No full-text available
To read the full-text of this research,
you can request a copy directly from the authors.
Genetic Subdivisions among Small Canids: Mitochondrial DNA Differentiation of Swift, Kit, and Arctic Foxes
Abstract
Gene flow can effectively suppress genetic divergence among widely separated populations in highly mobile species. However, the same may not be true of species that typically disperse over shorter distances. Using mtDNA restriction-site and sequence analyses, we evaluate the extent of divergence among populations of two small relatively sedentary North American canids, the kit and swift foxes (genus Vulpes). We determine the significance of genetic differentiation among populations separated by distance and those separated by discrete topographic barriers. Our results show the among-population component of genetic variation in kit and swift foxes is large and similar to that of small rodents with limited dispersal ability. In addition, we found two distinct groupings of genotypes, separated by the Rocky Mountains, corresponding to the traditional division between kit and swift fox populations. Previous workers have characterized these morphologically similar populations either as separate species or subspecies. Our mtDNA data also suggest that kit and swift fox populations hybridize over a limited geographic area. However, the sequence divergence between kit and swift foxes is similar to that between these taxa and the arctic fox (Alopex lagopus), a morphologically distinct species commonly placed in a separate genus. This result presents a dilemma for species concepts, and we conclude that kit and swift foxes should be recognized as separate species.
... The swift fox has an elongated skull with small widely spaced teeth (Carbyn 1998). Skull sizes from male Colorado swift foxes were measured to be 112 m, zygomatic breadth (64mm) and interorbital constriction (24mm), post orbital constriction (23mm) (Carbyn 1998).Brown et al. 1987, Dragoo et al. 1990, Mercure et al. 1993). Although taxonomic arguments still exist at this time, most systematists now agree in favor of separate specific status for the swift fox and kit fox (Thornton and Creel 1975, Egoscue 1979, Mercure et al. 1993). ...
... Skull sizes from male Colorado swift foxes were measured to be 112 m, zygomatic breadth (64mm) and interorbital constriction (24mm), post orbital constriction (23mm) (Carbyn 1998).Brown et al. 1987, Dragoo et al. 1990, Mercure et al. 1993). Although taxonomic arguments still exist at this time, most systematists now agree in favor of separate specific status for the swift fox and kit fox (Thornton and Creel 1975, Egoscue 1979, Mercure et al. 1993). Electrophoretic studies of serum proteins and hemoglobin have shown that the swift fox is distinct from the kit fox (Thornton and Creel 1975). ...
... ough taxonomic arguments still exist at this time, most systematists now agree in favor of separate specific status for the swift fox and kit fox (Thornton and Creel 1975, Egoscue 1979, Mercure et al. 1993). Electrophoretic studies of serum proteins and hemoglobin have shown that the swift fox is distinct from the kit fox (Thornton and Creel 1975). Mercure et al. (1993) conducted mitochondrial DNA tests and found that the genetic variation between the two foxes was large, and similar to that of small rodents with limited dispersal capabilities. They also found two distinct groupings of genotypes, separated by the Rocky Mountains and corresponding to the traditionally designated kit fox and swift fox po ...
... The erosion of genetic diversity has occurred in many species, increasing extinction risk because of the maintenance of isolated subpopulations with reduced effective population numbers. High vagility may also be influential in promoting hybridisation and affecting genetic composition (Lehman et al., 1991; Jenks and Wayne, 1992; Wayne, 1992; Mercure et al., 1993; Wilson et al., 2000; Wayne and Brown, 2001), having an impact on interspecific gene flow and affecting the gene pools of species (Jenks and Wayne, 1992; Wilson et al., 2000; Wayne and Brown, 2001). Phylogeographic concepts are increasingly being applied to the biological conservation of species (Beheregaray, 2008). ...
... Since nowadays natural processes are strongly affected by anthropic action, hybridisation has become one of the main causes of extinction risk (Wolf et al., 2001). Hybridisation, with and without genetic introgression has been frequently reported in Canidae (Lehman et al., 1991; Mercure , 1993; Roy et al., 1996; Sillero-Zubiri et al., 1996; Wayne et al., 1997; Wayne and Brown, 2001; Hailer and Leonardo, 2008; Kays et al., 2010; Wheeldon et al., 2010) leading in some cases to put the survival of species or populations at risk (Nowak, 1979; Wayne and Jenks, 1991; Gottelli et al., 1994; Roy et al., 1994). Wolves and domestic dogs are very closely related, the latter having been domesticated from the former probably in several independent episodes of domestication (Vilà et al., 1997; Wayne and Ostrander, 1999). ...
Phylogeographic studies are currently used to infer historical demographic processes such as gene flow, determination of effective population sizes, colonisation dynamics, and population bottlenecks, as well as for the determination of species boundaries and the identification of possible conservation units. We present a review of the main contributions of this approach, and its applications and implications for canid conservation. Studies performed in canids have shown that the number of named subspecies is often larger than that of phylogeographic units. In recent times, the fragmentation of habitats has increased and one of the major concerns of conservation biologists is the occurrence of inbreeding. Large-sized canids have demonstrated to have enough physiological and behavioural plasticity to survive in open habitats, while smaller species that depend on closed habitats are more susceptible to fragmentation. Another process that strongly affects canids is hybridisation because contacts between wild and domestic populations have increased, leading to gene introgression into natural populations. Canids are a key element in food chains; thus, a precise knowledge of intraspecific subdivision is of the utmost relevance for their management before these carnivores disappear, with unknown social, economic, and ecological consequences. In this sense, phylogeographic studies constitute a fundamental tool.
... Factors other than habitat loss, however, also might contribute to the range reduction of swift foxes, such as competition with coyotes (Brown et al. 1987; Sovada et al. 1998). Although swift and kit foxes (Vulpes macrotis ) were considered conspecifics based on initial genetic analysis (Dragoo et al. 1990), a more recent study using larger sample sizes and more advanced genetic analyses concluded they were separate species (Mercure et al. 1993). Mitochondrial deoxyribonucleic acid differentiation between these 2 species was similar to that between these taxa and the arctic fox (Alopex lagopus), a species commonly placed in a different genus (Mercure et al. 1993). ...
... Although swift and kit foxes (Vulpes macrotis ) were considered conspecifics based on initial genetic analysis (Dragoo et al. 1990), a more recent study using larger sample sizes and more advanced genetic analyses concluded they were separate species (Mercure et al. 1993). Mitochondrial deoxyribonucleic acid differentiation between these 2 species was similar to that between these taxa and the arctic fox (Alopex lagopus), a species commonly placed in a different genus (Mercure et al. 1993). The latter study supported previous studies that supported separate species status based on morphological data (Rohwer and Kilgore 1973; Stromberg and Boyce 1986; Thornton and Creel 1975). ...
Habitat loss might be one of the primary reasons for the decline of the swift fox (Vulpes velox) in the western Great Plains of North America. From 1998 to 2001, we monitored 42 swift foxes in a landscape interspersed with native short-grass prairies, nonnative grasslands enrolled in the Conservation Reserve Program, irrigated agricultural fields, and dryland agricultural fields. Survival estimates ranged from 0.52 to 0.66 for both adults and juveniles, and the primary causes of death were vehicle collisions (42% deaths) and coyote (Canis latrans) predation (33%). Annual home-range size was similar for males and females (10.8 and 10.5 km2, respectively). Within the study area, swift foxes selected only short-grass prairies and had lower-than-expected use or complete avoidance of all other habitat types. Our results indicate swift foxes are more specialized in habitat selection than other North American canids; thus, protection of native short-grass prairies might be necessary for their long-term existence.
... Descriptive genetic studies using modern molecular techniques can help to define appropriate genetic subdivisions . In large North American canids, patterns of mitochondrial DNA variation suggest 'that gene flow may occur across the continent and suppress genetic differentiation among even widely separated populations' (Mercure et al., 1993). For example, widely separated populations of coyotes (Canis latrans) show little mitochondrial DNA differentiation (Lehman et al., 1991). ...
