84–109 male adults. The minimum population size was estimated to be 449 (252 females and 197 males) in 2019. Long-term continuous genetic sampling prior to a short-term intensive survey would enable parentage to be identified in a population with a high probability, thus enabling reliable estimates of breeding population size for elusive species.

Comparison of Methods for Estimating Density and Population Trends for Low-density Asian Bears

Article

Full-text available

Feb 2022

Populations of bears in Asia are vulnerable to extinction and effective monitoring is critical to measure and direct conservation efforts. Population abundance (local density) or growth (λ) are the most sensitive metrics to change. We discuss and recommend implementing spatially explicit capture-recapture (SCR), the current gold standard for density estimation, and open population SCR (OPSCR) to monitor changes in density over time whenever possible. We provide guidance for designing studies to provide estimates with sufficient power to detect changes. Because of the wide availability of camera traps and interest in their use, we consider six density estimation methods and their extensions developed for use with camera traps, with specific consideration of assumptions and applications for monitoring Asian bears. We conducted a power analysis to calculate the precision in estimates needed to detect changes in populations with reference to IUCN Red List criteria. We performed a systematic review of empirical studies implementing camera trap abundance estimation methods and considered sample sizes, effort, and model assumptions required to achieve adequate precision for population monitoring. We found SCR and OPSCR, reliant on “marked” individuals, are currently the only methods with enough power to reliably detect even moderate to major (20-80%) declines. Camera trap methods with unmarked individuals rarely achieved precision sufficient to detect even large declines (80-90%), although with some exceptions (e.g., situations with moderate population densities, large number of sampling sites, or inclusion of ancillary local telemetry data. We describe additional estimation options including line transects, direct observations, monitoring age-specific survival and reproductive rates, and hybrid/integrated methodologies that may have potential to work for some Asian bear populations. We conclude monitoring changes in abundance or density is possible for most Asian bear populations but will require collaboration among researchers over broad spatial extents and extensive financial investment to overcome biological and logistical constraints. We strongly encourage practitioners to consider study design and sampling effort required to meet objectives by conducting simulations, power analyses, and assumption checks prior to implementing monitoring efforts, and reporting standardized dispersion measures such as coefficients of variation to allow for assessment of precision. Our recommendations are relevant to other low-density and wide-ranging species.

Physiological Stress in Rescued Wild Koalas (Phascolarctos cinereus) Being Held in a Rehabilitation Sanctuary: A Pilot Study

Article

Full-text available

Sep 2021

Koalas (Phascolarctos cinereus) are one of Australia's most charismatic native small marsupial species. Unfortunately, populations of koalas are rapidly declining throughout Australia and they continue to face increasing pressure from a changing ecosystem. Negative stimulants in the environment can elicit stress responses through activation of the hypothalamic-pituitary-adrenal (HPA) axis. Depending on the duration of the negative stimulant, the stress response can lead to either acute or chronic side effects, and is shown through the activation of the neuroendocrine stress system and the release of glucocorticoids (e.g., cortisol). Wild koalas entering clinical care face novel stressors that can be out of a wildlife carer's control. In this pilot study, we monitored physiological stress in three wild koalas at a wildlife rehabilitation centre in New South Wales, Australia. Acute and chronic stress was indexed non-invasively, with faecal samples taken to evaluate acute stress, and fur samples taken to evaluate chronic stress. Sampling occurred sporadically over four months, from the start of September 2018 to the end of December 2018. Results attempt to understand the stress response of koalas to negative stimulants in the environment by comparing faecal glucocorticoids on days where a known stressor was recorded with days where no known stressor was recorded. Furthermore, variations in faecal and fur glucocorticoids were compared between the three koalas in this study. To our knowledge, this is the first evidence of stress tracking of wild rescued koalas in a sanctuary. We suggest that further monitoring of baseline, acute and chronic stress will be needed to better understand how koalas respond to negative stimulants associated with clinical care.

Physiological Stress in Rescued Wild Koalas (Phascolarctos cinereus) Being Held in a Rehabilitation Sanctuary: A Pilot Study

Preprint

Full-text available

Aug 2021

Long-term monitoring using DNA sampling reveals the dire demographic status of the critically endangered Gobi bear

Article

Full-text available

Aug 2021

Information about population demography is crucial for developing and implementing conservation measures. The brown bear in the Gobi desert of southwestern Mongolia (referred to as the Gobi bear) is one of the smallest and most isolated brown bear populations in the world. We conducted genetic sampling (n = 2660 samples collected) using hair corrals around feeding sites at 13 water sources during 2009, 2013, and 2017 to evaluate population size, survival, and population trend. Bears were identified using 13 microsatellite loci and one sex marker. We detected 51 unique individuals (15F and 36M) from our targeted surveys in 2009, 2013, and 2017. Based on capture-mark-recapture robust design, population estimates were 23 (95% CI: 21-32) in 2009, 28 (95% CI: 25-35) in 2013, and 31 (95% CI: 29-38) individuals in 2017. Spatial capture-recapture analysis suggested abundance was very low (N = 27; 95% CI: 22-35), and there was no significant change from 2009 to 2017. The population density was 0.93 bears/1000 km 2 (95% CI: 0.74-1.17). Our population estimates suggested a stable population trend. However, the population is still very small, and the sex ratio is skewed toward males, raising concerns for future persistence. Annual survival based on Robust design CMR was 0.85. Low abundance and apparent survival for both sexes in this unhunted population coupled with a skewed sex ratio highlight the need for on-the-ground conservation action to conserve this isolated population of bears.

