LIGHT/TNFSF14 increases osteoclastogenesis and decreases osteoblastogenesis in multiple myeloma-bone disease

Abstract

LIGHT, a TNF superfamily member, is involved in T-cell homeostasis and erosive
bone disease associated with rheumatoid arthritis. Herein, we investigated whether
LIGHT has a role in Multiple Myeloma (MM)-bone disease. We found that LIGHT was
overproduced by CD14+ monocytes, CD8+ T-cells and neutrophils of peripheral
blood and bone marrow (BM) from MM-bone disease patients. We also found that
LIGHT induced osteoclastogenesis and inhibited osteoblastogenesis. In cultures
from healthy-donors, LIGHT induced osteoclastogenesis in RANKL-dependent and
-independent manners. In the presence of a sub-optimal RANKL concentration, LIGHT
and RANKL synergically stimulated osteoclast formation, through the phosphorylation
of Akt, NFκB and JNK pathways. In cultures of BM samples from patients without bone
disease, LIGHT inhibited the formation of CFU-F and CFU-OB as well as the expression
of osteoblastic markers including collagen-I, osteocalcin and bone sialoprotein-II.
LIGHT indirectly inhibited osteoblastogenesis in part through sclerostin expressed by
monocytes. In conclusion, our findings for the first time provide evidence for a role
of LIGHT in MM-bone disease development.

Full text

Oncotarget1
www.impactjournals.com/oncotarget
www.impactjournals.com/oncotarget/ Oncotarget, Advance Publications 2014
LIGHT/TNFSF14 increases osteoclastogenesis and decreases
osteoblastogenesis in multiple myeloma-bone disease
Giacomina Brunetti1,*, Rita Rizzi2,*, Angela Oranger1, Isabella Gigante1,
Giorgio Mori3, Grazia Taurino1, Teresa Mongelli1, Graziana Colaianni1,
Adriana Di Benedetto1, Roberto Tamma1, Giuseppe Ingravallo4, Anna Napoli4,
Maria Felicia Faienza5, Anna Mestice2, Paola Curci2, Giorgina Specchia2, Silvia
Colucci1,*, Maria Grano1,*
1 Department of Basic and Medical Sciences, Neurosciences and Sense Organs, section of Human Anatomy and Histology,
University of Bari, Bari, Italy
2 Department of Emergency and Organ Transplantation, Section of Hematology with Transplantation, University of Bari,
Bari, Italy
3Department of Clinical and Experimental Medicine, University of Foggia, Foggia, Italy
4Department of Emergency and Organ Transplantation, University of Bari, Bari, Italy
5Department of Biomedical Sciences and Human Oncology, University of Bari, Bari, Italy
*These authors contributed equally to this work
Correspondence to:
Brunetti Giacomina, e-mail: giacomina.brunetti@uniba.it
Keywords: LIGHT/TNFSF14, multiple myeloma, bone disease, osteoclast, osteoblast
Received: August 08, 2014 Accepted: October 23, 2014 Published: November 12, 2014
ABSTRACT
LIGHT, a TNF superfamily member, is involved in T-cell homeostasis and erosive
bone disease associated with rheumatoid arthritis. Herein, we investigated whether
LIGHT has a role in Multiple Myeloma (MM)-bone disease. We found that LIGHT was
overproduced by CD14+ monocytes, CD8+ T-cells and neutrophils of peripheral
blood and bone marrow (BM) from MM-bone disease patients. We also found that
LIGHT induced osteoclastogenesis and inhibited osteoblastogenesis. In cultures
from healthy-donors, LIGHT induced osteoclastogenesis in RANKL-dependent and
-independent manners. In the presence of a sub-optimal RANKL concentration, LIGHT
and RANKL synergically stimulated osteoclast formation, through the phosphorylation
of Akt, NFκB and JNK pathways. In cultures of BM samples from patients without bone
disease, LIGHT inhibited the formation of CFU-F and CFU-OB as well as the expression
of osteoblastic markers including collagen-I, osteocalcin and bone sialoprotein-II.
LIGHT indirectly inhibited osteoblastogenesis in part through sclerostin expressed by
monocytes. In conclusion, our ndings for the rst time provide evidence for a role
of LIGHT in MM-bone disease development.
INTRODUCTION
Multiple Myeloma (MM)-bone disease,
characterized by osteolytic lesions, is the most frequent
clinical manifestation of symptomatic MM, being detected
in 70 to 80% of patients at diagnosis and up to 90% at
relapse. It increases the risk of skeletal-related events
such as bone pain, pathological fractures, and spinal cord
compression [1].
Osteolytic lesions result from an imbalance
between increased osteoclast (OC) activity and reduced
osteoblast (OB) repair [2–4]. The latter has also been
related to suppressed functions of Wnt-signalling due
to MM-cells through the expression of Wnt inhibitors
such as dickkopf-1 (DKK1) and Sclerostin [5–11]. In
addition, several cytokines belonging to tumour necrosis
factor superfamily (TNFSF) have been implicated in
the increased osteoclastogenesis [2, 3, 12–13]. Among
these, decoy receptor 3 (DcR3) plays an important role
in the OC formation occurring in MM-bone disease,
as we previously described [14]. DcR3 is known to
be also a soluble receptor of LIGHT [15] (homologous

Oncotarget2
www.impactjournals.com/oncotarget
to Lymphotoxins exhibiting Inducible expression and
competing with herpes simplex virus Glycoprotein D for
herpes virus entry mediator [HVEM], a receptor expressed
by T lymphocytes), whose potential involvement in MM
is unknown.
LIGHT is a member of TNFSF (TNFSF14)
expressed on cells with an immunological role such as
activated T-cells, monocytes, granulocytes, spleen cells,
and immature dendritic cells [15, 16]. As membrane-
anchored or secreted form, LIGHT can bind two
membrane-bound TNFSF signalling receptors, HVEM
and lymphotoxin beta receptor (LTβR). HVEM is
expressed on endothelial, dendritic, natural killer,
T- and B-cells [17, 18] while LTβR is expressed on
broblasts, monocytes, endothelial, epithelial and
stromal cells [19]. Following the interaction of LIGHT
with HVEM or LTβR, the recruitment of TNF receptor
(TNFR)-associated factor-2 (TRAF2) and TRAF5
occurs, leading to gene induction through the activation
of Nuclear-Factor-kappaB (NFκB) or c-Jun N-terminal
kinase (JNK)/ activator protein 1 (AP-1) pathway, and
nally resulting in cytokine production, cell survival or
proliferation [20–23]. The LIGHT–LTβR interaction can
also lead to cell death through the recruitment of TRAF3
and subsequent activation of caspases [24, 25]. Through
the interaction with HVEM, LIGHT is described as a
potent T-cell co-stimulatory molecule [13, 17, 26, 27]; its
constitutive expression on T-cells causes activation and
expansion of these cells, favouring the development of
autoimmune diseases [28, 29]. Moreover, LIGHT has
been implicated in rheumatoid arthritis bone erosions
[30, 31]. To date, there are three literature reports on
the contribution of LIGHT to OC formation, reaching
conicting results [30–32]. In particular, LIGHT was
reported to induce in vitro differentiation of OCs from
peripheral blood (PB) CD14+ monocytes of healthy-
donors, when co-cultured with nurse-like cells isolated
from the synovium of patients with rheumatoid arthritis
[30]. Conversely, no OCs differentiated from the same
CD14+ monocytes cultured alone [30]. In addition, other
Authors reported that, in the presence or absence of the
key pro-osteoclastogenic cytokine receptor activator
of nuclear factor-kappaB ligand (RANKL), LIGHT
induced OC differentiation from human peripheral
blood mononuclear cells (PBMCs) of healthy-donors
[31, 32]. The in vitro data regarding the LIGHT pro-
osteoclastogenic role as well as the LIGHT high serum
levels [31] found in rheumatoid arthritis patients
supported a LIGHT contribution to the pathological bone
resorption.
Based on the above literature data and consistently
with our previous studies [8, 12, 14], we investigated the
expression of LIGHT in MM patients and the role that
this cytokine may play in the osteoclastogenesis and
osteoblastogenesis occurring in MM-bone disease.
RESULTS
LIGHT expression in monocytes, T-cells,
neutrophils and myeloma-cells from patients
and controls
By means of real-time PCR, western blotting,
ow cytometry and immunohistochemistry, we assessed
the expression of LIGHT in BM aspirates and biopsies
from patients as well as in PB from patients and healthy-
donors. Using these different methods, LIGHT resulted
overexpressed in 52/58 (90%) of MM-bone disease
samples, at both mRNA and protein levels; otherwise in
all the other samples, its expression resulted at the lowest
detectable levels by real-time PCR, and undetectable
by western blotting. In particular, LIGHT expression
was detected in CD14+ monocytes from all the positive
samples whereas, in 50% of them, it was detected in CD2
+
T-cells and/or neutrophils, too. The above results, referred
to PB samples analyzed by real-time PCR and western
blotting, are shown in Figures 1A and 1B, respectively.
The corresponding BM samples gave overlapping results
(data not shown). In Table 1, the mean values of the ow
cytometry results are detailed; they are referred to CD14+
monocytes, CD16+ neutrophils and CD8+ T-cells. The latter
cells were identied as the main LIGHT expressing T-cell
subset in MM-bone disease samples. Representative dot
plots of LIGHT cell expression are shown in Figure 1C.
By western blotting, we found low expression
of LIGHT in human myeloma cell lines (HMCLs -
i.e. H929, RPMI-8226, U266) as well as in CD138+
myeloma-cells, isolated from MM-bone disease
patients. In these cells, by ow cytometry, we detected
LIGHT expression at a percentage ranging from 2 to
5 (data not shown). By immunohistochemistry, we
demonstrated strong expression of LIGHT in BM biopsy
samples from MM-bone disease patients (Figure 1D).
We did not nd statistically signicant difference
in LIGHT serum levels among patients with MM-
bone disease (207.71 ± 26.53 pg/ml) or symptomatic
MM without bone disease (179.84 ± 20.48 pg/ml) as
well as in the other samples from patients with sMM
(237 ± 89 pg/ml), MGUS (183 ± 20.58 pg/ml), non-
neoplastic disease (199 ± 21.2 pg/ml) and healthy-donors
(189.84 ± 20.83 pg/ml).
Anti-LIGHT monoclonal antibody affects
osteoclast formation in cultures of PBMCs and
BMMNCs from MM-bone disease patients
In culture media of PBMCs and BM mononuclear
cells (BMMNCs) from MM-bone disease patients, we
found higher LIGHT levels than in those from controls
(1939 ± 220 pg/ml vs 74.7 ± 30 pg/ml, p < 0.001;