... For example, widely separated populations of coyotes (Canis latrans) show little mitochondrial DNA differentiation (Lehman et al., 1991). However, in kit foxes (Vulpes macrotis), a small canid with limited dispersal capabilities, there are significant genetic differences between populations that reflect geographical barriers (Mercure et al., 1993). Molecular genetic differentiation among populations must be interpreted critically because it does not always reflect historical barriers to gene flow. ...
Carnivore translocations are usually risky and expensive, and a number of biological and non-biological factors can influence success. Biological considerations include knowledge of genetics, demographics, behavior, disease, and habitat requirements. This information is critical for determining if the translocation should be attempted, if it could be successful, and how it could be implemented in an efficient and effective manner. We stress that individual species will vary in their responses, and ideas should be tested scientifically. The technical considerations of translocation are closely related to the biological questions. They include legal framework, fiscal and intellectual resources, monitoring capacity, goals of the translocation, logistic challenges, and organizational structure of decision-making. We do not discuss socio-economic aspects of translocation because those challenges require detailed discussion in a separate paper. We suggest that because large carnivores often play key roles in regulating ecological interactions between trophic levels, restoring them is more than a single-species activity. By restoring carnivores in viable numbers, we can take a large step toward recovering ecological integrity of geographically extensive landscapes.
... Second, vegetation changes across the Tehachapi Pass could encourage hybridization between the San Joaquin kit fox and other sub-species of kit fox. No foxes crossed this pass in our current-conditions scenario-a conclusion supported by the literature on kit fox genetics, which suggests that these populations have been separated for some time [25]. Modeled foxes did occasionally cross the pass in one of the climate change scenarios (CCSM), which shows grassland and desert scrub vegetation over the Tehachapi Pass. ...
Animal and plant species often face multiple threats simultaneously. We explored the relative impact of three major threats on populations of the endangered San Joaquin kit fox. This species was once widely distributed across the southern San Joaquin Valley, California, USA, but agriculture and urban development have replaced much of its natural habitat. We modeled impacts of climate change, land-use change, and rodenticide exposure on kit fox populations using a spatially explicit, individual-based population model from 2000 to 2050 for the Central Valley, California. Our study indicates that land-use change will likely have the largest impact on kit fox populations. Land development has the potential to decrease populations by approximately 15% under a compact growth scenario in which projected population increases are accommodated within existing urban areas, and 17% under a business-as-usual scenario in which future population growth increases the developed area around urban centers. Plausible scenarios for exposure to pesticides suggest a reduction in kit fox populations by approximately 13%. By contrast, climate change has the potential to ameliorate some of these impacts. Climate-change induced vegetation shifts have the potential to increase total available kit fox habitat and could drive population increases of up to 7%. These vegetation shifts could also reduce movement barriers and create opportunities for hybridization between the endangered San Joaquin kit fox and the more widely distributed desert kit fox, found in the Mojave Desert. In contrast to these beneficial impacts, increasing climate extremes raise the probability of the kit fox population dropping below critical levels. Taken together, these results paint a complex picture of how an at-risk species is likely to respond to multiple threats.
... Phylogenetic anal... yses of genetic data suggest a close relationship between kit fox (m acrotis), swift fox (~velox), and Arctic fox (A. lagopus- Mercure et al. 1993). ...
... Accordingly, we chose dispersal thresholds for massasauga of 2000, 4000, and 6000 cost units, corresponding to dispersal ability in optimal habitat of between 2 and 6 kilometers. For swift fox, Dark-Smiley and Keinath (2003) reported dispersal distances for adult swift foxes averaging 11 km, with an observed maximum distance of 64 km (Mercure et al. 1993). Kamler et al. (2004) report movement of one female swift fox as far as 20 km, before returning to her natal range where she remained philopatric. ...
In reading this book, you have observed that the spatial data used in landscape ecology
come from many sources and in many forms. For many organisms, these data take
the form of presence or absence at a location, or numbers of individuals at that
same location. For species such as trees, where huge size differences exist between
individuals, indices such as basal area, metric tons per hectare, or canopy cover
are more useful than counts. For any measured species that is handled (or sampled
noninvasively; Taberlet et al. 1999; Kendall and McKelvey 2008; Schwartz and
Monfort 2008), an additional data source is available: the genetic data stored in
the organism’s tissue. If genetic samples are taken, then these data become another
type of spatial data associated with the location where the organism was sampled.
As such, genetic data can be analyzed with many of the same approaches used to
analyze data of other types that vary spatially.
Genetic data, however, also have certain valuable properties that allow different
sorts of analyses than are possible using many other data sources. Most data are
representative of the present: where an organism is at the time of sampling, and
what attributes are correlated with that presence. Genetic data allow us to look into
the animal’s past and ask where it was born, and where its parents were born. They
also allow us to determine the individual’s likely response to stressors such as heat,
drought, or disease.
Landscape genetics has been viewed as a hybrid between population genetics
and landscape ecology (Manel et al. 2003). Another way to view landscape genetics is
as landscape ecology that uses spatial genetic patterns (e.g. genetic variation within
or between individuals or groups). This is because landscape genetics treats the
genetic patterns themselves as multivariate spatial data and seeks to infer ecological
understandings by evaluating these patterns either in isolation or in conjunction
with other spatial data. Because genetic data are very different from other data
sources, we need to briefly discuss genetic data before we can explore their uses
... Accordingly, we chose dispersal thresholds for massasauga of 2000, 4000, and 6000 cost units, corresponding to dispersal ability in optimal habitat of between 2 and 6 kilometers. For swift fox, Dark-Smiley and Keinath (2003) reported dispersal distances for adult swift foxes averaging 11 km, with an observed maximum distance of 64 km (Mercure et al. 1993). Kamler et al. (2004) report movement of one female swift fox as far as 20 km, before returning to her natal range where she remained philopatric. ...
In this chapter I frame the central issue of the book, namely is spatial and temporal
complexity in ecological systems merely noise around the predictions of non-spatial,
equilibrium processes? Or, alternatively, do spatial and temporal variability in the
environment and autogenic space–time processes in populations fundamentally
alter system behavior such that ideal models of nonspatial and equilibr
... Accordingly, we chose dispersal thresholds for massasauga of 2000, 4000, and 6000 cost units, corresponding to dispersal ability in optimal habitat of between 2 and 6 kilometers. For swift fox, Dark-Smiley and Keinath (2003) reported dispersal distances for adult swift foxes averaging 11 km, with an observed maximum distance of 64 km (Mercure et al. 1993). Kamler et al. (2004) report movement of one female swift fox as far as 20 km, before returning to her natal range where she remained philopatric. ...
A central theme of this book is that there is a strong mutual dependence between
explanatory theory, available data and analytical method in determining the lurching
progress of ecological knowledge (Fig. 1.1). The two central arguments are
first that limits in each of theory, data and method have continuously constrained
advances in understanding ecological systems and second that recent revolutionary
advances in data and method are enabling unprecedented expansion of ecological
investigation into areas of inquiry previously unapproachable due to lack
of fine-detail, broad scale data on environmental conditions, the distribution and
performance of organisms, the lack of sufficient computational power to process
and analyze such voluminous data sets, and inadequate analytical tools to investigate
pattern–process relationships among many interacting entities over large,
spatially complex landscapes.
... Accordingly, we chose dispersal thresholds for massasauga of 2000, 4000, and 6000 cost units, corresponding to dispersal ability in optimal habitat of between 2 and 6 kilometers. For swift fox, Dark-Smiley and Keinath (2003) reported dispersal distances for adult swift foxes averaging 11 km, with an observed maximum distance of 64 km (Mercure et al. 1993). Kamler et al. (2004) report movement of one female swift fox as far as 20 km, before returning to her natal range where she remained philopatric. ...
In the previous chapter we reviewed the challenges posed by spatial complexity and
temporal disequilibrium to efforts to understand and predict the structure and dynamics
of ecological systems. The central theme was that spatial variability in the environment
and population processes fundamentally alters the interactions between species and
their environments, largely invalidating the predictions of ideal models of community
structure and population processes. In addition, we argued that temporal variability
enormously amplifies the challenge of prediction, by altering and reversing species–
species and species–environment relationships over time. Typically these fluctuations
do not occur globally across space in synchrony; rather change in time is spatially
dependent on location in the environment, and thus interacts in highly complex and
nonlinear ways with spatial heterogeneity in influencing ecological processes. Given
these challenges, we proposed focusing on the interactions between species and their
immediate environments in the context of current and past conditions. However, given
critical sensitivity of ecological processes to spatial and temporal factors, it is also necessary
to consider their action within the context of a broader landscape of conditions,
constraints and drivers. This therefore seems a catch-22, with fine-scale understanding
of process required at the scale where ecological entities (e.g. organisms) directly
interact with each other and their environments, and also integration of these finescale
processes across complex and temporally varying broad-scale environments.
