Content uploaded by Akbar Esmaeili
Author content
All content in this area was uploaded by Akbar Esmaeili on Mar 17, 2016
Content may be subject to copyright.
Available via license: CC BY 4.0
Content may be subject to copyright.
ORIGINAL PAPER
The efficiency of Penicillium commune for bioremoval
of industrial oil
A. Esmaeili •E. Sadeghi
Received: 3 August 2013 / Revised: 17 January 2014 / Accepted: 5 February 2014 / Published online: 25 February 2014
ÓThe Author(s) 2014. This article is published with open access at Springerlink.com
Abstract Among all environmental contaminations,
industrial oil is one of the major pollutants of soil, water,
and air. There are different chemical, physical, and bio-
logical methods to remove all types of oil pollutions. One
of the common biological methods is to utilize the
microorganisms like yeast, fungi or bacteria. Previous
studies concerning the biodegradation of an aromatic
compound in industrial waste water by Aspergillus niger
have been reported. In this study, we tried to identify an
oil-derived microorganism and evaluate its efficacy on self-
removal of industrial oil. Firstly, the strain of isolated
fungus from various bulks of used oil was defined via
colonial identification and DNA sequencing. Secondly,
bioremoval activity of defined fungus (Penicillium com-
mune) was evaluated using gas chromatography–mass
spectrometry. The optimum conditions in biological elim-
ination of oil including the incubation time, pH level of
culture, and amount of reagents were determined. In the
best condition, a removal rate of 95.4 % was obtained.
Keywords Bioremoval Industrial oil Penicillium
commune Fungus
Introduction
Oil pollutants such as lubricants, cutting fluids, and other
types of heavy products such as tar, grease, crude oil, and
diesel oil as well as light hydrocarbons are considered as a
global disaster and a common problem in oil-bearing and
industrial regions (Merkel et al. 2004).
In our research, the biodegradation of 1-naphthol in
industrial waste water was examined. We separated
Aspergillus niger in the soil of industrial waste water and
its biodegradation by the same fungi was further investi-
gated by us (Esmaeili and Fazeli 2012).
In a field study, fugal strains were isolated from oil-
contaminated sites of Arak refinery (Iran) and their growth
ability was checked in potato dextrose agar media con-
taining 0–10 % v/v crude oil, the activity of three enzymes
was evaluated in the fungal colonies and bioremediation
ability of the fungi was checked in the experimental pots
containing 3 kg sterilized soil and different concentrations
of petroleum (0–10 % w/w) (Mohsenzadeh et al. 2012). In
recent years, a number of natural biodegradable sorbents
have been found as one of the most cost-effective and
capable means for the oil spill cleanup, and a number of
works have been studied for utilizing these materials in the
removal of oil spill, e.g., barley straw (Husseien et al.
2009), raw sugarcane bagasse in different particle sizes was
used for the sorption of layer of crude oil from surface of
sea water (Behnood et al. 2013).
During recent years in our country, we have encountered
with the increased destroying effects of oil pollution on
ecosystem similar to the other oil-rich countries. Recently,
the amazing effects of fungi on removal of pollutants or
their transformation to harmless or useful products have
been reported. In this process, many toxic components in
oil industry wastewater can be changed to novel substances
applicable in biotechnological procedures (Esmaeili and
Fazeli 2012). Industrial oils as by-products of mineral-
based oils are derived from crude oil in refineries. These
oils include hydrogen and carbon which forms numerous
compounds called hydrocarbons that are not heavy enough
A. Esmaeili (&)E. Sadeghi
Department of Chemical Engineering, North Tehran Branch,
Islamic Azad University, PO Box 19585/936, Tehran, Iran
e-mail: akbaresmaeili@yahoo.com
123
Int. J. Environ. Sci. Technol. (2014) 11:1271–1276
DOI 10.1007/s13762-014-0523-1
to change from a gas into a solid state. The most important
application of industrial oil is to lubricate the metal parts of
car engine or other types of machines (Dieter 1984).
