New North American records for Ascocoryne turficola (Ascomycota: Helotiales)

Abstract

Ascocoryne turfi cola (Boud.) Korf, one of the rarest fungi in Eu rope, is reported from North America. This interesting as co mycete was collected in 2007 from boggy localities in eastern and west ern Newfoundland. Morphological descriptions and ecological notes for this mysterious fungus, as well as its place ment within the Helotiales, are discussed.

Full text

23
Volume 1:2 Summer 2008 Fungi
New North American Records for Ascocoryne turfi cola
(Ascomycota: Helotiales)
Britt A. Bunyard,1* Zheng Wang,2 David Malloch,3 Stephen Clayden,3 and Andrus Voitk4
Abstract
Ascocoryne turfi cola (Boud.) Korf, one of the rarest fungi in Eu rope,
is reported from North America. This interesting as co mycete was
collected in 2007 from boggy localities in eastern and west ern
Newfoundland. Morphological descriptions and ecological notes
for this mysterious fungus, as well as its place ment within the
Helotiales, are discussed.
KEY WORDS: Ascomycetes, Coryne, mushrooms, New found land
fungi, Sarcoleotia
Introduction
This communication reports the occurrence of Ascocoryne turfi -
cola (Boud.) Korf in three disparate areas of Newfoundland over
one season. Ascocoryne turfi cola is an uncommon fungus, recorded
from the Far East and Europe. In Europe it is considered one of
their rarest fungal species (Stasinska and Sotek, 2004; Watling et
al., 2001; Dennis, 1968) with few recorded sightings; in most
Eu ro pe an countries where it has been recorded, it is listed in that
country’s Red Book. Ascocoryne turfi cola was first noted in France
where Boudier (1905) published the first description of the spe-
cies. It later was recorded in Switzerland (Favre, 1948) and Great
Britain (Dennis, 1968; 1971). The first reports of A. turfi cola from
Norway and Sweden came in 1972 (Eckblad and Torkelsen, 1972),
the Falkland and Shetland Islands in 2001 (Watling et al., 2001),
and Poland in 2004 (Stasinska and Sotek, 2004). The fungus also is
known from a handful of localities in Finland, Denmark, Ger ma ny,
and Czech Republic, but on the whole, the precise geo graph i cal
distribution has not been delineated (Stasinska and Sotek, 2004).
Furthermore, little about the ecology of A. turfi cola is understood.
The purpose of this paper is to confirm the pres ence of A. turfi cola
in North America as well as to present mor pho log i cal and ecologi-
cal notes for this enigmatic ascomycete fungus.
1W184 N12633 Fond du Lac Ave., Germantown, WI 53022, USA;
2Department of Ecology & Evolutionary Biology, Yale University, Osborne
Memorial Labs, 165 Prospect Street, PO Box 208106, New Haven, CT
06520, USA; 3New Brunswick Museum, Natural Sciences Department,
277 Douglas Ave., Saint John, New Brunswick E2K 1E5, Canada; 4Foray
Newfoundland and Labrador, PO Box 2312, RR #1, Corner Brook, NL
A2H 2N2, Canada. *Corresponding author, bbunyard@wi.rr.com.
History
The organism was first described by Boudier (1905) and was
possibly not found again until it was collected in 1935 by Jules
Favre (Favre, 1948). Favre described five collections he had made
between 1935 and 1944 in the same Jura Mountains explored by
Boudier. Four of these resembled Boudier’s C. turfi cola, while one
collection differed somewhat; this he accepted as natural variation
within the general spectrum of a species.
Groves and Wilson (1967) reviewed the genus Coryne and
concluded that the generic name was typified by an asexual form
(an anamorph or “imperfect state”) and was there fore not avail able
for sexually reproducing (“perfect”) fungi like C. turfi cola. For the
sexual forms of fungi described in the genus Coryne, they pro posed
a new genus, Ascocoryne, to which they trans ferred Coryne sar coides
as the type species (Groves and Wilson, 1967). Sub se quent name
transfers and changes by future workers were to follow.