This challenge fundamentally relates to scale and scaling ecological processes
... Accordingly, we chose dispersal thresholds for massasauga of 2000, 4000, and 6000 cost units, corresponding to dispersal ability in optimal habitat of between 2 and 6 kilometers. For swift fox, Dark-Smiley and Keinath (2003) reported dispersal distances for adult swift foxes averaging 11 km, with an observed maximum distance of 64 km (Mercure et al. 1993). Kamler et al. (2004) report movement of one female swift fox as far as 20 km, before returning to her natal range where she remained philopatric. ...
This project is addressing some of the most important emerging conservation issues in the
American Great Plains region by studying the interaction of climate change and human
development on habitat for native wildlife species. We are integrating the most current
understandings of expected future change in vegetation and land use patterns across the Great
Plains, and using state-of-the-art spatial analysis and modeling approaches to predict effects of
these changes on habitat area, fragmentation and corridor network connectivity. Our products
provide practical, detailed and specific management recommendations at scales relevant to
population viability for a selected set of focal species.
... More ancient splits that predate the Illinoian (penultimate) glaciation (190–130 KYA) typically have resulted in distinct sister species, such as the swift fox (Vulpes velox) and kit fox (Vulpes macrotis), and American marten (Martes americana) and Pacific marten (M. caurina) [3,4] . Other, more recent splits, tracing to the late Illinoian or Wisconsin glaciation, include bobcats (Lynx rufus) and red foxes (Vulpes vulpes)56. ...
Pleistocene aridification in central North America caused many temperate forest-associated vertebrates to split into eastern and western lineages. Such divisions can be cryptic when Holocene expansions have closed the gaps between once-disjunct ranges or when local morphological variation obscures deeper regional divergences. We investigated such cryptic divergence in the gray fox (Urocyon cinereoargenteus), the most basal extant canid in the world. We also investigated the phylogeography of this species and its diminutive relative, the island fox (U. littoralis), in California. The California Floristic Province was a significant source of Pleistocene diversification for a wide range of taxa and, we hypothesized, for the gray fox as well. Alternatively, gray foxes in California potentially reflected a recent Holocene expansion from further south. We sequenced mitochondrial DNA from 169 gray foxes from the southeastern and southwestern United States and 11 island foxes from three of the Channel Islands. We estimated a 1.3% sequence divergence in the cytochrome b gene between eastern and western foxes and used coalescent simulations to date the divergence to approximately 500,000 years before present (YBP), which is comparable to that between recognized sister species within the Canidae. Gray fox samples collected from throughout California exhibited high haplotype diversity, phylogeographic structure, and genetic signatures of a late-Holocene population decline. Bayesian skyline analysis also indicated an earlier population increase dating to the early Wisconsin glaciation (~70,000 YBP) and a root height extending back to the previous interglacial (~100,000 YBP). Together these findings support California's role as a long-term Pleistocene refugium for western Urocyon. Lastly, based both on our results and re-interpretation of those of another study, we conclude that island foxes of the Channel Islands trace their origins to at least 3 distinct female founders from the mainland rather than to a single matriline, as previously suggested.
... The CDS based time estimate for the divergence of the red and Arctic fox from a common ancestor at 3.17 +/− 0.09 Ma is slightly older than a previous estimate based on 22 nuclear loci and 3 mitochondrial (mt) genes and has a much narrower confidence range [3] . The sister species to the Arctic fox are the kit (Vulpes macrotis) and the swift fox (Vulpes velox), two desert-adapted species occurring in North America [3, 31, 32], while the red fox is more distantly related. Perini et al. [3] reported a divergence time estimate of the Arctic and the kit fox of about 0.9 Ma. ...
The genus Vulpes (true foxes) comprises numerous species that inhabit a wide range of habitats and climatic conditions, including one species, the Arctic fox (Vulpes lagopus) which is adapted to the arctic region. A close relative to the Arctic fox, the red fox (Vulpes vulpes), occurs in subarctic to subtropical habitats. To study the genetic basis of their adaptations to different environments, transcriptome sequences from two Arctic foxes and one red fox individual were generated and analyzed for signatures of positive selection. In addition, the data allowed for a phylogenetic analysis and divergence time estimate between the two fox species.
The de novo assembly of reads resulted in more than 160,000 contigs/transcripts per individual. Approximately 17,000 homologous genes were identified using human and the non-redundant databases. Positive selection analyses revealed several genes involved in various metabolic and molecular processes such as energy metabolism, cardiac gene regulation, apoptosis and blood coagulation to be under positive selection in foxes. Branch site tests identified four genes to be under positive selection in the Arctic fox transcriptome, two of which are fat metabolism genes. In the red fox transcriptome eight genes are under positive selection, including molecular process genes, notably genes involved in ATP metabolism. Analysis of the three transcriptomes and five Sanger re-sequenced genes in additional individuals identified a lower genetic variability within Arctic foxes compared to red foxes, which is consistent with distribution range differences and demographic responses to past climatic fluctuations. A phylogenomic analysis estimated that the Arctic and red fox lineages diverged about three million years ago.
Transcriptome data are an economic way to generate genomic resources for evolutionary studies. Despite not representing an entire genome, this transcriptome analysis identified numerous genes that are relevant to arctic adaptation in foxes. Similar to polar bears, fat metabolism seems to play a central role in adaptation of Arctic foxes to the cold climate, as has been identified in the polar bear, another arctic specialist.
... ( = 0.0069; Mercure et al., 1993) and Alopex lagopus ( = 0.009; Dalen et al., 1994), but also lower than other canids such as Canis lupus ( = 0.026; Vilá et al., 1999) or Vulpes vulpes ( = 0.023; Aubry et al., 2009). In general, these nucleotide diversity estimations in canids are lower than those found in other carnivores as the felids (for instance, jaguar, ocelot, margay, Pampa cats or jaguarundi to cite a few casesThese samples are currently been analyzing for mtCyt-b and microsatellites to obtain a clearer picture of the phylogenetics relationships of these Neotropical foxes as well as their respective genetic structures. ...
Herein we analyzed samples of four species of the Neotropical fox genus Pseudoalopex, representing Ps. culpaeus (Ps. culpaeus andina, from Peru and Bolivia, and Ps. culpaeus culpaeus, from Chile), Ps. sechurae (Peru and Ecuador), Ps. griseus (Argentina) and Ps. gymnocercus (Bolivia) for 419 base pairs of the mtCyt-b gene. The main results obtained were as follows: 1-The ancestor of Ps. sechurae was the first to diverge for the taxa of Pseudoalopex studied around 1.1-1.2 MYA. Ps. sechurae was the species which presented the highest levels of gene diversity of the Pseudoalopex species, probably because it is the oldest one of those studied; 2-The temporal separation of Ps. griseus and Ps. culpaeus is very recent (0.15-0.21 MYA) and no monophyly reciprocity was found in any of the analyses undertaken; 3-The divergence split between Ps. culpaeus culpaeus and Ps. culpaeus andina was around 0.17-0.22 MYA and these two culpaeus forms could be seen as two different ESUs in terms of biological conservation; 4-The individual of Ps. gymnocercus analyzed did not differentiate from the haplotypes of culpaeus. Two hypotheses were speculated: the taxa gymnocercus is not molecularly differentiated from culpaeus because a very extreme and recent speciation or it is an example of hybridization among two Neotropical fox species, with gene introgression of Ps. culpaeus within Ps. gymnocercus; 5-No geographical structure was found within Ps. culpaeus andina. This means that the populations of this species in Peru and Bolivia must be conserved as unique ESUs. 6-There was evidence of population expansion in Ps. culpaeus and Ps. sechurae, although the demographic evolution of both Neotropical foxes was different.