Hydrocarbons as oil industrial derivatives can be decom-
posed by soil fungi as a natural phenomenon. The living
condition of soil-bacteria or fungi makes them suitable for
bio-removal of hydrocarbon contaminations in soil.
Noticeably, Penicillium is one of the most abundant fungal
floras with the intention that there are 10
6
–10
8
spores in
one gram of normal soil and 10
4
spores in one milliliter of
unpolluted groundwater (Gallegos Martinez et al. 2000).
Recently, a considerable attention has been focused on
using physical, chemical, and biological methods to
remove or modify the environmental contamination created
by petroleum products. (Chehregani and Malayeri 2007).
According to previous studies, biological processes are the
best options because of being cost-effective and less haz-
ardous to both human and natural environment. They are
also a proper replacement of expensive engineering tech-
niques (Chehregani et al. 2009; Merkel et al. 2004; Smith
et al. 1981). From a biological point of view, the aim of this
study was to evaluate the potential of a fungus (Penicillium
commune) isolated from wastewater oil on the elimination
of oil industrial derivatives. More importantly, a probable
metabolic pathway was defined using product analysis.
Materials and methods
Chemicals and culture media
This study has been conducted in Garmsar, Semnan
Province in Iran. Industrial oil with the flash point of
160–350 °C was provided from the second refinement oil
industrial company. Samples were diluted (4 %) and their
pH adjusted to normal (pH 7) using 1 M HCl/1 M NaOH.
The microbiological culture medium used in this study
was SGA 4 % containing 5 g casein peptone, 5 g meat
peptone, 40 g glucose and 15 g agar which were solved in
1 l distilled water and adjusted to pH 5.6 ±0.2 at 25 °C
(Malik 1996; Kachuei et al. 2009; Sherman et al. 1991).
Isolation and cultivation of fungus
In order to cultivate microorganism, a sample of used oil
was collected from a barrel in an auto service using a
sterile 10 ml pipette and was kept in a glass bottle at 4 °C.
This sampling procedure was repeated three times in dif-
ferent auto service shops. Sample preparation was as fol-
low: 1 ml of used oil was mixed with 10 ml of sterile
distilled water and centrifuged 15 min at 1,000 rpm. After
removing the supernatant, the pellet was resuspended in
1 ml distilled water and cultured on Sabouraud Glucose
Agar (SGA) 4 %. Plates were kept at 27 °C incubator to
colonize the microorganism. After a 7-day culture, fully
colony growth plates were stored at a temperature of 4 °C
(Cruickshank et al. 1975).
Identification of microorganism derived from used oil
The following procedures were done to identify the strain
of oil-removal fungus: Colony formation on SGA was
applied to find the type of fungus as previously reported by
Kachuei et al. (2009), special staining of Penicillium on the
slide was done using lacto phenol blue. Finally, we could
detect P. commune in our samples.
DNA extraction
DNA extraction was performed according to the method
published by Kachuei et al. (Glass and Donaldson 1995)
with a few modifications. Briefly, the harvested mycelial
mass was frozen in liquid nitrogen and ground to a fine
powder. The mycelia powder was suspended in a DNA
extraction buffer containing 50 mM Tris–HCl (pH 8),
50 mM EDTA, 3 % sodium dodecyl sulfate, and 50 llof
proteinase-K (20 mg/ml). The suspension was incubated at
65 °C for 1 h, and the cellular debris was removed by
centrifugation at 3,000 rpm for 5 min. The suspension was
extracted once with phenol/chloroform/isoamyl alcohol
(25:24:1) and once with chloroform/isoamyl alcohol
(24:1). DNA was precipitated by addition of an equal
volume of ethanol and sodium acetate (3 M) followed by
centrifugation at 12,000 rpm for 10 min, frozen at -20 °C
for 2 h, and then centrifuged at 12,000 rpm for 30 min.
Finally, the DNA pellet was rinsed with 70 % ethanol and
suspended in TE buffer (Fig. 1) for further evaluations.