Integrating counts, telemetry, and non‐invasive DNA data to improve demographic monitoring of an endangered species

Article

Full-text available

May 2021

Population monitoring can take many different forms, and monitoring elusive and endangered species frequently involves a variety of sparse data from different sources. Small populations are often hard to sample precisely and without bias, so when estimates of vital rates like survival or recruitment point to conflicting population trends, it can be hard to determine which is more correct. Furthermore, data can be extremely hard to collect on small populations and it can be helpful to find a way to use all available hard‐won data. To address these issues, we developed an integrated population model (IPM) using all available data to estimate vital rates and abundance for a case study of an endangered woodland caribou (Rangifer tarandus caribou) population. This IPM allowed us to incorporate data from juvenile recruitment surveys, telemetry‐based survival, aerial population counts and mark–resight data, and non‐invasive capture–recapture DNA data to better understand population status and trend. We estimated survival, abundance, and recruitment of four age classes of male and female caribou: young, juveniles, subadults, and adults. The four‐age class structure of the IPM allowed us to estimate recruitment from reproductive‐aged female caribou alone, even though it can be difficult to distinguish age classes—and even sexes—in the field. As part of our IPM, we developed a novel mixture model to break apart data from different age classes when age is unobservable, as it typically is from non‐invasive DNA samples. This helped us decrease bias in juvenile and adult survival estimates from scat data, which was important to our understanding of the population dynamics. Overall, our integrated model provided more precise estimates of population trends than any one method (e.g., telemetry or non‐invasive DNA) alone. This IPM provides a useful, flexible tool for biologists to monitor populations and provides a valuable example of the benefits of integrated population modeling approaches for endangered species management and recovery.

Testing the precision and sensitivity of density estimates obtained with a camera‐trap method revealed limitations and opportunities

Article

Full-text available

May 2021

The use of camera traps in ecology helps affordably address questions about the distribution and density of cryptic and mobile species. The random encounter model (REM) is a camera‐trap method that has been developed to estimate population densities using unmarked individuals. However, few studies have evaluated its reliability in the field, especially considering that this method relies on parameters obtained from collared animals (i.e., average speed, in km/h), which can be difficult to acquire at low cost and effort. Our objectives were to (1) assess the reliability of this camera‐trap method and (2) evaluate the influence of parameters coming from different populations on density estimates. We estimated a reference density of black bears (Ursus americanus) in Forillon National Park (Québec, Canada) using a spatial capture–recapture estimator based on hair‐snag stations. We calculated average speed using telemetry data acquired from four different bear populations located outside our study area and estimated densities using the REM. The reference density, determined with a Bayesian spatial capture–recapture model, was 2.87 individuals/10km² [95% CI: 2.41–3.45], which was slightly lower (although not significatively different) than the different densities estimated using REM (ranging from 4.06–5.38 bears/10km² depending on the average speed value used). Average speed values obtained from different populations had minor impacts on REM estimates when the difference in average speed between populations was low. Bias in speed values for slow‐moving species had more influence on REM density estimates than for fast‐moving species. We pointed out that a potential overestimation of density occurs when average speed is underestimated, that is, using GPS telemetry locations with large fix‐rate intervals. Our study suggests that REM could be an affordable alternative to conventional spatial capture–recapture, but highlights the need for further research to control for potential bias associated with speed values determined using GPS telemetry data.

Genetic diversity, reproductive success, and genetic differentiation from congeners in the narrow endemic Phlox pilosa ssp. sangamonensis1

Article

May 2024

Berries and bullets: influence of food and mortality risk on grizzly bears in British Columbia

Article

Full-text available

Sep 2023
WILDLIFE MONOGR

The influence of bottom-up food resources and top-down mortality risk underlies the demographic trajectory of wildlife populations. For species of conservation concern, understanding the factors driving population dynamics is crucial to effective management and, ultimately, conservation. In southeastern British Columbia, Canada, populations of the mostly omnivorous grizzly bear (Ursus arctos) are fragmented into a mosaic of small isolated or larger partially connected sub-populations. They obtain most of their energy from vegetative resources that are also influenced by human activities. Roads and associated motorized human access shape availability of food resources but also displace bears and facilitate human-caused mortality. Effective grizzly bear management requires an understanding of the relationship between habitat quality and mortality risk. We integrated analyses of bottom-up and top-down demographic parameters to understand and inform a comprehensive and efficient management paradigm across the region. Black huckle-berry (Vaccinium membranaceum) is the key high-energy food for grizzly bears in much of southeastern British Columbia. Little is known about where and why huckleberries grow into patches that are useful for grizzly bears (i.e., densely clustered fruiting shrubs that provide efficient access to high energy food) and how Wildlife Monographs. 2023;e1078. wileyonlinelibrary.com/journal/wmon |

Estimating abundance of a recovering transboundary brown bear population with capture-recapture models