Dennis (1971) cited some British material col lect ed in Sphag-
num sp. that he identified as C. turfi cola (Dennis, 1968). Den nis’s
drawings differed somewhat from those of Boudier and Favre and
his specimens had smaller spores and had no apothecial gelati nous
layer. Because his specimens lacked the gelatinous tissue char-
acteristic of the genus Ascocoryne, he trans ferred the species to
Sarcoleotia, a genus characterized by the lack of gelatinous tissue
(Dennis, 1971).
The same year saw publication of a different transfer for this
ascomycete. In the course of preparing a key to the genera of Dis co-
mycetes Korf (1971a), made several transfers and re arrange ments
to reconcile groupings with current knowl edge. Because Bou dier
had described an ascomycete sporophore with ge lat i nous tissue,
and because the new Ascocoryne was a genus char ac ter ized by a
gelatinous layer below the hymenium, Korf trans ferred C. turfi cola
to the genus Ascocoryne.
North American Records
At the time of our finds, we were not aware of previous records of
this mushroom in North America. Exhaustive searches of books,
periodicals, the Web and extensive personal enquiries yielded four
encounters with this taxon in North America. Torbjørn Borgen
collected it ca.1980 near Paamiut, Greenland, among Sphagnum
sp. in a bog based on gneiss (Borgen, personal com mu ni ca tion).
Bessette, Bessette, and Fischer include it in the key of cup and

24Fungi Volume 1:2 Summer 2008
saucer fungi in their book of eastern North American mush rooms
(Bessette et al., 1997). Alan Bessette said this was done because
of a record of this taxon in the University of Maine Her bar i um
(per sonal communication). Indeed, Maine records show that it
was collected among Sphagnum sp., on Sep tem ber 29, 1984, from
Marble Fen in Maine by Ri ch ard Homola, who iden ti fied it as
Asco coryne turfi cola (Boudier) Den nis. This iden tification has been
con firmed by one of the authors (DM) from photographs of the
specimen made avail able by the Uni ver si ty of Maine Her bar i um.
The last en coun ter is a record in the Cornell Plant Pa thol o gy
Herbarium, collected in 1975 grow ing on Ulmus americana and
iden ti fied as Ascocoryne turfi cola (Boudier) Korf by Richard Korf.
In light of it reportedly grow ing on elm, Korf sus pects it may well
be a misidentification, but was unable to check as the specimen
was unavailable (per son al com mu ni ca tion).
Ma te ri als and Meth ods
The first New found land col lec tion, a sin gle im ma ture sporocarp
(Fig. 1), was col lect ed by one of the au thors (SC) on June 15,
2007, near Junction Pond in a peaty de pres sion among Sphagnum
squarrosum in an area apparently opened up by blowdowns on a
ridge of balsam fir (Abies balsamea), yellow birch (Betula allegha nien-
sis), moun tain white birch (B. cordifolia), and moun tain wood fern
(Dryopteris campyloptera), and small adjoining or in ter mixed boggy
areas with scattered balsam fir and black spruce (Picea mari ana).
The specimen was iden ti fied by another of the authors (DM) as
S. turfi cola. The second New found land col lec tion, two sporocarps
(Fig. 2), were found by Maria Voitk on Sep tem ber 21, 2007, on
the Western Brook Pond trail, at the edge of a large raised bog
(Fig. 3), in Sphagnum capillifolium var. tenellum, among a mod er ate
growth of sedges (Carex sp.). This site is about 400 km removed
from the site of the first discovery (Fig. 4). The trail was made with
crushed lime stone and rep re sents an alkaline zone in an otherwise
acid bog. The specimen was identified (by DM) from a photograph
as S. turfi cola. The third Newfoundland col lec tion consists of one
col lec tion by one of the authors (BB) and two collections by Kenny
Figure 2. The second Newfoundland col lec tion was found on Sep tem ber
21, 2007, along the Western Brook Pond trail among Sph ag num capil-
lifolium var. tenellum and sedg es (Carex sp.).
Figure 3. Boggy habitat of Western Brook Pond trail.
Figure 1. The first specimen of Ascocoryne turfi cola collected in New-
found land on June 15, 2007, near Junction Pond among Sphagnum
squarrosum.