... swift fox [V. velox] vs. kit fox; Mercure et al. 1993). Thus, the splitting time of American and Eurasian red foxes is consistent with the time frames separating these North American sister species, including other Vulpes species. ...
Widely distributed taxa provide an opportunity to compare biogeographic responses to climatic fluctuations on multiple continents and to investigate speciation. We conducted the most geographically and genomically comprehensive study to date of the red fox (Vulpes vulpes), the world's most widely distributed wild terrestrial carnivore. Analyses of 697 bp of mitochondrial sequence in ~1000 individuals suggested an ancient Middle Eastern origin for all extant red foxes and a 400 kya (SD = 139 kya) origin of the primary North American (Nearctic) clade. Demographic analyses indicated a major expansion in Eurasia during the last glaciation (~50 kya), coinciding with a previously described secondary transfer of a single matriline (Holarctic) to North America. In contrast, North American matrilines (including the transferred portion of Holarctic clade) exhibited no signatures of expansion until the end of the Pleistocene (~12 kya). Analyses of 11 autosomal loci from a subset of foxes supported the colonization timeframe suggested by mtDNA (and the fossil record) but, in contrast, reflected no detectable secondary transfer, resulting in the most fundamental genomic division of red foxes at the Bering Strait. Endemic continental Y-chromosome clades further supported this pattern. Thus, intercontinental genomic exchange was overall very limited, consistent with long-term reproductive isolation since the initial colonization of North America. Based on continental divergence times in other carnivoran species pairs, our findings support a model of peripatric speciation and are consistent with the previous classification of the North American red fox as a distinct species, V. fulva. This article is protected by copyright. All rights reserved.
... Given the above combination of hypercarnivorous characteristics seen only in the arctic fox (figures 2 and 3; electronic supplementary material, figure S2), it seems likely that the new Tibetan fox falls within the arctic fox clade, although possibilities exist that such shared derived characteristics can potentially be due to convergence as seen in multiple lineages of wolfsized forms during the Pleistocene [17]. Recent molecular phylogeny based on approximately 15 kb of exon and intron sequence places the arctic fox and kit fox as sister species [18], as was also shown in earlier mitochondrial DNA studies [19,20]. However, the kit fox retains the primitively bicuspid talonid, in contrast to the Vulpes lagopus -qiuzhudingi lineage that has a trenchant m1 talonid. ...
The 'third pole' of the world is a fitting metaphor for the Himalayan-Tibetan Plateau, in allusion to its vast frozen terrain, rivalling the Arctic and Antarctic, at high altitude but low latitude. Living Tibetan and arctic mammals share adaptations to freezing temperatures such as long and thick winter fur in arctic muskox and Tibetan yak, and for carnivorans, a more predatory niche. Here, we report, to our knowledge, the first evolutionary link between an Early Pliocene (3.60-5.08 Myr ago) fox, Vulpes qiuzhudingi new species, from the Himalaya (Zanda Basin) and Kunlun Mountain (Kunlun Pass Basin) and the modern arctic fox Vulpes lagopus in the polar region. A highly hypercarnivorous dentition of the new fox bears a striking resemblance to that of V. lagopus and substantially predates the previous oldest records of the arctic fox by 3-4 Myr. The low latitude, high-altitude Tibetan Plateau is separated from the nearest modern arctic fox geographical range by at least 2000 km. The apparent connection between an ancestral high-elevation species and its modern polar descendant is consistent with our 'Out-of-Tibet' hypothesis postulating that high-altitude Tibet was a training ground for cold-environment adaptations well before the start of the Ice Age.
... A museum specimen (Museum of Southwest Biology [MSB], University of New Mexico, #BRD101289) identified as V. velox, collected in 1928 about 13 km southwest of Albuquerque, which is substantially outside all estimates of the historical range of the Swift Fox, was recently examined and identified as V. macrotis (R. Harrison, University of New Mexico, Albuquerque, personal communication). There is range overlap with the Swift Fox's close relative, the Kit Fox, in the Trans-Pecos region of New Mexico, where the two species are known to hybridize (Mercure et al. 1993). Hubbard (1994*: 4) concluded that the hybrid zone for the two species " appeared to be restricted to an area not exceeding 50–60 miles [80.5–96.6 km] in width in the Pecos Basin of New Mexico. ...
The Swift Fox (Vulpes velox) was once common in the shortgrass and mixed-grass prairies of the Great Plains of North America. The species’ abundance declined and its distribution retracted following European settlement of the plains. By the late 1800s, the species had been largely extirpated from the northern portion of its historical range, and its populations were acutely depleted elsewhere. Swift Fox populations have naturally recovered somewhat since the 1950s, but overall abundance and distribution remain below historical levels. In a 1995 assessment of the species’ status under the US Endangered Species Act, the US Fish and Wildlife Service concluded that a designation of threatened or endangered was warranted, but the species was “precluded from listing by higher listing priorities.” A major revelation of the 1995 assessment was the recognition that information useful for determining population status was limited. Fundamental information was missing, including an accurate estimate of the species’ distribution before European settlement and an estimate of the species’ current distribution and trends. The objectives of this paper are to fill those gaps in knowledge. Historical records were compiled and, in combination with knowledge of the habitat requirements of the species, the historical range of the Swift Fox is estimated to be approximately 1.5 million km2. Using data collected between 2001 and 2006, the species’ current distribution is estimated to be about 44% of its historical range in the United States and 3% in Canada. Under current land use, approximately 39% of the species’ historical range contains grassland habitats with very good potential for Swift Fox occupation and another 10% supports grasslands with characteristics that are less preferred (e.g., a sparse shrub component or taller stature) but still suitable. Additionally, land use on at least 25% of the historical range supports dryland farming, which can be suitable for Swift Fox occupation. In the United States, approximately 52% of highest quality habitats currently available are occupied by Swift Foxes.
... TABLE 5. Mahalanobis distances between samples of adult (> 50 mm) Rana pretiosa complex (Table 1) based upon morphometric characters. Population species B, the same phenomenon of genetic uniformity that has been repeatedly observed in northern populations of other organisms affected by glaciation (Sage and Wolff 1986; Mercure et al. 1993; Gill et al. 1993; Zink and Dittmann 1993; Highton and Webster 1976; Cwynar and MacDonald 1987; Critchfield 1984) in North America. The widespread loss of alleles and increased homozygosity of northern populations is certainly not restricted to large mammals (Selander and Kaufman 1973; Sage and Wolff 1986 ) but is a general phenonemon to be expected from repeated founder events at an advancing edge of a range in any species (Nei et al. 1975). ...
The western North American complex of spotted frogs (Rana pretiosa) exhibits isolation-by-distance, genetic subdivision, and speciation in association with its extensive northward range shift in postglacial times. The southern relict populations of R. pretiosa species B existing at high altitudes or in desert springs have been subjected to restricted gene flow, high inbreeding, and bottlenecks to produce significant between-population genetic diversity. The more recently established northern populations, however, show genetic uniformity and isolation-by-distance, as estimated using Slatkin's (1993) statistic M̂. Middle latitude populations have higher heterozygosities than populations at either extreme. Fixed differences in allozyme variation separate 21 populations of species B from five populations of R. pretiosa species A found in southwest Washington State and the Cascades Mountains of Oregon. Morphological variation of 20 metric characters among 38 samples, examined using multiple discriminant function analysis, could partially resolve partitioning among populations but specimens from the vicinity of the type series of R. p. pretiosa could not be assigned to either species A or species B. Speciation in these frogs may not be correlated with morphological evolution since comparatively neutral allozyme changes may be established more rapidly than changes in morphology.
... Эта зависимость видна на примере различных представителей Canidae в Северной Америке. Так, между более мелкими видами (лисицы Vulpes macrotis и Vulpes velox) со средним расстоянием расселения около 11 км зона гибридизации охватывает несколько сотен километров , тогда как между крупными (волк и койот) несколько тысяч; у койотов среднее расстояние расселения составляет 50–100 км (Mercure et al. 1994: 1313 и 1323). Оценка ширины гибридной зоны также зависит от используемых критериев и признаков (Крюков 1990: 29). ...
