![Map of Costa Rica with the location of Hule and Río Cuarto lakes. Modified after Alvarado et al. [18].](https://www.researchgate.net/profile/Jacopo-Cabassi/publication/264201432/figure/fig16/AS:340039084068868@1458083043422/Map-of-Costa-Rica-with-the-location-of-Hule-and-Rio-Cuarto-lakes-Modified-after-Alvarado_Q320.jpg)
![Map of Costa Rica with the location of Hule and R ́o Cuarto lakes. Modified after Alvarado et al. [18]. doi:10.1371/journal.pone.0102456.g001](https://www.researchgate.net/profile/Jacopo-Cabassi/publication/264201432/figure/fig1/AS:295996417429509@1447582453903/Map-of-Costa-Rica-with-the-location-of-Hule-and-R-o-Cuarto-lakes-Modified-after_Q320.jpg)
![Panoramic view and bathymetric map of Lake Hule (modified after Göcke [24]).](https://www.researchgate.net/profile/Jacopo-Cabassi/publication/264201432/figure/fig25/AS:341131868033025@1458343583385/Panoramic-view-and-bathymetric-map-of-Lake-Hule-modified-after-Goecke-24_Q320.jpg)
Content uploaded by Jacopo Cabassi
Author content
All content in this area was uploaded by Jacopo Cabassi on Jul 24, 2014
Content may be subject to copyright.
Available via license: CC BY 4.0
Content may be subject to copyright.
Geosphere-Biosphere Interactions in
Bio-Activity
Volcanic Lakes: Evidences from Hule and Rı
`
o Cuarto
(Costa Rica)
Jacopo Cabassi
1
*, Franco Tassi
1,2
, Francesca Mapelli
3
, Sara Borin
3
, Sergio Calabrese
4
, Dmitri Rouwet
5
,
Giovanni Chiodini
6
, Ramona Marasco
3
, Bessem Chouaia
3
, Rosario Avino
6
, Orlando Vaselli
1,2
,
Giovannella Pecoraino
7
, Francesco Capecchiacci
1,2
, Gabriele Bicocchi
1
, Stefano Caliro
6
, Carlos Ramirez
8
,
Raul Mora-Amador
8
1 Dipartimento di Scienze della Terra, University of Florence, Florence, Italy, 2 CNR – Istituto di Geoscienze e Georisorse, Florence, Italy, 3 Department of Food,
Environmental and Nutritional Sciences, University of Milan, Milan, Italy, 4 Dipartimento di Scienze della Terra e del Mare, University of Palermo, Palermo, Italy, 5 Istituto
Nazionale di Geofisica e Vulcanologia, Sezione di Bologna, Bologna, Italy, 6 Istituto Nazionale di Geofisica e Vulcanologia, Osservatorio Vesuviano, Naples, Italy, 7 Istituto
Nazionale di Geofisica e Vulcanologia, Sezione di Palermo, Palermo, Italy, 8 Centro de Investigaciones en Ciencias Geolo
´
gicas, Escuela Centroamericana de Geologı
´
a, Red
Sismolo
´
gica Nacional, Universidad de Costa Rica, San Jose, Costa Rica
Abstract
Hule and Rı
´
o Cuarto are maar lakes located 11 and 18 km N of Poa
´
s volcano along a 27 km long fracture zone, in the Central
Volcanic Range of Costa Rica. Both lakes are characterized by a stable thermic and chemical stratification and recently they
were affected by fish killing events likely related to the uprising of deep anoxic waters to the surface caused by rollover
phenomena. The vertical profiles of temperature, pH, redox potential, chemical and isotopic compositions of water and
dissolved gases, as well as prokaryotic diversity estimated by DNA fingerprinting and massive 16S rRNA pyrosequencing
along the water column of the two lakes, have highlighted that different bio-geochemical processes occur in these
meromictic lakes. Although the two lakes host different bacterial and archaeal phylogenetic groups, water and gas
chemistry in both lakes is controlled by the same prokaryotic functions, especially regarding the CO
2
-CH
4
cycle. Addition of
hydrothermal CO
2
through the bottom of the lakes plays a fundamental priming role in developing a stable water
stratification and fuelling anoxic bacterial and archaeal populations. Methanogens and methane oxidizers as well as
autotrophic and heterotrophic aerobic bacteria responsible of organic carbon recycling resulted to be stratified with depth
and strictly related to the chemical-physical conditions and availability of free oxygen, affecting both the CO
2
and CH
4
chemical concentrations and their isotopic compositions along the water column. Hule and Rı
´
o Cuarto lakes were
demonstrated to contain a CO
2
(CH
4
,N
2
)-rich gas reservoir mainly controlled by the interactions occurring between
geosphere and biosphere. Thus, we introduced the term of bio-activity volcanic lakes to distinguish these lakes, which have
analogues worldwide (e.g. Kivu: D.R.C.-Rwanda; Albano, Monticchio and Averno: Italy; Pavin: France) from volcanic lakes only
characterized by geogenic CO
2
reservoir such as Nyos and Monoun (Cameroon).
Citation: Cabassi J, Tassi F, Mapelli F, Borin S, Calabrese S, et al. (2014) Geosphere-Biosphere Interactions in Bio-Activity Volcanic Lakes: Evidences from Hule and
Rı
`
o Cuarto (Costa Rica). PLoS ONE 9(7): e102456. doi:10.1371/journal.pone.0102456
Editor: Dwayne Elias, Oak Ridge National Laboratory, United States of America
Received April 2, 2014; Accepted June 19, 2014; Published July 24, 2014
Copyright: ß 2014 Cabassi et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: The authors confirm that all data underlying the findings are fully available without restriction. All relevant data are within the paper.
Funding: This work benefitted by the financial support of the 7th Workshop of the Commission on Volcanic Lakes (IAVCEI), INGV and the Laboratory of Fluid and
Rock Geochemistry of University of Florence (Resp. Franco Tassi). Francesca Mapelli was supported by University of Milan, DeFENS, European Social Found (FSE)
and Regione Lombardia (grant ‘‘Dote Ricerca’’). No funders were involved since this study was supported by using funds belonging to laboratories of different
institutions, which participated to this research. Nevertheless, FSE and Regione Lombardia had no role in study design, data collection and analysis, decision to
publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* Email: jacopo.cabassi@gmail.com
Introduction
Volcanic lakes are peculiar natural systems on Earth, although
they are a common feature of volcanic systems characterized by
recent activity, being present in 476 volcanic structures worldwide
(VHub, CVL Group page; [1]). A volcanic lake simultaneously
acts as both a calorimeter and a condenser for acidic volatiles from
magmatic and hydrothermal degassing [2–6]. Thus, its existence
and durability strictly depends on the balance between i) inputs of
meteoric water and hydrothermal-magmatic fluids and ii) losses
related to evaporation, permeation through sediments and
streaming [7]. Volcanic lakes were basically classified, as follows
[1,4]: i) ‘‘high-activity’’ lakes affected by the addition of significant
amounts of hot and hyperacidic hydrothermal–magmatic fluids; ii)
‘‘low-activity’’ lakes, characterized by CO
2
-dominated fluid inputs
at a relatively low rate from sub-lacustrine fluids discharges,
favoring the establishment of a stable vertical stratification and
possibly the accumulation of high amounts of dissolved gases in the
deep water layers. At these conditions, a lake overturn triggered by
either i) external events, such as earthquakes, landslides or extreme
PLOS ONE | www.plosone.org 1 July 2014 | Volume 9 | Issue 7 | e102456
weather conditions or ii) the progressive attainment of gas
saturation conditions may cause the abrupt release of toxic gas
clouds in the atmosphere. This phenomenon, also known as
‘‘limnic eruption’’, was firstly documented at Monoun and Nyos
lakes (Cameroon) in 1984 and 1986, respectively [8–15].
Accordingly, low activity lakes are commonly indicated as
‘‘Nyos-type’’ lakes.
In Costa Rica, volcanic lakes are found in quiescent systems
(Congo and Barva), as well as in volcanoes characterized by
moderate hydrothermal activity (Irazu´ and Tenorio) and strong
magmatic fluid emissions (Rinco´n de la Vieja and Poa´s) [16,17].
Hule and Rı
´
o Cuarto are low-activity, Nyos-type, maar lakes
located at 11 and 18 km N of Poa´s volcano (Fig. 1), respectively, in
relation of a 27 km long fracture zone passing through the Sabana
Redonda cinder cones, the Poa´s summit craters (Botos, Active
Crater and Von Frantzius) and the Congo stratocone [18]. In
these two lakes, changes in the water color and fish death events
were repeatedly reported, suggesting the occurrence of rollover
episodes related to inputs of deep-originated gases [18]. To the
best of our knowledge, no information is available on these lakes
for chemical and isotopic compositions of dissolved gases deriving
from geogenic sources and the structure of prokaryotic commu-
nities. The latter are expected to play pivotal ecological functions,
encompassing nutrient remineralization and carbon cycling, which
is firmly linked to the fate of dissolved C
1
gases, i.e. CH
4
and CO
2
.
This paper presents the geochemical (water and dissolved gas
chemistry) and microbiological results obtained from samples
collected in 2010 during the 7
th
Workshop of the Commission on
Volcanic Lakes (CVL; Costa Rica 10–21 March 2010), which is
part of the International Association of Volcanology and
Chemistry of the Earth’s Interior (IAVCEI), by a group of
geochemists, limnologists, biologists and volcanologists from
different universities and scientific institutions. The aim of this
multidisciplinary research was to unravel the bio-geochemical
processes controlling the physical-chemical features of Hule and
Rı
´
o Cuarto lakes along the vertical profiles, showing their
implications for lake stratification and stability, and proposing
evidences for a new classification system.
Morphological and Limnological Outlines
2.1 Morphological features
Lake Hule (10u179420N, 84u129370W) lies within the
2.361.8 km wide Hule basin, a volcanic depression also hosting
Lake Congo to the north, which is separated from Lake Hule by a
volcanic cone, and Lake Bosque Alegre (unofficial name) [18–20].
Lake Hule has a half-moon shape, a surface area of about
5.5610
5
m
2
, an estimated water volume of 6.9610
6
m
3
, and a
maximum depth of ,23 m [17,18,21,22] (Fig. 2). The northern
shoreline of the lake shows three tributaries, whereas an emissary
(Rı
´
o Hule) is located to the NE [18,23,24].
Rı
´
o Cuarto maar (10u219230N, 84u139000W) has a rim whose
maximum elevation is ,52 m a.s.l. Lake Rı
´
o Cuarto shows steep
sided walls and a flat bottom, a morphology typical of maar lakes.
The lake has an E-W axis of 758 m, a mean width of 581 m, a
surface of 3.3610
5
m
2
and a water volume of 15610
6
m
3
[18,25]
(Fig. 3). Rı
´
o Cuarto is the deepest (,67 m) natural lake in Costa
Rica [19]. A small tributary is located on the eastern shore,
whereas no emissaries were recognized [25].
The main morphological features of Hule and Rı
´
o Cuarto lakes
can be summarized using the ‘‘depth-ratio’’ [26], which is a
dimensionless parameter equal to the ratio between the average
depth (the volume divided by the surface area of the lake) and the
maximum depth of the lake. The obtained results are 0.55 and
0.68, respectively, for Lake Hule and Lake Rı
´
o Cuarto,
corresponding to an average depth of 12.6 and 45.5 m. According
to Carpenter’s heuristic classification [26], the depth-ratio values
are consistent with the so-called ellipsoid shape (typical values
comprised between 0.5 and 0.66), considered a common feature
for volcanic lake basins, even though Rı
´
o Cuarto morphometry
tends to approximate a steep-sided frustum model, corresponding
to steep sides and flat bottom [27]. Such morphological features
tend to prevent water vertical mixing, favoring meromictic
conditions [28]. Thus, these physical parameters have a strong
influence on the vertical distribution of chemical species, especially
approaching the lake bottom where bio-geochemical processes
have their maximum efficiency [29].
2.2 Limnological features and rollover events
At Lake Hule, the limit between epi- and hypolimnion, marked
by a very weak thermocline and the complete depletion of O
2
, was
reported to occur at a depth ranging between 210 and 212 m
[23,24]. As reported by [22], this lake shows a persistent vertical
stratification and the presence of CO
2
in the deepest water strata.
Occurrence of fish death episodes, associated with sudden changes
of water color from dark blue to red and strong smell in the lake
surroundings, were reported by the local population in the last
years (4 to 5 events from 1989 to 2002). These events, which took
place during the cool, rainy and windy season (i.e. from December
to February), were interpreted as caused by rollover phenomena
[16,17,18,30].
The transition between epilimnion and hypolimnion in the
meromictic Lake Rı
´
o Cuarto was measured at 20 and 25 m depth
in May-June and January-February, respectively [18,25]. Rollover
events, testified by fish killing and color changes of lake water from
green to yellow-reddish, were observed in 1920 [31], between
1978 and 1991 [22], in January 1997 [16] and in February 2010
[18], just one month before our sampling. These events were
possibly triggered by cooling of the shallow water layer caused by
an anomalous weather characterized by low air temperature and
strong winds [18,25,32].
Materials and Methods
3.1 Sampling of water and dissolved gases
Water and dissolved gas sampling was carried out in March
2010 along vertical profiles from the lake surface to the bottom at
regular intervals of 5 m (Lake Hule) and 10 m (Lake Rı
´
o Cuarto),
in sites corresponding to the deepest points. Permission to sample
in both lakes was guaranteed by Red Sismolo´gica Nacional and
Universidad de Costa Rica. According to the single hose method
[33–35], water and dissolved gas samples were collected using a
sampling line consisting of 10 m long Rilsan tubes (W = 6 mm)
connected among them by steel connectors. Once the tube end
was lowered to the chosen depth, water was pumped up to the
surface through the sampling line using a 150 mL glass syringe
equipped with a three-way teflon valve and transferred into plastic
bottles after the displacement of a water volume double than the
inner volume of the tube. One filtered (0.45
mm) and two filtered-
acidified (with ultrapure HCl and HNO
3
, respectively) water
samples were collected in polyethylene bottles for the analysis of
anions, cations and trace species, respectively. A fourth water
aliquot was collected in glass bottles with the addition of HgCl
2
for
the analysis of water isotopes and
13
C/
12
C ratios of total dissolved
inorganic carbon (TDIC). Five hundred mL of water were filtered
immediately after the sampling recovery through sterile cellulose
mixed esters 0.22
mm pore size filters (GSWP, Millipore, USA) for
the analysis of prokaryotic populations. The filters were stored at
Bio-Activity Volcanic Lakes: Hule and Rı
`
o Cuarto (Costa Rica)
PLOS ONE | www.plosone.org 2 July 2014 | Volume 9 | Issue 7 | e102456
220uC in RNAlater solution (Quiagen, Italy), to prevent nucleic
acid degradation. Dissolved gases were sampled using pre-
evacuated 250 mL glass vials equipped with a Teflon stopcock
and connected to the sampling line used to collect water samples.
Sampling flasks were filled with water up to L of the inner volume
[36–38].
3.2 Field measurements
Water depth (m), temperature (uC), pH, Eh and electrical
conductivity (EC;
mScm
21
) along the lake vertical profiles were
measured using a Hydrolab MiniSonde 5 equipped with a data
logger for data storage. The nominal precisions were: depth
60.05 m; T60.1uC; pH60.2; Eh620 mV; EC61
mScm
21
.