Oncotarget3
www.impactjournals.com/oncotarget
Figure 1: LIGHT expression in patients and controls. Monocytes, T-cells and neutrophils from peripheral blood of controls (ctr),
MGUS, smoldering MM (sMM) and symptomatic MM patients without or with bone disease were assessed for LIGHT expression by real-
time PCR (A), western blotting (B) and ow cytometry (C). LIGHT immunostaining was performed in bone marrow biopsies (D).
(Continued)

Oncotarget4
www.impactjournals.com/oncotarget
1750 ± 352 pg/ml vs 66.2 ± 44 pg/ml, p < 0.01,
respectively). The culture treatment with sequential
escalating doses, ranging from 0.005 to 500 ng/ml, of
anti-LIGHT monoclonal antibody (mAb) induced a
dose-dependent inhibition of osteoclastogenesis, quite
different in cultures derived from PBMCs and BMMNCs,
respectively. Indeed in PBMC cultures, 30% inhibition
of osteoclastogenesis was induced by the lowest dose
(0.005 ng/ml) of the anti-LIGHT mAb, increasing
up to 50% at the highest dose of the mAb (500 ng/ml)
(Figure 2A). In BMMNC cultures, the highest dose
(500 ng/ml) of the mAb was instead required to observe
Figure 1: The lowest mRNA levels of LIGHT were detected in monocytes (Aa), T-cells (Ab) and neutrophils (Ac) from
controls, MGUS, sMM and symptomatic MM patients without bone disease. As compared with all of them, LIGHT mRNA
higher levels of 11-fold (P < 0.0001) in monocytes (Aa), 9.2 fold ( p < 0.001) in T-cells (Ab) and 1.8- fold ( p < 0.01) in
neutrophils (Ac) were detected in symptomatic MM patients with bone disease. In these latter, high levels of LIGHT protein
were detected by western blotting in 90% of monocytes (Ba), 50% of T-cells (Bb) and 50% of neutrophils (Bc), whereas the
samples of symptomatic MM patients without bone disease, sMM, MGUS and controls did not display a detectable LIGHT
protein amount. Flow cytometry dot plots showed LIGHT expression on CD14+ monocytes, CD8+ T-cells and CD16+
neutrophils from a representative symptomatic MM patient without bone disease, and a symptomatic MM patient with bone-
disease; in particular, LIGHT levels were higher in the former than in the latter (C). LIGHT positive immunostaining was also
observed in the bone marrow biopsy from a representative symptomatic MM patient with bone-disease; conversely, LIGHT
resulted negative in a symptomatic MM patient without bone-disease (D). The photomicrographs were obtained using a Nikon
Eclipse E400 microscope equipped with a Nikon plan Apo 20×/0.75 DICM (Nikon, Italia), Magnication 200X.
ERK, extracellular signal-regulated kinase.
Table 1: Cytouorimetric expression of LIGHT in CD14+ Monocytes, CD8+ T-cells and CD16+
Neutrophils from all peripheral blood and bone marrow samples.
Peripheral Blood
CD14+ Monocytes CD8+ T-cells CD16+ Neutrophils
Healthy-
donors
Symptomatic
MM w/o
bone disease
Symptomatic
MM with
bone disease
Healthy-
donors
Symptomatic
MM w/o
bone disease
Symptomatic
MM with
bone disease
Healthy-
donors
Symptomatic
MM w/o
bone disease
Symptomatic
MM with
bone disease
1 ± 0.5 3.6 ± 2.8 47.1 ± 9.5* 1.1 ± 0.5 1 ± 0.5 8.0 ± 5.5§ 1 ± 0.9 2 ± 1.1 40.3 ± 17.8*
Bone Marrow
CD14+ Monocytes CD8+ T-cells CD16+ Neutrophils
Patients
with non-
neoplastic
disease
Symptomatic
MM w/o
bone disease
Symptomatic
MM with
bone disease
Patients
with non-
neoplastic
disease
Symptomatic
MM w/o
bone disease
Symptomatic
MM with
bone disease
Patients
with non-
neoplastic
disease
Symptomatic
MM w/o
bone disease
Symptomatic
MM with
bone disease
1.1 ± 0.2 3.5 ± 2.3 48.5 ± 8.5* 0.8 ± 0.3 1 ± 0.8 12.7 ± 7.8§ 0.9 ± 0.3 2.1 ± 1.1 21.2 ± 9.6*
*P < 0.0001;§P < 0.009

Oncotarget5
www.impactjournals.com/oncotarget
a 50% reduction of osteoclastogenesis rate (Figure 2B).
Since spontaneous osteoclastogenesis in vitro occurred
only in MM-bone disease patients, we did not test the
effect of anti-LIGHT mAb in PBMCs and BMMNCs of
MGUS and sMM patients.
Anti-LIGHT mAb affects osteoblast
differentiation in cultures of BMNCs
from MM-bone disease patients
To investigate whether LIGHT could be implicated
in the impaired OB differentiation occurring in MM-bone
disease, we performed long-term cultures (allowing cell
to cell contacts) of patients’ bone marrow nuclear cells
(BMNCs), in the absence or presence of the anti-LIGHT
mAb (100 or 200 ng/ml). CFU-F and CFU-OB formation
was referred to the early and the late phase of OB
differentiation, respectively. In the absence of anti-LIGHT
mAb, the formation rate of both the CFU-F and CFU-OB
was low (Figure 3 A-B). Otherwise, in the presence of anti-
LIGHT mAb at both the concentrations, a dose-dependent
increase of CFU-F and CFU-OB formation occurred
(Figure 3 A, B). The anti-LIGHT mAb seems to exert the
above effects through the induction of BM stromal fraction
proliferation, as shown with the 5’-Bromo-2’-deoxyuridine
(BrdU) test. Indeed, there was a dose-dependent increase
of BrdU incorporation by the BMNCs, cultured in
the presence of 100 or 200 ng/ml anti-LIGHT mAb
(Figure 3C). Thereafter by ow cytometry, we identied
the CD45+ cells as the source of LIGHT in CFU-F and
CFU-OB cultures from MM-bone disease patients (data
not shown). Additionally, the puried BM stromal cell
fraction (BMSCs), cultured in osteogenic medium, did
not express LIGHT mRNA in contrast with the positive
control, consisting of LIGHT expressing T-cells from
MM-bone disease patients, as shown in Figure 3D.
Figure 2: Anti-LIGHT mAb inhibits the osteoclast formation in cultures from MM-bone disease. Multinucleated and
TRAP+ cells, differentiated from peripheral blood mononuclear cell (PBMC) (A) and bone marrow mononuclear cells (BMMNC)
(B) cultures of MM-bone disease patients, were evaluated after 21 days of culture in the presence of anti-LIGHT mAb or control anti-IgG
mAb. The anti-LIGHT mAb culture treatment resulted in a dose-dependent inhibition of osteoclastogenesis, which was not affected by the
control anti-IgG mAb. The number of multinucleated and TRAP+ cells, identied as OCs, are represented in the graphs as mean ± SE of
all experiments performed in each patient’s sample.

