Macrolepiota distribution extends to the montane temperate forests of Pakistan

Abstract

Basidiomata of Macrolepiota dolichaula and M. excoriata were collected from mixed coniferous forests in Pakistan. T e species were identified using ITS nrDNA sequence analyses and morphological and anatomical characters. Detailed morphological and anatomical descriptions
and illustrations are provided along with results of molecular phylogenetic analysis. Both species are regarded as new records for Pakistan, and this report considerably extends their known distribution.

Full text

ISSN (print) 0093-4666 © 2014. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/129.197
Volume 129(1), pp. 197–208 July–September 2014
Macrolepiota distribution extends to the
montane temperate forests of Pakistan
Muhammad Fiaz1, Sana Jabeen2*, Amna Imran2,
Habib Ahmad3, & Abdul Nasir Khalid2
1Department of Botany & 3Department of Genetics,
Hazara University, Mansehra, Pakistan
2Department of Botany, University of the Punjab,
Quaid-e-Azam Campus-54590, Lahore, Pakistan
* Correspondence to: ectomycorrhizae@gmail.com
Abstract — Basidiomata of Macrolepiota dolichaula and M. excoriata were collected
from mixed coniferous forests in Pakistan. e species were identied using ITS nrDNA
sequence analyses and morphological and anatomical characters. Detailed morphological
and anatomical descriptions and illustrations are provided along with results of molecular
phylogenetic analysis. Both species are regarded as new records for Pakistan, and this report
considerably extends their known distribution.
Key words — Agaricaceae, basidiomata, Basidiomycota, saprotrophic
Introduction
Macrolepiota was established by Singer (1948). Currently, there are about
33 species recognized in the genus worldwide (Kirk et al. 2008; Ge et al. 2010,
2012), of which several are edible (Ding & Huang 2003). Representatives of
the genus typically have large eshy basidiomata, a pileal surface covered by
squamules composed of long subcylindric elements, white to cream lamellae,
and a prominent annulus. e basidiospores are relatively big and thick-walled
with a germ pore covered by a hyaline cap, and stipe squamules are oen visible
as colored bands in mature specimens (Singer 1948; Vellinga 2003; Vellinga et
al. 2003). Some Macrolepiota species have been transferred to Chlorophyllum
Massee, which diers from Macrolepiota s. str. by the presence of pileal
squamules made up of a hymenodermal layer, spore germ pores that are either
absent or truncated, and a smooth stipe (Vellinga & Kok 2002).

198 ... Fiaz & al.
Macrolepiota species are saprotrophic and grow in the soil litter layers that
contain mostly fresh leaves (Vellinga 2004). Some species, such as M. excoriata
and M. phaeodisca Bellù, have a restricted distribution (Courtecuisse & Duhem
1994; Nauta & Vellinga 1995; Candusso & Lanzoni 1990), although the exact
distribution is still unknown for many species. Macrolepiota procera (Scop.)
Singer is the only species that has been reported from Pakistan (Ahmad et al.
1997).
e present study focuses on M. dolichaula and M. excoriata, newly
recorded from Pakistan from two dierent areas of Khyber Pakhtunkhawa
(KPK) Province. Macrolepiota dolichaula has been previously reported from
China (Chiu 1948; Shao & Xiang 1981; Zang et al. 1996; Bi et al. 1994, 1997;
Ge et al. 2010, 2012), East Africa (Pegler 1977), eastern Australia (Grgurinovic
1997; Vellinga 2003), India (Manjula 1983; Natarajan & Manjuk 1983), Sri
Lanka (Pegler & Rayner 1969), ailand (Ge et al. 2010), and Vietnam (Kiet
1998; Yang 2000). Macrolepiota excoriata is native to Europe and has also been
reported from India (Kumari 2012), Israel (Barseghyan et al. 2012), South
Africa (Doidge 1950), Turkey (Afyon & Yağiz 2004; Doğan & Öztürk 2006),
China (Teng 1996; Mao 2000; Ge et al. 2010), and North America and South
Africa (http://www.gbif.org/). e correct identity of some of these records,
however, requires conrmation.
Materials & methods
Sampling site description
e two sampling sites are situated in the Mansehra and Swat districts of Khyber
Pakhtunkhwa.
Mansehra district is located at the eastern border of the KPK. Mountain ranges,
plains, valleys, and numerous lakes and rivers are the main features, with the Kunhar
and Siran rivers among the largest in the area. e climate is warm in summer and cold
in winter, although the northern high mountainous region remains cold in summer due
to snow cover. Evergreen and deciduous trees are well represented. Pinus wallichiana
A.B. Jacks. and Pinus roxburghii Sarg. are dominant tree species, while Juglans regia L. is
the most common broadleaf tree (Mustafa 2003).
e Swat valley, which lies in northern Khyber Pakhtunkhwa, is surrounded by
mountains that are oshoots of the Hindu Kush. e Swat River is formed by the joining
of the Ushu and Utrot rivers, which descend from the Hindu Kush Mountains. Kalam,
a village along the upper reaches of the Swat River, is known for its waterfalls, lakes, and
lush green hills dominated by Cedrus deodara (Roxb. ex D. Don) G. Don forests, Pinus
spp., and Quercus sp. e climate is moist temperate to dry temperate (Champion et al.
1965). Following the standard classication of Pakistan’s forests (Champion et al. 1965),
Shah & Khan (2006) classify the Swat forest type as belonging to “montane temperate
forest.”