25
Volume 1:2 Summer 2008 Fungi
Tuach at FORAY NEW FOUND LAND & LABRADOR on Sep-
tem ber 29, 2007 (Fig. 5), in a bog near the administrative build ings
of the Brother Brennan En vi ron men tal Education Cen tre, a site
about 50 km from the first discovery. All were confirmed to be S.
turfi cola. One of Tuach’s collections is from the same pop u la tion
as BB’s; the other may be the same or from a site a few meters
away. The fourth New found land col lec tion was tak en from the
same site by one of the au thors (AV) on October 11, 2007 (Fig.
6). For more information, see sup ple men tal information online
at www.fungimag.com.
DNA Sequence Analysis
The last three Newfoundland collections underwent molecular
DNA analysis to ex am ine the genetic similarity to European iso-
lates. For generating DNA sequence data of two ribosomal DNA
region, the ITS and LSU-rDNA, two primer pairs ITS1F/4 (White
et al., 1990) and LR0R/5 (Vilgalys and Hester, 1990) were used
(see Table 1).
Results
Ascocoryne turfi cola (Boudier) Korf 1971. Phytologia 21(4):
201–7.
=Sarcoleotia turfi cola [Boudier] Den nis 1971. Kew Bulletin 25:
335–74.
=Ombrophila turfi cola (Boud.) Svrcek 1957. Ceská Mykologie 11:
32–41.
=Coryne turfi cola Boudier 1905. Bullelltin de Societe Mycologie de
France 21: 71.
Apothecia 0.6–2.5 mm wide, round, flat, translucent, with
sharp and distinct mar gin, becoming irregular and wavy in age,
ge lat i nous, pale olive green in color, be com ing vinaceous, brown
Figure 4. Map of Newfoundland, Canada. Red dots are 2007 collection
sites for Ascocoryne turfi cola and are approximately 400 km apart.
Table 1. PCR primers sequences used for the am plification of
A. turfi cola rDNA (after White et al., 1990) and the genomic re-
gion amplifi ed (LSU = gene for large sub unit of the ri bosome;
ITS = internal tran scribed spacer re gion of DNA be tween two
ribosomal RNA genes).
Primers Sequences 5’–3’ Gene
LR0R ACCCGCTGAACTTAAGC LSU-rDNA
LR5 TCCTGAGGGAAACTTCG LSU-rDNA
ITS1 TCCGTAGGTGAACCTGCGG ITS
ITS4 TCCTCCGCTTATTGATATGC ITS
Primers Sequences 5’-3’ Gene
LR0R ACCCGCTGAACTTAAGC LSU-rDNA
LR5 TCCTGAGGGAAACTTCG LSU-rDNA
ITS1 TCCGTAGGTGAACCTGCGG ITS
ITS4 TCCTCCGCTTATTGATATGC ITS
Figure 6. The fourth Newfoundland col lec tion was taken on October
11, 2007, from the same location as that in Fig. 5.
Figure 5. The third Newfoundland col lec tion was made on Sep tem ber
29, 2007, in a bog near the administrative buildings of the Brother
Brennan Environmental Ed u ca tion Centre, a site about 50 km from
the first dis cov ery.