Oncotarget6
www.impactjournals.com/oncotarget
Figure 3: Anti-LIGHT mAb effect on CFU-F and CFU-OB formation in BMNC cultures of MM-bone disease
patients. (A) CFU-F and (B) CFU-OB detected in bone marrow nuclear cell (BMNC) cultures from MM-bone disease patients, in the
absence (0) or presence of 100 or 200 ng/ml anti-LIGHT neutralizing mAb. The results were compared to those obtained from untreated
BMNC cultures. Anti-LIGHT mAb signicantly increased CFU-F (A) and CFU-OB (B) formation in a dose-dependent manner. No effect
was detected in the presence of a control anti-IgG mAb. The graphs represent the mean number of CFU-F/well or CFU-OB/well ± SE of
6 independent experiments performed in triplicate. (C) 5-bromo-2-deoxyuridine (BrdU) incorporation evaluated in BMNC cultures from
MM-bone disease patients, treated or not with 100 and 200 ng/ml anti-LIGHT mAb, which positively affected cell proliferation. The graph
represents BrdU incorporation evaluated in 6 experiments performed in quadruplicate. (D) Puried bone marrow stromal cells (BMSCs)
cultured in osteogenic medium for 0, 10 and 20 days did not express LIGHT mRNA. The positive control was represented by T-cells from
MM-bone disease patients. (E) Anti-LIGHT mAb increased the expression at mRNA level of Alkaline Phosphatase (ALP) and Collagen-I
(COLL-I). (F) Anti-LIGHT mAb increased the expression at mRNA level of osteocalcin (OCN), bone sialoprotein II (BSP II), Osterix
(OSX) and Fra-2. The graphs show 6 real-time PCR experiments performed in triplicate.

Oncotarget7
www.impactjournals.com/oncotarget
By real-time PCR in CFU-F cultures from those patients,
we found a low expression of ALP and COLL-I, strongly
increased after treatment with 100ng/ml or 200ng/ml anti-
LIGHT mAb (Figure 3E). Further in CFU-OB untreated
cultures, we detected a low expression of BSPII and OCN
(matrix glycoproteins typically expressed during the late
phase of OB differentiation) as well as of Fra-2 and OSX
(transcription factors), as represented in Figure 3F.
In the presence of 100 or 200ng/ml anti-LIGHT mAb, we
detected signicantly increased mRNA levels of the above
molecules. The control anti-IgG mAb did not affect such
mRNA expression (data not shown).
LIGHT induces osteoclast differentiation
from healthy-donor PBMCs and puried
CD14+ monocytes
We investigated the effect of LIGHT on OC
differentiation in cultures of unfractionated PBMCs
or puried CD14+ monocytes from healthy-donors. In
these cultures, the monocyte precursors differentiate
into multinucleated TRAP+ OCs within 18–21 days,
only in the presence of MCSF (25 ng/ml) and RANKL
(30 ng/ml). In PBMC cultures treated with MCSF and
LIGHT at increasing concentrations (5, 20 or 50 ng/ml), a
dose-dependent formation of multinucleated and TRAP+
cells was also seen. In the presence of LIGHT, however,
the formation of a lower number of OCs than in RANKL
(30 ng/ml) treated cultures appeared. Moreover, in PBMC
cultures treated with both LIGHT (at the concentrations
of 5, 20 or 50 ng/ml) and RANKL (at a sub-optimal
dose of 20 ng/ml), active osteoclastogenesis occurred.
Herein, the rate of OC formation was signicantly
higher than in the presence of either LIGHT or RANKL
alone (Figure 4A). The OCs formed in the presence of
LIGHT (with or without RANKL) were functional, as
demonstrated by their ability in resorbing mineralized
matrix. In particular, in the PBMC cultures, OC
resorption area increased proportionally to the escalating
concentrations of LIGHT; this aspect was more evident
in cultures treated with both LIGHT and RANKL, as
represented in Figure 4B. The same results, referred
Figure 4: LIGHT pro-osteoclastogenic effect. LIGHT treatment of cultures of PBMCs from healthy-donors resulted in dose-
dependent increase of OC formation (A) and resorption activity (B). These effects were more evident after culture treatment with both
RANKL and LIGHT. TRAP+ OC number (A), and resorption area percentage (B) were assessed, and the results represented the mean ±
SE of 12 independent experiments. (C) Western blot analysis of phosphorylated AKT, JNK, IKB in pre-osteoclasts from healthy-donors
incubated with RANKL, RANKL + LIGHT, or LIGHT over a time course (0 to 60 min).

Oncotarget8
www.impactjournals.com/oncotarget
to both the number of formed OCs and the resorption
area, were obtained in cultures from puried CD14+
monocytes (data not shown).
To further investigate LIGHT effect on OC
formation in the presence or absence of RANKL, we
analyzed both the intracellular signal and the expression of
HVEM and LTβR in pre-osteoclasts treated with RANKL
and/or LIGHT. RANKL as well as LIGHT induced the
phosphorylation of IκBα (at 5–10 min for RANKL, and
longer for LIGHT), JNK (maximum at 50–60 min) and
Akt (maximum at 40–60 min) (Figure 4C). Otherwise,
the simultaneous treatment with LIGHT and RANKL
resulted in early and/or prolonged phosphorylation of
Akt (persisting for all the investigated times), IκBα
(maximum at 5–20 min) and JNK (maximum at 40–60
min) (Figure 4C). By contrast, the expression of HVEM
and LTβR did not signicantly change after the pre-
osteoclast exposure to RANKL, LIGHT or both (data
not shown).
LIGHT effect on osteoblastogenesis
We investigated the effect of LIGHT on
osteoblastogenesis by assessment of CFU-F and CFU-OB
formation, occurring in cultures of BMNCs from patients
without MM-bone disease (including symptomatic MM,
sMM, MGUS, non-neoplastic disease), in the presence or
absence of 100 or 200 ng/ml LIGHT. In BMNC cultures,
we found that LIGHT treatment strongly inhibited both
CFU-F (Figure 5A) and CFU-OB (Figure 5B) formation
in a dose-dependent manner. Moreover, we found that
LIGHT impaired the expression of osteogenic markers
of both early and late phase of OB differentiation. In the
early phase, LIGHT particularly inhibited the expression
of Alkaline Phosphatase (ALP), and Collagen-I (COLL-I),
Fra-2 and Jun-D (Figure 5C); differently in the late phase,
it decreased mRNA levels of osteopontin (OPN), bone
sialoprotein II (BSP II), osteocalcin (OCN) and Osterix
(OSX) (Figure 5D).
Figure 5: LIGHT effect on CFU-F and CFU-OB formation. (A) CFU-F and (B) CFU-OB formation were detected in BMNC
cultures from MGUS and non-neoplastic patients in the absence (0) or presence of 20, 50 or 100 ng/ml LIGHT. The results were compared
to those obtained from parallel untreated cultures. LIGHT signicantly inhibited both CFU-F (A) and CFU-OB (B) formation in a dose-
dependent manner. The graphs represent the mean number of CFU-F/well or CFU-OB/well ± SE of 6 independent experiments performed
in triplicate. (C) LIGHT inhibited the expression at mRNA level of Alkaline Phosphatase (ALP), Collagen-I (COLL-I), Fra-2 and Jun-D.
(D) LIGHT signicantly inhibited the expression at mRNA level of osteopontin (OPN), bone sialoprotein II (BSP II), osteocalcin (OSC)
and Osterix (OSX). The graphs show 6 real-time PCR experiments performed in triplicate.