Article

Full-text available

Nov 2022

Estimating the size of small populations of large mammals can be achieved via censuses, or complete counts, of recognizable individuals detected over a time period: minimum detected (population) size (MDS). However, as a population grows larger and its spatial distribution expands, the risk of underestimating population size using MDS rapidly increases because the assumption of perfect detection of all individuals in the population is violated. The need to report uncertainty around population size estimates consequently becomes crucial. We explored these biases using the monitoring framework of the critically endangered Pyrenean brown bear that was close to extinction in the mid-1990s, with only ve individuals remaining, but was subsequently bolstered by the introduction of 11 bears from Slovenia. Each year since 1996, the abundance of the population has been assessed using MDS and minimum retained (population) size (MRS), which corresponded to a reassessment of the MDS in the light of the new information collected in subsequent years (e.g., adding bears which were not detected the previous years but detected the current year).We used Pollock’s closed robust design (PCRD) capture-recapture models applied to the cross-border non-invasive sampling data from France, Spain and Andorra to provide the rst published annual abundance and temporal trend estimates of the Pyrenean brown bear population since 2008. Annual population size increased vefold between 2008 and 2020, going from 13 to 66 individuals. PCRD estimates were globally close to MRS counts and had reasonably narrow associated 95% Credibility Intervals. Even in cases where sampling e�ort is large compared to population size, the PCRD estimates of population size can diverge from the MDS counts.We report individual heterogeneity in detection that might stem from intraspeci c home range size variation that result in individuals that move the most being most likely to be detected.We also found that cubs had a higher mortality rate than adults and subadults, because of infanticide by males, predation, maternal death, or abandonment. Overall, the PCRD capture-recapture modelling approach provides estimates of abundance and demographic rates of the Pyrenean brown bear population, together with associated uncertainty, while minimizing bias due to inter-individual heterogeneity in detection probabilities. We strongly encourage wildlife ecologists and managers to use robust approaches when researching large mammal populations. Such information is vital for informing management decision-making and assessing population conservation status.

The Green Toad Example: A Comparison of Pattern Recognition Software

Preprint

Full-text available

Sep 2020

Background Individual identification of animals is important for assessing the size and status of populations. Photo-based approaches, where animals are recognized by naturally occurring and visually identifiable features, such as color patterns, are cost-effective methods for this purpose. We compared five available programs for their power to semi-automatically identify dorsal patterns of the European green toad (Bufotes viridis). Method We created a data set of 200 pictures of known identity, two pictures for each individual, and analyzed the percentage of correctly identified animals for each software. Furthermore, we employed a generalized linear mixed model to identify important factors contributing to correct identifications. We used these results to estimate the population size of our hypothetical population. Conclusions The freely available HotSpotter application was the software which performed by far the best for our green toad example, identifying close to 100% of the photos correctly. The animals’ sex highly significantly influenced detection probability, presumably because of sex-specific differences in the pattern contrast. Population estimates were close to the expected 100 for HotSpotter, but for the other applications population size was highly overestimated. Given the clarity of our results we strongly recommend the HotSpotter software, which is a highly efficient tool for individual pattern recognition.

Use of fecal DNA to estimate black bear density in an urban‐wildland interface

Article

Sep 2022

American black bears (Ursus americanus) commonly habituate to human resources in regions of urban‐wildland interface, which frequently leads to human‐wildlife conflict. Monitoring bear densities is important to inform management, yet traditional density estimation methods may not be practical in such areas. Minimally or noninvasive genetic tools offer a potential solution, but the most common sampling method employs barbed‐wire hair snares and scented lure, which can pose dangers to people and pets. Fecal DNA, which is less invasive, has been used successfully for many species, but has not been commonly used for ursids in the United States. We conducted a pilot study from July–September 2018 to assess the feasibility of using fecal DNA in a spatial capture‐recapture analysis to estimate black bear density in the Lake Tahoe Basin in California, a region of high‐human density compared to other urban‐wildland interface localities in the United States, where bears pose significant nuisance problems. The use of fecal DNA allowed us to sample in both urban and wildland areas with minimal disturbance to the surrounding community. Based on 142 genotyped samples from 101 distinct individuals, we estimated an abundance of 0.84 bears/km2 (95% CI = 0.58–1.21 bears/km2), which was similar to a previous capture‐recapture estimate in the study area and represents one of the highest densities reported for black bears. More generally, our findings indicated that fecal DNA capture‐recapture approaches provide a feasible means of estimating black bear densities in areas where hair sampling may be impractical. Our pilot study demonstrated the efficacy of fecal DNA for estimating bear density in areas of high human density, where more invasive methods are less practical. Estimates suggest that the bear population densities of the Lake Tahoe Basin are among the highest reported throughout their range.

Explaining detection heterogeneity with finite mixture and non-Euclidean movement in spatially explicit capture-recapture models

Article

Full-text available

Jun 2022

Landscape structure affects animal movement. Differences between landscapes may induce heterogeneity in home range size and movement rates among individuals within a population. These types of heterogeneity can cause bias when estimating population size or density and are seldom considered during analyses. Individual heterogeneity, attributable to unknown or unobserved covariates, is often modelled using latent mixture distributions, but these are demanding of data, and abundance estimates are sensitive to the parameters of the mixture distribution. A recent extension of spatially explicit capture-recapture models allows landscape structure to be modelled explicitly by incorporating landscape connectivity using non-Euclidean least-cost paths, improving inference, especially in highly structured (riparian & mountainous) landscapes. Our objective was to investigate whether these novel models could improve inference about black bear ( Ursus americanus ) density. We fit spatially explicit capture-recapture models with standard and complex structures to black bear data from 51 separate study areas. We found that non-Euclidean models were supported in over half of our study areas. Associated density estimates were higher and less precise than those from simple models and only slightly more precise than those from finite mixture models. Estimates were sensitive to the scale (pixel resolution) at which least-cost paths were calculated, but there was no consistent pattern across covariates or resolutions. Our results indicate that negative bias associated with ignoring heterogeneity is potentially severe. However, the most popular method for dealing with this heterogeneity (finite mixtures) yielded potentially unreliable point estimates of abundance that may not be comparable across surveys, even in data sets with 136–350 total detections, 3–5 detections per individual, 97–283 recaptures, and 80–254 spatial recaptures. In these same study areas with high sample sizes, we expected that landscape features would not severely constrain animal movements and modelling non-Euclidian distance would not consistently improve inference. Our results suggest caution in applying non-Euclidean SCR models when there is no clear landscape covariate that is known to strongly influence the movement of the focal species, and in applying finite mixture models except when abundant data are available.