Alkalinity was measured in situ by acidimetric titration using 0.01
N HCl. The analytical error for alkalinity analysis was #5%.
3.3 Chemical and isotopic analysis of water and dissolved
gases
Main anions (Cl
2
,SO
4
22
,NO
3
2
,Br
2
and F
2
) and cations
(Na
+
,K
+
,Ca
2+
,Mg
2+
,NH
4
+
and Li
+
) were analyzed by ion-
chromatography (IC) using Metrohm 761 and Metrohm 861
chromatographs, respectively. The analytical error for major water
constituents was #5%. Trace elements at selected depths were
analyzed at the INGV of Palermo by Inductively Coupled Plasma
Mass spectrometry (ICP-MS, Agilent 7500-ce). For most of the
elements the analytical uncertainty was in the order of 5-10% [39].
The
18
O/
16
O and
2
H/
1
H isotopic ratios of water (expressed as
d
18
O-H
2
O and dD-H
2
O % vs. V-SMOW, respectively) from
selected depths were analyzed using a Finnigan Delta plusXP
continuous-flow mass spectrometer (MS) coupled with a Gas-
benchII gas-chromatographic device (GBII), according to equili-
bration techniques with CO
2
for oxygen [40], and with H
2
for
Figure 1. Map of Costa Rica with the location of Hule and Rı
´
o Cuarto lakes. Modified after Alvarado
et al.
[18].
doi:10.1371/journal.pone.0102456.g001
Bio-Activity Volcanic Lakes: Hule and Rı
`
o Cuarto (Costa Rica)
PLOS ONE | www.plosone.org 3 July 2014 | Volume 9 | Issue 7 | e102456
Figure 2. Panoramic view and bathymetric map of Lake Hule (modified after Go
¨
cke [24]).
doi:10.1371/journal.pone.0102456.g002
Bio-Activity Volcanic Lakes: Hule and Rı
`
o Cuarto (Costa Rica)
PLOS ONE | www.plosone.org 4 July 2014 | Volume 9 | Issue 7 | e102456
Figure 3. Panoramic view and bathymetric map of Lake Rı
´
o Cuarto (modified after Go
¨
cke
et al.
[25]).
doi:10.1371/journal.pone.0102456.g003
Bio-Activity Volcanic Lakes: Hule and Rı
`
o Cuarto (Costa Rica)
PLOS ONE | www.plosone.org 5 July 2014 | Volume 9 | Issue 7 | e102456
Table 1. Depth (m), temperatures (uC), pH, Eh (mV), EC (mScm
21
), chemical composition, TDS (total dissolved solids), dD-H
2
O and d
18
O-H
2
O (expressed as % V-SMOW) and
d
13
C
TDIC
and d
13
C
TDICcalc
(expressed as % V-PDB) values of water samples collected.
Lake depth date T pH Eh HCO
3
2
F
2
Cl
2
NO
3
2
SO
4
22
Ca
2+
Mg
2+
Na
+
K
+
NH
4
+
Fe
tot
Mn TDS dD-H
2
O d
18
O-H
2
O d
13
C
TDIC
d
13
C
TDICcalc
Hule 0 March-10 24.1 7.0 11 42 0.04 1.2 0.05 2.0 7.0 2.3 2.8 1.5 0.01 0.09 0.003 60 220.3 23.8 n.a. n.a.
5 March-10 21.8 6.5 33 42 0.04 1.9 0.04 2.1 7.4 2.6 3.1 1.7 0.01 n.a. n.a. 61 n.a. n.a. n.a. n.a.
10 March-10 21.1 6.3 23 46 0.04 1.2 0.09 2.2 7.2 2.5 3.5 1.5 0.2 0.03 0.92 66 219.8 23.7 211.8 n.a.
15 March-10 20.9 6.5 2170 60 0.03 1.8 0.07 1.4 7.5 2.8 3.4 1.5 0.4 n.a. n.a. 79 2n.a. n.a. n.a. n.a.
23 March-10 20.8 6.6 2227 61 0.04 1.2 0.07 1.9 8.2 2.7 3.6 1.5 0.3 8.0 0.78 90 222.5 23.9 214.3 212.2
Rı
`
o Cuarto 0 March-10 27.9 7.5 166 85 0.05 1.8 0.4 1.1 12 5.1 5.7 2.7 1.9 0.02 0.004 116 220.3 23.3 28.3 n.a.
10 March-10 24.7 6.8 2191 92 0.04 1.9 0.6 0.88 13 5.1 5.5 2.7 2.0 3.4 0.27 127 219.7 23.4 27.9 n.a.
20 March-10 24.7 6.8 2215 93 0.04 1.7 0.1 0.91 13 5.1 5.5 2.7 2.1 n.a. n.a. 124 n.a. n.a. 27.8 27.8
30 March-10 24.7 6.8 2230 93 0.04 1.9 0.03 1.1 13 4.9 5.5 2.7 2.1 n.a. n.a. 124 n.a. n.a. 28.6 28.8
40 March-10 24.6 6.8 2243 103 0.05 2.1 0.03 0.95 14 5.0 5.5 2.8 2.4 3.6 0.27 140 222.2 23.4 28.4 28.9
50 March-10 24.7 6.6 2239 105 0.05 1.8 0.03 0.67 13 5.1 5.6 2.8 3.3 5.4 0.36 143 222.6 23.5 25.1 27.3
60 March-10 24.7 6.5 2245 163 0.06 1.8 0.08 0.51 14 5.6 5.9 3.3 9.0 15 0.63 219 224.5 23.7 23.7 22.0
67 March-10 24.7 6.6 2246 179 0.05 1.9 0.09 0.42 15 6.0 6.1 3.5 11 22 0.66 246 223.6 23.6
25.2 21.6
Ion contents and TDS are in mg L
21
. n.a.: not analyzed; n.d.: not detected.
doi:10.1371/journal.pone.0102456.t001
Bio-Activity Volcanic Lakes: Hule and Rı
`
o Cuarto (Costa Rica)
PLOS ONE | www.plosone.org 6 July 2014 | Volume 9 | Issue 7 | e102456
hydrogen [41]. The analytical uncertainties were 60.08% and
61% for d
18
O and dD values, respectively.
The
13
C
/12
C ratios of TDIC (expressed as d
13
C
TDIC
% vs. V-
PDB) at selected depths were determined on CO
2
produced by
reaction of 3 mL of water with 2 mL of anhydrous phosphoric
acid in vacuum [42] using a Finningan Delta Plus XL mass
spectrometer. The recovered CO
2
was analyzed after a two-step
extraction and purification procedures of the gas mixtures by using
liquid N
2
and a solid-liquid mixture of liquid N
2
and trichloro-
ethylene [43,44]. The analytical uncertainty was 60.05 %.
Dissolved gas composition was calculated using i) the compo-
sition of the gas phase stored in the headspace of the sampling
glass flasks, ii) the gas pressure in the flask headspace, iii) the
headspace volume, and iv) the solubility coefficients in water of
each gas compound [45]. The inorganic gas compounds hosted in
the flask headspace (CO
2
,N
2
,CH
4
, Ar, O
2
, Ne, H
2
and He) were
determined using a gas-chromatograph (Shimadzu 15a) equipped
with a Thermal Conductivity Detector (TCD). Methane was
analyzed with a Shimadzu 14a gas-chromatograph equipped with
a Flame Ionization Detector (FID). The analytical error for
dissolved gas analysis was #5%.
The analysis of the
13
C/
12
C ratios of CO
2
(expressed as d
13
C-
CO
2
% vs. V-PDB) stored in the flask headspace (d
13
C-CO
2STRIP
)
of selected samples was carried out with a Finningan Delta S mass
spectrometer after standard extraction and purification procedures
of the gas mixtures [43,44]. Internal (Carrara and San Vincenzo
marbles) and international (NBS18 and NBS19) standards were
used for the estimation of external precision. The analytical
uncertainty was 60.05%. The
13
C/
12
C ratio of dissolved CO
2
(d
13
C-CO
2
) was calculated from the d
13
C-CO
2STRIP
values using
the e
1
factor for gas-water isotope equilibrium proposed by Zhang
et al. [46], as follows:
e
1
~d
13
C{CO
2
{d
13
C{CO
2STRIP
~ 0:0049|TðÞ{1:31 ð1Þ
The analysis of the
13
C/
12
C and
2
H/
1
H ratios of dissolved CH
4
(expressed as d
13
C-CH
4
% vs. V-PDB and dD-CH
4
% vs. V-
SMOW, respectively) of selected samples was carried out by mass
spectrometry (Varian MAT 250) according to the procedure and
the sample preparation described by Schoell [47]. The analytical
uncertainty was 60.15%.
Figure 4. Vertical profiles of temperature (
6
C, a), electrical conductivity (EC, in
m
Scm
2
1
, b), pH (c), and redox potential (Eh, in mV, d)
in Lake Hule (blue line) and Lake Rı
´
o Cuarto (red line).
doi:10.1371/journal.pone.0102456.g004
Bio-Activity Volcanic Lakes: Hule and Rı
`
o Cuarto (Costa Rica)
PLOS ONE | www.plosone.org 7 July 2014 | Volume 9 | Issue 7 | e102456
The
3
He/
4
He ratios, expressed as R/Ra values, where R is the
3
He/
4
He isotopic ratio in gas samples and Ra is that of the air
equal to 1.39610
26
[48,49], were determined in selected gas
samples stored in the sampling flask headspace at the INGV
laboratories of Palermo, using the method described in Inguag-
giato and Rizzo [50]. The R/Ra values were corrected for air
contamination on the basis of measured He/Ne ratios. The
analytical uncertainty was 60.3%.
3.4 Microbiological analysis
DNA extraction for the analysis of microbial populations was
performed according to the protocol reported by Mapelli et al.
[51] and quantified by NanoDrop 1000 spectrophotometer
(Thermo Scientific, Waltham, MA). 16S rRNA gene was amplified
in PCR reactions using universal primers for bacteria with GC-
clamp as described in Marasco et al. [52]. Denaturing Gradient
Gel Electrophoresis (DGGE), applied to the bacterial 16S rRNA
gene amplified from the total water metagenome, was performed
by loading DGGE-PCR products (,150 ng) in a 0.5 mm
polyacrylamide gel (7% [w/v] acrylamide-bisacrylamide, 37.5:1)
containing 40 to 55% urea-formamide denaturing gradient, where
100% denaturant corresponds to 7 M urea and 40% [vol/vol]
formamide [52]. DGGE profiles were analyzed by using Image J
software (available at http://rsb.info.nih.gov/ij/) and cluster
analysis was performed using Microsoft Excel XLSTAT software
(Addinsoft Inc., New York, NY, USA). DGGE bands were excised
from the gel, eluted in water, PCR amplified and sequenced as
previously described [52]. The partial 16S rRNA gene sequences
obtained from the excised DGGE bands were edited in Chromas
lite 2.01 (http://www.technelysium.com.au) and subjected to
BLAST search (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The nu-
cleotide sequences were deposited in the EMBL public database
under the accession numbers HF930552-HF930593. To test the
presence of bacteria involved in anaerobic ammonium oxidation
(anammox), the functional gene hzsA was amplified using primers
hzsA_526F and hzsA_1857R as previously reported [53].
454 pyrosequencing assays were performed by using universal-
bacterial primers targeting the variable regions of the 16S rRNA,
V1–V3 (27 F mod 59 – AGRGTTTGATCMTGGCTCAG – 39;
519 R mod bio 59 - GTNTTACNGCGGCKGCTG - 39),
amplifying a fragment of approximately 400 bp, and 16S rRNA
archaeal primers arch344F (59 - ACGGGGYGCAGCAGGCG-
CGA – 39) and arch915R (59 - GTGCTCCCCCGCCAATTCCT
-39). The amplified 16S rRNA regions contained enough
nucleotide variability to be useful in identification of bacterial
and archaeal species [54,55]. PCR reactions and next generation
454 pyrosequencing were performed at MR DNA laboratories
(Shallowater, TX – U.S.A.). A first quality filtering was applied,
removing all the sequences that were shorter than 300 bp, longer
than 500 bp or with an average quality score under 25. All original
and non-chimeric 454 sequences are archived at EBI European
Read Archive. The high-quality 16S rRNA gene sequences
obtained by 454 pyrosequencing were analysed using QIIME
[56]. The sequences were clustered into operational taxonomic
units based on a threshold of 97% (OTU
97
) sequence identity,
using uclust [57] and one sequence for each OTU
97
,as
representative, was aligned to Greengenes (http://greengenes.lbl.
gov/) using PyNast [56]. Sequence identification was conducted
using Ribosomal Database Project classifier [58], with default
parameters. For each sample rarefaction curves of the observed
species and of Shannon index were estimated in order to analyse
the species sampling coverage. The OTU
97
diversity within and
between sample/s (respectively alpha and beta diversity) was
estimated using QIME workflow script alpha_rarefaction.py.
Shannon diversity index was calculated by PAST software [59].
Library coverage was calculated for each library using the
equation C = [1– (n1/N)] 6100, where n1 is the number of
singleton OTU
97
, and N is the total number of reads in the library.
To remove noise from the data, including potential rare
contaminants, OTU
97
not meeting the criterion of being present
at least 0.1% of the total number of reads were removed.
Figure 5. Vertical profiles (in mg L
2
1
) of HCO
3
2
,NO
3
2
,SO
4
2
2
,NH
4
+
,Fe
tot
and Mn in Lake Hule (a) and Lake Rı
´
o Cuarto (b).
doi:10.1371/journal.pone.0102456.g005
Bio-Activity Volcanic Lakes: Hule and Rı
`
o Cuarto (Costa Rica)
PLOS ONE | www.plosone.org 8 July 2014 | Volume 9 | Issue 7 | e102456
Results
4.1 Vertical profiles of temperature, EC, pH and Eh
Temperature, EC, pH, and Eh along the vertical profiles of the
lakes are shown in Tab. 1 and Fig. 4. Both Hule and Rı
´
o Cuarto
lakes showed relatively high temperature at the surface (24.1 and
27.9uC, respectively), and a thermocline at shallow depths (starting
from 22.5 and 25 m, respectively), with minimum temperatures
of 20.8 and 24.6uC, respectively, at the lake bottoms (Fig. 4a). The
temperature profiles were consistent with those reported in
previous studies [17,18,23,24,25,32,60], except those of the
epilimnion, likely because present and past measurements were
carried out in different periods of the year. Lake Hule did not show
a clear chemocline, as shown by the EC values that almost
constantly increased (from 84 to 140
mScm
21
) with depth (Fig. 4b).
Conversely, Lake Rı
´
o Cuarto showed two chemoclines: the first
one (from 159 to 186
mScm
21
) near the surface and the second
one (from 190 to 378
mScm
21
) between 240 and 267 m depth.
The vertical profile of pH values at Lake Hule exhibited a sharp
decrease from 6.9 to 6.3 between the depths of 0 m and 10 m, and
an opposite trend below this depth, where pH rose from 6.3 to 6.6
(Fig. 4c). At Lake Rı
´
o Cuarto the pH values decreased in the
shallower water strata (from 7.5 to 6.8) and from 240 to 260 m
depth (from 6.8 to 6.5), and slightly increased (up to 6.6) at the lake
bottom (Fig. 4c). Eh values at Lake Hule (Fig. 4d) showed a sharp
decrease between 210 and 215 m (from 33 to 2163 mV) and
reached the minimum values at lake bottom (2200 mV), whereas
at Lake Rı
´
o Cuarto it strongly decreased (from +166 at surface to
2191 mV) at the depth of 10 m displaying the lowest value (2
246 mV) at the lake bottom.