Hybridization is a widely distributed phenomenon among animals. It is an important factor of speciation. The history of problem is briefly outlined. Principal terms are defined and discussed. Various categories of hybridization and hybrid zones in terms of their shape (narrow, broad), genetic and spatial structure (clinal, mosaic, reticulate, and residual; sympatric; uni-and bimodal zones), bidirectional and asymmetric introgression, mechanisms of origin and maintenance of hybrid zones, stability and movement of zones, as well as the relation of hybridization to taxonomy, zoogeography and conservation are considered.
... Swift fox (Vulpes velox) 10, 30, 60 Mercure et al. (1993), Dark-Smiley and Keinath (2003), Kamler et al. (2004) can then represent the landscape resistance surface as a graph with nodes and edges. Each occurrence record was considered to be a node. ...
Habitat loss and fragmentation are widely recognized as among the most important threats to global biodiversity. New analytical approaches are providing an improved ability to predict the effects of landscape change on population connectivity at vast spatial extents. This paper presents an analysis of population connectivity for three species of conservation concern [swift fox (Vulpes velox); lesser prairie-chicken (Tympanuchus pallidicinctus); massasuaga (Sistrurus catenatus)] across the American Great Plains region. We used factorial least-cost path and resistant kernel analyses to predict effects of landscape conditions on corridor network connectivity. Our predictions of population connectivity provide testable hypotheses about the location of core habitats, corridors, and barriers to movement. The results indicate that connectivity is more sensitive to a species’ dispersal ability than variation in landscape resistance to movement. Thus, it may prove difficult to optimize conservation strategies to maintain population connectivity for multiple species with disparate dispersal abilities and independent distributions.
... MtDNA and microsatellites were used to determine that this Ethiopian wolf is a distinct species but that hybridization occurs with domestic dogs (Gottelli et al. 1994). Molecular markers have also been used to document additional cases of extensive canid hybridization in swift and kit foxes (Vulpes velox and V. macrotis; Mercure et al. 1993). In each of these cases, once hybridization is defined, difficult and controversial decisions must be made regarding whether hybrids should receive further attention and protection. ...
Recent advances in molecular technology have opened a new chapter in species conservation efforts, as well as population biology. DNA sequencing, MHC (major histocompatibility complex), minisatellite, microsatellite, and RAPD (random amplified polymorphic DNA) procedures allow for identification of parentage, more distant relatives, founders to new populations, unidentified individuals, population structure, effective pop- ulation size, population-specific markers, etc. PCR (polymerase chain reaction) amplifi- cation of mitochondrial DNA, nuclear DNA, ribosomal DNA, chloroplast DNA, and other systems provide for more sophisticated analyses of metapopulation structure, hybridization events, and delineation of species, subspecies, and races, all of which aid in setting species recovery priorities. Each technique can be powerful in its own right but is most credible when used in conjunction with other molecular techniques and, most importantly, with ecological and demographic data collected from the field. Surprisingly few taxa of concern have been assayed with any molecular technique. Thus, rather than showcasing exhaustive details from a few well-known examples, this paper attempts to present a broad range of cases in which molecular techniques have been used to provide insight into conservation efforts.
... A 311bp portion of cyt b from mitochondrial DNA (mtDNA) was amplified with the following primer pair: Foxcytb-F (59 TTTCTGCCTGAT- GAAACTTCGGAT) and Foxcytb-R (59 ACGTAACCTATAAATGCTGTGGCT). This primer set was designed to have 100% sequence identity with swift and kit foxes, and approximately 96% sequence identity with sympatric species. Thus, swift and kit foxes were identifiable with one PCR amplification and only one enzyme digest, which offers an improvement over previously published methods (Mercure et al., 1993; Paxinos et al., 1997). PCR amplifications were conducted in 50 ll volumes with 0.5 lM each primer, 25 ll of FailSafe PCR 2X PreMix C (Epicentre, Madison, WI), 1.25 Units of FailSafe PCR Enzyme Mix (Epicentre) and 200 ng of genomic DNA. ...
We examined collection of scats (feces) as a survey method for indexing statewide populations of swift foxes (Vulpes velox). We searched for scats on 99 transects throughout the range of swift foxes in New Mexico. Swift fox scats were found on 79.8% of transects. Scats confirmed by DNA analysis to have originated from swift foxes were found on 59.6% of transects. Statistical power was sufficient to detect a 20% decline in the proportion of transects with swift fox scats or a 7% decline in the total number of scats collected over the entire range. The proportion of transects with scats and the total number of scats collected may be useful as indices of relative swift fox population abundance. Average number of scats found per collection site was not found to be a useful index due to large variations between sites in the numbers of scats found. Confirmation of swift fox presence by DNA analysis does not appear to be necessary for transects with >7 scats, as all transects with >7 scats had at least one confirmed swift fox scat. Collection of scats appears to be a useful technique for indexing populations of swift foxes in New Mexico.
... The two species of Canis, wolf and coyote, differ greatly in turbinate packing, with the coyote displaying a much more open structure. Of the remaining canids, the kit fox and arctic fox are the only other sister taxa (Mercure et al., 1993), and are quite similar in the distribution of turbinates from rostral to caudal, with the arctic fox exhibiting a slightly denser network of bone (Fig. 6). ...
The respiratory turbinates of mammals are complex bony plates within the nasal chamber that are covered with moist epithelium and provide an extensive surface area for the exchange of heat and water. Given their functional importance, maxilloturbinate size and structure are expected to vary predictably among species adapted to different environments. Here the first quantitative analysis is provided of maxilloturbinate structure based on high-resolution computed tomography (CT) scans of the skulls of eight canid and seven felid species. The key parameters examined were the density of the maxilloturbinate bones within the nasal chamber and how that density varied along the air pathway. In both canids and felids, total maxilloturbinate chamber volume and bone volume increased with body size, with canids having c. 1.5–2.0 times the volume of maxilloturbinate than felids of similar size. In all species, the volume of the maxilloturbinates varies from rostral to caudal, with the peak volume occurring approximately midway, close to where airway cross-sectional area is greatest. Interspecific differences among canids or felids in maxilloturbinate density were not consistent with adaptive explanations, i.e. the densest maxilloturbinates were not associated with species living in arid or cold habitats. Some of the observed variation in maxilloturbinate form might reflect a need for both low- and high-resistance pathways for airflow under alternative conditions.
... The levels of relative gene diversity found for Ps. sechurae were the highest found in this study ( = 0.015) and similar to those levels found in other canids as Cerdocyon thous ( = 0.019; Tchaika et al., 2006) and higher than values for other canids such as Vulpes macrotis ( = 0.0069; Mercure et al., 1993) and Alopex lagopus ( = 0.009; Dalen et al., 1994), but also lower than other canids such as Canis lupus ( = 0.026; Vilá et al., 1999) or Vulpes vulpes ( = 0.023; Aubry et al., 2009). In general, these nucleotide diversity estimations in canids are lower than those found in other carnivores as the felids (for instance, jaguar, ocelot, margay, Pampa cat or jaguarundi to cite a few cases; Ruiz-García et al., 2012a,b,c,d). ...
Herein we analyzed samples of four species of the Neotropical fox genus Pseudoalopex, representing Ps. culpaeus (Ps. culpaeus andina, from Peru and Bolivia, and Ps. culpaeus culpaeus, from Chile), Ps. sechurae (Peru and Ecuador), Ps. griseus (Argentina) and Ps. gymnocercus (Bolivia) for 419 base pairs of the mtCyt-b gene. The main results obtained were as follows: 1-The ancestor of Ps. sechurae was the first to diverge for the taxa of Pseudoalopex studied around 1.1-1.2 MYA. Ps. sechurae was the species which presented the highest levels of gene diversity of the Pseudoalopex species, probably because it is the oldest one of those studied; 2-The temporal separation of Ps. griseus and Ps. culpaeus is very recent (0.15-0.21 MYA) and no monophyly reciprocity was found in any of the analyses undertaken; 3-The divergence split between Ps. culpaeus culpaeus and Ps. culpaeus andina was around 0.17-0.22 MYA and these two culpaeus forms could be seen as two different ESUs in terms of biological conservation; 4-The individual of Ps. gymnocercus analyzed did not differentiate from the haplotypes of culpaeus. Two hypotheses were speculated: the taxa gymnocercus is not molecularly differentiated from culpaeus because a very extreme and recent speciation or it is an example of hybridization among two Neotropical fox species, with gene introgression of For Ps. culpaeus within Ps. gymnocercus; 5-No geographical structure was found within Ps. culpaeus andina. This means that the populations of this species in Peru and Bolivia must be conserved as unique ESUs; 6-There was evidence of population expansion in Ps. culpaeus and Ps. sechurae, although the demographic evolution of both Neotropical foxes was different.