Noninvasive genetic sampling for flying foxes: a valuable method for monitoring demographic parameters

Article

Full-text available

Jul 2021

Establishing effective wildlife conservation measures requires accurate demographic information such as population size and survival probability: parameters that can be extremely difficult to obtain. This is especially the case for threatened species, which are often rare and sometimes occupy inaccessible areas. While noninvasive genetic sampling (NIGS) techniques are promising tools for providing demographic data, these methods may be unreliable in certain situations. For instance, fecal samples of frugivo-rous species in tropical areas degrade rapidly, affecting the usability of the genetic material. In this study, we compared (1) NIGS capture-mark-recapture (NIGS-CMR) with conventional CMR to determine their potential in estimating demographic parameters of fruit bats, and (2) the precision of these demographic parameters and the associated costs given varying sampling designs through simulations. Using Living-stone's fruit bats (Pteropus livingstonii) fecal samples, microsatellite markers were tested and genotyping success and error rates were assessed. The average genotyping success rate was 77%, and the total geno-typing error rate for all loci was low (allelic dropout rate = 0.089, false alleles rate = 0.018). Our results suggested that five loci were required to identify individuals. Simulations showed that monitoring the species over a 9-yr period with a recapture rate of 0.20 or over a 6-yr period with a recapture rate of 0.30 seems appropriate to obtain valuable demographic parameters. Overall, in comparison to conventional CMR, NIGS-CMR offers a better method for estimating demographic parameters and subsequently for conducting long-term population monitoring in flying foxes due to the fact that (1) sample collection is easy and the level of genotyping errors in the laboratory is low and (2) it is cheaper, less time-consuming, and less disturbing to individual animals. We strongly advocate an approach that couples a pilot study with simulations as done in this study in order to choose the most efficient monitoring method for a given species or context.

Amplification of the Zfy and Zfx Genes for Sex Identification in Humans, Cattle, Sheep and Goats

Article

Full-text available

Jan 1991
Bio Tech

We describe a quick and efficient method of determining the sex of DNA samples from humans, cattle, sheep, and goats. Using universal primers we have amplified 447 or 445 bp fragments from male or female genomic DNA corresponding to the ZFY or ZFX genes. Restriction fragment length polymorphism (RFLP) analysis of the fragments yielded specific banding patterns between the two sexes in these species. Horse, pig and rainbow trout fragments did not show RFLPs with the group of enzymes chosen for the other species. Use of this method would allow animal breeders to determine the sex of preimplantation embryos before transfer to recipient females. Human embryos at risk for sex-linked disorders could be sexed soon after in vitro fertilization (IVF) and options considered before implantation.

Excrement analysis by PCR [4]

Article

Full-text available

Oct 1992

Mouse Zfx protein is similar to Zfy-2: Each contains an acidic activating domain and 13 zinc fingers

Article

Full-text available

Mar 1990

The Zfy gene is located on the Y chromosome of placental mammals and encodes a zinc finger protein which may serve as the primary sex-determining signal. A related gene, Zfx, is similarly conserved on the X chromosome. Unlike that in most mammals, the mouse genome contains four homologous zinc finger loci: Zfy-1, Zfy-2, Zfx, and Zfa (on an autosome). We report that, in contrast to the mouse Zfy genes, Zfx is widely transcribed in embryos, newborns, and adults, both male and female. Moreover, Zfx transcripts contain long 3' untranslated sequences which are phylogenetically conserved. Zfa is a processed gene derived from Zfx. An analysis of cDNA clones demonstrated that Zfx encodes a 799-amino-acid protein that is 70% identical to the mouse Zfy-1 and Zfy-2 proteins. Zfx, Zfy-1, and Zfy-2 contain highly acidic amino-terminal domains and carboxy-terminal regions containing 13 zinc fingers. When fused to the DNA-binding domain of GAL4, the acidic domains of Zfx and Zfy-2 activated transcription in yeast cells.

Microsatellite analysis of population-structure in Canadian Polar Bears

Article

Full-text available

Jul 1995

Attempts to study the genetic population structure of large mammals are often hampered by the low levels of genetic variation observed in these species. Polar bears have particularly low levels of genetic variation with the result that their genetic population structure has been intractable. We describe the use of eight hypervariable microsatellite loci to study the genetic relationships between four Canadian polar bear populations: the northern Beaufort Sea, southern Beaufort Sea, western Hudson Bay, and Davis Strait-Labrador Sea. These markers detected considerable genetic variation, with average heterozygosity near 60% within each population. Interpopulation differences in allele frequency distribution were significant between all pairs of populations, including two adjacent populations in the Beaufort Sea. Measures of genetic distance reflect the geographic distribution of populations, but also suggest patterns of gene flow which are not obvious from geography and may reflect movement patterns of these animals. Distribution of variation is sufficiently different between the Beaufort Sea populations and the two more eastern ones that the region of origin for a given sample can be predicted based on its expected genotype frequency using an assignment test. These data indicate that gene flow between local populations is restricted despite the long-distance seasonal movements undertaken by polar bears.