Oncotarget9
www.impactjournals.com/oncotarget
These experiments, however, did not indicate
whether LIGHT exerts a direct or indirect effect
on osteoblastogenesis, because BMNCs include
mesenchymal (i.e. stromal) cells differentiating into OBs
and hematopoietic cells. On the other hand, the latter
cells are known to express LIGHT receptors [17–19],
and to secrete soluble factors positively affecting CFU-F
and CFU-OB survival and proliferation [33]. To address
this issue, we performed cultures of either bone marrow
stromal cells (BMSCs) or mesenchymal stem cells
(MSCs) from dental follicle, which allowed to exclude
hematopoietic cell involvement in LIGHT-mediated
osteoblastogenesis; both BMSCs and MSCs are indeed
lacking in hematopoietic cell fraction. The BMSCs as
well as the MSCs were cultured in osteogenic medium
and in the presence or absence of LIGHT; MSCs were
co-cultured with monocytes and/or T-cells, too. LIGHT
resulted to affect osteoblastogenesis neither in the cultures
of BMSCs (data not shown) nor in those of MSCs alone
(Figure 6A), suggesting that it is not able to exert a
direct effect on osteoblastogenesis. Conversely, in the
co-cultures of MSCs either with monocytes plus T-cells or
with monocytes alone, we detected a signicant LIGHT
impairment of osteoblastogenesis (Figure 6A). Indeed in
Figure 6: LIGHT effect on osteoblastogenesis in co-cultures of mesenchymal stem cells and monocytes with or without
T-cells. (A) For 8 days in osteogenic medium and in the presence or absence of 100 ng/ml LIGHT, mesenchymal stem cells (MSCs) were
cultured alone or co-cultured with monocytes + T-cells, monocytes, or T-cells, respectively. In co-cultures of MSCs with either monocytes
+ T-cells or monocytes alone, LIGHT signicantly inhibited the differentiation of Alkaline Phosphatase positive (ALP+) osteoblasts. The
graphs represent the mean percentage of ALP positive area/well ± SE of 5 independent experiments performed in triplicate. (B) In the same
conditions, LIGHT inhibited the expression, at mRNA level, of Alkaline Phosphatase (ALP) and Collagen-I (COLL-I) in co-cultures of
MSCs with monocytes + T-cells, or monocytes alone, respectively.
(Continued )

Oncotarget10
www.impactjournals.com/oncotarget
LIGHT treated co-cultures, we found signicantly reduced
ALP positive surface/well (Figure 6A) as well as lower
levels of ALP and COLL-I mRNA than in the untreated
co-cultures (Figure 6B). Albeit slightly, LIGHT inhibitory
effect on osteoblastogenesis was more evident in the
co-cultures of MSCs with monocytes plus T-cells than in
those with monocytes alone. Finally, no LIGHT effect on
osteoblastogenesis was detected in the co-cultures between
MSCs and T-cells (Figure 6A).
High Sclerostin levels were associated to LIGHT
inhibitory effect on osteoblastogenesis
In order to investigate the mechanism of LIGHT
inhibitory effect on osteoblastogenesis, we treated the
co-cultures of MSCs with monocytes alone or monocytes
plus T-cells with 100 ng/ml LIGHT for 3, 6 and 12 hours,
after over-night MSC adhesion. At each time, cell
extracts from isolated monocytes, and from monocytes
Figure 6: (C) In the absence or presence of 100 ng/ml LIGHT over a time course [0 to 12 hours (h)], cultures of monocytes
+ T-cells or monocytes alone as well as co-cultures of MSCs with monocytes + T-cells, or monocytes alone were performed.
Thereby, sclerostin expression was evaluated in the cell extracts from each co-culture consisting of monocytes + T-cells or
monocytes alone. The results showed a signicant sclerostin up-regulation occurring at 6 hours in the co-coltures of MSCs
with monocytes + T-cells, and at 12 hours in those of MSCs with monocytes alone. (D) For 8 days in osteogenic medium
and in the presence or absence of 100 ng/ml LIGHT and/or 100 ng/ml anti-sclerostin mAb, mesenchymal stem cells (MSCs)
were cultured alone and co-cultured with monocytes + T-cells or monocytes, respectively. By treating the above described
co-cultures simultaneously with LIGHT and a neutralizing anti-sclerostin mAb, LIGHT inhibitory effect on the differentiation
of ALP+ osteoblasts was partially reverted.

Oncotarget11
www.impactjournals.com/oncotarget
plus T-cells were obtained after purity assessment (99%
CD45+) by ow cytometry. The above cell extracts were
then evaluated for the expression of genes involved in
osteoblastogenesis inhibition such as TNFα, DKK1 and
sclerostin. Among these, statistically signicant results
were obtained only for sclerostin, which is known to be
produced by osteocytes [34]. After 6h LIGHT treatment,
increased levels of sclerostin mRNA were detected in the
monocyte plus T-cell extracts; otherwise in the monocyte
extracts, sclerostin expression increased to a statistically
signicant level after 12h LIGHT treatment, as depicted
in Figure 6C. Therefore, the effect of LIGHT on sclerostin
expression was stronger in the RNA extracts from
monocytes than in those from monocytes plus T-cells. In
the cell extracts from the parallel cultures without MSCs,
no sclerostin mRNA expression was instead detected
(Figure 6C). Interestingly, the treatment of the above
co-cultures with both LIGHT and a neutralizing anti-
sclerostin mAb, partially reverted the sclerostin inhibitory
effect on osteoblastogenesis (Figure 6D).
DISCUSSION
The results of the present study highlighted the high
expression of LIGHT in PB and BM samples from the
large majority of MM-bone disease patients at diagnosis,
in whom LIGHT was demonstrated to be involved
in both increased osteoclastogenesis and decreased
osteoblastogenesis.
Firstly, we detected high LIGHT expression in
CD14+ monocytes, CD8+ T-cells and CD16+ neutrophils
from PB and BM of newly diagnosed patients with MM-
bone disease. Conversely, we found a low or undetectable
expression of LIGHT in the other samples from patients
affected by symptomatic MM without bone disease, sMM,
MGUS, non-neoplastic disease and in healthy-donors.
In the literature, LIGHT was reported in rheumatoid
arthritis erosive bone-disease as expressed by synovial
CD4+ T-cells [35] as well as PB and synovial uid CD14+
monocytes and CD20+ B-cells [36].
Secondly, by means of an in vitro osteoclastogenesis
model consisting of PBMC and BMMNC cultures
from MM-bone disease patients, we demonstrated that
LIGHT exerts a pro-osteoclastogenic effect. Indeed, the
neutralizing anti-LIGHT mAb induced a dose-dependent
inhibition of osteoclastogenesis spontaneously occurring
in both the above cultures derived from MM-bone disease
patients. We observed, however, that in PBMC cultures
lower doses of the mAb inhibited OC formation, compared
with those required to obtain the same effect in the parallel
BMMNC cultures. Consistently with the literature
including our previous reports [2, 12, 14, 37], these results
support the involvement of various cytokines, guring
out the occurrence of alternate or additional pathways
concerning OC formation and activity. Additionally, it
must be also considered the greater complexity of the
cultures derived from BM compared to those from PB
[37, 38].
Furthermore, we investigated LIGHT pro-
osteoclastogenic effect using cultures of PBMCs or
CD14+ monocytes from the healthy-donors, where
LIGHT dose-dependently increased the OC formation
rate. This nding was amplied in the presence of a sub-
optimal concentration of RANKL, indicating that LIGHT
pro-osteoclastogenic effect occurs both in a RANKL-
dependent and -independent way, as also reported in
the literature [31, 32]. Conversely, other Authors did
not describe a LIGHT pro-osteoclastogenic effect from
CD14+ monocyte precursors [30]; these conicting results
might be explained by different culture conditions, such
as the number of monocytes plated by them, which was
lower than ours [30]. In addition, we found that LIGHT
pro-osteoclastogenic effect is related to phosphorylation of
the intracellular signaling, typically activated by RANKL
during osteoclastogenesis and including IkB, AKT and
JNK pathways [39, 40]. However, other Authors [32]
described the phosphorylation of both IkB and AKT,
following LIGHT stimulation of RAW264 and HL60, and
a low rate of phosphorylation of JNK in HL60; both these
murine monocyte cell lines are capable of differentiating
into OCs under appropriate conditions [31, 41]. The
absence or the low rate of JNK phosphorylation might
be related to the use of cell lines rather than primary
human cells [32]. We detected early and sustained
phosphorylation of IkB, AKT and JNK in the cultures
treated with both LIGHT and RANKL, whose synergic
pro-osteoclastogenic effect resulted herein highlighted.
It seems to resemble a mechanism possibly underlying
the in vivo bone destruction occurring in MM-bone
disease, where RANKL is known to play a pivotal role
[2, 12, 13, 42].
Thirdly, the results of the present study showed for
the rst time that LIGHT also affects OB differentiation
in BMNC cultures derived from MM-bone disease
patients; in which, the osteoblastogenesis indeed resulted
signicantly improved by the addition of anti-LIGHT
mAb. Moreover in BMNC cultures from patients without
bone disease, we demonstrated that the addition of LIGHT
inhibited osteoblastogenesis. Since BMNCs include
mesenchymal cell fraction and CD45+ cells, we could
not argue whether LIGHT induces the osteoblastogenesis
impairment through a direct or indirect effect. Thus, we
carried on with our study evaluating OB differentiation
from BMSCs of patients with or without bone disease,
in the presence or absence of LIGHT. In addition,
we assessed the effects of LIGHT on MSCs isolated
from dental follicle, cultured alone or co-cultured with
monocytes and/or T-cells. This model was suitable for our
purposes since MSCs are known to be immunologically
privileged cells [43]. Since no effect of LIGHT on OB
differentiation was detected either in cultures of BMSCs