... Such habitat barriers could contribute to the strong population genetic structure we observed. Habitat specificity explains similarly high genetic structure found in swift foxes, kit foxes (Vulpes velox— Mercure et al. 1993), and black-footed ferrets (Mustela nigripes—Wisely et al. 2002). Habitat specificity might also contribute to the exceptionally low levels of gene flow (migrants per generation) estimated among populations. ...
Evolutionary processes can be strongly affected by landscape features. In vagile carnivores that disperse widely, however, genetic structure has been found to be minimal. Using microsatellite DNA primers developed for other mustelids, we found that populations of a vagile forest carnivore, the fisher (Martes pennanti), exhibit high genetic structure (F ST ¼ 0.45, SE ¼ 0.07) and limited gene flow (Nm , 1) within a .1,600-km narrow strip of forested habitat; that genetic diversity decreases from core to periphery; and that populations do not show an equilibrium pattern of isolation-by-distance. Genetic structure was greater at the periphery than at the core of the distribution and our data fit a 1-dimensional model of stepping-stone range expansion. Multiple lines of paleontological and genetic evidence suggest that the fisher recently (,5,000 years ago) expanded into the mountain forests of the Pacific coast. The reduced dimensionality of the distribution of the fisher in western coastal forests appears to have contributed to the high levels of structure and decreasing diversity from north to south. These effects were likely exacerbated by human-caused changes to the environment. The low genetic diversity and high genetic structure of populations in the southern Sierra Nevada suggest that populations in this part of the geographic range are vulnerable to extinction.
Hybridization is an important evolutionary force with a principal role in the origin of new species, known as hybrid speciation. However, ongoing hybridization can create hybrid swamping, in which parental genomes are completely lost. This can become a biodiversity threat if it involves species that have adapted to certain environmental conditions and occur nowhere else. Because conservation scientists commonly have a negative attitude toward hybrids, it is important to improve understanding of the influence of interspecific gene flow on the persistence of species. We reviewed the literature on species hybridization to build a list of all known cases in the order Carnivora. To examine the relative impact, we also noted level of introgression, whether fertile offspring were produced, and whether there was mention of negative or positive evolutionary effects (hybrid speciation and swamping). To evaluate the conservation implications of hybrids, we developed a decision‐making tree with which to determine which actions should be taken to manage hybrid species. We found 53 hybrids involving 68 unique taxa, which is roughly 23% of all carnivore species. They mainly involved monophyletic (83%) and sympatric species (75%). For 2 species, the outcome of the assessment was to eliminate or restrict the hybrids: Ethiopian wolf (Canis simensis) and Scottish wildcat (Felis silvestris silvestris). Both species hybridize with their domestic conspecifics. For all other cases, we suggest hybrids be protected in the same manner as native species. We found no evidence of genomic extinction in Carnivora. To the contrary, some species appear to be of hybrid origin, such as the Asiatic black bear (Ursus thibetanus) and African golden wolf (Canis lupaster). Other positive outcomes of hybridization are novel genetic diversity, adaptation to extreme environments, and increased reproductive fitness. These outcomes are particularly valuable for counterbalancing genetic drift and enabling adaptive introgression in a human‐dominated world.
The gray fox (Urocyon cinereoargenteus) lineage diverged from all other extant canids at their most basal node and is restricted to the Americas. Previous mitochondrial analysis from coastal populations identified deeply divergent (up to 1 Mya) eastern and western lineages that predate most intraspecific splits in carnivores. We conducted genotyping by sequencing (GBS) and mitochondrial analysis on gray foxes sampled across North America to determine geographic concordance between nuclear and mitochondrial contact zones and divergence times. We also estimated the admixture within the contact zone between eastern and western gray foxes based on nuclear DNA. Both datasets confirmed that eastern and western lineages met in the southern Great Plains (i.e, Texas and Oklahoma), where they maintained high differentiation. Admixture was generally low, with the majority of admixed individuals carrying <10% ancestry from the other lineage. Divergence times confirmed a mid-Pleistocene split, similar to the mitochondrial estimates. Taken together, findings suggest gray fox lineages represent an ancient divergence event, far older than most intraspecific divergences in North American carnivores. Low admixture may reflect a relatively recent time since secondary contact (e.g., post-Pleistocene) or, alternatively, ecological or reproductive barriers between lineages. Though further research is needed to disentangle these factors, our genomic investigation suggests species-level divergence exists between eastern and western gray fox lineages.
An annotated checklist of the terrestrial mammals of Los Angeles County was compiled, based on over 10,000 museum records spanning over 100 years of scientific research. Part 1 covered 42 species in the orders Didelphimorphia, Lagomorpha, and Rodentia. Part II provides an annotated list and abbreviated synonymies for 46 species of terrestrial mammals in the orders Eulipotyphla, Carnivora, Artiodactyla, and Chiroptera.
The Mexican kit fox (Vulpes macrotis zinseri) is an endangered subspecies that is restricted to the arid plains of the Sierra Madre Mountains of Mexico. Previous genetic analysis of other arid-land fox populations in the U.S. showed that the species is divided into two phylogenetically distinct taxa; the kit fox occupies the western, and the swift fox, the eastern plains bordering the Rocky Mountains. We analyzed 740 base pairs (bp) of cytochrome b sequence and 350 bp of control region sequence to determine if Mexican kit foxes are genetically distinct and to assess their relationship to kit and swift foxes of the U.S. We found two genotypes in 19 foxes from Nuevo Leon and Coahuila, Mexico that differed by a single base pair substitution. These genotypes were phylogenetically grouped with those sequences from kit foxes in Arizona, Utah, and New Mexico but differed from them by 1 to 4 substitutions (0.3 to 1.3%) in control region sequence. Our results suggest that the Mexican kit foxes are closely associated with populations of the kit fox to the west of the Rocky Mountains and, although they have unique genotypes, Mexican kit foxes have only recently been isolated from their conspecifics in the U.S.
Biologists of the California Department of Fish and Game have conducted quarterly spotlight surveys of San Joaquin kit foxes, Vulpes macrotis mutica, and potential species of prey along seven 48-km routes since 1970. The annual reproductive cycle of the foxes was reflected by a seasonal cycle in the counts. Counts of foxes during surveys in June were correlated with total precipitation during the previous rainfall season, but not with concurrent counts of prey. Number of foxes seen/0.8-km interval was more highly correlated with estimated sighting distance based on physical features, such as hills and plains, than with current vegetation density or type. Mean number of foxes counted per survey per route ranged from two to 20. Counts of foxes increased over time on one route, decreased over time on another, and showed a curvilinear trend on two routes. The average number of foxes seen over all routes did not show any long-term trend. However, small samples, missing data, and lack of replication limited statistical analysis and interpretation of surveys. Statistical tests on simulated data similar to the data collected during the surveys indicated that larger samples, which could be obtained by replication, would be needed to detect changes in the population of foxes with any efficiency (statistical power). An expanded spotlight-survey program of kit foxes, with additional routes and replicated surveys, could be used to monitor population trends throughout the range of this endangered subspecies.