Rapid purification of high-activity Taq DNA polymerase

Article

Full-text available

Nov 1993

Fred Pluthero

Reliable genotyping of samples with very low DNA quantities using PCR

Article

Full-text available

Sep 1996

Our purpose was to identify an experimental procedure using PCR that provides a reliable genotype at a microsatellite locus using only a few picograms of template DNA. Under these circumstances, it is possible (i) that one allele of a heterozygous individual will not be detected and (ii) that PCR-generated alleles or ‘false alleles’ will arise. A mathematical model has been developed to account for stochastic events when pipetting template DNA in a very dilute DNA extract and computer simulations have been performed. Laboratory experiments were also carried out using DNA extracted from a bear feces sample to determine if experimental results correlate with the mathematical model. The results of 150 typing experiments are consistent with the proposed model. Based on this model and the level of observed false alleles, an experimental procedure using the multiple tubes approach is proposed to obtain reliable genotypes with a confidence level of 99%. This multiple tubes procedure should be systematically used when genotyping nuclear loci of ancient or forensic samples, museum specimens and hair or feces of free ranging animals.

Genetic tagging of humpback whales

Article

Full-text available

Sep 1997

The ability to recognize individual animals has substantially increased our knowledge of the biology and behaviour of many taxa. However, not all species lend themselves to this approach, either because of insufficient phenotypic variation or because tag attachment is not feasible. The use of genetic markers ('tags') represents a viable alternative to traditional methods of individual recognition, as they are permanent and exist in all individuals. We tested the use of genetic markers as the primary means of identifying individuals in a study of humpback whales in the North Atlantic Ocean. Analysis of six microsatellite loci among 3,060 skin samples collected throughout this ocean allowed the unequivocal identification of individuals. Analysis of 692 'recaptures', identified by their genotype, revealed individual local and migratory movements of up to 10,000 km, limited exchange among summer feeding grounds, and mixing in winter breeding areas, and also allowed the first estimates of animal abundance based solely on genotypic data. Our study demonstrates that genetic tagging is not only feasible, but generates data (for example, on sex) that can be valuable when interpreting the results of tagging experiments.

PHYLOGENETIC RELATIONSHIPS OF NORTH AMERICAN URSIDS BASED ON ANALYSIS OF MITOCHONDRIAL DNA

Article

Feb 1991
EVOLUTION

Microsatellite Analysis of Paternity and Reproduction in Arctic Grizzly Bears

Article

Jul 1995
J HERED

We report data from analyses of microsatellite loci of 30 grizzly bear family groups which demonstrate that each cub in a litter can be sired independently, and we derive estimates of maximum reproductive success for males, from an Arctic population in northwestern Alaska that is minimally affected by human activities. These analyses were made possible by the use of single-locus primers that amplified both of an individual's alleles at eight microsatellite loci and by detailed knowledge of maternal/offspring relationships that allowed the identification of paternal alleles. No single male was responsible for more than approximately 11% of known off-spring, and no more than 49% of breeding-age males successfully bred. These data contribute to an understanding of the genetic and demographic basis of male reproductive success, which is of vital importance in the maintenance of small, isolated grizzly bear populations.

Phylogenetic Relationships of North American Ursids Based on Analysis of Mitochondrial DNA

Article

Feb 1991

Spatial and Temporal Interaction of Male and Female Grizzly Bears in Northwestern Montana

Article

Jan 1997

Spatial requirements of grizzly bears (Ursus arctos horribilis) in Montana are poorly understood, yet habitat management is based on attributes of female home ranges. We evaluated home range size, overlap, and spatial/temporal use of overlap zones (OZ) of grizzly bears inhabiting the Swan Mountains of Montana. Annual home ranges of adult males were larger (x̄ = 768 km2), and adult female ranges smaller (x̄ = 125 km2), than those of subadults. Overlap in annual home ranges of adjacent female grizzly bears averaged 24% $(37\ \text{km}^{2})$ , varied from 0 to 94%, and was less when one or both females had young. Female home range overlap was greatest when one of both members of a pair were subadults. Male home range overlap with females averaged 19% for adult males and 30% for subadult males. Most simultaneous use of the OZ occurred during summer. We investigated both spatial and temporal interaction of grizzly bears having overlapping home ranges. Thirty-seven of 49 (76%) adjacent female pairs showed symmetrical and random spatial use of the OZ indicating lack of territoriality. In one of 49 (2%) cases, simultaneous use of the OZ exceeded solitary use. Temporal use of the OZ was random in 44 of 49 (90%) female interactions. Avoidance behavior within the OZ of home ranges was indicated for 1 of 2 pairs of sisters following dispersal from their mother. Most male/female pairs exhibited symmetrical and random use of the OZ. In 12 of 21 (57%) cases where the female home range was enclosed within a male range, the male exhibited spatial attraction to the female range. There was no evidence of spatial avoidance of the OZ for male pairs. Habitat availability in different portions of overlapping home ranges helped explain the observed patterns of spatial and temporal interaction among grizzly bears. The overlap zone of home ranges had higher proportional availability of avalanche chutes, rock/forb lands, and slabrock than home range areas outside the OZ. These home range and behavioral characteristics occurred at a female-dominated population density of 2-3 solitary grizzly bears/100 km2.