Macrolepiota species new to Pakistan ... 199
Morphological & anatomical characterization
Fresh basidiomata were collected and catalogued, described morphologically, and
photographed using a Nikon D70S digital camera. Color codes follow Munsell Soil
Color Charts (1975). e specimens were dried under a fan heater. e specimens
were mounted in 5% KOH solution for examination of basidia, cystidia, spores, pileal
elements and stipe hyphae under a MX4300H microscope (Meiji Techno Co., Ltd.,
Japan). Anatomical features were measured with a Carl Zeiss Jena ocular micrometer.
Basidiospore dimensions follow the format [n/m/p = n basidiospores measured from
m fruit bodies of p collections], length × width (l × w), and avQ (= average l/w ratio
of all spores). Line drawings were made using Leitz Wetzlar Camera Lucida. Voucher
specimens were deposited in either the Herbarium, Department of Botany, University
of the Punjab, Lahore, Pakistan (LAH) or the Herbarium Hazara University, Dhodial,
Pakistan (HUP).
Molecular characterization
A small piece (2 mg) of lamellae was kept in 2% CTAB buer. DNA was extracted using
modied CTAB method following Bruns (1995). e nrDNA ITS regions were amplied
using ITS1F (cttggtcatttagaggaagt) and ITS4 (tcctccgcttattgatatgc) primers
under standard conditions (Gardes & Bruns 1993) Agarose Gel Electrophoresis was
performed to visualize PCR products in Gel Documentation System (UVtec. Avebury
House, Cambridge CB4 1QB UK) at default settings. e products were sent to Macrogen
Inc. (Korea) to perform sequencing using the same pair of primers. e consensus
sequence was generated from the sequences obtained using both primers. A BLAST
search was used to retrieve nucleotide sequences from GenBank (http://www.ncbi.nlm.
nih.gov/), with the closest matching sequences selected from the initial blast. e most
closely related species were also included in the nal data set. ClustalW was used to
align sequences in MEGA soware. e sequences were trimmed with the conserved
motifs 5′-(...gat)catta... and ...gacct(caaa...)-3′, and the alignment portion between
them was included in phylogenetic analysis. Maximum likelihood (ML) analysis was
performed using Jukes-Cantor model and nearest neighbor interchange as ML heuristic
search method in MEGA5 soware to test the phylogeny at 1000 bootstraps. e rDNA-
ITS divergence was reconstructed using MegAlign (DNAStar). Sequences generated in
this study were submitted to GenBank (KJ013326; KJ643333; KJ643334).
Taxonomy
Macrolepiota dolichaula (Berk. & Broome) Pegler & R.W. Rayner, Kew Bull. 23: 365
(1969). Fig. 1
Basidiomata medium to large with long stipe. Pileus ≤13.5 cm diam.,
eshy, convex to plano-convex, white (5Y9/2), with inwardly projected margins,
umbonate, covered with minute, pallid, yellowish brown (10YR5/6) squamules,
crowded at centre, become minute and sparse towards margins; disc yellowish
brown (10YR5/6); margins rough, fragile at maturity; context thick and white
(5Y9/2). Lamellae free, crowded, white (5Y9/2) when young, becoming o-