Oncotarget12
www.impactjournals.com/oncotarget
or in those of MSCs alone, the event of a LIGHT direct
effect could be excluded. On the contrary, the results
we detected in the co-cultures of MSCs with monocytes
alone and/or T-cells pointed out a LIGHT indirect effect,
to some extent occurring through the release of sclerostin
by monocytes. Sclerostin is indeed a key inhibitor of
OB differentiation, known to be produced by osteocytes
[34], whereas there are no literature data concerning
its expression by monocytes. Some Authors, however,
described sclerostin expression within the hematopoietic
islands of embryo livers and by OCs, which are known
to be derived from the fusion of monocyte precursors
[44, 45]. Therefore, we could argue that sclerostin may be
expressed by monocytes under particular conditions. There
are numerous literature reports on monocyte involvement
in osteoblastogenesis [46–48]; in particular, bone resident
macrophages have been recognized as critical regulators of
bone homeostasis and repair in a murine tibia injury model
[48]. The increase of cytokines such as IL-1β, IL-6, IL-10
and TNFα was described as following the MSC-monocyte
contact [49–53]; no role was, however, recognized to these
cytokines in the enhanced monocyte-induced osteogenesis.
In studies using MG-63 osteoblastic cell line or calvarial
OBs, IL-6 has been described as involved in the direct
promotion of osteogenic differentiation [54, 55]. More
recently, monocytes have been reported as regulating the
osteogenic differentiation of MSCs through cell-contact
mechanisms involving Oncostatin-M in monocytes, and
STAT-3 signaling in MSCs [56].
In conclusion, the results of the present study show
for the rst time high expression of LIGHT by monocytes,
T-cells and neutrophils from symptomatic MM patients
with bone disease. Further, our results show that LIGHT
seems to be implicated in the development of MM-bone
disease through a direct pro-osteoclastogenic effect and
an indirect induction of OB suppression. Based on these
ndings, LIGHT provides a potential target for novel
therapeutic strategies.
PATIENTS AND METHODS
Patients
PB, bone marrow (BM) aspirates and biopsies were
obtained from 80 patients newly diagnosed as having
symptomatic MM (58 of them with, and 22 without
related bone disease), 16 with smoldering MM (sMM),
and 35 with monoclonal gammopathy of undetermined
signicance (MGUS). The control samples included PB
and BM from 10 patients with non-neoplastic disease
without skeletal involvement, and PB from 30 healthy
volunteer blood donors (healthy-donors), age and sex
matching with the patients.
The patient characteristics are reported in table 2. All
patients underwent skeletal X-ray, and some of them also
required magnetic resonance imaging or computerized
tomography to assess symptomatic bone sites, pathological
fractures, cord compression or tumour mass. Patient
diagnoses were performed according to the International
Myeloma Working Group’s (IMWG) criteria [1, 57],
and symptomatic MM was also classied according to
the International Staging System (ISS) [58]. Patients and
controls gave their informed consent to the study performed
according to the Declaration of Helsinki, and approved by
Bari University Hospital Ethical Committee.
Cells and cell cultures
Human myeloma cell lines (HMCLs) and
CD138+ cells
HMCLs (H929, RPMI-8226, U266) were cultured in
RPMI-1640 medium supplemented with 10% fetal bovine
serum (FBS; Life Technologies, Milan, Italy). Plasma cells,
identied as CD138+ cells, were isolated from BM aspirates
[8]. RNA or proteins were extracted from HMCLs and fresh
CD138+ cells to evaluate LIGHT expression.
Bone marrow and peripheral blood cells
Buffy coat BM nuclear cells (BMNCs) and PB
mononuclear cells (PBMCs), isolated by Histopaque
1077 density gradient (Sigma, St Louis, MO), were plated.
Thereby, BM stromal cells (BMSCs) and BM mononuclear
cells (BMMNCs) were obtained from BMNC adherent and
non-adherent fractions, respectively. BMMNC and PBMC
cultures were performed to investigate osteoclastogenesis,
whereas BMNCs and BMSCs were cultured to investigate
osteoblastogenesis.
Mesenchymal stem cells (MSCs), bone marrow and
peripheral blood cells
MSCs, isolated as previously described [59], were
used for osteoblastogenesis experiments.
CD14+ monocyte, CD2+ T-cell and
neutrophil isolation
From PBMCs and BMNCs, CD14+ and CD2+ cells
were puried by immunomagnetic selection (Miltenyi
Biotec GmbH, Bergisch Gladbach, Germany), according
to the manufacturer’s instruction. Neutrophils were
isolated as previously described [60]. Only samples with a
purity >98%, checked by ow cytometry, were considered.
RNA and proteins were extracted from puried CD14+
monocytes, CD2+ T-cells and neutrophils to evaluate
LIGHT expression. CD14+ monocytes were also used in
osteoclastogenesis experiments.
Osteoclastogenesis
To investigate LIGHT-dependent OC formation,
BMMNCs and PBMCs from MM-bone disease
patients were plated at 1.5 × 106 cell/cm2 in α-Minimal
Essential Medium (α-MEM, Life Technologies),

Oncotarget13
www.impactjournals.com/oncotarget
supplemented with 10% FBS and cultured in the absence
or presence of anti-LIGHT mAb (0.005 to 500 ng/ml;
R&D Systems Inc., Minneapolis, MN) or control anti-
immunoglobulin G (IgG)-Ab. PBMCs and puried CD14+
cells from healthy-donors were cultured in the presence
or absence of 25 ng/ml recombinant human Macrophage
Colony Stimulating Factor (rh-MCSF) plus either
30 ng/ml rh-RANKL or rh-LIGHT (range 0-50 ng/ml)
(all from R&D Systems). For some experiments, PBMC and
CD14+ cell cultures were treated with MCSF (25 ng/ml),
RANKL (20 ng/ml), and/or LIGHT (range 5-50 ng/ml).
Mature OCs were identied as Tartrate-Resistant Acid
Phosphatase (Sigma) positive (TRAP+) cells containing
3 or more nuclei. OC resorbing activity was assessed
by plating the cells on Millennium multiwell slides
(Millennium Biologix, Kingston, ON, Canada).
To study the phophorylation of IkB, JNK and
AKT, healthy-donor PBMCs were cultured for 10 days
in the presence of MCSF to obtain pre-osteoclasts, that
after overnight starvation were incubated with RANKL,
RANKL + LIGHT, or LIGHT over a time course
(0 to 60 min).
Osteoblastogenesis
BMNCs were plated at 4 × 105/cm2 in osteogenic
differentiating medium [α-MEM supplemented with 10%
FBS, 50 µg/mL ascorbic acid, 10-8 M dexamethasone
and 10 mM beta-glycerophosphate (Sigma)]. BMNCs
from patients without bone disease were cultured in the
presence or absence of rh-LIGHT (range 20-100 ng/ml).
Conversely, BMNCs from MM-bone disease patients were
cultured in the absence or presence of 100 and 200 ng/
ml neutralizing anti-LIGHT mAb or control anti-IgG Ab.
After 21 days, colony forming unit-broblast (CFU-F)
formation was assessed with alkaline phosphatase (ALP,
Sigma) staining. After 30 days, in parallel cultures
CFU-OB formation was assessed with Von Kossa
staining [8]. The mRNA expression of ALP, collagen-I
(COLL-I), Fra-2 and JunD was analyzed in CFU-F
cultures, and that of osteopontin (OPN), Osterix (OSX),
bone sialoprotein II (BSP II) and osteocalcin (OCN) in
CFU-OB cultures.
BMSCs, cultured in α-MEM with 10% FBS, after
reaching conuence, were seeded in 6-well plate at
Table 2: Characteristics of patients and controls.
Parameters Symptomatic MM at diagnosis Smoldering
MM
MGUS Controls
With bone
disease
Without bone
disease
Patients with
non-neoplastic
disease
Healthy-
donors
Number of subjects 58 22 16 35 10 30
Gender (M/F) 30/28 12/10 9/7 18/17 6/4 18/12
Median age (range) 69 (60–85) 64 (54–84) 55 (31–83) 60 (29–83) 63(50–73) 62 (26–72)
Monoclonal
Component:
IgG/IgA/BJ/IgD/NS 47-8-2-1-0 18-3-1-0-0 25-10-0-0-0 - -
ISS-stage ISS-1: 20 ISS-1: 11
ISS-2: 18 ISS-2: 6
ISS-3: 20 ISS-3: 5
Hb<10 g/dL 12 5 - -
Creatinine ≥ 2 mg/dl 5 4 - -
Albumin<3.5 g/dL 15 2 - -
β2-M > 3 mg/L 8 2 - -
β2-M > 6 mg/L 7 - -
LDH > 240 U/L 4 1 - -
Calcium > 10 mg/dl - - -
Abbreviation: MM, multiple myeloma; MGUS, monoclonal gammopathy of undetermined signicance; M, male; F, female;
Ig, immunoglobulin; Hb, hemoglobin; CRP, C-reactive protein; LDH, lactate deydrogenase; ISS, International Staging
System; NS, non secretory.