Variation in Genetic Diversity across the Range of North American Brown Bears

Article

Jul 2008
CONSERV BIOL

Understanding the factors that influence the rate at which natural populations lose genetic diversity is a central aspect of conservation genetics because of the importance of genetic diversity in maintaining evolutionary potential and individual fitness. Concerns about loss of genetic diversity are particularly relevant to large carnivores, such as brown bears (Ursus arctos), that are distributed at low densities and are highly susceptible to human‐caused population fragmentation. We used eight highly variable nuclear microsatellite markers to study current levels of genetic variation across the North American range of brown bears. The highest levels of within‐population genetic diversity (H e = 0.76) were found in northern populations in the core of the North American distribution. Diversity was significantly lower in populations at the southern fringe of the distribution, in the Northwest Territories, and in southwest Alaska. Diversity was lower still in the Yellowstone Ecosystem population (H e = 0.55), an isolated remnant of the larger distribution that recently extended south from the Canadian border into Mexico. The insular population on the Kodiak Archipelago had very low genetic diversity (H e = 0.26). The Yellowstone and Kodiak data suggest that the effective population size for brown bears is much smaller than previously suspected. These results indicate that the levels of diversity in most undisturbed populations can be maintained only through connections to populations on the scale of the current North American distribution. At the same time, the Kodiak data demonstrate that populations well under the size recommended for long‐term conservation can persist and thrive for thousands of years, although the probability of such persistence remains unknown. Variación en la Diversidad Genética a lo largo del Rango de Distribución del Oso Café de Norteamérica Entender los factores que influeyen en la tasa a la cual las poblaciones naturales pierden diversidad genética es un aspecto central de la genética de la conservación debido a la importancia de la diversidad genética en el mantenimiento del potencial evolutivo y la condición individual. Las preocupaciones sobre la pérdida de la diversidad genética tiene particular relevancia para los carnivoros mayores, como lo es el oso café (Ursus arctos), que se distribuye a bajas densidades y que es altamente susceptible a la fragmentación poblacional causada por humanos. Para estudiar los niveles actuales de variación genética a lo largo del rango de distribución de los osos cafés, usamos ocho marcadores microsatélite nucleares altamente variables. Los niveles mas altos de diversidad genética intrapoblacional (H e = 0.76) se encontraron en poblaciones del Norte en el centro de la distribución en Norteamérica. La diversidad fue significativamente menor en poblaciones limítrofes sureñas, en los territorios del Noroeste y el Suroeste de Alaska. La diversidad fue mas baja aún en la población de Yellowstone (H e = 0.55), un remanente de una distribución mayor que recientemente se extendía hacia el sur desde la frontera Canadiense hacia México. La población insular en el archipielago de Kodiak tuvo una diversidad genética muy baja (H e = 0.26). Los datos de Yellowstone y Kodiak sugieren que el tamaño poblacional efectivo para el oso café es mucho mas pequeño que lo previamente estimado. Estos resultados indican que los niveles de diversidad en la mayoría de las poblaciones no perturbadas pueden ser mantenidos mediante conecciones con poblaciones en la escala de la distibución actual en Norteamérica. Al mismo tiempo, los datos de Kodiac demuestran que poblaciones muy por debajo del tamaño recomendado para la conservación a largo plazo pueden persistir por miles de años, aunque su probabilidad de persistencia es aún desconocida.

Bear Conservation Genetics

Article

Aug 1992

Chelex 100 as a Medium for Simple Extraction of DNA for PCR-Based Typing from Forensic Material

Article

May 1991

Procedures utilizing Chelex 100 chelating resin have been developed for extracting DNA from forensic-type samples for use with the PCR. The procedures are simple, rapid, involve no organic solvents and do not require multiple tube transfers for most types of samples. The extraction of DNA from semen and very small bloodstains using Chelex 100 is as efficient or more efficient than using proteinase K and phenol-chloroform extraction. DNA extracted from bloodstains seems less prone to contain PCR inhibitors when prepared by this method. The Chelex method has been used with amplification and typing at the HLA DQ alpha locus to obtain the DQ alpha genotypes of many different types of samples, including whole blood, bloodstains, seminal stains, buccal swabs, hair and post-coital samples. The results of a concordance study are presented in which the DQ alpha genotypes of 84 samples prepared using Chelex or using conventional phenol-chloroform extraction are compared. The genotypes obtained using the two different extraction methods were identical for all samples tested.

DNA typing from single hairs

Article

May 1988

The characterization of genetic variation at the DNA level has generated significant advances in gene and disease mapping, and in the forensic identification of individuals. The most common method of DNA analysis, that of restriction fragment length polymorphism (RFLP), requires microgram amounts of relatively undegraded DNA for multi-locus typing, and hundreds of nanograms for single-locus comparisons. Such DNA frequently cannot be obtained from forensic samples such as single hairs and blood stains, or from anthropological, genetic or zoological samples collected in the field. To detect polymorphic DNA sequences from single human hairs, we have used the polymerase chain reaction (PCR), in which specific short regions of a gene can be greatly amplified in vitro from as little as a single molecule of DNA. We have detected genetically variable mitochondrial and nuclear DNA sequences from the root region of shed, as well as freshly-plucked, single hairs; mitochondrial DNA (mtDNA) sequences have been detected in a sample from a single hair shaft. We have used three different means of DNA typing on these samples: the determination of amplified DNA fragment length differences, hybridization with allele-specific oligonucleotide probes, and direct DNA sequencing.

Paternity exclusion in a community of wild chimpanzees using hypervariable simple sequence repeats

Article

Nov 1994

We report the use of hypervariable simple sequence repeat (SSR) nuclear loci to study paternity in a community of wild chimpanzees (Pan troglodytes schweinfurthii) in Gombe National Park, Tanzania. All 43 living members of a habituated community were sampled and 35 were genotyped at 8 SSR loci using DNA amplified from hair. Paternity exclusions were performed for 25 chimpanzees including 10 for whom the mother was also genotyped. In each case 12-20 males were potential fathers based on their age and/or direct observation of sexual behaviour. 179 tests involving potential father/offspring combinations were performed. In four cases the data permit the probable identification of the previously undetermined father; these are the first such determinations for free-ranging chimpanzees, and the first based on non-invasive sampling. In another four cases we were able to exclude all but two to five potential fathers, and in the remaining cases we were able to exclude all living males. For molecular ecologists SSR genotype databases offer important advantages over currently popular minisatellite DNA finger-printing: they can be analysed unequivocally using traditional population genetics techniques and they can be expanded through time and space by other researchers.