200 ... Fiaz & al.
Figure 1: Macrolepiota dolichaula (FM-22). A–D. Basidiomata; E. Basidia; F. Basidiospores;
G. Cheilocystidia; H. Hyphae from pileus. Scale bars: A = 3 cm; B–D = 4.5 cm; E = 13 µm;
F = 9 µm; G = 10 µm; H= 15 µm.
white to cream (2.5Y8/4) at maturity. Lamellulae few in general. Stipe ≤26
cm long, gradually tapering towards the apex, diam. 0.5 cm towards the pileus
and ≤1.3 cm towards the base, farinose, mostly glabrous, o-white to cream
(2.5Y8/4), scabrous just below the annulus, with brown (10YR7/6) scales; base
bulbous, ≤2 cm in diam. Annulus ascending, whitish (2.5Y8/4), superior,
membranous, moveable. Odor and taste not recorded.

Macrolepiota species new to Pakistan ... 201
Basidiospores [50/1/1] 9.4–15.6 × 7.5–11.3 µm (average = 12.5 × 9.4 µm),
avQ = 1.33, ovoid to broadly ellipsoid, ellipsoid, hyaline in 5% KOH, reddish
brown in Melzer’s reagent, with a germ pore on the rounded apex with a
hyaline cap; apiculus 1–1.5 µm high. Basidia 29–39.6 × 9.9–14.4 µm, clavate
to subclavate, thin-walled, hyaline in 5% KOH, 4-spored. Pleurocystidia
absent. Cheilocystidia 18.4–28.4 × 7.1–12.8 µm, clavate, thin walled, hyaline.
Squamules on pileus consisting of cylindric to subcylindric, branched,
clampless hyphae, 3–10 µm in diam., terminal elements cylindric to slightly
attenuating towards the tip, hyaline to yellowish brown vacuolar pigment.
Clamp connections occasional at basidial bases.
Material examined—PAKISTAN, Mansehra District, Khabbal Paien, 1450 m asl,
on soil under Pinus wallichiana, August 2009, Muhammad Fiaz FM–22 (HUP MFM–
331; GenBank KJ643334).
Macrolepiota excoriata (Schae.) Wasser, Ukr. Bot. Zh. 35: 516 (1978) Fig. 2
Basidiomata medium to large. Pileus ≤8 cm in diameter, eshy, convex
to plano-convex with smooth margins, slightly umbonate, white to o white
(2.5Y8/4), covered with furfuraceous brownish squamules (10YR5/6), which
become sparse toward margin; disc smooth, brownish (10YR5/6), margins
rough and fragile. Lamellae free, ≤9 mm broad, crowded with 1–2 tiers of
short lamellulae, white to o white (2.5Y8/4). Stipe 7.3–14.5 cm long, diam.
0.4 cm towards the point of attachment and 0.7 cm towards the base, with
abruptly bulbous base ≤1.7 cm diam., central, hollow, brillose, white to o
white (2.5Y8/4), cylindrical, white to o-white (2.5Y8/4), covered with minute
brownish (10 YR 5/6) squamules above the annulus. Annulus persistent,
descending, whitish (2.5Y8/4), membranous, superior, about 3 cm below the
stipe apex. Context white, not changing when bruised. Odor and taste not
recorded.
Basidiospores [50/2/2] 12.7–18.4 × 11.1–12 µm (average = 15.7 × 11.5 µm),
avQ = 1.36, ellipsoid to ovoid with one or many guttules, thick-walled (0.8 µm),
smooth, o-white or pale yellow in 5% KOH, light brown to reddish brown in
Melzer’s reagent, with rounded apex; germ pore visible; apiculus prominent.
Basidia 40.3–47.4 × 16.0–18.6 µm (average = 43.6 × 17.2 µm), at base 5.7 µm
wide on average, clavate, guttulate, thin-walled, commonly 4-spored, hyaline
to o-white or pale yellow in KOH; sterigmata 6 µm long. Pleurocystidia
absent. Cheilocystidia 29.3–32.1 × 11.1–13.9 µm (average = 31 × 11.9
µm), base 5 µm, thin-walled, hyaline to o-white or pale yellow in 5% KOH,
clavate. Squamules made up of lamentous, branched, cylindrical, clampless,
hyphae 3.3–16 µm in diam. with yellowish pigment; terminal segments
32.5–153.4 × 6.3–12.5 µm. Stipe hyphae thin walled, hyaline to cream. Clamp
connections not observed.