Fig. 1 Bright field microscopic examination of P. commune fungus
1272 Int. J. Environ. Sci. Technol. (2014) 11:1271–1276
123
PCR and DNA sequencing
Isolated DNA was used in PCR. b-Tubulin gene and the
internal transcribed spacer (ITS) regions were amplified
using universal primers Bt2a, Bt2b, ITS5, and ITS4 (White
et al. 1990).
Forward (ITS1): 50TCCGTAGGTGAACCTGCGG30
Reverse (ITS4): 50TCCTCCGCTTATTGATATGC30
Amplification was performed in a final volume of 25 ll
containing 25 llof109PCR buffer, 0.5 ll deoxynucleo-
side triphosphate (dNTP) at 0.2 mM, each forward and
reverse primer at 20 pmol, 1.25 ll of template DNA, and
2.5 U of qDNA polymerase (0.5 ll). The PCR condition
consisted of the initial denaturation at 94 °C (20 min), 35
cycles each of denaturation at 94 °C (45 s), 58 °C for
annealing (1 min) and finally at 72 °C for 7 min. A tem-
perature of 58 °C was found suitable for the PCR process.
Approximately, 500–600-bp of the PCR product was
obtained and sequenced by Pishgam Biotechnology Co.
The result of the sequence analysis revealed that the iso-
lated fungus was P. commune.
Evaluation of industrial oil
To evaluate the industrial oil, 7 ml of oil were reached to
the volume of 25 ml using dichloromethane solvent in a
volumetric flask and assessed by gas chromatography–
mass spectrometry (GC–MS) device. The levels of indi-
vidual components were determined using the measure-
ment of specific spectral peaks with units of parts per
million (ppm).
Determination of oil-removal capacity of fungus
After completing the fungal growth, industrial oil was
added to the plates with an area of 1 cm using a pipette.
After 10-day culture at 27 °C, the samples were collected
and the oil-removal ability of contained fungus was studied
using GC–MS device. Mass of harvested sample from each
plate was about 0.2 g. Thereafter, the samples were solved
in an appropriate solvent (ethyl acetate) and filtered. The
filtered samples were diluted to a volume of 25 ml in the
flask balloon. The formulae for the assessment of oil-
removal activity and the percentage of removing were as
follow:
Y¼ðXt=XoÞ100
Percentage of removing ¼100 YðÞ
X
o
and X
t
were the ppm values of initial and final volumes
of oil, respectively. Bioremoval process was assessed by
measuring different parameters including injection volume
of oil to each plate, pH level of plates’ contents and the
removal time. The tests were conducted in various time
intervals between 0 and 10 days. In addition, the effects of
a range of pH values (4, 5, 5.6, 6, and 7), concentration of
oil (1, 3, 5, 7, 10, 15, 25, 50, and 75 ll), and biomass
content were studied in culture medium. All the assess-
ments were repeated five times and the mean ±SD values
were reported.
Statistical analysis
One-way ANOVA and LSD were used to evaluate differ-
ences between groups. All statistical analyses were carried
out using SPSS 17 (SPSS Inc.). The significance level of
0.05 was considered in this study.
Results and discussion
The present study aimed to investigate the potential ability
of wastewater-derived fungus on bioremoval of industrial
oil. A fungus from Penicillin family named P. commune
was isolated from oil in an effluent disposal area near the
second refinement oil industrial company of Garmsar. The
strain of fungus was also confirmed using gene sequence
analysis of 18s Ribosomal RNA. In addition, bioremoval
activity of P. commune to degrade the hydrocarbon com-
pounds was about 95.4 %. A morphological study of
P. commune was done after smearing on slides and staining
them with lactophenol cotton blue wet mount preparation.
Slides were assessed by optical microscopy and the con-
idiophores specifically basipetal conidia were observed
(Fig. 1).