4.2 Chemical and isotopic composition of water samples
Both lakes showed low TDS values (up to 90 and 246 mg L
21
,
respectively, at lakes bottom) and a Ca
2+
-HCO
3
2
composition
(Tab. 1). Concentrations of HCO
3
2
,NH
4
+
,Fe
tot
and Mn (Fig. 5a–
b) tended to increase towards the two lakes bottom (up to 61 and
179 mg L
21
, 0.3 and 11 mg L
21
, 8 and 22 mg L
21
, 0.9 and
0.7 mg L
21
in Hule and Rı
´
o Cuarto, respectively), whilst oxidized
nutrients NO
3
2
and SO
4
22
, typical electron acceptors in
anaerobic environments, showed an opposite behaviour in Lake
Rı
´
o Cuarto, decreasing to 0.03 and 0.4 mg L
21
, respectively
(Fig. 5b). On the contrary, F
2
,Cl
2
,Ca
2+
,Mg
2+
,Na
+
,K
+
and,
only in Lake Hule, NO
3
2
and SO
4
22
, did not display specific
vertical trends along the lakes water column.
The dD-H
2
O values in Hule and Rı
´
o Cuarto lakes ranged from
226.5 to 220.5 % and 224.4 to 219.7 % V-SMOW,
respectively, while those of d
18
O-H
2
O varied from 24.7 to 2
4.6 % and from 24.5 to 24.0 % V-SMOW, respectively (Tab. 1).
The d
13
C
TDIC
values were between 214.3 and 211.8 % and 2
8.6 to 2 3.7 % V-PDB, in Hule and Rı
´
o Cuarto, respectively.
Trace element composition did not differ significantly between
the two lakes. The most abundant trace elements (.4
mgL
21
)
along Hule and Rı
´
o Cuarto vertical profiles were Al, B, Ba, Rb, Sr
and Zn. The maximum concentrations of Co, Cu, Ni, Ti and V (,
2.2
mgL
21
) were observed at the bottom layer of Lake Rı
´
o Cuarto
(267 m) and the other measured trace elements (As, Cd, Cr, Cs,
Li, Mo, Pb, Sb, Se, Th, U) were all ,1
mgL
21
(Tab. 2). In terms
of vertical distribution, those trace elements that clearly increased
towards both lakes bottom were Al, As, Ba, Co, Ni, Sr, Ti and V
(Tab. 2), whilst Mo concentrations showed a decrease with depth
only in Lake Rı
´
o Cuarto.
Table 2. Trace elements composition of water samples collected.
Lake depth Al As B Ba Cd Co Cr Cs Cu Li Mo Ni Pb Rb Sb Se Sr Th Ti U V Zn
Hule 0 5.4 0.11 5.0 5.1 0.04 ,0.05 ,0.05 0.04 0.25 0.11 0.11 0.66 0.04 4.6 0.01 0.03 69 ,0.02 0.31 ,0.02 0.88 3.3
5 n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a.
10 5.0 0.12 4.5 9.0 0.08 0.61 ,0.05 0.05 0.12 0.11 0.12 0.79 0.04 4.9 0.01 0.02 81 ,0.02 0.30 ,0.02 0.40 4.4
15 n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a.
23 12 0.54 4.5 15 ,0.01 1.4 ,0.05 0.06 ,0.05 0.11 0.16 1.0 0.03 5.4 0.01 0.03 100 ,0.02 0.47 ,0.02 1.8 1.5
Rı
`
o Cuarto 0 11 0.25 8.8 6.8 0.08 0.16 0.05 0.08 0.38 0.21 0.77 1.0 0.12 8.1 0.17 0.06 118 ,0.02 0.66 0.02 0.76 5. 1
10 7.4 0.21 7.9 20 0.04 0.55 ,0.05 0.08 0.10 0.15 0.22 2.8 0.06 8.0 0.03 0.02 115 ,0.02 0.44 ,0.02 1.0 3. 1
20 n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a.
30 n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a.
40 11 0.21 7.9 22 0.01 0.56 0.06 0.08 0.10 0.14 0.14 1.4 0.15 8.0 0.02 0.02 115 ,0.02 0.52 ,0.02 1.1 2.8
50 6.1 0.23 9.1 34 0.01 0.75 ,0.05 0.09 0.05 0.15 0.12 1.7 0.04 9.0 0.02 0.02 130 ,0.02 0.50 ,0.02 1.2 4.5
60 8.1 0.38 9.6 91 ,0.01 1.6 ,0.05 0.12 0.10 0.11 0.05 3.1 0.03 10 0.01 0.03 149 ,0.02 0.83 ,0.02 1.6 3.3
67 30 0.45 9.3 108 0.02 1.8 0.06 0.12 1.0 0.08 ,0.05 3.8 0.22 9.9 0.02 0.04 145 ,0.02 1.30 ,0.02 2.2 8.4
Chemical concentrations are in
mgL
21
. n.a.: not analyzed.
doi:10.1371/journal.pone.0102456.t002
Bio-Activity Volcanic Lakes: Hule and Rı
`
o Cuarto (Costa Rica)
PLOS ONE | www.plosone.org 9 July 2014 | Volume 9 | Issue 7 | e102456
Table 3. Chemical composition (mmol L
21
) and total pressure (pTOT; in atm) of dissolved gases (CO
2
,N
2
,CH
4
, Ar, O
2
, Ne, H
2
and He) and d
13
C-CO
2
(expressed as % V-PDB), d
13
C-
CH
4
(expressed as % V-PDB), dD-CH
4
(expressed as % V-SMOW) and R/Ra values of gas samples collected.
lake depth CO
2
N
2
CH
4
Ar O
2
Ne H
2
He pTOT d
13
C-CO
2
d
13
C-CH
4
dD-CH
4
R/Ra He/Ne
Hule 0 n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a.
5 29 520 n.d. 13 160 0.006 0.007 n.d. 0.88 n.a. n.a. n.a. n.a. n.d.
10 191 537 1.7 12 n.d. 0.005 0.005 0.005 0.79 n.a. n.a. n.a. n.a. 1.0
15 257 552 66 13 n.d. 0.006 0.01 0.008 0.85 n.a. n.a. n.a. n.a. 1.4
23 1090 618 232 15 n.d. 0.008 0.01 0.03 1.1 216.2 262.5 2159 0.95 4.1
Rı
`
o Cuarto 0 n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a.
10 239 528 73 12 0.33 0.006 0.01 n.d. 0.87 n.a. n.a. n.a. n.a. n.d.
20 357 524 206 13 n.d. 0.007 0.02 n.d. 0.96 214.3 260.7 2233 n.a. n.d.
30 751 559 546 13 n.d. 0.007 0.02 0.31 1.3 214.2 261.9 2239 n.a. 45
40 1045 576 746 14 n.d. 0.007 0.02 0.05 1.4 213.9 263.8 2241 n.a. 7.6
50 1450 522 1080 13 n.d. 0.007 0.03 0.09 1.6 211.6 272.3 2250 1.15 13
60 2090 538 2435 13 n.d. 0.006 0.05 0.25 2.6 26.5 274.8 2248 n.a. 39
67 1790 532 2830 13 n.d. 0.007 0.04 0.34 2.9 26.6 277.2 2251 1.09 49
Dissolved gas concentrations are in
mmol L
21
. n.a.: not analyzed; n.d.: not detected.
doi:10.1371/journal.pone.0102456.t003
Bio-Activity Volcanic Lakes: Hule and Rı
`
o Cuarto (Costa Rica)
PLOS ONE | www.plosone.org 10 July 2014 | Volume 9 | Issue 7 | e102456
4.3 Chemical and isotopic composition of dissolved gases
Molecular nitrogen was the most abundant dissolved gas in the
shallow portion of the two lakes (down to the depths of 215 m and
220 m at Lake Hule and Lake Rı
´
o Cuarto, respectively; Tab. 3).
At lower depths CO
2
dominated the gas composition (up to 1090
and 2090
mmol L
21
at Lake Hule and Lake Rı
´
o Cuarto,
respectively), except at the bottom of Lake Rı
´
o Cuarto (Fig. 6a–
b) where CH
4
concentrations up to 2830 mmol L
21
were
measured. O
2
is not present below 210 m depth at Hule and
Rı
´
o Cuarto, defining a clear anaerobic zone (Fig. 6a–b). Ar and
Ne did not vary significantly with depth, whereas H
2
and He
concentrations increased with depth in both lakes (up to 0.01 and
0.03
mmol L
21
and to 0.04 and 0.3 mmol L
21
in Hule and Rı
´
o
Cuarto, respectively; Tab. 3). It is noteworthy to point out that He
was an order of magnitude more abundant at Rı
´
o Cuarto than at
Hule. The maximum total pressure (pTOT; Tab. 3) value of
dissolved gases was measured at the bottom of Lake Rı
´
o Cuarto
(2.9 atm), whereas pTOT in Lake Hule ranged from 0.79 to 1.1
atm.
The d
13
C-CO
2
value at the bottom of Lake Hule was 216.2 %
V-PDB (Tab. 3). At Lake Rı
´
o Cuarto, the d
13
C-CO
2
values
showed an increase with depth, ranging from 214.3 at 220 m to
26.5 % V-PDB at the lake bottom. No specific trends were
recognized in the epilimnion (Fig. 7). The d
13
C-CH
4
values,
basically characterized by the same interval (from 277.2 to 260.7
% V-PDB) in both lakes, showed a rapid decrease in the Rı
´
o
Cuarto hypolimnion. The dD-CH
4
values of Lake Rı
´
o Cuarto
were significantly more negative (from 2251 to 2233 % V-
SMOW) when compared to that of Lake Hule bottom (2159 %
V-SMOW; Tab. 3). The R/Ra values, corrected for the presence
of atmospheric helium [61], were 0.95 in Lake Hule (lake bottom)
and 1.15 and 1.09 in Lake Rı
´
o Cuarto (at 250 and 267 m depth,
respectively; Tab. 3).
4.4 Prokaryotic diversity along the water column
Phylogenetic analyses of 16S rRNA DGGE derived sequences
(Fig. 8a–b) allowed to detect 7 phyla within the bacterial
communities and to identify the prevalent taxonomic groups
colonizing the Hule and Rı
´
o Cuarto lakes at different depths
(Tab. 4). Overall, the sequences were related to uncultured
unclassified bacteria previously described in aquatic environments,
mainly represented by freshwater of lacustrine origin.
At Lake Hule a clear shift in taxa distribution was evaluated,
corresponding to the transition at , 10 m depth of the redox
potential from positive to negative. The lake epilimnion was
mainly colonized by aerobic heterotrophic Bacteroidetes and
Betaproteobacteric while deeper anoxic layers (.10 m depth;
Fig. 4d) were inhabited by bacteria belonging to the phylum
Chlorobi, comprising anaerobic photoautotrophic bacteria (Chlor-
obium clathratiforme and Ignavibacterium album). Bacteroidetes
and Betaproteobacteria phyla were also the main components of
the bacterial community in Lake Rı
´
o Cuarto. In this lake the
shallower portion (down to the depth of 40 m) was colonized by
Cyanobacteria affiliated to the genera Synechococcus, Merismope-
dia and Cyanobium. Differently from Lake Hule, the more
uniform composition of the bacterial community in Lake Rı
´
o
Cuarto can be related to the homogeneity of the redox conditions
along the water column, which is negative in all the analyzed
layers except at the lake surface (Fig. 4d).
The results of DGGE analysis were taken into account to select
a sub-set of samples to gain a deeper insight into the microbiome
structure by massive pyrosequencing of bacterial and archaeal 16S
rRNA libraries. This high-throughput analysis was applied to 3
samples for each lake (0, 10, 15 m depth from Lake Hule, named
H0, H10 and H15, and 30, 50, 60 m depth from Lake Rı
´
o
Cuarto, named RC30, RC50 and RC60). Unfortunately, any
archaeal library could not be obtained from sample H0. The
number of final reads varied among the samples, similarly to the
OTU
97
number, nonetheless a significant coverage of bacterial
and archaeal diversity was reached in all the samples (Tab. 5). The
Figure 6. Vertical profiles (in
m
mol L
2
1
)ofCO
2
,N
2
,CH
4
and O
2
in Lake Hule (a) and Lake Rı
´
o Cuarto (b).
doi:10.1371/journal.pone.0102456.g006
Bio-Activity Volcanic Lakes: Hule and Rı
`
o Cuarto (Costa Rica)
PLOS ONE | www.plosone.org 11 July 2014 | Volume 9 | Issue 7 | e102456
number of OTU
97
present in the archaeal communities was
constant along the water column of Lake Rio Cuarto, while in
Lake Hule a significant increase was observed with depth (Tab. 5).
In all the samples, Proteobacteria were the most abundant
bacterial phylum, with the exception of the water samples
collected from Lake Rio Cuarto at 50 and 60 m depths (RC50
and RC60) where Cyanobacteria and Chloroflexi were the
prevalent phyla, respectively (Tab. 6). Cyanobacteria were also
present at high percentage (29.4%) in the oxic surface water
sample in lake Hule (Tab. 6). The phylum Chlorobi was
widespread in both the lakes in all the samples characterized by
negative Eh values, with significant prevalence at 10 and 15 m
depth in Lake Hule (18.5 and 17.6%, respectively). Among
Proteobacteria, the Epsilon-subgroup was a minor community
component in both lakes and Deltaproteobacteria were more
abundant in Rı
´
o Cuarto, especially in the deeper layers (Tab. 6).
Alpha- and Gamma-proteobacteria were differently distributed in
the two lakes. The latter were particularly abundant in shallower
Hule layers (H10 and H15), while the former were present at high
percentages throughout the whole Hule water column (Tab. 6).
The class Betaproteobacteria, mainly represented by the Coma-
monadaceae and Methylophilaceae families, was abundant at all
depths in both the lakes (Tab. 6). In Lake Hule between 12.9 and
22.8% of the bacterial community was represented by sequences
belonging to the ACK-M1 cluster of the order Actinomycetales,
whose presence in lacustrine habitats was previously reported
(Tab. 6) [62]. At the oxic-anoxic interfaces, anaerobic ammonium
oxidation (anammox) was indicated as an autotrophic denitrifica-
tion metabolism co-responsible of nitrogen loss from water
environments [63]. The research of bacterial taxa known to be
responsible of anammox reaction was performed by amplifying
with specific primers the functional gene hzsA, encoding for
hydrazine synthase and recently proposed as an anammox
phylomarker [53]. The PCR amplification showed negative
results, confirming that anammox populations are absent at Hule
and Rio Cuarto lakes.
As far as the archaeal community is concerned, Euryarchaeota
were the most abundant phylum in Lake Rio Cuarto (up to 99%).
Methanomicrobia were the most abundant class within this
phylum, encompassing in particular the orders Methanomicro-
biales and Methanosarcinales (Tab. 7). Lake Hule showed a
different archaeal community, being dominated by Parvarchea
and Micrarchaea, with significant concentrations of Crenarch-
aeota (8.1 and 13.7% at 10 and 15 m depth, respectively), and a
minor percentage of Methanomicrobia and unknown taxa (Tab. 7).