Sexing Free-Ranging Brown Bears Ursus-Arctos Using Hairs Found In The Field

Article

Jan 1994

As an aid to the management of the Pyrenean population of the brown bear Ursus arctos, a sexing method based on the amplification of a Y chromosome specific sequence has been developed, and tested using hairs found in the field as a source of DNA. This method involves a two-step polymerase chain reaction (PCR) which allows the detection of a very small amount of DNA, probably a single SRY gene molecule. The sex can reliably be identified using about 50pg of DNA extract as template. It is possible that this approach could, with adjustments, be used to identify the sex of other species of eutherian mammals.

Molecular scatology: The use of molecular genetic analysis to assign species, sex and individual identity to seal faeces

Article

Apr 1997

Seals and commercial fisheries are potential competitors for fish and cephalopods. Research into the diet of British seal species has been based on conventional dietary analyses, but these methods often do not allow assignment of species identity to scat samples. We present a protocol for obtaining DNA from seal scat (faecal) samples which can be used in polymerase chain reactions to amplify both nuclear and mitochondrial DNA. This can provide a method of identifying the species, sex and individual identity of the seal, from a particular scat sample. Combined with conventional dietary analyses these techniques will allow us to assess sources of variation in seal diet composition. Scat samples have been collected from intertidal haul-out sites around the inner Moray Firth, north-east Scotland. We have assessed methods to extract and purify faecal DNA, a combination of DNA from the individual seal, prey items, and gut bacteria, for use in PCR. Controls using faecal and blood samples from the same individual have enabled microsatellite primer sets from four pinniped species to be tested. Approximately 200 scat samples have been examined for species identity and individual matches. This study will provide essential information for the assessment of interactions between seals and commercial or recreational fisheries.

Noninvasive genetic tracking of the endangered Pyrenean brown bear population

Article

Oct 1997

Pyrenean brown bears Ursus arctos are threatened with extinction. Management efforts to preserve this population require a comprehensive knowledge of the number and sex of the remaining individuals and their respective home ranges. This goal has been achieved using a combination of noninvasive genetic sampling of hair and faeces collected in the field and corresponding track size data. Genotypic data were collected at 24 microsatellite loci using a rigorous multiple-tubes approach to avoid genotyping errors associated with low quantities of DNA. Based on field and genetic data, the Pyrenean population was shown to be composed at least of one yearling, three adult males, and one adult female. These data indicate that extinction of the Pyrenean brown bear population is imminent without population augmentation. To preserve the remaining Pyrenean gene pool and increase genetic diversity, we suggest that managers consider population augmentation using only females. This study demonstrates that comprehensive knowledge of endangered small populations of mammals can be obtained using noninvasive genetic sampling.

Microsatellite scoring errors associated with noninvasive genotyping based on nuclear DNA amplified from shed hair

Article

Sep 1997

In the context of a study of wild chimpanzees, Pan troglodytes verus, we found that genotypes based on single PCR amplifications of microsatellite loci from single shed hair have a high error rate. We quantified error rates using the comparable results of 791 single shed hair PCR amplifications of 11 microsatellite loci of 18 known individuals. The most frequent error was the amplification of only one of the two alleles present at a heterozygous locus. This phenomenon, called allelic dropout, produced false homozygotes in 31% of single-hair amplifications. There was no difference in the probability of preferential amplification between longer and shorter alleles. The probability of scoring false homozygotes can be reduced to below 0.05 by three separate amplifications from single hairs of the same individual or by pooling hair samples from the same individual. In this study an additional 5.6% of the amplifications gave wrong genotypes because of contamination, labelling and loading errors, and possibly amplification artefacts. In contrast, amplifications from plucked hair taken from four dead individuals gave consistent results (error rate < 0.01%, n = 120). Allelic dropout becomes a problem when the DNA concentration falls below 0.05 ng/10 microL in the template as it can with shed hair, and extracts from faeces and masticated plant matter.

Techniques for application of faecal DNA methods to field studies of Ursids

Article

Dec 1997

We describe methods for the preservation, extraction and amplification of DNA from faeces that facilitate field applications of faecal DNA technology. Mitochondrial, protein encoding and microsatellite nuclear DNA extracted and amplified from faeces of Malayan sun bears and North American black bears is shown to be identical to that extracted and amplified from the same individual's tissue or blood. A simple drying agent, silica beads, is shown to be a particularly effective preservative, allowing easy and safe transport of samples from the field. Methods are also developed to eliminate the risk of faecal DNA contamination from hair present in faeces.

Plucked hair samples as a source of DNA: Reliability of dinucleotide microsatellite genotyping

Article

Oct 1998

To test whether plucked hairs are a reliable source of DNA for genotyping microsatellite loci, we carried out experiments using one, three, or 10 hairs per extract for 50 alpine marmots. For each extract, seven independent genotypings were performed for the same locus (multiple-tubes approach). Two types of genotyping errors were recorded: a false homozygote defined as the detection of only one allele of a true heterozygote, and a false allele defined as a PCR-generated allele that was not one of the alleles of the true genotype. Using DNA extracted from one, three, or 10 hairs the overall error rate was 14.00%, 4.86%, and 0.29%, respectively. Based on our results, we conclude that 10 hairs should be used to obtain consistently reliable genotypings using the single-tube approach, and that a single plucked hair could represent a reliable source of DNA if the multiple-tubes approach is used. For future studies of dinucleotide repeat diversity using DNA extracted from one to three shed or plucked hairs, we strongly recommend initiating an appropriate pilot study to quantify the error rate and to determine the reliability of the single-tube approach.