202 ... Fiaz & al.
Figure 2: Macrolepiota excoriata (FM-305 [A–D]; F2;K3-1 [E–I]). A–D. Basidiomata; E. Basidia;
F. Cheilocystidia; G. Basidiospores; H. Hyphal squamules; I. Hyphae from pileipellis. Scale bars:
A, C, D = 3 cm; B = 2 cm; E = 10 µm; F = 9 µm; G = 8 µm; H = 18 µm; I = 21 µm.
Material examined–PAKISTAN, Mansehra District, Khabbal Paien, Dub, 1700
m asl, on soil under Pinus wallichiana, July 2009, Muhammad Fiaz FM–305 (HUP
MFM–332; GenBank KJ643333); Swat District, Kalam, 2070 m asl, on soil under
Cedrus deodara, 4 September 2013, Sana Jabeen F2; K3-1 (LAH-SJ1-2013; GenBank
KJ013326).

Macrolepiota species new to Pakistan ... 203
Phylogeny
e nrITS sequences of Macrolepiota excoriata comprised 750–753 (ITS1F
primer) and 760–769 (ITS4 primer) base pairs; a consensus sequence of 654
base pairs was obtained by trimming the motif of both sequences. Macrolepiota
dolichaula sequences comprised 1390 (ITS1F primer) and 768 (ITS4 primer)
base pairs. e BLAST of M. excoriata (KJ013326) revealed that it was 99%
identical to JQ683100, JQ683089, HM246504, AF482840, AY243606, and
JQ683118 with 100% query cover and 0.0 E value; M. dolichaula was100%
identical to AF482839 with 100% query cover and 0.0 E value. Published
sequences from dierent Macrolepiota sections were included to reconstruct
the phylogeny with Leucoagaricus barssii (Zeller) Vellinga as outgroup. e
analysis revealed three major clades within Macrolepiota (Fig. 3; /macrolepiota,
/macrosporae, /volvatae), which correspond to sections Macrolepiota,
Macrosporae, and Volvatae in earlier studies (Vellinga et al. 2003; Ge et al. 2010).
Within /macrolepiota, M. dolichaula, M. detersa, M. procera, M. colombiana,
M. fuliginosa, M. subcitrophylla and M. clelandii clustered with 58% bootstrap
support; within /macrosporae, M. phaeodisca, M. konradii, M. mastoidea,
M. subsquarrosa, M. orientiexcoriata, and M. excoriata clustered with 97%
bootstrap support; and within /volvatae, the two volvate species, M. eucharis
and M. velosa, clustered with 100% bootstrap support.
Discussion
Macrolepiota is a monophyletic group in accordance with ITS based ndings
(Vellinga et al. 2003). In present study, all three clades recovered by the ITS data
set received strong bootstrap support. Morphological characters also support
separation of these clades.
Macrolepiota dolichaula (KJ643334) from Pakistan clustered with similar
specimens in sect. Macrolepiota, which is characterized by a complex annulus,
relatively big (usually 14–20 µm) ovoid-ellipsoid spores, frequent clamp
connections at the bases of the cheilocystidia and basidia, and a long stipe (Bon
1996). Within this section, the stipe surface usually has ne brown squamules,
but Macrolepiota dolichaula with a farinose stipe surface is an exception.
e pileus within this section usually forms plate-like squamules, but again
M. dolichaula is an exception, with its pileus covered by minute, pallid
squamules.
In the phylogenetic analysis, the M. dolichaula specimen from Pakistan
shared a 100% identity with HM125516 (China) and AF482839 (Australia),
99.7% identity with AY083193 (Australia), and 99.6% identity with HM125517
(China). All analyzed M. dolichaula sequences form a sister clade with
M. detersa (Fig. 3).

204 ... Fiaz & al.

Macrolepiota species new to Pakistan ... 205
Figure 3 (le): Molecular phylogenetic analysis of Macrolepiota spp. inferred by using the
Maximum Likelihood method. Sequences generated from Pakistan are marked with . Genbank
accession numbers of all the taxa are given. e percentage of trees in which the associated taxa
clustered together at 1000 bootstraps is shown next to the branches. e tree is drawn to scale,
with branch lengths measured in the number of substitutions per site. e analysis involved
93 nucleotide sequences. ere were a total of 712 positions in the nal dataset.
Figure 4: Map showing distribution of Macrolepiota dolichaula () and M. excoriata (). Open
dots () represent reports of M. excoriata without voucher specimens.
Macrolepiota excoriata is closely related to M. orientiexcoriata Z.W. Ge
et al. but forms a separate subclade within /macrosporae. Macrolepiota sect.
Macrosporae is characterized by a long stipe, a simple annulus, and rare clamp
connections. e species within this clade have furfuraceous ne squamules
with rarely branched, light brown cylindrical hyphae. Macrolepiota excoriata
(KJ013326) and M. excoriata (KJ643333) from Pakistan shared a 99.9% identity
and clustered with M. excoriata from Israel (JQ683089, JQ683100, JQ683089),
Italy (HM246504), the Netherlands (AF482840), the United Kingdom