Figure 7. Vertical distribution of d
13
C-CO
2
and d
13
C-CH
4
of Lake Rı
´
o Cuarto. See the text for further details.
doi:10.1371/journal.pone.0102456.g007
Bio-Activity Volcanic Lakes: Hule and Rı
`
o Cuarto (Costa Rica)
PLOS ONE | www.plosone.org 12 July 2014 | Volume 9 | Issue 7 | e102456
Bio-Activity Volcanic Lakes: Hule and Rı
`
o Cuarto (Costa Rica)
PLOS ONE | www.plosone.org 13 July 2014 | Volume 9 | Issue 7 | e102456
Discussion
5.1 Processes controlling the water chemistry
Water isotopes can provide notable information on physical-
chemical processes affecting the chemistry of volcanic lakes, such
as evaporation, water-rock interaction and hydrothermal/meteor-
ic inputs [64]. As shown in Fig. 9, water samples plot near the
Global Meteoric Water Line (GMWL) [65] and the Costa Rica
Surface Water Line [66], indicated that in both lakes the main
water source is meteoric, consistently with their Ca
2+
(Mg
2+
)-
HCO
3
2
composition, which is typical for superficial waters and
shallow aquifers worldwide [67]. Both lakes show a slight D- and
18
O- depletion at increasing depth, likely related to evaporation
affecting epilimnetic waters [64,68,69].
The parallel increases of HCO
3
2
(Fig. 5) and dissolved CO
2
(Fig. 6) along the vertical profiles suggest that the behaviour of
these two chemical species is controlled by the following reactions:
CO
2
zH
2
O?H
2
CO
3
ð2Þ
and
H
2
CO
3
zH
2
O?H
3
O
z
zHCO
3
{
ð3Þ
The observed weak decreases of SO
4
22
and NO
3
2
concentra-
tions (Fig. 5) with depth possibly result from microbial activity
occurring at anaerobic conditions. The lack of free oxygen in the
hypolimnion is favorable for nitrate reduction by microbial
denitrification, a typical process in anoxic water bodies [70–74].
The genus Pseudomonas is known to include denitrifier species
[75] and was retrieved at high abundance in pyrosequencing
libraries in the anoxic layers of Lake Hule, constituting up to 16%
of the total bacterial community (Tab. 6). In the Hule anoxic
layers, 16S rRNA pyrosequencing allowed to detect additional
denitrifying genera like Sulfuricurvum, Opitutus and Geothrix
(Tab. 6). Sulfate reducing bacteria (SRB) of the genus Syntropho-
bacter were retrieved by 16S rRNA pyrosequencing in the deepest
layers of the Rı
´
o Cuarto water column (Tab. 6), and could be
responsible of the weak depletion observed for SO
4
22
(Fig. 5b).
Nevertheless, the relatively low SO
4
22
and NO
3
2
concentrations,
typical of meteoric-sourced lakes, implies that sulfate reduction
and denitrification have a minor impact on the chemistry of the
two lakes. The increase of NH
4
+
concentrations with depth (Fig. 5)
is apparently suggesting direct NH
4
+
production within the
hypolimnion via ammonification processes [76].
The increase of Fe and Mn contents in the deepest water layers
can be attributed to direct production inside the bottom sediments
by minerogenic processes [77–79], although their presence as
solutes is limited by the formation of insoluble Fe- and Mn-
hydroxides. Go¨cke [24] suggested that the high concentration of
Fe in Lake Hule is also caused by the addiction of yellow/
brownish Fe(OH)
3
material through the southern brooklets, which
subsequently precipitates in the hypolimnion and iron is reduced
to the ferrous state, as also supported by the relatively low Eh
values (Fig. 4). Oxidation of hypolimnetic Fe
2+
in the epilimnion
would explain the yellow-reddish color of the shallow water layer
that was occasionally observed in these lakes as a consequence of
water rollover [18,25]. Nevertheless, the red coloration observed
at Lake Hule in February 1991 was likely caused by the presence
of dense purple clumps or masses floating of Merismopedia [18], a
genus belonging to the phylum Cyanobacteria that were observed
by DGGE at 230 and 240 m depth in Lake Rı
´
o Cuarto (Tab. 4).
As shown in the spider-diagrams of Fig. 10, where concentra-
tions of Al, Ba, Cr, Cu, Ni, Rb, Sr, Ti and V at maximum depths
for both lakes are normalized to those measured in basalt rock
samples collected from the young intra-caldera cone at Laguna
Hule (the only one available) [80], water-rock interactions
efficiently mobilized soluble elements such as Ba, Rb and Sr,
whereas Al and Ti were basically retained in the rock matrix. In
particular, Cr and Ni, as well as As and Co, are possibly related to
the dissolution of Mn-and Fe-oxide particles that settled through
the chemocline [78,81,82]. The concentrations of dissolved V are
strongly correlated with those of Fe, similarly to what observed for
Mo and Mn [29,83], likely because they belong to the same
mineralogical paragenesis. For what concerns the other trace
elements, Cu and Zn may be related to dissolution of stable
organic complexes buried in the bottom sediments [29]. Cs, Rb
and B, which are strongly correlated with Li (Tab. 2), can be
considered as conservative elements, likely due to the strong
affinity of alkali ions and boric acid for the aqueous phase [82].
The relatively low Mo concentrations at increasing depth in Lake
Rı
´
o Cuarto (Tab. 2) may be related to its consumption during
microbial nitrate reduction [29].
5.2 Processes governing chemical and isotopic
composition of dissolved gases
5.2.1 Noble gases, N
2
,O
2
, and H
2
. Dissolved gas species in
volcanic lakes basically originate from i) external sources (e.g.
atmosphere, volcanic-hydrothermal fluids) and/or ii) microbial
activity occurring both in lake water and at water-sediment
interface [4,14,28,84,85,86].
Dissolved Ar and Ne in lakes are related to air dissolution
through the lake surface, a process that is mainly controlled by
atmospheric pressure and the water temperature [87]. The inert
noble gases behave inertly in any bio-geochemical process and
thus along the lake water column they are affected by advection
and diffusion. Accordingly, Ar and Ne concentrations in the two
investigated lakes did not show significant variations with depth
(Tab. 3). Conversely, O
2
, which is typically consumed by aerobic
microbial populations for oxidation of organic matter and reduced
ionic species, rapidly decreases with depth, and was virtually
absent at depths $5 and 10 m, in Hule and Rı
´
o Cuarto lakes,
respectively. It is worth noting that the N
2
/Ar ratios were slightly
higher than that of air saturated water (,40), suggesting the
addition of N
2
from an extra-atmospheric source. This hypothesis
is expected to be confirmed by d
15
N values that are presently not
available, although the relatively high N
2
/Ar ratios are apparently
consistent with nitrate depletion with depth and microbial
denitrification in both lakes. Consistently with the N
2
excess, the
distribution of N
2
concentrations in both lakes showed significant
variations with depth (Tab. 3), probably related to N
2
production
and consumption by denitrifiers and nitrogen fixing prokaryotes,
respectively. Microbial N
2
fixation, depending on light [88] and
the presence of bio-available trace metals [89], can be carried out
by heterocyst-forming species in water and in sediment pores [90–
92]. Cyanobacteria were indeed retrieved by both DGGE and
Figure 8. DGGE analysis performed on the bacterial 16S rRNA gene, showing the structure of the bacterial community inhabiting
freshwater samples collected from the Hule and Rı
´
o Cuarto lakes (a); taxonomic identification of bacterial 16S rRNA sequences
excised from DGGE bands cut from the Lake Hule and Rı
´
o Cuarto water profiles (b).
doi:10.1371/journal.pone.0102456.g008
Bio-Activity Volcanic Lakes: Hule and Rı
`
o Cuarto (Costa Rica)
PLOS ONE | www.plosone.org 14 July 2014 | Volume 9 | Issue 7 | e102456
Table 4. Phylogenetic identification of the bacterial sequences retrieved from 16S rRNA DGGE gel.
Sample Phylum Band Closest relative Acc.n
6
% Environments Closest described specie Acc. n
6
%
Hule 0 m Actinobacteria 1 Unc. bact. GU127259 99 Anoxic plant reservoir Planktophila limnetica FJ428831 95
0 m Betaproteobacteria 2 Massilia sp. FJ477729 99 Soil Massilia aerilata EF688526 96
5 m Betaproteobacteria 7 Unc. Betaproteobacterium HM153624 99 Freshwater sample Limnobacter thiooxidans AJ289885 94
5 m Betaproteobacteria 8 Unc. Methylophilaceae bact. HM856563 100 Yellowstone Lake water Methylotenera mobilis CP001672 95
5 m Bacteroidetes 5 Unc. Flexibacter sp. FN668188 98 Lake Zurich water Lishizhenia tianjinensis EU183317 93
5 m Bacteroidetes 3 Unc. bact. EU803667 99 Lake Gatun water Mucilaginibacter daejeonensis AB267717 83
5 m Bacteroidetes 4 Unc. bact. JF295800 97 Soil Pedobacter terricola EF446147 83
5 m Bacteroidetes 6 Unc. bact. HM129930 98 Freshwater Lishizhenia tianjinensis EU183317 92
10 m Bacteria 9 Unc. bact. DQ642387 99 Anoxic freshwater Chlorobium phaeovibrioides Y08105 82
10 m Betaproteobacteria 11 Unc. bact. HQ653799 99 Freshwater Methylotenera mobilis CP001672 95
10 m Betaproteobacteria 10 Unc. Undibacterium sp. GU074344 99 Water sample Undibacterium pigrum AM397630 96
15 m Betaproteobacteria 16 Massilia sp. FJ477729 99 Soil Massilia aerilata EF688526 97
15 m Chlorobi 12 Unc. Chlorobi bact. FJ902335 99 Limestone sinkholes Chlorobium clathratiforme CP001110 96
15 m Chlorobi 13 Unc. Chlorobi bact. FJ902335 99 Limestone sinkholes Chlorobium clathratiforme CP001110 96
15 m Chlorobi 14 Unc. bact. HM228636 99 Riverine alluvial aquifers Ignavibacterium album AB478415 88
15 m Chlorobi 15 Unc. bact. HM228636 98 Riverine alluvial aquifers Ignavibacterium album AB478415 88
23 m Chlorobi 17 Unc. bact. HM228636 92 Riverine alluvial aquifers Ignavibacterium album AB478415 86
Rı
`
o Cuarto 0 m Betaproteobacteria 19 Unc. Proteobacterium GU074082 99 Freshwater Burkholderia andropogonis AB021422 95
0 m Cyanobacteria 18 Unc. bact. GQ091396 99 Freshwater Synechococcus rubescens AF317076 98
10 m Betaproteobacteria 21 Unc. bact. DQ060410 98 Soil enrichment culture Methylovorus glucosotrophus FR733702 95
10 m Betaproteobacteria 22 Unc. bact. GU291353 98 Tropical lakes Sulfuritalea hydrogenivorans AB552842 94
10 m Bacteroidetes 20 Unc. bact. AM409988 98 Profundal lake sediments Owenweeksia hongkongensis AB125062 88
10 m Bacteria 23 Unc. Chloroflexi bact. AB116427 93 Coastal marine sediment Ignavibacterium album AB478415 82
30 m Cyanobacteria 24 Unc. Cyanobacterium FJ844093 99 High mountain lake Merismopedia tenuissima AJ639891 97
30 m Bacteroidetes 25 Unc. bact. FJ437920 97 Green Lake water Owenweeksia hongkongensis AB125062 88
40 m Bacteroidetes 29 Unc. bact. AM409988 98 Profundal lake sediment Solitalea koreensis EU787448 88
40 m Cyanobacteria 26 Unc. bact. HQ653660 97 Shallow freshwater lake Cyanobium gracile AF001477 96
40 m Cyanobacteria 27 Unc. bact. GU305729 99 Oligotrophic lakes Cyanobium gracile AF001477 98
40 m Cyanobacteria 28 Unc. bact. FJ262922 99 Freshwater Merismopedia tenuissima AJ639891 97
40 m Deltaproteobacteria 31 Unc. bact. EF515611 97 Anaerobic bioreactor sludge Syntrophobacter pfennigii X82875 94
40 m Bacteria 33 Unc. Chloroflexi bact. AB116427 93 Coastal marine sediment Ignavibacterium album AB478415 83
40 m Bacteria 32 Unc. Chlorobi bact. GQ390242 98 Low-sulphate lake Ignavibacterium album AB478415 82
40 m Bacteroidetes 30 Unc. Haliscomenobacter sp. HM208523 99 sediment resuspension Candidatus Aquirestis calciphila
AJ786341 99
50 m Betaproteobacteria 37 Unc. bact. GU291353 98 Tropical lakes Sulfuritalea hydrogenivorans AB552842 95
50 m Bacteroidetes 34 Unc. bact. AM409988 98 Profundal lake sediment Owenweeksia hongkongensis AB125062 88
50 m Bacteroidetes 36 Unc. bact. FJ612364 99 Dongping Lake Ecosystems Sphingobacterium alimentarium FN908502 88
Bio-Activity Volcanic Lakes: Hule and Rı
`
o Cuarto (Costa Rica)
PLOS ONE | www.plosone.org 15 July 2014 | Volume 9 | Issue 7 | e102456
pyrosequencing in surface layers of Rı
´
o Cuarto and Hule lakes
(where they constitute 26% of the total bacterial community in the
oxic layer H0, Tab. 6), supporting the occurrence of N
2
fixation in
both the lakes.
H
2
increase with depth in the hypolimnion at Hule and Rı
´
o
Cuarto (Tab. 3) suggests a production of H
2
likely related to
fermentation of organic matter under anaerobic conditions at the
water-sediment interface. Additionally, photoreactions carried out
by Cyanobacteria , abundantly present in the Rı
´
o Cuarto deep
layers and in the upper layer of the Hule water columns (Tab. 6),
could be responsible of H
2
production [93–97]. Once produced at
the lake bottom, H
2
can be consumed acting as electron donor for
hydrogenotrophic methanogenic archaea and SRB [98–100],
detected in Rı
´
o Cuarto pyrosequencing libraries. Moreover, it
slowly diffuses up to shallower, oxygenated layers where it can be
consumed by hydrogen-oxidizing bacteria [101–104].
The presence of an extra-atmospheric source for helium can be
recognized on the basis of the R/Ra values (Tab. 3), which are
relatively high (up to 20 or more) for mantle gases, and as low as
0.01 in fluids from crustal sources [61]. Dissolved gas samples from
Hule and Rı
´
o Cuarto lakes showed R/Ra values ,1 that, coupled
with the relatively high He/Ne ratios (49 and 4.1 at Lake Rio
Cuarto and Lake Hule, respectively), indicate a significant fraction
of mantle He, whose uprising is likely favored by the fault system
characterizing this area [18].