Effect of initial dye pH on the process
The optimum conditions for some important parameters in
this biological process such as final injection volume of oil,
the pH level of culture, and removal time were also
determined (Fig. 2). According to the recent studies, the
changes in pH influence the oil-removal efficiency of fungi.
As shown in Fig. 2, the most bioremoval activity of P.
commune was found in pH 5.6 (83.59 %) which was con-
siderably lower than normal condition (pH 7). The statis-
tical analysis of these changes has been shown in Table 1.
In contrast to acid-resistant microorganisms (e.g., P. com-
mune), the suitable pH for living and higher activity of
some other kinds of microorganisms is near neutral pH.
However, considerable decrease in soil pH level has a great
impact on the ability of microbial population to reduce
hydrocarbons (Bossert and Bartha 1984). In addition,
Verstraete et al. indicated that the biological elimination of
gasoline will be doubled if some modifications perform to
maintain the acidity of soil when it increases from 4.5 to
Int. J. Environ. Sci. Technol. (2014) 11:1271–1276 1273
123
7.4 (Walker and Colwell 1974; Verstraete et al. 1976;
Spain et al. 1980).
Effect of different time on the process
In order to find the optimum incubation time, this process
was done in different time intervals (1–10 days). As shown
in Fig. 3, the ideal length of time for oil degradation is
5 days. A gradually increasing in the efficacy of fungus to
remove the oil was seen from 89.16 % in the first day to
95.4 % in the fifth day. The study continued to day 10 and
the results have been shown in Fig. 3.
The statistical analysis of parameters related to the
10-day evaluation of oil-fungus co-culture has been also
shown in Table 1. The biomass of fungus in this study was
about 0.2 g per 1 cm
2
. According to a research conducted
in Ardabil, East Azerbaijan Province in Iran, the maximum
bio-removal function of A. niger derived from the soil of
industrial waste water was 75 % after 5-day co-culture
with the fungal concentration of 75 mg/l (Esmaeili and
Kalantari 2012).
Effect of inoculated oil volume on the process
Although there is a report of higher removal efficacy of P.
commune than A. niger following 10 days cultivation, but
another study revealed that the extended duration time
could improve the removal efficacy no more than 75 %. On
the other hand, the effect of different volumes of oil from 1
to 75 ll was evaluated in a period of 10 days. As shown in
Fig. 4, our results pointed to a gradually decrease in the
removal activity due to increased amount of oil from 7 ll
(83.6 %) to 75 ll (3.33 %). Outcomes of related statistical
analysis have been also shown in Table 1. The peaks of
industrial oil analysis in an optimized condition before and
after bioremoval process were obtained by GC (Fig. 5). As
a result of this study, P. commune is a suitable, highly cost-
effective and eco-friendly bioremoval for elimination of
industrial-oil pollution (Atlas et al. 1980; Esmaeili and
Kalantari 2012).
There are some evidences on the abundant amounts of
bacteria and fungi in soil and their potential role in the
elimination of hydrocarbons (White et al. 1990). Effluent
of oil water waste into the soil increases the bacteria
population and makes it easy to collect a large amount of
Fig. 2 Removal of injection volume (7 ll), 0.2 g of biological
weight, 10 days, at different pH
Fig. 3 Removal of injection volume (7 ll), 0.2 g of biological
weight, 10 days, at different time
Table 1 Injection volume, pH, time: ANOVA test statistical study,
0.2 g of biological weight
Between group Within groups Total
Sum of squares
Volume 392.185 50.000 442.185
pH 459.601 69.920 529.521
Time 41,258.556 90.000 41,348.556
df
Volume 4 20 24
pH 6 28 34
Time 8 36 44
Mean square
Volume 98.046 2.500 –
pH 76.600 2.497 –
Time 5,157.319 2.500 –
F
Volume 39.218 – –
pH 30.675 – –
Time 2,063 – –
Sig.