A better understanding of the relationships between endangered San Joaquin kit foxes (Vulpes macrotis mutica) and sympatric larger canids that prey on them is important for conservation efforts toward kit foxes. We used radiotelemetry to monitor the survival and cause of death of 41 San Joaquin kit foxes and 24 coyotes (Cants latrans) on the Carrizo Plain Natural Area, California, during the 1989–1991 drought. The estimated minimum-annual-survival rate for all coyotes was 0.88. Estimated annual-survival rates for juvenile foxes (0.21–0.41) were somewhat less than those for adult foxes (0.58–0.61). Survival rates for foxes were similar across years and sexes. Larger canids accounted for 78% of 23 verified deaths of kit foxes: 15 killed by coyotes; 2 by non-native red foxes (Vulpes vulpes); 1 by a domestic dog. High predation by larger canids, coupled with poor reproduction in kit foxes due to reduced prey availability during the drought, contributed to a significant decrease in density of kit foxes (from 0.24 to 0.12 foxes/km2) during the study. Although coyotes can have a significant impact on populations of kit foxes, larger non-native red foxes may pose a greater threat in some areas.
The Great Plains region is fragmented by natural and anthropogenic sources, yet the interaction between habitat fragmentation and genetic structure in this region has received limited study. Swift fox (Vulpes velox) are closely associated with short and mixed grass ecosystems, providing an opportunity to study patterns of gene flow, diversity and genetic structure in this area. We collected 589 samples throughout the species’ distribution in the United States and analyzed these samples using 15 microsatellite loci and a 250 base pair sequence of the mitochondrial DNA control region. We detected three levels of spatial genetic structure using microsatellite markers and identified six mitochondrial haplotypes, five of which showed spatial clustering. Differentiation between groups was significant while genetic diversity within groups was generally high. Anthropogenic influences, particularly agriculture, appear to reducing gene flow, especially in the central portion of the species’ range. Conservation measures should be taken to remediate these impacts and to maintain future gene flow in light of expected agricultural expansion in the Great Plains. Potential evolutionary significant units are identified, although further investigation using ecological indicators and adaptive loci is recommended to characterize the adaptive distinctiveness of swift fox populations.
The life cycle of the zoonotic cestode Echinococcus multilocularis depends on canids (mainly red foxes) as definitive hosts and on their specific predation on rodent species (intermediate hosts). Host densities and predation rates are key drivers for infection with parasite eggs. We demonstrate that they strongly depend on multifaceted human–wildlife interactions: vaccination against rabies, elimination of top predators, and changing attitude towards wildlife (feeding) contribute to high fox densities. The absence of large canids, low hunting pressure, and positive attitudes towards foxes modify their anti-predator response (‘landscape of fear’), promoting their tameness, which in turn facilitates the colonization of residential areas and modifies parasite transmission. Such human factors should be considered in the assessment of any intervention and prevention strategy.
Meriwether Lewis and William Clark in 1805 wrote the first substantial details of an arid-land fox. It was not until 1823, however, that Thomas Say described this same species of fox scientifically, and gave it a Latin name. Since then several other arid-dwelling foxes have been discovered. It almost seems that each south-western state in the United States and northern Mexico had its own fox, neatly described and named. But with the advent of modern biology and genetics, and the re-thinking of the "species concept", has the rich history of arid-land fox discoveries become just a footnote? In this paper I bring the work of nineteenth- and twentieth-century explorers and naturalists to the modern reader, providing the historical accounts that can only be found in library archives. I focus only on foxes that occur in North American desert and prairie habitats, excluding those fox species that occur in woodland and forested communities.
We studied kit fox den characteristics on the northern McGregor Range of Fort Bliss Military Reservation, New Mexico, during 1994 and 1995. Twenty radio-collared kit foxes used 132 different dens, including 16 natal dens. Kit fox dens were located primarily in creosote-dominated habitat found in relatively flat, well-drained terrain. Natal dens were virtually indistinguishable from non-natal dens; however, natal den entrances were taller than non-natal den entrances. Entrances found at all dens were oriented more frequently toward the northwest and southeast. Kit foxes used more new dens during the breeding (January-February) and pup-rearing season (May-July) than during gestation.
The temperate rainforest of Chiloé Island, Chile, is inhabited by an endemic fox (Dusicyon fulvipes) first described by Charles Darwin and now designated Darwin's fox. Despite morphological differences, Darwin's fox has been considered only an insular subspecies of the mainland chilla fox (D. griseus). This follows the assumption that the island population, with an estimated population of less than 500, has been separated from the mainland chilla fox for only about 15,000 years and may have received occasional immigrants from the mainland. Consequently, this island population has not been protected as endangered or bred in captivity. Recently, a population of Darwin's fox was discovered on the Chilean mainland 600 km north of Chiloé Island. This population exists in sympatry with chilla and possibly culpeo (O. culpaeus) foxes, which suggests that Darwin's fox may be reproductively isolated. To clarify the phylogenetic position of Darwin's fox, we analyzed 344 bp of mitochondrial DNA control-region sequence of the three species of Chilean foxes. Darwin's foxes from the island and mainland populations compose a monophyletic group distinct from the two other Chilean fox species. This indicates that Darwin's fox was probably an early inhabitant of central Chile, and that its present distribution on the mainland may be a relict of a once much wider distribution. Our results highlight the ability of molecular genetic techniques to uncover historical relationships masked by recent events, such as local extinctions. The "rediscovery" of Darwin's fox as a distinct species implies that greater significance should be given to the protection of this species and its unique habitat and to documenting the extent of its mainland distribution.
Lathyrus vernus (L.) Bernh. is a diploid, long-lived perennial and insect-pollinated herb with no special adaptation to long-distance dispersal. It occurs on neutral soil in deciduous forests throughout western Eurasia. Due to specific habitat preferences,L. vernus has a fragmented distribution with isolated populations. We investigated allozyme variation at eleven loci in 20 populations ofL. vernus from one geographically central region (the Czech Republic and the Slovak Republic) and two geographically marginal regions (southern and central Sweden) in the species present-day distribution. There was a clear differentiation between the three regions and the genetic distance between the populations was highly correlated with geographic distance. The total genetic diversity (HT) was 0.354. The proportion of genetic diversity due to differentiation between regions, and to differentiation between populations within regions, accounted for 10% each. There was no difference in level of genetic diversity between the three regions. No significant difference in level of genetic diversity was found between small and large populations. The genetic diversity inL. vernus may either be a result of the long generation-time of the species or peculiarities in the post-glacial migration species, e.g. survival only in refugia far east of the sampled populations and/or migration as a continuous process not involving founder-events.
Tanto el zorro veloz (Vulpes velox) como el zorro ártico (Alopex lagopus) a menudo utilizan ladridos para comunicarse con su pareja, con otros miembros del grupo social, y con otros conespecíficos. Sin embargo, el ladrido de la zorra norteña (V. macrotis), que esta emparentada con las otras dos especies, no ha sido observado a menudo y no está documentado. Observamos ladridos de una población de zorra norteña de la subespecie San Joaquín (V. m. mutica) cuyos miembros estaban dotados con radio collares. Estas observaciones se llevaron a cabo en Bakersfield, condado de Kern, California, desde agosto del 2002 hasta marzo del 2003. Observamos 150 ladridos de zorros, incluyendo 56 de dos machos adultos (≥1 año), 83 de una hembra adulta, y 11 de dos juveniles (<1 año). De éstos, registramos 9 ladridos, cada uno compuesto por una serie de elementos cortos y discretos, repetidos en secuencias rápidas – de estructura y sonido similares a las secuencias de ladridos del zorro del ártico y del veloz. El uso de estos ladridos fue escaso y se concentró principalmente durante la época de reproducción a mediados de diciembre. Nuestras observaciones sugieren que la función principal de los ladridos es contactar o atraer a la pareja o a una pareja potencial, y que tendría poca importancia en cuanto a la territorialidad.
Realizamos un programa riguroso de monitoreo para desarrollar métodos de conservación apropiados para Vulpes velox. Pusimos 20 trampas de jaula en 51 cuadrículas para estimar la tasa de ocupación en el este de Colorado. Empezando con una cuadrícula escogida al azar, escogimos cada quincuagésima cuadrícula sistemáticamente de una lista de 2,566 cuadrículas puestas en orden de porcentaje de pradera de pasto corto. Atrapamos desde el 31 agosto 2004 hasta el 12 febrero 2005 y atrapamos por tres noches en cada cuadrícula. Al capturar cada zorro, le colocamos una identificación exclusiva y determinamos el sexo antes de liberarlo. Utilizamos un sistema de información geográfica (SIG) para calcular el porcentaje de pradera de pasto corto en un rectángulo de 6.4 × 8.0 km centrado sobre cada cuadrícula. Atrapamos 136 V. velox en 40 cuadrículas incluyendo 12 recapturas; 71% de las capturas ocurrió en cuadrículas con >50% de pradera de pasto corto. Estimamos la proporción de cuadrículas de 4.8 × 6.4 km en el este de Colorado ocupadas por V. velox comoψ ˆ = 0.711 (EE = 0.069, IC 95% 0.576–0.846) sin evidencia de una disminución comparada a los muestreos de 1995–1997.