5.2.2 CO
2
and CH
4
. CO
2
and CH
4
are the most abundant
extra-atmospheric dissolved gases present in Hule and Rı
´
o Cuarto
lakes. As already mentioned, dissolved CO
2
controls pH values
and HCO
3
2
concentrations. Previous studies [17,18,20,22,23]
have hypothesized that these lakes are affected by CO
2
inputs
through the bottom, as supported by the presence of CO
2
-rich
bubbling pools and caverns or boreholes with high CO
2
concentrations characterizing this area [18,105]. A significant
contribution of mantle CO
2
is indicated by the d
13
C-CO
2
value of
the dissolved gas sample collected at the maximum depth of Lake
Rı
´
o Cuarto (26.6 % vs. V-PDB; Tab. 3), which is in the range of
mantle gases (from 28to24 % vs. V-PDB) [106]. Although not
confirmed by the d
13
C-CO
2
values, the CO
2
/CH
4
ratio measured
in the dissolved gas at the bottom of Lake Hule (4.7) is too high,
even higher than that of Rı
´
o Cuarto bottom sample (0.63), to be
ascribable to microbiological processes. This would imply that
even at Lake Hule a strongly negative isotopic signature of CO
2
is
externally added to the bottom waters, possibly from a CO
2
-rich
source deriving from oxidation of previously produced hydrocar-
bons.
The d
13
C-CO
2
values at the bottom of Lake Hule (216.2 % vs.
V-PDB) and at depths between 220 and 250 m in Lake Rı
´
o
Cuarto (as low as 214.3 % vs. V-PDB; Tab. 3) were intermediate
between those generated by organic matter degradation [24] and
mantle degassing [107–109], indicating that along the vertical
profiles of both lakes, excluding the bottom layers, biogenic
processes are the most important sources of CO
2
.
According to the classification proposed by Whiticar [110], the
d
13
C-CH
4
and dD-CH
4
values of the Hule and Rı
´
o Cuarto lakes
indicate that CH
4
has a biogenic origin (Fig. 11). The vertical
profiles of the concentrations and d
13
C values of CO
2
and CH
4
of
Lake Rı
´
o Cuarto (Fig. 7) were thus produced by the combination
of different processes occurring at various depths in the lake:
1) At the bottom of the lake, CO
2
inputs from a deep source
likely related to the hydrothermal fluid circulation [18,111]
promote methanogenic processes that have their maximum
efficiency within the sediments. Methanogenesis takes place
through i) CO
2
reduction and ii) degradation of organic
Table 4. Cont.
Sample Phylum Band Closest relative Acc.n
6
% Environments Closest described specie Acc. n
6
%
50 m Bacteroidetes 35 Unc. bact. FJ612364 99 Dongping Lake Ecosystems Sphingobacterium alimentarium FN908502 88
60 m Chloroflexi 38 Unc. bact. JF305756 97 Mature fine tailings Dehalogenimonas
lykanthroporepellens
CP002084 86
60 m Bacteria 39 Unc. bact. GQ860063 99 PCB-Spiked sediments Dehalogenimonas
lykanthroporepellens
CP002084 85
60 m Bacteroidetes 40 Unc. bact. FM956124 98 Rice field soil Owenweeksia hongkongensis AB125062 87
60 m Bacteroidetes 41 Unc. bact. FJ437920 97 Freshwater Owenweeksia hongkongensis AB125062 88
67 m Betaproteobacteria 42 Unc. bact. DQ060410 98 Soil enrichment culture Methylovorus glucosotrophus FR733702 95
The table reports the identification of the dominant bands in the PCR-DGGE fingerprinting profiles marked in Fig. 8. %: percent of identity between the DGGE band sequence and closest relative sequence in GenBank. Acc. Nu.
Accession number of the closest relative sequence in Genebank. Environment: environment of origin of the closest relative sequence.
doi:10.1371/journal.pone.0102456.t004
Bio-Activity Volcanic Lakes: Hule and Rı
`
o Cuarto (Costa Rica)
PLOS ONE | www.plosone.org 16 July 2014 | Volume 9 | Issue 7 | e102456
matter through acetate fermentation [47,110,112–115].
These processes can be described by the following reactions:
CO
2
z8H
z
z8e
{
?CH
4
zH
2
O ð4Þ
and
CH
3
COOH? CH
4
zCO
2
ð5Þ
where the * indicates the intact transfer of the methyl position
to CH4.
2) In the hypolimnion, microbial CH
4
production is still active,
although this process is accompanied by CO
2
dissolution,
CH
4
oxidation, and vertical diffusion of both the gas species.
Moreover, in correspondence of aerobic/anaerobic boundar-
ies, anaerobic decomposition of organic matter [116–118],
and CH
4
oxidation carried out by methanotrophic bacteria
can efficiently produce CO
2
in lakes [86,119–121].
3) In the epilimnion, photosynthetic microorganisms (e.g.
Cyanobacteria) convert light into biochemical energy through
oxygenic photochemical reactions combined with CO
2
assimilative reduction. Vertical water circulation favors the
activity of photosynthetic and methanotrophic bacterial
populations, as well as the continuous addition of atmospheric
gases from the lake surface..
These hypotheses were confirmed by the 16S rRNA pyrose-
quencing of samples collected along the water column of Lake Rio
Cuarto, demonstrating that archaeal communities encompass
almost exclusively methanogenic populations (Tab. 7) typical of
freshwater ecosystems, namely Methanomicrobiales and Methano-
sarcinales [122–124], as also observed in freshwater meromictic
lake sediments [125]. Methanosarcinales included solely the
acetate-utilizing methanogen Methanosaeta, the most abundant
archaeal genus along the Rı
´
o Cuarto water column. Within the
H
2
-CO
2
utilizing methanogens of the order Methanomicrobiales,
Methanoregula was the prevalent genus, but unclassified Metha-
nomicrobiales and Methanoregulaceae sequences were also detect-
ed (Tab. 7).
The lack of isotopic data along the vertical profile of Lake Hule
did not allow to investigate in detail the (bio)-geochemical
processes controlling the vertical profiles of CO
2
and CH
4
.In
this lake the majority of the archaeal 16S rRNA sequences were
affiliated within unclassified Euryarchaeota, showing high similar-
ity with the Candidate divisions Micrarchaea and Parvarchaea
(Tab. 7) previously described by metagenomics studies of an acidic
ecosystem by Baker et al. [126,127]. These archaeal sequences
belong to the ARMAN (Archaeal Richmond Mine Acidophilic
Nanoorganisms) lineages, which are among the smallest cellular
life forms known [126], still poorly described from an ecological
perspective. The presence of novel uncultivated lineages in the
Lake Hule water is linked to neither specific metabolism nor the
influence on the water and dissolved gas chemistry. However,
besides a minor fraction of known acetotrophic methanogenic
Methanosarcinales (Tab. 7), the archaeal community of Lake Hule
included also the Miscellaneous Crenarchaeota Group (MCG),
within the phylum Crenarchaeota (Tab. 7). MCG is a cosmopol-
itan clade that was previously detected in both freshwater [128]
and marine ecosystems [129], where it had been hypothesized to
have a significant role in dissimilatory methane oxidation [129].
This hypothesis leads to the speculation that MCG could have the
same ecological function also in the Lake Hule. It is worth noting
that the minor percentage of known methanogenic archaea in
Lake Hule compared to that of Lake Rı
´
o Cuarto corresponds to
the differences between the lakes in CH
4
concentrations (Tab. 3).
16S rRNA pyrosequencing of bacterial communities showed
that type I and type II methanotrophic bacteria, belonging to the
Gamma- (i.e. Methylocaldum, Methylomonas, Crenothrix) and
Alpha-subgroup of proteobacteria (i.e. Methylocystaceae)
[125,130], respectively, were abundant in the anoxic layers of
Hule and Rı
´
o Cuarto (Tab. 6), suggesting a key role in the carbon
cycle. Within the Beta-proteobacteria, additional families that
encompass methylotrophic bacteria, namely Methylophilaceae,
Rhodocyclaceae, and Comamonadaceae [131,132], were retrieved
by deep sequencing in the same water layers both in Lake Hule
and Lake Rı
´
o Cuarto, the latter hosting up to 36% of
Methylophilaceae at 30 m depth (Tab. 6). Within the family
Comamonadaceae, relevant in Lake Hule, 5.2% of the bacterial
sequences from the surface layer were affiliated to the genus
Limnohabitans, which was reported to play a functional key role in
freshwater habitats and showing high ecological diversification
[133]. Moreover, 6.3% of the bacterial sequences were affiliated to
the genus Rubrivivax that includes, among the few characterized
Table 5. Library coverage estimations and sequence diversity of 16S rRNA.
Sample N. reads/sample N. OTU
97
% Coverage* Shannon index**
H0 Bacteria 9384 586 0.98 4.21
H10 Bacteria 11115 615 0.98 4.21
H15 Bacteria 15872 1260 0.97 4.98
RC30 Bacteria 32932 3017 0.95 4.60
RC50 Bacteria 13291 1609 0.94 4.37
RC60 Bacteria 13530 1882 0.93 5.08
H10 Archaea 1405 68 0.99 2.76
H15 Archaea 5889 289 0.98 2.08
RC30 Archaea 2429 177 0.96 2.66
RC50 Archaea 2005 172 0.95 2.81
RC60 Archaea 2937 178 0.97 2.34
*Library coverage was calculated as C = 1-n/N, where n is the number of OTU
97
without a replicate, and N is the total number of sequences.
**Shannon diversity index calculated using PAST.
doi:10.1371/journal.pone.0102456.t005
Bio-Activity Volcanic Lakes: Hule and Rı
`
o Cuarto (Costa Rica)
PLOS ONE | www.plosone.org 17 July 2014 | Volume 9 | Issue 7 | e102456
Table 6. List of the taxonomic groups, identified according to the results of the 16S rRNA pyrosequencing, composing the bacterial communities in the freshwater samples
collected along the depth profiles of the Hule and Rı
´
o Cuarto lakes.
PHYLUM/CLASS ORDER FAMILY GENUS H0 H10 H15 RC30 RC50 RC60
Other Other Other Unknown seq 0.41 0.00 0.21 3.81 6.09 1.12
Other Other Other Uncl. Bacteria 0.00 0.14 0.87 0.43 0.15 0.50
Acidobacteria Uncl. Acidobacteria Uncl. Acidobacteria Uncl. Acidobacteria 0.00 0.13 1.15 0.00 0.00 0.00
Acidobacteria Holophagales Holophagaceae Geothrix 0.00 2.79 3.87 0.00 0.00 0.00
Actinobacteria Acidimicrobiales Uncl. Acidimicrobiales Uncl. Acidimicrobiales 0.25 0.08 0.33 3.55 0.78 0.71
Actinobacteria Actinomycetales ACK-M1 Uncl. ACK-M1 22.77 12.90 15.06 2.86 3.20 0.91
Actinobacteria Actinomycetales Microbacteriaceae Candidatus Aquiluna 0.00 0.00 0.00 0.23 0.55 0.04
Actinobacteria Uncl. Actinobacteria Uncl. Actinobacteria Uncl. Actinobacteria 0.00 0.00 0.01 0.21 0.01 1.15
Bacteroidetes Uncl. Bacteroidetes Uncl. Bacteroidetes Uncl. Bacteroidetes 0.00 0.04 0.00 3.78 1.89 4.29
Bacteroidetes Flavobacteriales Cryomorphaceae Uncl. Cryomorphaceae 3.32 0.00 0.00 0.00 0.00 0.00
Bacteroidetes Flavobacteriales Flavobacteriaceae Flavobacterium 0.03 0.00 0.00 0.37 0.05 0.82
Bacteroidetes Sphingobacteriales Uncl. Sphingobacteriales Uncl. Sphingobacteriales 0.00 0.00 0.00 2.19 11.55 0.22
Bacteroidetes Sphingobacteriales Chitinophagaceae Uncl. Chitinophagaceae 2.29 0.42 0.24 0.00 0.00 0.00
Chlorobi Chlorobiales Chlorobiaceae Uncl. Chlorobiaceae 0.00 14.40 10.96 0.12 0.08 0.11
Chlorobi Ignavibacteriales Other Uncl. Ignavibacteriales 0.00 1.39 4.53 0.32 0.72 0.11
Chlorobi Uncl. Chlorobi Uncl. Chlorobi Uncl. Chlorobi 0.00 2.77 2.11 6.71 3.57 5.83
Chloroflexi Uncl. Anaerolineae Uncl. Anaerolineae Uncl. Anaerolineae 0.00 0.05 4.85 1.36 0.38 1.55
Chloroflexi Uncl. Dehalococcoidetes Uncl. Dehalococcoidetes Uncl. Dehalococcoidetes 0.00 0.01 1.00 4.24 1.20 39.52
Cyanobacteria Uncl. Cyanobacteria Uncl. Cyanobacteria Uncl. Cyanobacteria 0.01 0.00 0.01 1.01 2.89 0.07
Cyanobacteria Synechococcales Synechococcaceae Prochlorococcus 29.4 2.56 1.45 17.19 40.20 1.47
OP3 Uncl. OP3 Uncl. OP3 Uncl. OP3 0.00 0.00 0.00 0.27 0.09 0.56
OP8 Uncl. OP8 Uncl. OP8 Uncl. OP8 0.00 0.00 0.00 0.05 0.00 1.20
Planctomycetes Uncl. Phycisphaerae Uncl. Phycisphaerae Uncl. Phycisphaerae 0.00 0.00 0.00 0.36 0.15 0.14
Planctomycetes Gemmatales Gemmataceae Uncl. Gemmataceae 0.16 0.06 0.67 0.65 0.76 0.87
Planctomycetes Pirellulales Pirellulaceae Uncl. Pirellulaceae 0.57 0.39 0.72 2.06 1.03 3.39
Alphaproteobacteria Rhizobiales Methylocystaceae Methylosinus 0.07 0.12 0.47 0.49 0.14 0.09
Alphaproteobacteria Rhodospirillales Rhodospirillaceae Uncl. Rhodospirillaceae 0.04 0.97 1.14 0.08 0.04 0.01
Alphaproteobacteria Rickettsiales Uncl. Rickettsiales Uncl. Rickettsiales 18.31 6.95 14.40 0.30 0.29 0.09
Betaproteobacteria Uncl. Betaproteobacteria Uncl. Betaproteobacteria Uncl. Betaproteobacteria 0.00 0.00 0.00 0.58 0.23 0.36
Betaproteobacteria Burkholderiales Burkholderiaceae Uncl. Burkholderiaceae 0.73 0.08 0.04 0.16 0.26 0.00
Betaproteobacteria Burkholderiales Comamonadaceae Uncl. Comamonadaceae 3.22 0.29 0.44 0.02 0.02 0.00
Betaproteobacteria Burkholderiales Comamonadaceae Limnohabitans 5.18 0.51 0.33 0.00 0.00 0.00
Betaproteobacteria Burkholderiales Comamonadaceae Rhodoferax 4.59 0.12 0.24 0.00 0.00 0.00
Betaproteobacteria Burkholderiales Comamonadaceae Rubrivivax 0.03 6.26 1.22 0.02 0.03 0.00
Bio-Activity Volcanic Lakes: Hule and Rı
`
o Cuarto (Costa Rica)
PLOS ONE | www.plosone.org 18 July 2014 | Volume 9 | Issue 7 | e102456
Table 6. Cont.