26Fungi Volume 1:2 Summer 2008
or tan in ad vanced age. Stipe 20–45 mm long, 4–8 mm wide at
apex, straight, becoming curved and wavy in advanced age, tapering
evenly to 1 mm at base, translucent, ge lat i nous, smooth, whit ish to
tan in young spec i mens, darkening to vinaceous or brown in age,
gentle vinaceous shading of variable intensity toward the base, may
reach to near the cap in some specimens. Medullary excipu-
lum composed of two layers: an inner zone of non-ge la ti nized
hyphae (Fig. 7-2) and an outer zone of gelatinized hy phae that is
compact and firm when dried but becomes considerably expanded
when fresh or remoistened (Fig. 7-3). Outer zone com posed to
parallel to interwoven hy phae with cells 17–45 X 4–9 µm and
with weakly to strongly gelatinized walls, with hyphae becoming
irregularly arched and coiled when moistened, with some highly
refractile non-gelatinized hyphae in ter mixed with the gelatinous
ones (Fig. 8). Inner zone similar in gross ap pear ance to the ectal
excipulum, composed of non-gelatinized in ter wo ven hyphae
with cells measuring 20–35 X 4–10 µm.Ectal excipulum
250–300 µm thick com posed of parallel to slight ly interwoven
hyphae with individual cells nearly cy lin dri cal to ellip soidal and
measuring 20–60 X 5–18 µm in diameter (Fig. 7-4). Subhyme-
nium brown in Melzer’s So lu tion, composed of a very compact
mass of interwoven hyphae 2.5–4.8 µm in di am e ter, with some
hy phae having dextrinoid ma te ri al on their walls. Para phy ses
cy lin dri cal, mostly un branched, septate, 1.4–2.4 µm in di am e ter
(Fig. 9). Asci arising from cro ziers, cylindrical to very narrowly
clavate, thin-walled, with a prominent api cal cush ion containing
an elongated pore, with the lu men often prom i nent ly de pressed
below the apical cushion, 90–120 X 6.4–10.0 µm. Apical apparatus
of the asci consisting of a cylindrical pore 2.4–3.2 µm long embed-
ded in a thickened matrix, with pore strong ly amyloid in Melzer’s
and Lugol’s so lu tion with or with out 5% KOH pre treat ment (Fig.
10). As cospores uniseriate or more rarely sub-uniseriate in the
ascus, el lip soi dal at first but later be com ing more tapered toward
the poles and finally fusoid, hy a line, smooth, unicellular at first
but of ten with one or even two septa at maturity or upon ger mi -
na tion, 8.9–16.4 X 3.6–5.6 µm (median(n=47)=12.86 ± 2.35
X 4.63 ± 0.42), Q=1.92–3.80 (Median(n=47)=2.78 ± 0.47)
(Table 2), ger mi nat ing by means of germ tubes pro duced at one
or both poles (Fig. 11). Habitat: Singly or often clus ters fused
at the base, invariably among a variety of Sphagnum spp., usually
in ti mate ly associated with stem of Sphagnum sp. at base, in open
bog or edge of forest, with a variety of Carex spp.
Figure 9. Asci and paraphyses of SPC WP440, collection 1 from 15 June
2007. The asci are immature but the paraphyses show up well.
Figure 8. Hyphae with gelatinized walls are shown. Note the appearance
of irregularly arched and coiled hyphae.
Figure 7. Dry cross-section of A. turfi cola (from collection 4). The num-
bers refer to the various layers: 1) hymenium (asci and para phy ses), 2)
inner medullary excipulum, 3) outer med ul lary excipulum, and 4 ectal
excipulum. The medullary excipulum is composed of two layers, the
outer gelatinous zone (Layer 3) and the in ner non-gelatinous zone (Lay er
2) that is similar in ap pear ance to the ectal excipulum.

27
Volume 1:2 Summer 2008 Fungi
Parsimony analyses using ITS sequence data in PAUP* 4.0b
(Swofford, 1999) produced a 100% match with un i den ti fied en-
vi ron men tal samples of A. turficola from Europe, showing only
minor geographic variation (Fig. 12). They fit completely within the
Ascocoryne clade. When compared with previously analyzed taxa,
the New found land specimens are grouped among the Ascocoryne
clade within the Helotiales (see supplemental ma te ri als online).
Discussion
Ascocoryne turfi cola is an enigmatic as co mycete. A number of ques-
tions regarding this species persist. For example, little is known
of its ecology, besides the fact that this species has been found
exclusively in peat bogs. All other known species of Ascocoryne
(including the cosmopolitan A. sarcoides, see Fig. 13) grow on wood.
There fore, it is possible that A. turfi cola finds subsphagnic wood bits
in the peat to rot (all specimens demonstrate a very long tapering,
“rootlike” base). Stasinska and Sotek (2004) re port ed it from the
stems of sedges (Carex rostrata) in a Sphagnum bog in Poland. Other
bog inhabiting fungi are known to be wood rotters. For example,
Pholiota astragalina and P. scamba (Fig. 14) both grow in deep moss
but have a con nec tion with small pieces of wood (per son al ob-
servations). Of course it is also possible that A. turfi cola does not
utilize wood at all. Environmental (soil) samples from the United
Kingdom yield ed base se quenc es iden ti fied as those of A. turfi cola
(Wang et al., 2006b), suggesting that sub strates other than wood
may have been colonized. In fact, even though A. sarcoides and other
species of Ascocoryne oc cur ex clu sive ly on wood,there may not
be any ex per i men tal ev i dence to show that they actually di gest
its components. Future col lec tors of this species would ben e fit
our un der stand ing of this fun gus by searching for evidence of its
nutritional ac tiv i ties.