206 ... Fiaz & al.
(AY243606), and France (AY243607) with 99.7–99.9% identity and 0.2–0.3%
genetic divergence.
Many Macrolepiota species have relatively small distribution areas
(Courtecuisse & Duhem 1994; Nauta & Vellinga 1995; Candusso & Lanzoni
1990). Occurrence of M. dolichaula and M. excoriata in KPK, Pakistan extends
the known distributions of these species considerably (Fig. 4). ese two species
were found in two dierent habitats dominated by obligatory mycorrhizal tree
species. Mansehra district, KPK, lies in the moist temperate region dominated
by Pinus wallichiana where the forest oor is dominated by dierent grass
species. ese coniferous forests are very similar to those in other parts of the
northern temperate zone of Europe and America (Champion et al. 1965). Swat
district, KPK, falls in the dry temperate region dominated by Cedrus deodara
forests, in which there is no understory vegetation.
Although Macrolepiota species are generally very regional and are not
widely distributed, M. dolichaula is an exception. We still lack enough data on
the full distribution of these fungi to be able to predict their occurrence (or
non-occurrence) in a certain area.
Acknowledgements
We are sincerely thankful to Dr. Else C. Vellinga (University of California, Berkeley,
USA) for critically reviewing the manuscript, valuable suggestions to improve the map
and acting as presubmission reviewer. anks to Dr. Zai-Wei Ge (Kunming Institute
of Botany, Chinese Academy of Sciences, P. R. China) for his useful suggestions to
improve the manuscript. We are also thankful to Dr. T. K. Arun Kumar (e Zamorin’s
Guruvayurappan College, India) for acting as presubmission reviewer. We are highly
indebted to Higher Education Commission (HEC), Pakistan for nancial assistance
under Indigenous PhD Fellowships (Phase II).
Literature cited
Afyon A, Yağiz D. 2004. Macrofungi of Sinop Province. Turkish J. Bot. 28: 351–360.
Ahmad S. Iqbal SH, Khalid AN. 1997. Fungi of Pakistan. Sultan Ahmad Mycological Society,
Pakistan. 248 p.
Barseghyan GS, Kosakyn A, Isikhuemhen OS, Didukh M, Wasser SP. 2012. Phylogenetic analysis
within genera Morchella (Ascomycota, Pezizales) and Macrolepiota (Basidiomycota, Agaricales)
inferred from rDNA ITS and EF-1a sequences. JK Misra et al. (eds.). Systematics and evolution
of fungi (ed. 1). Science Publishers.
Bi ZS, Zheng GY, Li TH. 1994. Macrofungus ora of Guangdong Province. Guangdong Science and
Technology, Guangdong. 879 p. [in Chinese].
Bi ZS, Li TH, Zhang WM, Song B. 1997. A preliminary agaric ora of Hainan Province. Guangdong
Higher Education, Guangzhou. 388 p. [in Chinese].
Bon M. 1996. Die Großpilzora von Europa 3. Lepiotaceae. Eching: IHW-Verlag.
Bruns TD. 1995. oughts on the processes that maintain local species diversity of ectomycorrhizal
fungi. Pl. Soil 170: 63–73. http://dx.doi.org/10.1007/BF02183055