PHYLUM/CLASS ORDER FAMILY GENUS H0 H10 H15 RC30 RC50 RC60
Betaproteobacteria Burkholderiales Oxalobacteraceae Uncl. Oxalobacteraceae 2.52 0.94 0.86 0.01 0.00 0.00
Betaproteobacteria Burkholderiales Oxalobacteraceae Polynucleobacter 0.67 0.25 0.14 0.07 0.15 0.00
Betaproteobacteria Methylophilales Uncl. Methylophilales Uncl. Methylophilales 0.70 1.01 0.32 0.00 0.00 0.00
Betaproteobacteria Methylophilales Methylophilaceae Uncl. Methylophilaceae 0.03 4.21 2.72 35.99 11.75 20.57
Betaproteobacteria Rhodocyclales Rhodocyclaceae Uncl. Rhodocyclaceae 0.00 1.05 0.36 0.91 2.13 0.09
Deltaproteobacteria Desulfuromonadales Geobacteraceae Geobacter 0.00 0.00 0.01 0.24 0.04 0.66
Deltaproteobacteria Myxococcales Uncl. Myxococcales Uncl. Myxococcales 0.00 0.00 0.98 0.07 0.03 0.06
Deltaproteobacteria Spirobacillales Uncl. Spirobacillales Uncl. Spirobacillales 0.10 0.01 0.04 1.65 3.55 0.67
Deltaproteobacteria Syntrophobacterales Syntrophobacteraceae Syntrophobacter 0.00 0.00 0.00 0.96 0.62 6.96
Epsilonproteobacteria Campylobacterales Helicobacteraceae Sulfuricurvum 0.00 0.00 1.86 1.15 1.91 0.07
Gammaproteobacteria Uncl. Gammaproteobacteria Uncl. Gammaproteobacteria Uncl. Gammaproteobacteria 0.00 0.00 0.00 0.44 1.72 0.10
Gammaproteobacteria Enterobacteriales Enterobacteriaceae Uncl. Enterobacteriaceae 0.17 0.64 0.05 0.11 0.00 0.02
Gammaproteobacteria Legionellales Legionellaceae Uncl. Legionellaceae 0.00 0.05 0.02 0.45 0.07 0.05
Gammaproteobacteria Methylococcales Crenotrichaceae Crenothrix 0.00 17.25 3.37 0.00 0.00 0.00
Gammaproteobacteria Methylococcales Methylococcaceae Methylocaldum 0.07 1.24 2.76 2.31 0.67 4.38
Gammaproteobacteria Methylococcales Methylococcaceae Methylomonas 0.01 0.24 1.12 0.00 0.00 0.00
Gammaproteobacteria Pseudomonadales Pseudomonadaceae Pseudomonas 0.01 16.31 16.47 0.00 0.02 0.02
Gammaproteobacteria Xanthomonadales Sinobacteraceae Uncl. Sinobacteraceae 0.83 0.39 0.02 0.02 0.03 0.01
Verrucomicrobia Opitutales Opitutaceae Opitutus 0.89 2.09 2.50 0.00 0.01 0.00
Verrucomicrobia Uncl. Opitutae Uncl. Opitutae Uncl. Opitutae 2.61 0.89 0.06 0.00 0.04 0.00
Verrucomicrobia Uncl. Verrucomicrobia Uncl. Verrucomicrobia Uncl. Verrucomicrobia 0.00 0.00 0.03 1.52 0.72 0.69
WS3 Uncl. WS3 Uncl. WS3 Uncl. WS3 0.00 0.00 0.00 0.64 0.22 0.47
Uncl: unclassified. Results are expressed as % of the sequences.
doi:10.1371/journal.pone.0102456.t006
Bio-Activity Volcanic Lakes: Hule and Rı
`
o Cuarto (Costa Rica)
PLOS ONE | www.plosone.org 19 July 2014 | Volume 9 | Issue 7 | e102456
species, strains able to oxidize carbon monoxide producing carbon
dioxide and hydrogen [134]. The presence of the genus
Syntrophobacter at 60 m depth in Rı
´
o Cuarto (RC60) is in
agreement with the establishment in deep anoxic layers of
syntrophic relations between organic acid degrading bacteria
and methanogenic archaea. Members of this genus were
commonly detected in anaerobic mixed cultures, where they
obtain energy from the anaerobic oxidation of acetate, growing
syntrophically with hydrogen- and formate-utilizing methanogenic
archaea [135]. The RC60 sample showed a high percentage of
sequences affiliated to the order Dehalococcoidetes (Tab. 6), which
comprises obligate organohalide respirers, widely detected in
marine and freshwater ecosystems [136,137]. The presence of
organohalide compounds favors the competition with methano-
gens for the use of molecular hydrogen [138]. Hence the finding of
Dehalococcoidetes in the deeper layers of Lake Rı
´
o Cuarto,
retrieved by both pyrosequencing (RC50) and DGGE (RC60),
suggest the presence of naturally occurring organo-halogens in the
water that could serve as electron acceptors for organohalide-
respiring bacteria.
Further confirmation of the importance of anaerobic microbial
processes on the CO
2
-CH
4
balance can be obtained by comparing
measured d
13
C
TDIC
values with those expected assuming isotopic
equilibrium between CO
2
and HCO
3
2
. Isotopic fractionation
caused by the reaction between dissolved CO
2
and HCO
3
2
is
quantified by the enrichment factor (e
2
), as follows [139]:
e
2
~d
13
C{HCO
3
{
{d
13
C{CO
2
~9483=TKðÞ{23:9 ð6Þ
Theoretical d
13
C
TDIC
values (d
13
C
TDICcalc
) can be computed
by:
d
13
C
TDICcalc
~
d
13
C{CO
2
ze
2
| HCO
{
3
= HCO
{
3
z CO
2
ðÞ
ð7Þ
As shown in Fig. 12, water samples from the shallower strata
(down to 40 m depth) of Lake Rı
´
o Cuarto displayed d
13
C
TDIC
and
d
13
C
TDICcalc
values basically consistent. On the contrary, samples
from depth .40 m showed a strong difference between the two
sets of values: at 250 m depth, d
13
C
TDICcalc
were more negative
than d
13
C
TDIC
, whereas an opposite behavior was observed in the
deeper water layer, as well as at the maximum depth of Lake Hule
(Tab. 1). At the lake bottoms, continuous inputs of hydrothermal
CO
2
, characterized by d
13
C-CO
2
values significantly less negative
with respect to that already present in the lake, are likely
responsible of the positive shift of the d
13
C
TDICcalc
values, since
this external CO
2
was not in equilibrium with HCO
3
2
. In the
shallower layers, especially at the depth of 260 m, addition of
non-equilibrated biogenic CO
2
played an opposite role (Fig. 12),
whereas at depth #40 m CO
2
concentrations were too low to
significantly affect the d
13
C
TDICcalc
values, which were consistent
with the d
13
C
TDIC
ones. The disagreement between measured and
calculated d
13
C
TDIC
values, depending on both microbial activity
and inputs of hydrothermal CO
2
, was documented in other
meromictic lakes hosted in volcanic environments, such as Lake
Kivu, D.R.C. [34] and the Italian lakes of Albano, Averno and
Monticchio [86].
Although the multidisciplinary approach applied in the present
study allowed to link the presence of different prokaryotic
taxonomic groups to the observed physical conditions and the
concentrations of chemical species along the water columns, the
Table 7. List of the taxonomic groups, identified according to the results if the 16S rRNA pyrosequencing, composing the archaeal communities in the freshwater samples
collected along the depth profiles of the Hule and Rı
´
o Cuarto lakes.
PHYLUM CLASS ORDER FAMILY GENUS H10 H15 RC30 RC50 RC60
Unknown seq. Unknown seq. Unknown seq. Unknown seq. Unknown seq. 2.30 0.00 0.00 0.00 0.00
Uncl. Archaea Uncl. Archaea Uncl. Archaea Uncl. Archaea Uncl. Archaea 0.00 0.00 0.56 0.34 0.00
Crenarchaeota MCG Uncl. MCG Uncl. MCG Uncl. MCG 1.63 0.76 0.10 0.68 0.80
Crenarchaeota MCG pGrfC26 Uncl. pGrfC27 Uncl. pGrfC27 6.51 12.94 0.29 0.24 0.04
Euryarchaeota Uncl. Euryarchaeota Uncl. Euryarchaeota Uncl. Euryarchaeota Uncl. Euryarchaeota 0.95 0.30 0.00 0.00 0.00
Euryarchaeota Methanomicrobia Uncl. Methanomicrobia Uncl. Methanomicrobia Uncl. Methanomicrobia 0.00 0.00 0.10 0.43 0.18
Euryarchaeota Methanomicrobia Methanomicrobiales Methanoregulaceae Uncl. Methanoregulaceae 0.50 0.32 0.62 1.21 0.55
Euryarchaeota Methanomicrobia Methanomicrobiales Methanoregulaceae Methanoregula 4.04 5.52 20.39 39.39 7.73
Euryarchaeota Methanomicrobia Methanosarcinales Methanosaetaceae Methanosaeta 1.01 0.92 46.67 39.59 86.48
Euryarchaeota Cand. Micrarchaea Cand. Micrarchaeles Uncl. Micrarchaeles Uncl. Micrarchaeles 25.01 73.09 29.84 14.32 3.72
Euryarchaeota Cand. Parvarchaea Cand. WCHD3-30 Uncl. WCHD3-30 Uncl. WCHD3-30 30.57 5.09 0.49 2.12 0.15
Euryarchaeota Cand. Parvarchaea Cand. YLA114 Uncl. YLA114 Uncl. YLA114 27.48 1.05 0.95 1.69 0.36
Uncl: unclassified. Cand: Candidatus. Results are expressed in % with respect to the total archaeal community.
doi:10.1371/journal.pone.0102456.t007
Bio-Activity Volcanic Lakes: Hule and Rı
`
o Cuarto (Costa Rica)
PLOS ONE | www.plosone.org 20 July 2014 | Volume 9 | Issue 7 | e102456
Figure 9. d
18
O–dD diagram for the water samples from Lake Hule (blue squares) and Lake Rı
´
oCuarto(redsquares).See the text for details.
doi:10.1371/journal.pone.0102456.g009
Figure 10. Spider-diagrams, where concentrations of selected trace elements in Lake Hule (a) and Lake Rı
´
o Cuarto (b) maximum
depths are normalized to those measured in basalt rock samples collected from the young intra-caldera cone at Laguna Hule [80].
doi:10.1371/journal.pone.0102456.g010
Bio-Activity Volcanic Lakes: Hule and Rı
`
o Cuarto (Costa Rica)
PLOS ONE | www.plosone.org 21 July 2014 | Volume 9 | Issue 7 | e102456
ecological function of certain prokaryotes in these intriguing
ecosystems, particularly in the case of Lake Hule, remains cryptic.
In particular, among the bacterial community, Lake Hule hosted
the Actinomycetales ACK-M1 cluster [140], whose phenotypic
and metabolic traits have not yet been described. The ACK-M1
cluster was one of the most abundant bacterial taxonomic groups
in Lake Hule, reaching up to 22.8% in the oxic water layer H0
(Tab. 6). Moreover, in the Lake Hule waters, the Alphaproteo-
bacterial order Rickettsiales showed relatively high concentrations
(18.3% of the total bacterial community in the oxic layer H0;
Tab. 6). This order comprises intracellular organisms, pinpointing
the importance of symbiotic relationships in these lakes. In this
context, the impact of the associations between bacteria and algae
[141] or phytoplancton [142] on nutrients re-mineralization was
recently discussed showing the crucial role of trophic levels
interaction on the food web of lacustrine habitats, possibly relevant
also in volcanic lakes.
Conclusions
Hule and Rı
´
o Cuarto are meromictic maar lakes mainly fed by
meteoric water, and characterized by significant amounts of
dissolved gases, partially consisting of CO
2
having a hydrothermal-
magmatic origin, in their hypolimnion. They are currently
classified as low activity or, alternatively, ‘‘Nyos-type’’ lakes [4],
implying that a limnic eruption could be expected to occur from
these lakes, as confirmed by the rollover events they have
experienced. However, gases stored in the deep layers of Hule
and Rı
´
o Cuarto are fundamentally different with respect to those
of Nyos and Monoun lakes, a difference that must be considered
for evaluating the eruption risk. The gas reservoirs of the two
Figure 11. d
13
C-CH
4
vs. dD-CH
4
plot (modified after Whiticar [110]) of Lake Hule (blue square) and Lake Rı
´
o Cuarto (red squares).
See the text for further details.
doi:10.1371/journal.pone.0102456.g011
Bio-Activity Volcanic Lakes: Hule and Rı
`
o Cuarto (Costa Rica)
PLOS ONE | www.plosone.org 22 July 2014 | Volume 9 | Issue 7 | e102456
Cameroonian killer lakes are composed of almost pure CO
2
and
basically their temporal evolution only depends on a high
magmatic gas input rate [12,13]. At Nyos, the risk of gas bursts
was successfully mitigated artificially by discharging the deep-
seated gases at the lake surface [35,143]. On the contrary, the gas
reservoirs of Hule and Rı
´
o Cuarto lakes consist of CO
2
,CH
4
and
N
2
in comparable amounts, mainly controlled by the activity of a
microbial network governed by CO
2
and CH
4
metabolism, thus
the possible occurrence of a lake rollover that may pose a local risk
is not directly related to the input rate of external CO
2
.
Despite geographic separation, Lake Rı
´
o Cuarto and Lake Hule
showed similar physical-chemical settings, though hosting phylo-
genetically distinct bacterial and archaeal communities. Phyloge-
netic difference apart, however, both lakes have revealed the
presence of the same prokaryotic ecological functions deeply
involved in affecting water and gas chemistry.
On the whole, Lake Hule and Lake Rio Cuarto host a
CO
2
(CH
4
,N
2
)-rich gas reservoir which is mainly controlled by the
complex and delicate interactions occurring between geosphere
and biosphere and whose monitoring can appropriately be carried
out by coupling the conventional geochemical approach with
studies about prokaryotic colonization. Consequently, for these
lakes we can introduce the new definition of bio-activity lakes. This
term can be extended to several other volcanic lakes which show
similar compositional features of water and dissolved gases, e.g.
Kivu (D.R.C.-Rwanda) [34,144], Monticchio, Albano and Averno
(Italy) [37,86,145–147], Pavin (France) [121,148].
Acknowledgments
We wish to thank Lorenzo Brusca and Sergio Bellomo (INGV-Palermo) for
their laboratory assistance for trace elements analyses. The authors would
like to thank Corentin Caudron (Earth Observatory of Singapore) for the
detailed and constructive reviews of the original manuscript.
Author Contributions
Conceived and designed the experiments: JC FT FM SB S. Calabrese DR
GC RM BC RA OV GP S. Caliro RMA. Performed the experiments: JC
FT FM SB S. Calabrese RM BC RA OV GP FC GB S. Caliro. Analyzed
the data: JC FT FM SB. Contributed reagents/materials/analysis tools: FT
SB S. Calabrese DR GC OV GP CR RMA. Contributed to the writing of
the manuscript: JC FT FM SB S. Calabrese DR RM BC OV GP RMA.
Figure 12. Vertical distribution of measured and calculated d
13
C
TDIC
for the water samples from Lake Rı
´
o Cuarto. See the text for
further details.
doi:10.1371/journal.pone.0102456.g012
Bio-Activity Volcanic Lakes: Hule and Rı
`
o Cuarto (Costa Rica)
PLOS ONE | www.plosone.org 23 July 2014 | Volume 9 | Issue 7 | e102456
References
1. Rouwet D, Tassi F, Mora-Amador R, Sandri L, Chiarini V (2014) Past, present
and future of volcanic lake monitoring. J Volcanol Geotherm Res 272: 78–97.
2. Brown G, Rymer H, Dowden J, Kapadia P, Stevenson D, et al. (1989) Energy
budget analysis for Poa´s crater lake: implications for predicting volcanic
activity. Nature 339: 370–373.