Oncotarget14
www.impactjournals.com/oncotarget
100000/well and cultured in osteogenic medium for 0, 10
and 20 days. At each time, RNA was extracted to evaluate
LIGHT expression.
MSCs, seeded in 24-well-plate at 400/well, were
cultured alone for 8 days in osteogenic differentiating
medium, in the absence or presence of 100 ng/ml LIGHT
and/or anti-sclerostin mAb (R&D Systems). In the same
conditions, MSCs were also co-cultured with monocytes
alone, T-cells alone or monocytes plus T-cells at 750000
cell/well, respectively. At the end of culture period, ALP
staining or mRNA extraction were performed to evaluate
ALP and COLL-I expression.
Immunohistochemistry
BM biopsies were xed in 4% neutral buffered
formalin solution, decalcied, parafn-embedded, and
cut into 5 μm slices. After standard antigen retrieval
procedures, the sections were incubated overnight at
4°C with primary mouse anti-human LIGHT (Abcam,
Cambridge Science Park). The reaction was revealed with
Dako EnVisionTM FLEX+ detection system (Dako Italia
S.p.A. Milan, Italy).
Flow cytometry analysis
Freshly BM and PB samples were stained with
suitable conjugated antibody: PE-LIGHT (R&D Systems),
CD45-APC-Cy7, FITC-CD8, FITC-CD4, Pe-Cy-5-CD14
and FITC-CD16 (Becton Dickinson, Milan, Italy). Flow
cytometry analysis was performed on a FACSCantoTM II
ow cytometer (Becton Dickinson Immunocytometry
System, Mountain View, CA, USA). Positivity area was
determined using an isotype-matched mAb, and a total of
2000 events for each cell sub-population was acquired.
RNA isolation and real-time polymerase
chain reaction (PCR) amplication
RNA extraction and reverse-transcription as well
as Real-Time PCR amplication were performed, as
previously described [12]. The appropriate primer pairs
were listed in Table 3.
Western blot analysis
Cell protein extracts were analyzed by
western blotting, as previously described [12]. The
following primary antibodies were used: anti-LIGHT and
anti-β-actin (Santa Cruz Biotechnology, Santa Cruz, CA),
anti-pAKT, anti-pIkB, anti-pJNK, anti-total AKT, anti-
IkB, anti-total-ERK and anti-total JNK (Cell Signaling,
San Diego, CA, USA).
Cell proliferation assay
After 10 days of culture, the anti-LIGHT effect
on BMNC proliferation was evaluated with BrdU
incorporation by using a cell proliferation enzyme-linked
immunosorbent assay (ELISA) kit (Roche Diagnostics,
Mannheim, Germany) according to the manufacturer’s
instructions.
Table 3: Sense and antisense primer sequences.
Gene Sense primer Antisense primer Accession number
LIGHT 5′ CAGTGTTTGTGGTGGATGG 3′5′ GGGTTGACCTCGTGAGAC NM_003807.3
ALP 5′ CGCACGGAACTCCTGACC 3′5′ GCCACCACCACCATCTCG 3′NM_000478.4
COLL 1 5′ CGTGGCAGTGATGGAAGTG 3′5′ AGCAGGACCAGCGTTACC 3′NM_000089.3
OCN 5′ ACACTCCTCGCCCTATTG 3′5′ CAGCCATTGATACAGGTAGC 3′NM_199173.4
BSP II 5′ CTGCTACAACACTGGGCTATG 3′5′ TTCCTTCCTCTTCCTCCTCTTC 3′NM_004967.3
OSX 5′ GCAAGGTGTATGGCAAGG 3′5′ CATCCGAACGAGTGAACC 3′NM_001173467.1
Fra-2 5′ GAACCTCGTCTTCACCTATCC 3′5′ CCGCTGCTACTGCTTCTG 3′NM_005253.3
Jun-D 5′ CTCATCATCCAGTCCAAC 3′5′ GTTCTGCTTGTGTAAATCC 3′NM_001286968.1
OPN 5′ CTGATGAATCTGATGAACTGGTC 3′5′ GTGATGTCCTCGTCTGTAGC 3′NM_001251830.1
Sclerostin 5′ CAGCCTTCCGTGTAGTGG 3′5′ TTCATGGTCTTGTTGTTCTCC 3′NM_025237.2
β-Actin 5′ AATCGTGCGTGACATTAAG 3′5′ GAAGGAAGGCTGGAAGAG 3′NM_001101.3
Abbreviation: ALP, Alkaline Phosphatase; COLL I, Collagen Type I; OCN, Osteocalcin; BSP II, Bone Sialoprotein; OSX,
Osterix; OPN, Osteopontin.

Oncotarget15
www.impactjournals.com/oncotarget
ELISA
Patient and control sera as well as media from
BMNC, PBMC and BMMNC cultures, were evaluated
for LIGHT by ELISA (R&D Systems) according to
manufacturer’s instructions. The results were expressed
as mean ± standard error (SE).
Statistical analyses
Statistical analyses were performed by ANOVA or
Student’s t-test with the Statistical Package for the Social
Sciences (spssx/pc) software (SPSS, Chicago, IL, USA). The
results were considered statistically signicant for p < 0.05.
ACKNOWLEDGEMENTS
The authors thank Ministero dell’Istruzione
Università e Ricerca (ex 60% grant to Maria Grano) and
Associazione Italiana per la Ricerca sul Cancro (AIRC,
Grant no. IG_11957 to Maria Grano). The authors thanks
Pasqua Bellocci for technical support.
Conict of interest statement
The authors declare no conict of interest.
REFERENCES
1.
Kyle RA, Rajkumar SV. Criteria for diagnosis, staging, risk
stratication and response assessment of multiple myeloma.
Leukemia. 2009; 23:3–9.
2.
Oranger A, Carbone C, Izzo M, Grano M. Cellular
mechanisms of multiple myeloma bone disease. Clin Dev
Immunol. 2013; 2013:289458.
3.
Garcia-Gomez A, De Las Rivas J, Ocio EM,
Díaz- Rodríguez E, Montero JC, Martín M, Blanco JF,
Sanchez-Guijo FM, Pandiella A, San Miguel JF,
Garayoa M. Transcriptomic prole induced in bone marrow
mesenchymal stromal cells after interaction with multiple
myeloma cells: implications in myeloma progression and
myeloma bone disease. Oncotarget. 2014; 5:8284–8305.
4.
Demchenko YN, Kuehl WM. A critical role for the
NFkB pathway in multiple myeloma. Oncotarget. 2010;
1:59–68.
5.
Oshima T, Abe M, Asano J, Hara T, Kitazoe K, Sekimoto E,
Tanaka Y, Shibata H, Hashimoto T, Ozaki S, Kido S,
Inoue D, Matsumoto T. Myeloma cells suppressed bone
formation by secreting a soluble Wnt inhibitor, sFRP-2.
Blood. 2005; 106:3160–3165.
6.
Wang XT, He YC, Zhou SY, Jiang JZ, Huang YM,
Liang YZ, Lai YR. Bone marrow plasma macrophage
inammatory protein protein-1 alpha (MIP-1 alpha) and
sclerostin in multiple myeloma: Relationship with bone
disease and clinical characteristics. Leuk Res. 2014;
38:525–531.
7.
Brunetti G, Oranger A, Mori G, Specchia G, Rinaldi E,
Curci P, Zallone A, Rizzi R, Grano M, Colucci S. Sclerostin
is overexpressed by plasma cells from multiple myeloma
patients. Ann N Y Acad Sci. 2011; 1237:19–23.
8.
Colucci S, Brunetti G, Oranger A, Mori G, Sardone F,
Specchia G, Rinaldi E, Curci P, Liso V, Passeri G,
Zallone A, Rizzi R, Grano M. Myeloma cells suppress
osteoblasts through sclerostin secretion. Blood Cancer J.
1,e27; 2011.
9.
Terpos E, Christoulas D, Katodritou E, Bratengeier C,
Gkotzamanidou M, Michalis E, Delimpasi S, Pouli A,
Meletis J, Kastritis E, Zervas K, Dimopoulos MA. Elevated
circulating sclerostin correlates with advanced disease
features and abnormal bone remodeling in symptomatic
myeloma: reduction post-bortezomib monotherapy. Int J
Cancer. 2012; 131:1466–1471.
10.
Kristensen IB, Christensen JH, Lyng MB, Møller MB,
Pedersen L, Rasmussen LM, Ditzel HJ, Abildgaard N.
Expression of osteoblast and osteoclast regulatory genes in
the bone marrow microenvironment in multiple myeloma:
only up-regulation of Wnt inhibitors SFRP3 and DKK1 is
associated with lytic bone disease. Leuk Lymphoma. 2014;
55:911–919.
11.
Tian E, Zhan F, Walker R, Rasmussen E, Ma Y, Barlogie B,
Shaughnessy JD Jr. The role of the Wnt-signaling
antagonist DKK1 in the development of osteolytic lesions
in multiple myeloma. N Engl J Med. 2003; 349:2483–2494.
12.
Colucci S, Brunetti G, Rizzi R, Zonno A, Mori G,
Colaianni G, Del Prete D, Faccio R, Liso A, Capalbo S,
Liso V, Zallone A, Grano M. T cells support
osteoclastogenesis in an in vitro model derived from human
multiple myeloma bone disease: the role of the OPG/TRAIL
interaction. Blood. 2004; 104:3722–3730.
13.
Giuliani N, Colla S, Sala R, Moroni M, Lazzaretti M,
La Monica S, Bonomini S, Hojden M, Sammarelli G,
Barillè S, Bataille R, Rizzoli V. Human myeloma
cells stimulate the receptor activator of nuclear factor-
kappa B ligand (RANKL) in T lymphocytes: a potential
role in multiple myeloma bone disease. Blood. 2002;
100:4615–4621.
14.
Colucci S, Brunetti G, Mori G, Oranger A, Centonze M,
Mori C, Cantatore FP, Tamma R, Rizzi R, Liso V,
Zallone A, Grano M. Soluble decoy receptor 3 modulates
the survival and formation of osteoclasts from multiple
myeloma bone disease patients. Leukemia. 2009;
23:2139–2146.
15.
Mauri DN, Ebner R, Montgomery RI, Kochel KD,
Cheung TC, Yu GL, Ruben S, Murphy M, Eisenberg RJ,
Cohen GH, Spear PG, Ware CF. LIGHT, a new member
of the TNF superfamily, and lymphotoxin α are ligands for
herpesvirus entry mediator. Immunity. 1998; 8:21–30.