Yet another question regarding A. turfi cola is whether it is a
recent arrival to North America or has it merely gone un no ticed
for a long time. Likewise, its oc cur rence in Europe is wide spread
al though it is rarely recorded. Watling et al. (2001) de ter mined
that because of its con spic u ous shape and color it would be more
fre quent ly reported, were it not so scarce. However, Eckblad and
Torkelsen (1972) argued that it is likely to be fairly common but
often overlooked as mycologists rarely investigate bogs.
If A. turfi cola has been in the New World for a long time, was
it present before the breakup of Gondwanaland or is it the re sult
of long distance dispersal? Little is known about the distribution
Table 2. Ascospore sizes of A. turfi cola of col lections re ported previously from Eu rope and herein from New foundland. Me dian
measurements and standard de viations are shown, where available; Q value is the ratio of mean length to width of elongate spores,
thus spores ellipsoidal or ovoid when Q < 2, and spores el lipsoidal-ob long, fusoid, cylindrical, etc. when Q > 2.
Collection Length µm Width µm Q µm
(Mean; std deviation) (Mean; std deviation) (Mean; std deviation)
Boudier1 14.8 – 18.8 4.1 – 4.9
Favre2 15 – 18 5.6 – 6.6
Cheype3 15 – 18 5.5 – 6.0
Moreau4 11.5 – 17.5 4.2 – 5.5
Dennis5 12 – 14 4 – 5
Kirk6 10.8 – 16.4 4.0 – 5.2
Dissing7 15 – 20 3.6 – 5.6
Ohenoja8 12 – 13 4.5 – 5.0
NL, all colls.9 8.9 – 16.4 3.6 – 5.6
NL coll. 110 8.9 – 10.9 (9.728; 0.640) 3.6 – 4.8 (4.368; 0.376) (2.246; 0.282)
NL coll. 211 9.2 – 13.2 (11.564; 3.741) 4.0 – 5.2 (4.58; 1.405) (2.536; 0.375)
NL coll. 312 13.6 – 16.0 (14.440; 1.111) 4.0 – 5.2 (4.520; 0.434) (3.215; 0.338)
NL coll. 413 12.0 – 16.4 (14.397; 1.261) 4.0 – 5.6 (4.738; 0.432) (3.052; 0.274)
1. Original values from Boudier (1905), corrected for magni-
fi cation (see Brummelen, 1985).
2. Favre,1955.
3. Sourced from website http://jlcheype.free.fr/.
4. Personal com munication, Pierre-Arthur Moreau.
5. Dennis, 1971.
6. Collected from Europe and mea sured by one of the cur-
rent authors (DM), data not published.
7. Dissing, 1992.
8. Collected from northern Finland and Norway, kept in Uni-
versity of Oulu Herbarium; personal communication, E.
Ohenoja.
9. n=54.
10. n=10.
11. n=11.
12. n=10.
13. n=10.

28Fungi Volume 1:2 Summer 2008
of this spe cies which is not surprising as mycologists have been
slow to determine the dis tri bu tion patterns, within evolutionary
con texts, for fungi, in general (Lumbsch et al., 2008). With the
accumulation of DNA sequence information we are now be gin ning
to see the emergence of a brand new field of re search (phylogeog-
raphy) to answer such questions. It is probably safe to assume that
A. turfi cola is a recent arrival to New found land as most of the soil
was eroded away (taking the original flora and fauna with it) dur-
ing the last glacial period, which ended around 7,000 years ago
(South, 1983). Like wise, Newfoundland has al ways been the first
landfall for organisms (including hu mans) traveling from the Old
World to the New World.