3. Brantley SL, Agustsdottir AM, Rowe GL (1993) Crater lakes reveal volcanic
heat and volatile fluxes. Geol Soc Am 3: 175–178.
4. Pasternack GB, Varekamp JC (1997) Volcanic lake systematics I. Physical
constraints. Bull Volcanol 58(7): 528–538. doi:10.1007/s004450050160.
5. Anzidei M, Carapezza ML, Esposito A, Giordano G, Lelli M, et al. (2008) The
Albano Maar Lake high resolution bathymetry and dissolved CO
2
budget
(Colli Albani volcano, Italy): constrains to hazard evaluation. J Volcanol
Geotherm Res 171: 258–268.
6. Hurst T, Christenson B, Cole-Baker J (2012) Use of a weather buoy to derive
improved heat and mass balance parameters for Ruapehu Crater Lake.
J Volcanol Geotherm Res 235: 23–28.
7. Rouwet D, Tassi F (2011) Geochemical monitoring of volcanic lakes. A
generalized box model for active crater lakes. Ann Geophys 54: 161–173. doi:
10.4401/ag-5035.
8. Kling GW, Clark MA, Compton HR, Devine JD, Evans WC, et al. (1987) The
1986 Lake Nyos gas disaster in Cameroon, West Africa. Science 236: 169–175.
9. Sigurdsson H, Devince JD, Tchoua FM, Presser TS, Pringle MKW, et al.
(1987) Origin of the lethal gas burst from Lake Monoun, Cameroon. J Volcanol
Geotherm Res 31: 1–16.
10. Barberi F, Chelini W, Marinelli G, Martini M (1989) The gas cloud of Lake
Nyos (Cameroon, 1986): Results of the Italian technical mission. J Volcanol
Geotherm Res 39: 125–134.
11. Giggenbach WF (1990) Water and gas chemistry of Lake Nyos and its bearing
on the eruptive process. J Volcanol Geotherm Res 42: 337–362.
12. Evans WC, Kling GW, Tuttle ML, Tanyileke G, White LD (1993) Gas buildup
in Lake Nyos, Cameroon: the recharge process and its consequences. Appl
Geochem 8: 207–221.
13. Evans WC, White LD, Tuttle ML, Kling GW, Tanyileke G, et al. (1994) Six
years of changes at Lake Nyos, Cameroon, yield clues to the past and cautions
for the future. Geochem J 28: 139–162.
14. Kusakabe M (1996) Hazardous crater lakes. In: Scarpa R, Tilling RI,
editors.Monitoring and mitigation of volcano hazards.Springer-Verlag, Berlin.
pp. 573–598.
15. Rice A (2000) Rollover in volcanic crater lakes: a possible cause for Lake Nyos
type disasters. J Volcanol Geotherm Res 97: 233–239.
16. Haberyan KA, Horn SP, Uman˜ a GV (2003) Basic limnology of fifty-one lakes
in Costa Rica. Rev Biol Trop 51: 107–122.
17. Tassi F, Vaselli O, Fernandez E, Duarte E, Martinez M, et al. (2009b)
Morphological and geochemical features of crater lakes in Costa Rica: an
overview. J Limnol 68: 193–205.
18. Alvarado GE, Soto GJ, Salani FM, Ruiz P, Hurtado de Mendoza L (2011) The
formation and evolution of Hule and Rı
´
o Cuarto maars, Costa Rica. J Volcanol
Geotherm Res 201: 342–356.
19. Horn SP, Haberyan KA (1993) Physical and chemical properties of Costa
Rican lakes. Natl Geogr Res Explor 9(1): 86–103.
20. Horn SP (2001) The age of the Laguna Hule explosion crater, Costa Rica, and
the timing of subsequent tephra eruptions: evidence from lake sediments. Rev
Geol Am Cent 24: 57–66.
21. Uman˜ a G, Haberyan KA, Horn SP (1999) Limnology in Costa Rica. In: Gopal
B, Wetzel RW, editors. Limnology in Developing Countries 2: 33–62.
22. Haberyan KA, Horn SP (1999) Chemical and physical characteristics of seven
volcanic lakes in Costa Rica. Brenesia 51: 85–95.
23. Uman˜ a G (1993) The planktonic community of Laguna Hule, Costa Rica. Rev
Biol Trop 41(3): 499–507.
24. Go¨cke K (1997) Basic morphometric and limnological properities of Laguna
Hule, a caldera lake in Costa Rica. Rev Biol Trop 44/45: 537–548.
25. Go¨cke K, Bussing W, Corte´s J (1987) Morphometric and basic limnological
properties of the Laguna de Rı
´
o Cuarto, Costa Rica. Rev Biol Trop 35(2): 277–
285.
26. Carpenter SR (1983) Lake geometry: implications for production and sediment
accretion rates. J Theor Biol 105: 273–286.
27. Lehman JT (1975) Reconstructing the rate of accumulation of lake sediment.
The effect of sediment focusing. Quatern Res 5: 541–550.
28. Martini M, Giannini L, Prati F, Tassi F, Capaccioni B, et al. (1994) Chemical
characters of crater lakes in the Azores and Italy: the anomaly of the Lake
Albano. Geochem J 28: 173–184.
29. Wetzel RG (2001) Limnology: Lake and River Ecosystems. 3rd Ed., Academic,
San Diego, Calif., USA.
30. Soto GJ (1999) Geologı
´
a Regional de la hoja Poa´s (1: 50.000). In: Alvarado GE,
Madrigal LA, editors. Estudio Geolo´gico-Geote´cnico de Avance a factibilidad
del P. Laguna Hule. Inf. Interno ICE, San Jose´, Costa Rica. pp. 15–45.
31. Sapper K (1925) Los Volcanes de la Ame´rica Central. Max Niemayer, Halle
(Saale). 144 p.
32. Go¨cke K, Bussing W, Corte´s J (1990) The annual cycle of primary productivity
in Laguna de Rı
´
o Cuarto, a volcanic lake (maar) in Costa Rica. Rev Biol Trop
38(2B): 387–394.
33. Tassi F, Vaselli O, Giannini L, Tedesco D, Nencetti A, et al. (2004) A low-cost
and effective method to collect water and gas samples from stratified crater
lakes: the 485 m deep lake Kivu (DRC). Proc. IAVCEI Gen. Ass., Puchon,
Chile, 14–19 November 2004.
34. Tassi F, Vaselli O, Tedesco D, Montegrossi G, Darrah T, et al. (2009a) Water
and gas chemistry at Lake Kivu (DRC): geochemical evidence of vertical and
horizontal heterogeneities in a multi-basin structure Geochem. Geophys.
Geosyst. 10, doi:10.1029/2008GC002191
35. Tassi F, Rouwet D (2014) An overview of the structure, hazards, and methods
of investigation of Nyos-type lakes from the geochemical perspective. J Limnol
73(1): DOI: 10.4081/jlimnol.2014.836
36. Chiodini G (1996) Gases dissolved in groundwaters: analytical methods and
examples of applications in central Italy. In: Marini L, Ottonello G, editors.
Proc. Symp.Environmental Geochemistry. Castelnuovo di Porto, Rome, 22–26
May 1996. pp. 135–148.
37. Caliro S, Chiodini G, Izzo G, Minopoli C, Signorini A, et al. (2008)
Geochemical and biochemical evidence of lake overturn and fish kill at Lake
Averno, Italy. J Volcanol Geotherm Res 178: 305–316.
38. Tassi F, Vaselli O, Luchetti G, Montegrossi G, Minissale A (2008)Metodo per
la determinazione dei gas disciolti in acque naturali. Int Rep CNR-IGG,
Florence, nu 10450. 11 p.
39. Calabrese S, Aiuppa A, Allard P, Bagnato E, Bellomo S, et al. (2011)
Atmospheric sources and sinks of volcanogenic elements in a basaltic volcano
(Etna, Italy). Geochim Cosmochim Acta 75: 7401–7425.
40. Epstein S, Mayeda TK (1953) Variation of the
18
O/
16
O ratio in natural waters.
Geochim Cosmochim Acta 4: 213–224.
41. Nelson ST (2000) A simple, practical methodology for routine VSMOW/SLAP
normalization of water samples analyzed by continuous flow methods. Rapid
Commun Mass Spectrom 14: 1044–1046.
42. Salata GG, Roelke LA, Cifuentes LA (2000) A rapid and precise method for
measuring stable carbon isotope ratios of dissolved inorganic carbon. Mar
Chem 69: 153–161.
43. Evans WC, White LD, Rapp JB (1998) Geochemistry of some gases in
hydrothermal fluids from the southern Juan de Fuca ridge. J Geophys Res 15:
305–313.
44. Vaselli O, Tassi F, Montegrossi G, Capaccioni B, Giannini L (2006) Sampling
and analysis of fumarolic gases. Acta Vulcanol 1–2: 65–76.
45. Whitfield M (1978) Activity coefficients in natural waters. In: Pytkowicz RM,
editor.Activity Coefficients in Electrolyte Solutions. CRC Press, Boca Raton,
Florida, pp. 153–300.
46. Zhang J, Quay PD, Wilbur DO (1995) Carbon isotope fractionation during
gas-water exchange and dissolution of CO
2
. Geochim Cosmochim Acta 59:
107–114.
47. Schoell M (1980) The hydrogen and carbon isotopic composition of methane
from natural gases of various origins. Geochim Cosmochim Acta 44: 649–661.
48. Mamyrin BA, Tolstikhin IN (1984) Helium isotopes in nature. Elsevier,
Amsterdam.
49. Ozima M, Podosek FA (2002) Noble Gas Geochemistry. Cambridge University
Press, UK.
50. Inguaggiato S, Rizzo A (2004) Dissolved helium isotope ratios in ground-
waters: a new technique based on gas-water re-equilibration and its application
to Stromboli volcanic system. Appl Geochem 19: 665–673. http://dx.doi.org/
10.1016/j.apgeochem.2003.10.009
51. Mapelli F, Varela MM, Barbato M, Alvarin˜o R, Fusi M, et al. (2013)
Biogeography of planktonic microbial communities across the whole Mediter-
ranean Sea. Ocean Sci Discuss 10: 291–319. doi:10.5194/osd-10-291-2013
52. Marasco R, Rolli E, Ettoumi B, Vigani G, Mapelli F, et al. (2012) A drought
resistance-promoting microbiome is selected by root system under desert
farming. PLoS ONE 7(10): e48479. doi:10.1371/journal.pone.0048479
53. Harhangi HR, Le Roy M, van Alen T, Hu B-I, Groen J, et al. (2012)
Hydrazine synthase, a unique phylomarker with which to study the presence
and biodiversity of anammox bacteria. Appl Environ Microbiol 78: 752–758.
54. Van de Peer Y, Chapelle S, De Wachter R (1996) A quantitative map of
nucleotide substitution rates in bacterial rRNA. Nucleic Acids Res 24(17):
3381–3391.
55. Chakravorty S, Helb D, Burday M, Connell N, Alland D (2007) A detailed
analysis of 16S ribosomal RNA gene segments for the diagnosis of pathogenic
bacteria. J Microbiol Methods 69: 330–339.
56. Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, et al.
(2010) QIIME allows analysis of high-throughput community sequencing data.
Nat Methods 7: 335–336.
57. Edgar RC (2010) Search and clustering orders of magnitude faster than
BLAST. Bioinformatics 26(19): 2460–2461.
58. Wang Q, Garrity GM, Tiedje JM, Cole JR (2007) Naı
¨
ve Bayesian Classifier for
Rapid Assignment of rRNA Sequences into the New Bacterial Taxonomy.
Appl Environ Microbiol 73(16): 5261–5267.
59. Hammer Ø, Harper DAT, Ryan PD (2001) PAST: paleontological statistics
software package for education and data analysis. Palaeontol Electronica 4(4):
1–9.
Bio-Activity Volcanic Lakes: Hule and Rı
`
o Cuarto (Costa Rica)
PLOS ONE | www.plosone.org 24 July 2014 | Volume 9 | Issue 7 | e102456
60. Uman˜ a G (2010) Comparison of basic limnological aspects of some crater lakes
in the Cordillera Volca´nica Central, Costa Rica. Rev Geol Ame´r Central 43:
137–145.
61. Craig H, Lupton JE (1976) Primordial neon, helium and hydrogen in oceanic
basalts. Earth Planet Sci Lett 31: 369–385.
62. Wu QL, Zwart G, Schauer M, Kamst-van Agterveld MP, Hahn MW (2006)
Bacterioplankton Community Composition along a Salinity Gradient of
Sixteen High-Mountain Lakes Located on the Tibetan Plateau, China. AEM
72: 5478–5485.
63. Zhu G, Jetten MSM, Kuschk P, Ettwig KF, Yin C (2010) Potential roles of
anaerobic ammonium and methane oxidation in the nitrogen cycle of wetland
ecosystems. Appl Microbiol Biotechnol 86: 1043–1055.
64. Varekamp JC, Kreulen R (2000) The stable isotope geochemistry of volcanic
lakes, with examples from Indonesia. J Volcanol Geotherm Res 97: 309–327.
65. Craig H (1961) Isotopic variations in meteoric waters. Science 133: 1702–1703.
66. Lachniet MS, Patterson WP (2002) Stable isotope values of Costa Rican surface
waters. J Hydrol 260: 135–150.
67. Berner EK, Berner RA (1987) Global Water Cycle: Geochemistry and
Environment. Prentice-Hall, Inc, Englewood Cliffs, New Jersey. p. 397.
68. Matsubaya O, Sakai H (1978) D/H and
18
O/
16
O fractionation factors in
evaporation of water at 60 and 80uC. Geochem J 12: 121–126.
69. Rowe GL Jr (1994) Oxygen, hydrogen and sulfur isotope systematics of the
crater lake system of Poas volcano, Costa Rica. Geochem J 28: 263–287.
70. Alexander M (1961) Introduction to Soil Microbiology. John Wiley & Sons,
New York. p. 472.
71. Buresh RJ, Patrick WH (1981) Nitrate reduction to ammonium and organic
nitrogen in an estuarine sediment. Soil Biol Biochem 13: 279–283.
72. Stewart WDP, Preston T, Peterson HG, Christofi N (1982) Nitrogen cycling in
eutrophic freshwaters. Philosoph Transact Royal Soc B 296: 491–509.
73. Ahlgren I, So¨rensson F, Waara T, Vrede K (1994) Nitrogen budgets in relation
to microbial transformations in lakes. Ambio 23(6): 367–377.
74. Brune A, Frenzel P, Cypionka H (2000) Life at the oxic-anoxic interface:
microbial activities and adaptation. FEMS Microbiol Rev 24(5): 691–710.
75. Carlson CA, Ingraham JL (1983) Comparison of denitrification by Pseudomo-
nas stutzeri, Pseudomonas aeruginosa,andParacoccus denitrificans. Appl
Environ Microbiol 45: 1247–1253.
76. Molongoski JJ, Klug MJ (1980) Anaerobic metabolism of particulate organic
matter in the sediments of a hypereutrophic lake. Freshwater Biol 10: 507–518.
77. Davison W, Heaney SI, Talling JF, Rigg E (1980) Seasonal transformations and
movements of iron in a productive English lake with deep water anoxia.
Schweiz Z Hydrol 42: 196–224.
78. Balistrieri LS, Murray JW, Paul B (1992) The cycling of iron and manganese in
the water column of Lake Sammamish, Washington. Limnol Oceanogr 37:
510–528.