Although interspecific killing among carnivores can drive populations toward extinction, it is generally unknown how these intraguild interactions vary among populations, and whether the threat for vulnerable species can be mitigated. We studied imperiled populations of swift foxes (Vulpes velox) in Canada and kit foxes (Vulpes macrotis) in Mexico to determine potential differences in survival or predator-avoidance strategies. Survival rates were significantly lower in Canada than in Mexico because of mortality caused by coyotes (Canis latrans) and golden eagles (Aquila chrysaëtos), and the potential for population recovery is likely higher for the Mexican fox population. Differences in body size between coyotes and foxes, diet, group sizes, intraspecific home-range overlap, home-range sizes of coyotes, and movements of coyotes relative to foxes were similar among study areas. However, Canadian foxes had home ranges that were approximately 3 times larger than those in Mexico, and Canadian foxes were most frequently killed on their home-range peripheries. Home ranges of kit foxes decreased in size as the availability of black-tailed prairie dog (Cynomys ludovicianus) colonies increased and associated refuge holes, which foxes could use to escape predation, were significantly more abundant in Mexico than in Canada. Small home ranges of foxes probably reduced encounters with coyotes in Mexico, and a high availability of refuges likely allowed foxes to elude predators when such encounters did occur. Differences in survival of foxes relative to mortality caused by coyotes demonstrate that interactions between carnivores can vary greatly between populations and that, in some situations, vulnerable species may be able to coexist with dominant carnivores despite a lack of large-scale habitat partitioning.
Climate change during the late Quaternary has been implicated as the cause of both massive range shifts and extinction events. We combined molecular marker data and previously published fossil data to reconstruct the late Quaternary history of a grassland-dependent species, the black-footed ferret (Mustela nigripes), and to determine whether populations from Pleistocene refugia in the Columbia Basin, eastern Beringia, and Great Plains persisted into the Holocene and Recent eras. Using DNA extracted from 97 museum specimens of extirpated populations, we amplified 309 bp of the mtDNA control region, and 8 microsatellite markers from the nuclear genome. Overall haplotype diversity from 309 base pairs (bp) of mitochondrial DNA (mtDNA) control region was low (5 haplotypes, nucleotide diversity = 0.001 +/- 0.001 SD) and was contained within a single phylogenetic clade. The star phylogeny and unimodal mismatch distribution indicated that a rapid range expansion from a single Pleistocene refugium occurred. Microsatellite data corroborated this genetic pattern: populations from the mixed grasslands of the Great Plains had significantly higher expected heterozygosity and allelic richness than populations to the west (HE = 0.66 versus 0.41, AR = 4.3 versus 2.7, respectively), and 0, a measure of relative population size, was substantially greater in the east than west (2.4 versus 0.7). We infer from these data that black-footed ferrets rapidly colonized western ecoregions in a stepwise fashion from the Great Plains to the intermountain regions of the Rocky Mountains and the Colorado Plateau after the last ice age. It appears that glacial retreat and global warming caused both range expansion and localized extinction in this North American mustelid species.
Dispersal is fundamental to the persistence of wild populations. Historically, swift foxes Vulpes velox of the northern Great Plains of North America have been thought to be poor dispersers. Short-grass prairie is optimal habitat for swift foxes but can be fragmented in the northern Great Plains. We wanted to assess whether wild-born, juvenile swift foxes from two proximate but distinct reintroduced populations had potential to move from one population to the other. We found five animals exhibiting long bouts of dispersal, much further than averages previously reported. One female fox traversed the long distance between the two populations and survived for at least three breeding seasons in the wild. We believe our findings are significant for conservation because they show that swift foxes are not poor dispersers and that patches of short-grass prairie previously thought to be too isolated (> 25 km) for natural movement may be recolonized or be suitable for reintroductions of swift foxes.
We identified species of fleas found in New Mexico on kit foxes (Vulpes macrotis), swift foxes (V. velox), red foxes (V. vulpes), and gray foxes (Urocyon cinereoargenteus). Pulex irritans and P. simulans were the fleas found most commonly. All species found, except 2, are known to carry plague, and we found fleas on foxes throughout New Mexico capable of carrying plague, which occurs in every county of New Mexico. Thus, every fox in New Mexico should be considered a potential carrier of plague. RESUMEN Identificamos especies de pulgas encontradas en Nuevo México en la zorra del de-sierto (Vulpes macrotis), la zorra de pradera (V. velox), la zorra roja (V. vulpes) y la zorra gris (Urocyon cinereoargenteus). Pulex irritans y P. simulans fueron las pulgas más frecuentemente halladas. Se sabe que todas las especies encontradas, excepto dos, transportan la plaga, y encontramos pulgas en zorros de todas partes de Nuevo México capaces de trasportar la plaga, la cual puede ocurrir en cualquier condado de Nuevo México. Entonces, cada zorro de Nuevo México se debe considerar un portador potencial de la plaga.
Wil-son. 1989. DynamicsofmitochondrialDNAevo-lution in animals: Amplification and sequencing with conserved primers
- T D Kocher
- W K Thomas
- A Meyer
- S V Ed-Wards
- S Paabo
- F X Villablanca
Kocher, T. D., W. K. Thomas, A. Meyer, S. V. Ed-wards, S. Paabo, F. X. Villablanca, and A. C. Wil-son. 1989. DynamicsofmitochondrialDNAevo-lution in animals: Amplification and sequencing with conserved primers. Proceedings of the Na-tional Academy of Sciences, USA 86:6196-6200.
Swift fox distribution in Wyoming: A biogeographical study. Master's Thesis
- M Linberg
Linberg, M. 1986. Swift fox distribution in Wyoming: A biogeographical study. Master's Thesis. Univer-sity of Wyoming, Laramie.
Dogs, jackals, wolves, and foxes: A monograph of the Canidae
- F R S Mivart
Mivart, F. R. S. 1890. Dogs, jackals, wolves, and foxes: A monograph of the Canidae. R. H. Porter, London.
Ecology of cooperation in canids Ecological aspects of social evo-lution Intraspecific variation in canid social systems Car-nivore behavior, ecology, and evolution Evolution of animal mitochondrial DNA: Rele-vance for population biology and systematics
- P D Moehlman
- N J Moritz
- T E Dowling
- W M Brown
Moehlman, P. D. 1986. Ecology of cooperation in canids. Pp. 64-86 in D. I. Rubenstein and R. W. Wrangham, eds. Ecological aspects of social evo-lution. Princeton University Press, Princeton, N.J. 1989. Intraspecific variation in canid social systems. Pp. 143-163 in J. L. Gittleman, ed. Car-nivore behavior, ecology, and evolution. Cornell University Press, Ithaca, N.Y. Moritz, C., T. E. Dowling, and W. M. Brown. 1987. Evolution of animal mitochondrial DNA: Rele-vance for population biology and systematics. An-nual Review of Ecology and Systematics 18:269-292.
PAUP: Phylogenetic Analysis Using Parsimony (version 3.0) Illinois Natural History Society
- D L Swofford
Swofford, D. L. 1989. PAUP: Phylogenetic Analysis Using Parsimony (version 3.0). Illinois Natural History Society, Champaign, Ill.
The taxo-nomic status of kit foxes
- W A Thornton
- G C Creel
Thornton, W. A., and G. C. Creel. 1975. The taxo-nomic status of kit foxes. Texas Journal of Science 26: 127-136.
Mitochondrial DNA analysis of the eastern coyote: Origins and
- R K Wayne
- N Lehman
Wayne, R. K., and N. Lehman. 1992. Mitochondrial DNA analysis of the eastern coyote: Origins and