Oncotarget16
www.impactjournals.com/oncotarget
16.
Tamada K, Shimozaki K, Chapoval AI, Zhai Y, Su J,
Chen SF, Hsieh SL, Nagata S, Ni J, Chen L. LIGHT, a
TNF-like molecule, costimulates T cell proliferation and
is required for dendritic cell-mediated allogeneic T cell
response. J Immunol. 2000; 164:4105–4110.
17.
Harrop JA, Reddy M, Dede K, Brigham-Burke M,
Lyn S, Tan KB, Silverman C, Eichman C, DiPrinzio R,
Spampanato J, Porter T, Holmes S, Young PR, Truneh A.
Antibodies to TR2 (herpesvirus entry mediator), a new
member of the TNF receptor superfamily, block T cell
proliferation, expression of activation markers, and
production of cytokines. J Immunol. 1998; 161:1786–1794.
18.
Kwon BS, Tan KB, Ni J, Oh KO, Lee ZH, Kim KK, Kim YJ,
Wang S, Gentz R, Yu GL, Harrop J, Lyn SD, Silverman C,
Porter TG, Truneh A, Young PR. A newly identied member
of the tumor necrosis factor receptor superfamily with a wide
tissue distribution and involvement in lymphocyte activation.
J Biol Chem. 1997; 272:14272–14276.
19.
Browning JL, Miatkowski K, Sizing I, Grifths D,
Zafari M, Benjamin CD, Meier W, Mackay F. Signaling
through the lymphotoxin β receptor induces the death of
some adenocarcinoma tumor lines. J Exp Med. 1996;
183:867–878.
20.
Harrop JA, McDonnell PC, Brigham-Burke M, Lyn SD,
Minton J, Tan KB, Dede K, Spampanato J, Silverman C,
Hensley P, DiPrinzio R, Emery JG, Deen K, Eichman C,
Chabot-Fletcher M, Truneh A, Young PR. Herpesvirus entry
mediator ligand (HVEM-L), a novel ligand for HVEM/TR2,
stimulates proliferation of T cells and inhibits HT29 cell
growth. J Biol Chem. 1998; 273:27548–27556.
21.
Hsu H1, Solovyev I, Colombero A, Elliott R, Kelley M,
Boyle WJ. ATAR, a novel tumor necrosis factor receptor
family member, signals through TRAF2 and TRAF5. J Biol
Chem. 1997; 272:13471–13474.
22.
Marsters SA1, Ayres TM, Skubatch M, Gray CL, Rothe M,
Ashkenazi A. Herpesvirus entry mediator, a member of the
tumor necrosis factor receptor (TNFR) family, interacts
with members of the TNFR-associated factor family and
activates the transcription factors NF-kappaB and AP-1.
J Biol Chem. 1997; 272:14029–14032.
23.
Arch RH1, Gedrich RW, Thompson CB. Tumor necrosis
factor receptor-associated factors (TRAFs)—a family of
adapter proteins that regulates life and death. Genes Dev.
1998; 12:2821–2830.
24.
Zhai Y, Guo R, Hsu TL, Yu GL, Ni J, Kwon BS, Jiang GW,
Lu J, Tan J, Ugustus M, Carter K, Rojas L, Zhu F,
Lincoln C, Endress G, Xing L, Wang S, Oh KO, Gentz R,
Ruben S, Lippman ME, Hsieh SL, Yang D. LIGHT, a novel
ligand for lymphotoxin beta receptor and TR2/HVEM
induces apoptosis and suppresses in vivo tumor formation
via gene transfer. J Clin Invest. 1998; 102:1142–1151.
25.
Rooney IA, Butrovich KD, Glass AA, Borboroglu S,
Benedict CA, Whitbeck JC, Cohen GH, Eisenberg RJ,
Ware CF. The lymphotoxin-beta receptor is necessary and
sufcient for LIGHT-mediated apoptosis of tumor cells.
J Biol Chem. 2000; 275:14307–14315.
26.
Granger SW, Rickert S. LIGHT-HVEM signaling and the
regulation of T cell-mediated immunity. Cytokine Growth
Factor Rev. 2003; 14:289–296.
27.
Tamada K, Shimozaki K, Chapoval AI, Zhu G, Sica G,
Flies D, Boone T, Hsu H, Fu YX, Nagata S, Ni J, Chen L.
Modulation of T-cell-mediated immunity in tumor and
graft-versus-host disease models through the LIGHT
co-stimulatory pathway. Nat Med. 2000; 6:283–289.
28.
Shaikh RB, Santee S, Granger SW, Butrovich K, Cheung T,
Kronenberg M, et al. Constitutive expression of LIGHT on
T cells leads to lymphocyte activation, inammation, and
tissue destruction. J Immunol. 2001; 167:6330–6337.
29.
Wang J, Lo JC, Foster A, Yu P, Chen HM, Wang Y,
Tamada K, Chen L, Fu YX. The regulation of T cell
homeostasis and autoimmunity by T cell-derived LIGHT.
J Clin Invest. 2001; 108:1771–1780.
30.
Ishida S, Yamane S, Nakano S, Yanagimoto T,
Hanamoto Y, Maeda-Tanimura M, Toyosaki-Maeda T,
Ishizaki J, Matsuo Y, Fukui N, Itoh T, Ochi T, Suzuki R.
The interaction of monocytes with rheumatoid synovial
cells is a key step in LIGHT-mediated inammatory bone
destruction. Immunology. 2009; 128:e315–e324.
31.
Edwards JR, Sun SG, Locklin R, Shipman CM,
Adamopoulos IE, Athanasou NA, Sabokbar A. LIGHT
(TNFSF14), a novel mediator of bone resorption, is
elevated in rheumatoid arthritis. Arthritis Rheum. 2006;
54:1451–1462.
32.
Hemingway F, Kashima TG, Knowles HJ, Athanasou NA.
Investigation of osteoclastogenic signalling of the
RANKL substitute LIGHT. Exp Mol Pathol. 2013; 94:
380–385.
33.
Baksh D, Davies JE, Zandstra PW. Soluble factor
cross-talk between human bone marrow-derived
hematopoietic and mesenchymal cells enhances in vitro
CFU-F and CFU-O growth and reveals heterogeneity in
the mesenchymal progenitor cell compartment. Blood.
2005; 106:3012–3019.
34.
van Bezooijen RL, ten Dijke P, Papapoulos SE, Löwik CW.
SOST/sclerostin, an osteocyte-derived negative regulator
of bone formation. Cytokine Growth Factor Rev. 2005;
16:319–327.
35. Pierer M, Brentano F, Rethage J, Wagner U, Hantzschel H,
Gay RE, Gay S, Kyburz D. The TNF superfamily member
LIGHT contributes to survival and activation of synovial
broblasts in rheumatoid arthritis. Rheumatology (Oxford).
2007; 46:1063–1070.