Volume 0.000 – –
pH 0.000 – –
Time – –
1274 Int. J. Environ. Sci. Technol. (2014) 11:1271–1276
123
bacteria from the soil (Bossert and Bartha 1984; Jensen
1975; Atlas et al. 1980). In contrast to our study, Song
et al. showed that bacteria (82 %) had a more potent
activity to eliminate n-hexadecane in sandy environments
than fungi (13 %) (Mohsenzadeh et al. 2012). In a
research study, the possible role of different fungi to
eradicate the contamination of soil has been compared.
Among them, Aspergillus terreus,Penicillium sp., Alter-
naria sp., Acromonium sp. could efficiently remove 10, 8,
8, and 2 % of crude oil, respectively (Kirk and Gordon
1988). Although, the environmental oil contaminations
can be removed by bacteria and fungi (Atlas et al. 1980),
but the biological degradation of hydrocarbon compounds
is mostly done by both Penicillium sp. and Aspergillus
(Fusey and Oudot 1984). The highest rate of bioremoval
is associated with saturated hydrocarbons and the lowest
rate to light aromatic, with high molecular and polar
compounds (Kirk and Gordon 1988; Fusey and Oudot
1984).
In this study, decreasing in peak area of GC–MS after
passing the time of incubation indicates the successful
ability of P. commune to remove or modify the industrial
oil. In optimum condition (5 days, pH 5.6, 7 ll of oil), the
remove of 95.4 % industrial oil is possible to wrap up, it is
possible to efficiently use of natural metabolic function of
microorganisms to eliminate the environmental pollutants
such as industrial oil and, in fact, it will be as a part of
biological self-removing.
Fig. 4 Effect of injection volume on industrial oil by P. commune.
0.2 g of biological weight, 10 days
Fig. 5 GC spectrum relating to industrial oil before removing process (a) and after biological removing (b)byP. commune in optimized
conditions
Int. J. Environ. Sci. Technol. (2014) 11:1271–1276 1275
123
Conclusion
In conclusion, bio-removal of the oil waste water was
carried out by a fungal strain named P. commune which
was derived from oil and identified using biological tests.
Effective identification of the isolated fungus was per-
formed by 18s rRNA gene sequence analysis. GC–MS
spectrums analyses confirmed the remove of oil industrial
by P. commune. The bio-removal of the oil was dependent
on the volume of oil, pH level of culture, and co-culture
time point. The most efficiency of bioremoval process was
up to 95.4 % under optimal condition.
Acknowledgments The authors wish to thank Mr. Hossini, Spec-
troscopy of Laboratory, North Tehran Branch, Islamic Azad Uni-
versity (Tehran, Iran) for her assistance.
Open Access This article is distributed under the terms of the
Creative Commons Attribution License which permits any use, dis-
tribution, and reproduction in any medium, provided the original
author(s) and the source are credited.
References
Atlas RM, Sexstone A, Gustin P, Miller O, Linkins P, Everett K
(1980) Biodegradation of crude oil by tundra soil microorgan-
isms. In: Oxley TA, Becker G, Allsop D (eds) Proceedings of the
4th international biodeterioration symposium. Pitman, London,
pp 21–28
Behnood R, Anvaripour B, Jaafarzade Haghighi Fard N, Farasati M
(2013) Petroleum hydrocarbons adsorption from aqueous solu-
tion by raw sugarcane bagasse. Int J Emerg Sci Eng 1(6):96–99
Bossert I, Bartha R (1984) The fate of petroleum in soil ecosystems.