79. Hongve D (1997) Cycling of iron, manganese, and phosphate in a meromictic
lake. Limnol Oceanogr 42: 635–647.
80. Prosser JT, Carr MJ (1987) Poa´s volcano, Costa Rica: geology of the summit
region and spatial and temporal variations among the most recent lavas.
J Volcanol Geotherm Res 33: 131–146.
81. Balistrieri LS, Murray JW, Paul B (1994) The geochemical cycling of trace
elements in a biogenic meromictic lake. Geochim Cosmochim Acta 58(19):
3993–4008.
82. Viollier E, Jezequel D, Michard G, Pepe M, Sarazin G, et al. (1995)
Geochemical study of a crater lake (Pavin Lake, France): trace-element
behaviour in the monimolimnion. Chem Geol 125(1–2): 61–72.
83. Schaller T, Moor HC, Wehrli B (1997) Reconstructing the iron cycle from the
horizontal distribution of metals in the sediment of Baldeggersee. Aquat Sci 59:
326–344.
84. Varekamp JC, Pasternack GB, Rowe GL Jr (2000) Volcanic lake systematics II.
Chemical constraints. J Volcanol Geotherm Res 97: 161–179.
85. Schmid M, Halbwachs M, Wehrli B, Wu¨ est A (2005) Weak mixing in Lake
Kivu: new insights indicate increasing risk of uncontrolled gas eruption.
Geochem Geophys Geosyst 6: 1–11.
86. Cabassi J, Tassi F, Vaselli O, Fiebig J, Nocentini M, et al. (2013)
Biogeochemical processes involving dissolved CO
2
and CH
4
at Albano,
Averno, and Monticchio meromictic volcanic lakes (Central-Southern Italy).
Bull Volcanol 75(1): 1–19.
87. Weiss R (1970) The solubility of nitrogen, oxygen and argon in water and
seawater. Deep Sea Res 17: 721–735.
88. Tison DL, Palmer FE, Staley JT (1977) Nitrogen fixation in lakes of the Lake
Washington drainage basin. Water Res 11: 843–847.
89. Hyenstrand P, Blomqvist P, Pettersson A (1998) Factors determining
cyanobacterial success in aquatic systems – a literature review. Arch Hydrobiol
15: 41–62.
90. Moeller RE, Roskoski JP (1978) Nitrogen-fixation in the littoral benthos of an
oligotrophic lake. Hydrobiologia 60(1): 13–16.
91. Loeb SL, Reuter JE (1981) The epilithic periphyton community: a five-lake
comparative study of community productivity, nitrogen metabolism and depth-
distribution of standing crop. Verh Internat Verein Limnol 21: 346–352.
92. Valiela I (1991) Ecology of coastal ecosystems. In: Barnes RSK, Mann KH,
editors.Fundamentals of aquatic ecology. Blackwell Science, Oxford, pp. 57–
76.
93. Benemann JR, Weare NM (1974) Hydrogen evolution by nitrogen-fixing
Anabaena cylindrical cultures. Science 184: 174–175.
94. Greenbaum E (1982) Photosynthetic hydrogen and oxygen production: kinetic
studies. Science 215: 291–293.
95. Asada Y, Kawamura S (1986) Aerobic hydrogen accumulation by a nitrogen-
fixing Cyanobacterium, Anabaena sp. Appl Environ Microbiol 51: 1063–1066.
96. Asada Y, Miyake J (1999) Photobiological hydrogen production. J Biosci
Bioengineer 88(1): 1–6.
97. Bandyopadhyay B, Sto¨ckel J, Min H, Sherman LA, Pakrasi HB (2010) High
rates of photobiological H
2
production by a cyanobacterium under aerobic
conditions. Nature Communications 1: 139. doi:10.1038/ncomms1139
98. Mah RA, Ward DM, Baresi L, Glass TL (1977) Biogenesis of methane. Annu
Rev Microbiol 31: 309–341.
99. Zehnder AJB (1978) Ecology of methane formation. In: Michell R, editor.
Water pollution microbiologyk. J. Wiley & Sons Inc, New York. pp. 349–376.
100. Thauer RK, Badziong W (1980) Respiration with sulfate as electron acceptor.
In: Knowles CJ, editor.Diversity of bacterial respiratory systems. CRC Press,
Boca Raton, Fla, 2. pp. 65–85.
101. Aragno M, Schlegel HG (1981) The hydrogen-oxidizing bacteria. In: Starr MP,
Stolp H, Tru¨per HG, Ballows A, Schlegel HG, editors.The prokaryotes. A
handbook of habitats, isolation and identification of bacteria. Vol. 1. Springer-
Verlag, Berlin.
102. Bowien B, Schlegel HG (1981) Physiology and biochemistry of aerobic
hydrogen-oxidizing bacteria. Ann Rev Microbiol 35: 405–452.
103. Conrad R, Aragno M, Seiler W (1983) Production and consumption of
hydrogen in a eutrophic lake. Appl Environ Microbiol 45: 502–510.
104. Bianchi L, Mannelli F, Viti C, Adessi A, De Philippis R (2010) Hydrogen-
producing purple non-sulfur bacteria isolated from the trophic lake Averno. Int
J Hydr En 35: 12213–12223.
105. Zimmer MM, Fisher TP, Hilton DH, Alvarado GE, Sharp ZD, et al. (2004)
Nitrogen systematics and gas fluxes of subduction zones: insights from Costa
Rica arc volatiles. Geochem Geophys Geosyst 5(5): 1–19. doi:10.1029/
2003GC000651
106. Barnes I, Irwin WP, White DE (1978) Global distribution of carbon dioxide
discharges and major zones of seismicity. US Geological Survey, Water-
Resources Investigation, 78–39, Open File Report.
107. O’Leary MH (1988) Carbon isotopes in photosynthesis. BioScience 38: 328–
336.
108. Rollinson H (1993) Using geochemical data: evaluation, presentation,
interpretation. Longman Scientific and Technical, New York, p. 352.
109. Hoefs J (2009) Stable Isotope Geochemistry, 6th edn. Springer, Berlin,
Germany, p. 288.
110. Whiticar MJ (1999) Carbon and hydrogen isotope systematics of bacterial
formation and oxidation of methane. Chem Geol 161: 291–314.
111. Alvarado GE, Soto GJ, Pullinger CR, Escobar R, Bonis S, et al. (2007)
Volcanic activity, hazards, and monitoring. In: Bundschuh J, Alvarado GE,
editors.Central America: Geology, Resources and Hazards, Vol. 2. Taylor &
Francis, London, pp. 1155–1188.
112. Mah RA, Ward DM, Baresi L, Glass TL (1977) Biogenesis of methane. Annu
Rev Microbiol 31: 309–341.
113. Barker JF, Fritz P (1981) Carbon isotope fractionation during microbial
methane oxidation. Nature 293: 289–291.
114. Schoell M (1988) Multiple origins of methane in the Earth. Chem Geol 71: 1–
10.
115. Woese CR, Kandler O, Wheelis ML (1990) Towards a natural system of
organisms: proposal for the domains Archaea, Bacteria and Eucarya. Proc Natl
Acad Sci 87: 44576–44579.
116. Rudd JWM, Hamilton RD, Campbell NER (1974) Measurement of microbial
oxidation of methane in lake water. Limnol Oceanogr 19: 519–524.
117. Rich PH (1975) Benthic metabolism of a soft-water lake. Verh Internat Verein
Limnol 19: 1023–1028.
118. Rich PH (1980) Hypolimnetic metabolism in three Cape Cod lakes. Amer
Midland Natur 104: 102–109.
119. Frenzel P, Thebrath B, Conrad R (1990) Oxidation of methane in the oxic
surface layer of a deep lake sediment (Lake Constance). FEMS Microbiol Ecol
73: 149–158.
120. Casper P (1992) Methane production in lakes of different trophic state. Arch
Hydrobiol Beih Ergebn Limnol 37: 149–154.
121. Lopes F, Viollier E, Thiam A, Michard G, Abril G, et al. (2011)
Biogeochemical modeling of anaerobic vs. aerobic methane oxidation in a
meromictic crater lake (Lake Pavin, France). Appl Geochem 26: 1919–1932.
122. Franzmann PD, Liu YT, Balkwill DL, Aldrich HC, deMacario EC, et al. (1997)
Methanogenium frigidum sp. nov., a psychrophilic, H
2
-using methanogen from
Ace Lake, Antarctica. Int J Syst Bacteriol 47: 1068–1072.
123. Bra¨ uer SL, Cadillo-Quiroz H, Ward RJ, Yavitt JB, Zinder SH (2011)
Methanoregula boonei gen. nov., sp. nov., an acidiphilic methanogen isolated
from an acidic peat bog. Int J Syst Evol Microbiol 61: 45–52.
124. Chaudhary PP, Brablcova´ L, Buria´nkova´ I, Rulı
´
k M (2013) Molecular diversity
and tools for deciphering the methanogen community structure and diversity in
freshwater sediments. Appl Microbiol Biotechnol 97: 7553–7562.
125. Borrel G, Je´ze´quel D, Biderre-Petit C, Morel-Desrosiers N, Morel J, et al.
(2011) Production and consumption of methane in freshwater lake ecosystems.
Res Microbiol 162: 832–847.
126. Baker BJ, Tyson GW, Webb RI, Flanagan J, Hugenholtz P, et al. (2006)
Lineages of acidophilic Archaea revealed by community genomic analysis.
Science 314: 1933–1935. doi:10.1126/science.1132690.
Bio-Activity Volcanic Lakes: Hule and Rı
`
o Cuarto (Costa Rica)
PLOS ONE | www.plosone.org 25 July 2014 | Volume 9 | Issue 7 | e102456
127. Baker BJ, Comolli LR, Dicka GJ, Hauser LJ, Hyatt D, et al. (2010) Enigmatic,
ultrasmall, uncultivated Archaea. PNAS 107: 8806–8811.
128. Borrel G, Lehours A-C, Crouzet O, Je´ze´quel D, Rockne K, et al. (2012)
Stratification of Archaea in the deep sediments of a freshwater meromictic lake:
Vertical Shift from Methanogenic to Uncultured Archaeal Lineages. PLoS
ONE 7:e43346. doi:10.1371/journal.pone.0043346.
129. Biddle JF, Lipp JS, Lever MA, Lloyd KG, Sørensen KB, et al. (2006)
Heterotrophic Archaea dominate sedimentary subsurface ecosystems off Peru.
PNAS 103: 3846–3851.
130. Stoecker K, Bendinger B, Scho¨ning B, Nielsen PH, Nielsen JL, et al. (2006)
Cohn’s Crenothrix is a filamentous methane oxidizer with an unusual methane
monooxygenase. PNAS 103: 2363–2367.
131. Chistoserdova L, Kalyuzhnaya MG, Lidstrom ME (2009) The expanding
world of methylotrophic metabolism. Annu Rev Microbiol 63: 477–499.
doi:10.1146/annurev.micro.091208.073600
132. Beck DAC, Kalyuzhnaya MG, Malfatti S, Tringe SG, del Rio TG, et al. (2013)
A metagenomic insight into freshwater methane-utilizing communities and
evidence for cooperation between the Methyloc occaceae and the Methylophi-
laceae. PeerJ 1:e23. doi:10.7717/peerj.23
133. Jezbera J, Jezberova´ J, Kasalicky´V,S
ˇ
imek K, Hahn MW (2013) Patterns of
Limnohabitans microdiversity across a large set of freshwater habitats as
revealed by reverse line blot hybridization. PLoS ONE 8: e58527. doi:10.1371/
journal.pone.0058527.
134. Maness P, Huang J, Smolinski S, Tek V, Vanzin G (2005) Energy generation
from the CO oxidation-hydrogen production pathway in Rubrivivax
gelatinosus. Appl Environ Microbiol 71: 2870–2874.
135. Harmsen HJM, Van Kuijk BLM, Plugge CM, Akkermans ADL, De Vos WM,
et al. (1998) Syntrophobacter furnaroxidans sp nov, a syntrophic propionate-
degrading sulfate-reducing bacterium. Int J Syst Bact 48: 1383–1387.
136. Hug LA, Castelle CJ, Wrighton KC, Thomas BC, Sharon I, et al. (2013)
Community genomic analyses constrain the distribution of metabolic traits
across the Chloroflexi phylum and indicate roles in sediment carbon cycling.
Microbiome 1:22, doi:10.1186/2049-2618-1-22.
137. Zanaroli G, Balloi A, Negroni A, Borruso L, Daffonchio D, et al. (2012) A
Chloroflexi bacterium dechlorinates polychlorinated biphenyls in marine
sediments under in situ-like biogeochemical conditions. J Haz Mat 209–210:
449–457.
138. Balloi A, Rolli E, Marasco R, Mapelli F, Tamagnini I, et al. (2010) The role of
microorganisms in bioremediation and phytoremediation of polluted and
stressed soils. Agrochimica 54(6): 353–369.
139. Mook WG, Bommerson JC, Staverman WH (1974) Carbon isotope
fractionation between dissolved bicarbonate and gaseous carbon dioxide.
Earth Planet Sci Lett 22: 169–176.
140. Zwart G, Crump BC, Agterveld M, Hagen F, Han SK (2002) Typical
freshwater bacteria: an analysis of available 16S rRNA gene sequences from
plankton of lakes and rivers. Aquat Microb Ecol 28: 141–155.
141. Eigemann F, Hilt S, Salka I, Grossart H (2013) Bacterial community
composition associated with freshwater algae: species specificity vs. dependency
on environmental conditions and source community. FEMS Microbiol Ecol 83:
650–663.
142. Paver SF, Hayek KR, Gano KA, Fagen JR, Brown CT, et al. (2013)
Interactions between specific phytoplankton and bacteria affect lake bacterial
community succession. Environ Microbiol 15: 2489–2504.
143. Kusakabe M, Ohba T, Issa YY, Satake H, Ohizumi T, et al. (2008) Evolution
of CO
2
in lakes Monoun and Nyos, Cameroon, before and during controlled
degassing. Geochem J 42: 93–118.
144. Schoell M, Tietze K, Schoberth SM (1988) Origin of methane in Lake Kivu
(East-Central Africa). Chem Geol 71: 257–265.
145. Carapezza ML, Lelli M, Tarchini L (2008) Geochemistry of the Albano and
Nemi crater lakes in the volcanic district of Alban Hills (Rome, Italy). J Volcanol
Geotherm Res 178: 297–304.
146. Caracausi A, Nuccio PM, Favara R, Nicolosi M, Paternoster M (2009) Gas
hazard assessment at the Monticchio crater lakes of Mt Vulture, a volcano in
Southern Italy. Terra Nova 21: 83–87.
147. Chiodini G, Tassi F, Caliro S, Chiarabba C, Vaselli O, et al. (2012) Time-
dependent CO
2
variations in Lake Albano associated with seismic activity. Bull
Volcanol 74: 861–871.
148. Aeschbach-Hertig W, Hofer M, Kipfer R, Imboden DM, Wieler R (1999)
Accumulation of mantle gases in a permanently stratified volcanic lake (Lac
Pavin, France). Geochim Cosmochim Acta 63: 3357–3372.
Bio-Activity Volcanic Lakes: Hule and Rı
`
o Cuarto (Costa Rica)
PLOS ONE | www.plosone.org 26 July 2014 | Volume 9 | Issue 7 | e102456