Oncotarget17
www.impactjournals.com/oncotarget
36.
Kang YM, Kim SY, Kang JH, Han SW, Nam EJ, Kyung HS,
Park JY, Kim IS. LIGHT up-regulated on B lymphocytes
and monocytes in rheumatoid arthritis mediates cellular
adhesion and metalloproteinase production by synoviocytes.
Arthritis Rheum. 2007; 56:1106–1117.
37.
Giuliani N, Lisignoli G, Colla S, Lazzaretti M, Storti P,
Mancini C, Bonomini S, Manferdini C, Codeluppi K,
Facchini A, Rizzoli V. CC-Chemokine ligand 20/macrophage
inammatory protein-3alpha and CC-chemokine receptor 6
are overexpressed in myeloma microenvironment related to
osteolytic bone lesions. Cancer Res. 2008; 68:6840–6850.
38.
El Hajj Dib I, Me´lanie G, Valery S, Romuald M, Michel B,
Kamel S. Multiple myeloma cells directly stimulate bone
resorption in vitro by down-regulating mature osteoclast
apoptosis. Leuk Res. 2008; 2:1279–1287.
39.
Boyle WJ, Simonet WS, Lacey DL. Osteoclast
differentiation and activation. Nature. 2003; 423:337–342.
40.
Wong BR, Besser D, Kim N, Arron JR, Vologodskaia M,
Hanafusa H, Choi Y. TRANCE, a TNF family member,
activates Akt/PKB through a signaling complex involving
TRAF6 and c-Src. Mol Cell. 1999; 4:1041–1049.
41.
Kido S, Inoue D, Hiura K, Javier W, Ito Y, Matsumoto T.
Expression of RANK is dependent upon differentiation
into the macrophage/osteoclast lineage: induction by
1alpha, 25-dihydroxyvitamin D3 and TPA in a human
myelomonocytic cell line, HL60. Bone. 2003; 32:
621–629.
42.
Pearse RN, Sordillo EM, Yaccoby S, Wong BR, Liau DF,
Colman N, Michaeli J, Epstein J, Choi Y. Multiple
myeloma disrupts the TRANCE/ osteoprotegerin
cytokine axis to trigger bone destruction and promote
tumor progression. Proc Natl Acad Sci U S A. 2001; 98:
11581–11586.
43.
Yao S, Pan F, Prpic V, Wise GE. Differentiation of stem
cells in the dental follicle. J Dent Res. 2008; 87:767–771.
44.
Ota K, Quint P, Ruan M, Pederson L, Westendorf JJ,
Khosla S, Oursler MJ. Sclerostin is expressed in
osteoclasts from aged mice and reduces osteoclast-
mediated stimulation of mineralization. J Cell Biochem.
2013; 114:1901–1907.
45.
Kusu N, Laurikkala J, Imanishi M, Usui H, Konishi M,
Miyake A, Thesleff I, Itoh N. Sclerostin is a novel secreted
osteoclast-derived bone morphogenetic protein antagonist
with unique ligand specicity. J Biol Chem. 2003;
278:24113–24117.
46.
Jung Y, Song J, Shiozawa Y, Wang J, Wang Z,
Williams B, Havens A, Schneider A, Ge C, Franceschi RT,
McCauley LK, Krebsbach PH, Taichman RS.
Hematopoietic stem cells regulate mesenchymal stromal
cell induction into osteoblasts thereby participating in
the formation of the stem cell niche. Stem Cells. 2008;
26:2042–2051.
47.
Chang MK, Raggatt LJ, Alexander KA, Kuliwaba JS,
Fazzalari NL, Schroder K, Maylin ER, Ripoll VM,
Hume DA, Pettit AR. Osteal tissue macrophages are
intercalated throughout human and mouse bone lining
tissues and regulate osteoblast function in vitro and in vivo.
J Immunol. 2008; 181:1232–1244.
48.
Alexander KA, Chang MK, Maylin ER, Kohler T,
Muller R, Wu AC, Van Rooijen N, Sweet MJ, Hume DA,
Raggatt LJ, Pettit AR. Osteal macrophages promote in vivo
intramembranous bone healing in a mouse tibial injury
model. J Bone Miner Res. 2011; 26:1517–1532.
49.
Groh ME, Maitra B, Szekely E, Koc ON. Human
mesenchymal stem cells require monocyte-mediated
activation to suppress alloreactive T cells. Exp Hematol.
2005; 33:928–934.
50.
Aggarwal S, Pittenger MF. Human mesenchymal stem cells
modulate allogeneic immune cell responses. Blood. 2005;
105:1815–1822.
51.
Nemeth K, Leelahavanichkul A, Yuen PS, Mayer B,
Parmelee A, Doi K, Robey PG, Leelahavanichkul K,
Koller BH, Brown JM, Hu X, Jelinek I, Star RA,
Mezey E. Bone marrow stromal cells attenuate sepsis via
prostaglandin E(2)-dependent reprogramming of host
macrophages to increase their interleukin-10 production.
Nat Med. 2009; 15:42–49.
52.
Beyth S, Borovsky Z, Mevorach D, Liebergall M,
Gazit Z, Aslan H, Galun E, Rachmilewitz J. Human
mesenchymal stem cells alter antigen-presenting cell
maturation and induce T-cell unresponsiveness. Blood.
2005; 105:2214–2219.
53.
Kim J, Hematti P. Mesenchymal stem cell-educated
macrophages: a novel type of alternatively activated
macrophages. Exp Hematol. 2009; 37:1445–1453.
54.
Bellido T, Borba VZ, Roberson P, Manolagas SC.
Activation of the Janus kinase/STAT (signal transducer
and activator of transcription) signal transduction pathway
by interleukin-6-type cytokines promotes osteoblast
differentiation. Endocrinology. 1997; 138:3666–3676.
55.
Nishimura R, Moriyama K, Yasukawa K, Mundy GR,
Yoneda T. Combination of interleukin-6 and soluble
interleukin-6 receptors induces differentiation and
activation of JAK-STAT and MAP kinase pathways in
MG-63 human osteoblastic cells. J Bone Miner Res. 1998;
13:777–785.
56.
Nicolaidou V1, Wong MM, Redpath AN, Ersek A,
Baban DF, Williams LM, Cope AP, Horwood NJ.
Monocytes induce STAT3 activation in human
mesenchymal stem cells to promote osteoblast formation.
PLoS One. 2012; 7:e39871.
57.
International Myeloma Working Group Criteria
for the classication of monoclonal gammopathies,
multiple myeloma and related disorders: a report of the

Oncotarget18
www.impactjournals.com/oncotarget
International Myeloma Working Group. Br J Haematol.
2003; 121:749–757.
58.
Greipp PR, San Miguel J, Durie BG, Crowley JJ,
Barlogie B, Bladé J, Boccadoro M, Child JA,
Avet-Loiseau H, Kyle RA, Lahuerta JJ, Ludwig H,
Morgan G, Powles R, Shimizu K, Shustik C, Sonneveld P,
Tosi P, Turesson I, Westin J. International staging system
for multiple myeloma. J Clin Oncol. 2005; 23:3412–3420.
59.
Mori G, Ballini A, Carbone C, Oranger A, Brunetti G,
Di Benedetto A, Rapone B, Cantore S, Di Comite M,
Colucci S, Grano M, Grassi FR. Osteogenic
differentiation of dental follicle stem cells. Int J Med Sci.
2012; 9:480–487.
60.
Brunetti G, Faienza MF, Piacente L, Ventura A, Oranger A,
Carbone C, Di Benedetto A, Colaianni G, Gigante M,
Mori G, Gesualdo L, Colucci S, Cavallo L, Grano M. High
dickkopf-1 levels in sera and leukocytes from children
with 21-hydroxylase deciency on chronic glucocorticoid
treatment. Am J Physiol Endocrinol Metab. 2013;
304:E546–E554.