While very similar to European isolates, our col lec tions were
not mor pho log i cal ly identical. Ascospores of our spec i mens were
not as large as those reported by Boudier. Brummelen has reported
that the scaling of Boudier’s mi cro scope in tro duced a magnifica-
tion factor, requiring that all mea sure ments be mul ti plied by 0.82
to correct them (Brummelen, 1985). We have used this correc-
tion in our comparisons (Table 2). When this is done, Boudier’s
match those of Favre, but both remain some what larg er than ours.
Table 2 shows the sizes and ranges of spores of A. turfi cola from
published and unpublished ob ser va tions, as well as from our four
collections. Likewise, the mean spore size for each of our collec-
tions is shown. With one ex cep tion, spores of col lec tions from
the European Alps (Boudier, Favre, Cheype) seem to be larger
than those from else where. If consistent, this would be op po site
to reports for many mush rooms, where smaller spores are noted
from south ern lat i tudes (Redhead and Ginns, 1980; Steyaert,
1975). However, the re port by Dissing in Nordic Macromycetes
(Dissing, 1992) clear ly breaks this re la tion ship. Although Dissing
does not re port the location of his long-spored specimens, since
the book en com pass es mush rooms of Scandinavia, they must be
con sid er ably north of the Alps.
Therefore, another explanation for spore size discrepancy
must be sought. Our collections represent mushrooms at dif fer ent
stages of maturity. Collection 1 is a single immature spec i men,
with almost all spores still within the asci; the few free ones were
just at the mouths of the asci. Not surprisingly, these were the
Figure 11. Four asci from collection 1. The ellipsoidal ascospores to the
right of the asci also are from same the material and are probably im-
ma ture. The rest of the spores, including the ger mi nat ing ones, are from
the September and October collections and are mature.
Figure 10. Asci mount ed in Lugol’s so lu tion with out KOH pre treat ment.
Col lec tion 3 of 29 Sep tem ber 2007.

29
Volume 1:2 Summer 2008 Fungi
Figure 12. ITS phylogeny of Ascocoryne species.

30Fungi Volume 1:2 Summer 2008
smallest spores we encountered. Collection 2 con sist ed of one
juvenile and one young adult spec i men. The spores were consider-
ably larger. Collections 3 and 4 were from the same pop u la tion,
two weeks apart, toward the end of the sea son. As expected, they
con tained several overmature specimens. Spores from these col-
lections were the larg est. Maturity of the spores was also shown by
the appearance of septation and ev i dence of germination in some
cases. Seemingly contrary to the trend, the median spore size of
Collection 4, the latest in the season, was slightly smaller than
that of Collection 3. However, as seen in the photograph (Fig. 6),
Collection 4 contained more immature spec i mens than Collec-
tion 3. If the range of size is examined (Table 2), it is evident that
Collection 4 contained the largest spores of all four.
Because our collections had a good match with the DNA of
European specimens, we can be reasonably assured that we are deal-
ing with the same species. We also had an opportunity to examine
one of the European specimens used for the DNA stud ies (Kirk
specimen). Our re view of reported spore sizes sug gests that there
is a wide size range for spores of A. turfi cola. The review of our
own collections sug gests that most of this vari a tion relates to the
age of the spores. Spores from our more mature and overmature
specimens matched the range reported from the Alps. There fore,
some circumspection in interpreting spore size for this mushroom
is advised.
Coryne, Sarcoleotia or Ascocoryne?
As discussed above, the genus Coryne is now applied only to non-
sexually reproducing fungi and is unavailable for Ascomycetes.
However, the names Sarcoleotia Imai and Ascocoryne Groves and
Wilson are both avail able for Ascomycetes and have been used
to accommodate C. turfi cola. The only mor pho log i cal feature that
has been used to resolve this problem is the presence or absence
of a gelatinous excipular layer with in the apothecia. While most
previous authors have described Coryne turfi cola as having ge lat i nous
apothecial tissues Den nis (1971) reported the Brit ish col lec tions
to lack these features, and on that basis as signed it to Sarcoleotia as
S. turfi cola Dennis. The Newfoundland material is so similar to the
specimens illustrated by Boudier that we have no reason to doubt
their conspecificity and, in accordance with Boudier’s description,
ours have well-de fined gelatinous tis sues. We can only spec u late
that Dennis ex am ined poorly dried or atypical rep re sen ta tives of
C. turfi cola or, perhaps more likely, had another species altogether.
Only an examination of Den nis’ ma te ri al will settle this question.