Paetkau D, Shields GF, Strobeck C.. Gene flow between insular, coastal and interior populations of brown bears in Alaska. Mol Ecol 7: 1283-1292

Article

Nov 1998

The brown bears of coastal Alaska have been recently regarded as comprising from one to three distinct genetic groups. We sampled brown bears from each of the regions for which hypotheses of genetic uniqueness have been made, including the bears of the Kodiak Archipelago and the bears of Admiralty, Baranof and Chichagof (ABC) Islands in southeast Alaska. These samples were analysed with a suite of nuclear microsatellite markers. The 'big brown bears' of coastal Alaska were found to be part of the continuous continental distribution of brown bears, and not genetically isolated from the physically smaller 'grizzly bears' of the interior. By contrast, Kodiak brown bears appear to have experienced little or no genetic exchange with continental populations in recent generations. The bears of the ABC Islands, which have previously been shown to undergo little or no female-mediated gene flow with mainland populations, were found not to be genetically isolated from mainland bears. The data from the four insular populations indicate that female and male dispersal can be reduced or eliminated by water barriers of 2-4 km and 7 km in width, respectively.

Sex determination in spotted hyena () by restriction fragment length polymorphism of amplified ZFX/ZFY loci

Article

Mar 1994
THERIOGENOLOGY

We describe a quick and efficient method of determining the sex of DNA samples in the hyena. By choosing primers from sequences that are conserved between the human and bovine ZFY and ZFX genes, we amplified a 448 bp fragment from 1 male and 2 female hyenas. Using comparative sequencing, single base pair polymorphisms between the amplified ZFY and ZFX were established. Restriction fragment length polymorphism (RFLP) analysis with PstI and TaqI confirmed the sequence data and yielded specific banding patterns between the 2 sexes in the hyena.

Molecular markers, natural history and evoluJ. C. tion. Chapman and Hall. New'Yhrk Monitoring techniques of small bear popuJ.J. lations: application in the Pyrenees Mountains

Jan 1994
5-6

A ~ L. 1994. Molecular markers, natural history and evoluJ. C. tion. Chapman and Hall. New'Yhrk. New York. CLZ~ARIU. 1994. Monitoring techniques of small bear popuJ.J. lations: application in the Pyrenees Mountains. International Conference on Bear Rese:irch and Jlanageme~lt 9(2):5-1-581.

Molecular contributions to conservation

Jan 1998
425

H,%I(;. S. h1. 1998. Molecular contributions to conservation. Ecology-9:ilS-425.

Estimating grizzly bear population size using camera sightings

Jan 1994
Wildl Soc Bull
83

M.m. R. D.. S. (:. ~IIYTA. T. L. hLiu1n; mu K. E. ALSE. 1994. Estimating grizzly bear population size using camera sightings.Wildlife Society Bulletin 22:'i-83.

Paternity exclusion in a communit)-of wild chimpanzees

J J Moori

J. J. MOORI,. Paternity exclusion in a communit)-of wild chimpanzees. hlolecular Ecology 3:469-4'8. NIETIXLD. N. SILLY.

h key for the identification of hair of m:~mmals of a snow-leopard (Pcirztlzel-nI L I Z C~C Z ) habitat in Nepal

Jan 1993
91

M.K. 1993. h key for the identification of hair of m:~mmals of a snow-leopard (Pcirztlzel-nI L I Z C~C Z ) habitat in Nepal.Joumal of Zoology Londo~i 231:'l-91

Zlark-recapture density estimation for animals with large home ranges

Jan 1992
4

G,\RSHELIS. D. L. 1992. Zlark-recapture density estimation for animals with large home ranges. Pages 1098-1 11 1 in D.R. McCullough and R.H. Barrett. editors. Wildlife 2001: Populations. Elsevier,4pplied Science, London. England.

I(;H.AND BER~I.I)IYGES. H. A. ERLILII. 1988. DNA typing from single hairs

NATURE
546

C H E Vopi G
Sessab

C H. VOPI G. E SESSAB.I(;H.AND BER~I.I)IYGES. H. A. ERLILII. 1988. DNA typing from single hairs. Nature 332:iiS-546.

Capture-recapture and removal methods for sampling closed populations

Jan 1982

G C White
D R Anderson
K Burnwm
D L Otis

WHITE, G. C., D. R.ANDERSON, K. I? BURNWM,AND D. L. OTIS. 1982. Capture-recapture and removal methods for sampling closed populations. Los Alamos National Laboratory, Los Alamos, New Mexico. LA-8787-NEW.

Genetic tagging of free-ranging Black and Brown Bears

Abstract

No full-text available

Recommended publications

A mark–recapture study of the caecilian amphibian Gegeneophis ramaswamii (Amphibia: Gymnophiona: Cae...

MEASUREMENT OF THE WAVE WASH GENERATED BY FAST FERRIES WITH UPWARD LOOKING SONAR INSTRUMENTATION

Ecotypic mode of regional differentiation of black cottonwood (Populus trichocarpa) due to restricte...

Detection of emamectin benzoate tolerance emergence in different life stages of sea lice, Lepeophthe...