Macrolepiota species new to Pakistan ... 207
Candusso M, Lanzoni G. 1990. Lepiota s.l. Fungi europaei 4. Saronno, Italy: Giovanna Biella. 743 p.
Champion HG, Sethi SK, Khattak GM. 1965. Forest types of Pakistan. Pakistan Forest Institute.
Peshawar, Pakistan. 233 p.
Chiu WF. 1948. e Amanitaceae of Yunnan. Sci. Rept. Natl. Tsing Hua Univ. Ser. B., Biol. and
Psychol. Sci 3(3): 165–178.
Courtecuisse R, Duhem B. 1994. Guide des champignons de France et d’Europe. Lausanne:
Delachaux et Niestlé. 478 p.
Ding ZQ, Huang SZ. 2003. Characteristics and high-yield culture technique of Macrolepiota
procera. Edible Fungi 4: 33 [in Chinese].
Doğan HH, Öztürk, C. 2006. Macrofungi and their distribution in Karaman Province, Turkey.
Turk. J. Bot. 30: 193–207.
Doidge EM, 1950. e South African fungi and lichens. Bothalia 5: 1–1094.
Gardes M, Bruns TD. 1993. ITS primers with enhanced specicity for Basidiomycetes: application
to the identication of mycorrhizae and rusts. Mol. Ecol. 2: 113–118.
Ge ZW, Yang ZL, Vellinga EC. 2010. e genus Macrolepiota (Agaricaceae, Basidiomycota) in
China. Fungal Diversity. 45: 81–98. http://dx.doi.org/10.1007/s13225-010-0062-0
Ge ZW, Chen ZH, Yang ZL. 2012. Macrolepiota subcitrophylla sp. nov., a new species with yellowish
lamellae from southwest China. Mycoscience 53: 284–289.
http://dx.doi.org/10.1007/S10267-011-0167-7
Grgurinovic CA. 1997. Larger fungi of South Australia. Botanic Gardens of Adelaide and State
Herbarium and Flora and Fauna of South Australia Handbooks Committee, Adelaide.
Kiet TT. 1998. Preliminary checklist of macrofungi of Vietnam. Feddes Repert. 109: 257–277.
Kirk PM, Cannon PF, Minter DW, Stalpers JA. (eds) 2008. Dictionary of the fungi, 10th edn. CABI,
Wallingford.
Kumari B. 2012. Diversity, sociobiology and conservation of lepiotoid and termitophilous
mushrooms of north west India. PhD Dissertation. Punjabi University, Patiala, India.
Manjula B. 1983. A revised list of the agaricoid and boletoid basidiomycetes from India and Nepal.
Proc. Indian Acad. Sci. (Plant Sciences) 92: 81–213.
Mao XL. 2000. e macrofungi in China. Henan Science and Technology, Zhengzhou. 719 p. [in
Chinese].
Munsell Soil Color Charts. 1975. Munsell Color Co., Baltimore, MD.
Mustafa G. 2003. Mansehra, an introduction. Gazetteer of the Hazara District.
Natarajan K, Manjuk B. 1983. South Indian Agaricales XII – Lepiota. Bibliotheca Mycologica
91: 563–581.
Nauta MM, Vellinga EC. 1995. Atlas van Nederlandse paddestoelen. Rotterdam, Brookeld:
A.A. Balkema. 352 p.
Pegler DN, Rayner RW. 1969. A contribution to the agaric ora of Kenya. Kew Bulletin 23: 347–412.
Pegler DN. 1977. A preliminary agaric ora of east Africa. Kew Bulletin Additional Series, London
6: 1- 615.
Shah GM, Khan MA. 2006. Check list of medicinal plants of Siran Valley Mansehra-Pakistan,
Ethnobotanical Leaets 10: 63–71.
Shao LP, Xiang CT. 1981. e study on the Macrolepiota spp. in China. J. NE Forestry Inst. 4: 35–38.
Singer R. 1948. New and interesting species of Basidiomycetes. Pap. Mich. Acad. Sci., Arts Lett.
32: 103–150.
Teng SC. 1996. Fungi of China. Mycotaxon Ltd, Ithaca, New York.
Vellinga EC. 2003. Chlorophyllum and Macrolepiota (Agaricaceae) in Australia. Austr. Syst. Bot.
16: 361–370.

208 ... Fiaz & al.
Vellinga EC. 2004. Ecology and distribution of lepiotaceous fungi (Agaricaceae) – A Review. Nova
Hedwigia 78: 273–299.
Vellinga EC, Kok RPJ de. 2002. Proposal to conserve the name Chlorophyllum Massee against
Endoptychum Czern. Taxon 51: 563–564.
Vellinga EC, Kok RPJ de, Bruns TD. 2003. Phylogeny and taxonomy of Macrolepiota (Agaricaceae).
Mycologia 95: 442–456.
Yang ZL. 2000. Type studies on agarics described by N. Patouillard (and his co-authors) from
Vietnam. Mycotaxon 75: 431–476.
Zang M, Li B, Xi JX. 1996. Fungi of Hengduan mountains. Science, Beijing. [in Chinese]