Thus we are confident that our material fits the morphological con-
cept of C. turfi cola as un der stood by all authors other than Dennis.
Morphologically, it also fits within the ge nus Ascocoryne.
To quote Hsü Yu, “Names are only the guests of reality.” The
organism remains the same and always has a gelatinous layer be low
the apothecium, no matter what we call it. When we claim to reas-
sign it on the basis of “new” genetic evidence, we should remember
that the evidence is not new, only our awareness of it. Studying
the ge net ic relationships of the Helotiales, Wang and coworkers
(2006 a; b) discovered that the genus Sarcoleotia sen su Schumacher
and Sivertsen (1987) was made up of two sep a rate genetic groups
(Fig. 9). One group (the Geoglossum clade) in cludes S. globosa, the
type species of Sarcoleotia, which shares genetic, morphological
and ecological sim i lar i ty with the so-called earth-tongue fun gi,
Geoglossum and Trichoglossum. A sec ond group (the Ascocoryne
clade) contains spe cies having ge net ic similarity with the small
Figure 13. The cosmopolitan Ascocoryne sarcoides grows on wood.
Figure 14. Besides A. turfi cola, other bog inhabiting fungi are known to be
wood rotters. Pholiota astragalina (top) and P. scamba (bot tom) both grow in
deep Sph ag num moss but have a connection with small pieces of wood.

31
Volume 1:2 Summer 2008 Fungi
genusAscocoryne and includes C. turfi cola. Thus the genetic evidence
supports in clu sion of C. turfi cola in Ascocoryne and not Sarcoleotia.
Appeal
We have done our best to cap ture every record of this taxon from
North America. Nev er the less, it is pos si ble that despite our best
efforts some records may have been missed. If any reader is aware
of a North Amer i can record of this mush room, please no ti fy the
Editor of FUNGI, <bbunyard@wi.rr.com>, so that we may com-
plete our records. One of the ad van tag es of elec tron ic pub li ca tion
is that while the printed version remains as is, the elec tron ic ver-
sion of this ar ti cle, available for down load from the FUNGI Web
site, <www.fungimagazine.com>, can be amend ed con stant ly to
re flect new in for ma tion. We also request that having been alerted
to the existence of this beau ti ful bog denizen, read ers who find
it, please notify the Editor.
Acknowledgments
During the search for information about Ascocoryne turfi cola, the
authors have en gaged several authorities, who gave unstintingly
of their time. We wish to thank those, who added illumination or
insight, allowing us to piece together the bits to form a picture:
Seanna Annis, Alan Bessette, David Boertmann, Torbjørn Borgen,
David Fischer, Gro Gulden, Kathie Hodge, Henning Knudsen,
Richard Korf, Thomas Læssøe, Pierre-Arthur Moreau, Esteri
Ohenoja, Scott Redhead, Brian Spooner, Markus Thormann, Jan
Vesterholt, and Roy Watling.
References
Bessette, A. E., A. R. Bessette, and D. W. Fischer. 1997. Mushrooms of
North east ern North America. Syracuse University Press, Syr a cuse,
NY.
Boudier, J. L. E. 1904–1909. Icones Mycologicae ou Iconographie des Cham-
pi gnons de France, Principalement Discomycètes (vols. 1–4).
Boudier, J. L. E. 1905. Bullelltin de Societe Mycologie de France 21: 71.
Brummelen, J. 1985. Introductory note to the re-edition of Boudier’s
Icones Mycologicae. In: Brummelen, J., R. P. Korf, H. Clémencon, W.
Julich, and V. Demoulin, V. Icones Mycologicae par Emile Boudier. V. Liste
préliminaire et explication des planches. Editions Piantanida, Lausanne.
Dennis, R. W. G. 1968. British Ascomycetes. J. Cramer, Vaduz; 585 pp.
Dennis, R. W. G. 1971. New or interesting British microfungi. Kew Bul-
le tin 25: 335–74.