In: Atlas RM (ed) Petroleum microbiology. Macmillan, New
York, pp 434–476
Chehregani A, Malayeri B (2007) Removal of heavy metals by native
accumulator plants. Int J Agric Biol Sci 9:462–465
Chehregani A, Noori M, Lari Yazdi H (2009) Phytoremediation of
heavy metal polluted soils: screening for new accumulator plants
and evaluation of removal ability. Ecotoxicol Environ Saf
72:1349–1353
Cruickshank R, Duguid JP, Marmion BP, Swain RHA (1975) Medical
microbiology, vol 2, 12th edn. Longman Group Ltd., London,
p 136
Dieter K (1984) Lubricants and related products. Chemie, Verlag,
p 101
Esmaeili A, Fazeli Sh (2012) Investigation of biodegradation of an
aromatic compound in industrial waste water. Rom J Biochem
49(2):153–157
Esmaeili A, Kalantari M (2012) Bioremoval of an azo textile dye,
Reactive Red 198, by Aspergillus flavus. World J Microbiol
Biotechnol 28:1125–1129
Fusey P, Oudot J (1984) Relative influence of physical removal and
biodegradation in the depuration of petroleum-contaminated
seashore sediments. Mar Pollut Bull 15:136–141
Gallegos Martinez MG, Gomez Santoz AG, Gonzalez Cruz LG, De
Oca M, Garcia MA, Yanez Trujillo LY, Zermeno Eguia JA,
Gutierrez Rojas M (2000) Diagnostic and resulting approaches to
restore petroleum-contaminated soil in a Mexican tropical
swamp. Water Sci Technol 42:377–384
Glass NL, Donaldson GC (1995) Development of primer sets
designed for use with the PCR to amplify conserved genes from
filamentous ascomycetes. Appl Environ Microbiol
61:1323–1330
Husseien M, Amer AA, El-Maghraby A, Taha NA (2009) Availability
of barley straw application on oil spill clean-up. Int J Environ Sci
Technol 6:123–130
Jensen V (1975) Bacterial flora of soil after application of oily waste.
Oikos 26:152–158
Kachuei RMH, Yadeghari S, Rezaie A, Allameh N, Safaie FZ,
Khanezad Yazdi F (2009) Investigation of stored wheat myco-
flora, reporting the Fusarium cf. Langesethiae in three provinces
flora Iran during 2007. Ann Microbiol 59:383–390
Kirk PW, Gordon AS (1988) Hydrocarbon degradation by filamen-
tous marine higher fungi. Mycologia 80:776–782
Malik BS (1996) A laboratory manual of veterinary microbiology,
part III. Pathogenic bacteriology and mycology, 4th edn. Satish
Kumar Jain for CBS Publishers and Distributors, New York,
pp 137–146
Merkel N, Schultez-Kraft R, Infante C (2004) Phytoremediation of
petroleum contaminated soils in the tropics-preselection of plant
species from eastern Venezuela. J Appl Bot Food Qual
78:185–192
Mohsenzadeh F, Chehregani Rad A, Akbari M (2012) Evaluation of
oil removal efficiency and enzymatic activity in some fungal
strains for bioremediation of petroleum-polluted soils. Iran J
Environ Health Sci Eng 9(26–29):20
Sherman PW, Jarvis JUM, Alexander RD (1991) The Biology of the
Naked Mole-rat. Princeton University Press, Princeton
Smith JE, Berry DR, Andkristiansen B (1981) The filamentous fungi.
Volume H: fungal technology. Edward Arnold, London
Spain JC, Pritchard PH, Bourquin AW (1980) Effects of adaptation on
biodegradation rates in sediment/water cores from estuarine and
freshwater environments. Appl Environ Microbial 40:726–734
Verstraete W, Vanloocke R, DeBorger R, Verlinde A (1976)
Modelling of the breakdown and the mobilization of hydrocar-
bons in unsaturated soil layers. In: Sharpley JM, Kaplan AM
(eds) Proceedings of the 3rd international biodegradation
symposium. Applied Science, London, pp 99–112
Walker JD, Colwell RR (1974) Microbial degradation of model
petroleum at low temperatures. Microb Ecol 1:63–95
White TJ, Bruns T, Lee S, Taylor JW (1990) Amplification and direct
sequencing of fungal ribosomal RNA genes for phylogenetics.
In: Innis MA, Gelfan DH, Sninsky JJ et al (eds) PCR protocols: a
guide to methods and applications. Academic Press, San Diego,
pp 315–322
1276 Int. J. Environ. Sci. Technol. (2014) 11:1271–1276
123