Dissing, H. 1992. In: L. Hansen, H. Knudsen, eds: Nordic Macromycetes
Vol 2, Polyporales, Boletales, Agaricales, Russulales Nordsvamp,
Copenhagen.
Eckblad, F.-E. and A.-E. Torkelsen. 1972. Contributions to the Ombro-
phi loideae (Ascomycetes) in Norway. Norwegian Jour nal of Botany
19: 25–30.
Favre, J. 1948. Les Associations fongiques des hauts-marais jurassiens et
des quelques régions voisines. Matériaux pour la Flore Cryptogamique
Suisse, Vol. X, Fasc. 3.
Favre, J. 1955. Les Champignons Supérieurs de la Zone Alpine du Parc National
Suisse. Druck Lüdin, Liestal, Switzerland.
Groves, J. W. and D. E. Wilson. 1967. The no men cla tur al status of Coryne.
Taxon 16: 35–41.
Korf, R. P. 1971a. Discomycetes and Tuberales. In: The Fungi: An Advanced
Treatise (G. C. Ainswoirth, A. S. Sussman, F. K. Spar row, eds.), Vol
IV. Academic Press, New York & London.
Korf, R. P. 1971b. Some new Discomycete names. Phytologia 21(4):
201–7.
Lumbsch, H. L., P. K. Buchanan, T. W. May, and G. M. Mueller. 2008.
Phylogeography and biogeography of fungi. My co log i cal Re search
112(4): 423–24.
Redhead, S. A. and J. H. Ginns. 1980. Cyptotrama asprata (Agaricales)
from North America and notes on the five spe cies of Cyptotrama
sect. Xerulina.Canadian Journal of Botany 58: 731–40.
Schumacher, T. and S. Sivertsen. 1987. Sarcoleotia globosa (Sommerf.:
Fr.) Korf, tax on o my, ecol o gy and distribution. In: G.A. Larsen, J.F.
Amirati, S.A. Redhead (Eds.), Arctic and Al pine My col o gy 2. Plenum
Press, New York and London, pp. 163–76.
South, G. R. 1983. Introduction, pp. 1–3. In: South, G. R. (Ed.) Biogeog-
raphy and Ecology of the Island of Newfoundland. Dr. W. Junk Publishers,
The Hague.
Stasinska, M. and Z. Sotek. 2004. Ascocoryne turfi cola (Fungi, As co my-
cet es), a species new to Poland. Acta Societatis Botanicorum Poloniae
73(1): 61–64.
Steyaert, J. A. 1975. The concept and cir cum scrip tion of Ganoderma tor-
natum. Transactions of the British Mycological Society 65: 451–67.
Swofford, D. L. 1999. PAUP* 4.0 vers. b2. Phylogenetic analysis using
parsimony and other methods. Sinauer Associates, Sunderland,
Massachusetts.
Vilgalys, R. and M. Hester. 1990. Rapid ge net ic identification and map-
ping of en zy mat i cal ly amplified ribosomal DNA from sev er al Cryp-
to coc cus species. Journal of Bac te ri ol o gy 172: 4238–46.
Wang, Z., M. Binder, C. Schoch, P. Johnston, J.W. Spatafora, and D.S.
Hibbett. 2006a. Evolution of helotialean fungi (Leotiomycetes,
Pezizomycota): a nuclear rDNA phylogeny. Mo lec u lar Phylogenetics
and Evolution 41: 295–312.
Wang, Z., P. Johnston, S. Takamasu, J.W . Spatafora, and D. S. Hibbett.
2006b. To ward a phylogenetic classification of the Leotiomycetes
based on rDNA data. Mycologia 98(6): 1065–75.
Watling, R., R. King, and N. Riddiford. 2001. New and in ter est ing
records of fun gi from Shetland. Botanical Journal of Scot land 53(1):
57–64.
White, T. J., T. Bruns, S. Lee, and J. Taylor. 1990. Amplification and
direct sequencing of fun gal ribosomal RNA genes for phylogenet-
ics. In: Innis, M. A., D. H. Gelfand, J. J. Shinsky, T. J. White, eds.
PCR Protocols: A Guide to Methods and Ap pli ca tions, 315–22. Ac a dem ic
Press, San Diego.