Content uploaded by Priscila Chaverri
Author content
All content in this area was uploaded by Priscila Chaverri on Feb 10, 2015
Content may be subject to copyright.
Phylogeny and taxonomic revision of Thelonectria discophora
(Ascomycota, Hypocreales, Nectriaceae) species complex
Catalina Salgado-Salazar & Amy Y. Rossman &
Gary J. Samuels & Yuuri Hirooka & Romina M. Sanchez &
Priscila Chaverri
Received: 3 September 2013 /Accepted: 29 January 2014 / Published online: 16 February 2014
#
Mushroom Research Foundation 2014
Electronic supplementary material The online version of this article
(doi:10.1007/s13225-014-0280-y) contains supplementary material,
which is available to authorized users.
C. Salgado-Salazar (*)
:
P. Chaverri
Department of Plant Science and Landscape Architecture, University
of Maryland, 2112 Plant Sciences Building, College Park,
MD 20742, USA
e-mail: salgadoc@umd.edu
A. Y. Rossman
:
G. J. Samuels
Systematic Mycology and Microbiology Laboratory, USDA-ARS,
Beltsville, MD 20705, USA
Y. H i r o ok a
Biodiversity (Mycology), Eastern Cereal and Oilseed Research
Centre, Agriculture and Agri-Food Canada, Ottawa, Ontario K1A
0C6, Canada
R. M. Sanchez
Centro de Recursos Renovables de la Zona Semiarida - Cerzos
Conicet, Universidad Nacional del Sur, Camino La Carrindanga
Km7, B8000FWB Bahía Blanca, Provincia de Buenos Aires,
Argentina
P. Chav e r ri
Escuela de Biología, Universidad de Costa Rica, Apartado,
11501-2060 San Pedro, San José, Costa Rica
Fungal Diversity (2015) 70:1–29
DOI 10.1007/s13225-014-0280-y
Abstract Specimens regarded as Thelonectria discophora
(Thelonectria, Nectriaceae, Hypocreales) constitute a con-
spicuous group of saprobic fungi on decaying plant material,
characterized by red perithecia each with a broad mammiform
(nipple-like) apex. The asexual state is characterized by a
cylindrocarpon-like morphology, with 3– 5 septate
macroconidia, unicellular microconidia and chlamydospores
that are rarely produced in culture. In the past, T. discophora
was regarded as one species with a wide geographic distribution.
However , a recent study rejected the monophyly and cosmopol-
itan distribution of this species, and showed the existence of at
least 16 cryptic species distributed in three main groups. By
combining the results of phylogenetic analyses of six nuclear
loci and morphological studies, we revised the taxonomy of the
T. discophora species complex, resulting in the description of 12
new species and four new combinations based on historic
names. Even though molecular phylogenetic analyses strongly
support the segregation of these species, and are in agreement
with previous studies, individual diagnostic morphological char-
acters for each species could not be identified. However , discrete
morphological traits corresponding to each of the three main
groups of species were discovered. Lineages could be differen-
tiated based on the average values of morphological traits as
well as the presence/abse nce of characteristic asexual propa-
gules and colony growth at 30C. Descriptions, illustrations are
provided for the reco gnized species.
Keywords New species
.
Rubus canker
.
Species concept
.
Taxonomy
Introduction
Specimens regarded as Thelonectria discophora (Mont.) P.
Chaverri & C. Salgado 2011 represent a complex of morpho-
logically similar species in the Nectriaceae ( Hypocreales,
Ascomycota). First described in 1835 from material collected
in Chile, T. discophora is the type species of the genus
Thelonectria P. Chaverri & C. Salgado. This species was
previously considered to have a cosmopolitan distribution
because it had been encountered on every continent, exclud-
ing Antarctica and the Arctic regions (Brayford et al. 2004),
and has been found in fungal diversity surveys throughout the
world (e.g., Samuels et al. 1990;Brayfordetal.2004;Guu
et al. 2007; Hirooka and Kobayashi 2007). Recent studies
have demonstrated that even though truly cosmopolitan fun-
gal species exist (James et al. 1999; Finlay 2002; Pringle et al.
2005; Fierer and Jackson 2006; Rydholm et al. 2006;Queloz
2 Fungal Diversity (2015) 70:1–29
et al. 2011), cosmopolitanism could not be found in the
T. discophora species complex, rather it is an assemblage of
morphologically similar but genetically divergent species
(Salgado-Salazar et al. 2013).
Species in the T. discophora complex occur in diverse
habitats and plant substrates, such as bark of twigs, branches
or trunks of recently dead or dying trees (Samuels et al. 1990;
Brayford et al. 2004; Guu et al. 2007). These cryptic species
show little intraspecific morphological variability. Perithecia
occur singly or in groups and are smooth, shiny, red to dark-
red colored, o ften with a broad mammiform (nipple-like)
apex. The ascospores are bicellular and colorless or pale
yellow with a spinulose surface. The asexual state produces
long, c urved, 3–5 septate macroconidia with round ends
(Booth 1966; Brayford et al. 2004; Chaverri et al. 2011).
Microconidia and chlamydospores are rarely reported. These
morphological characters described equally other species in
Thelonectria, such as T. lucida, making the accurate identifi-
cation of these species difficult when based solely on mor-
phological characters (Brayford et al. 2004).
Thelonectria discophora is among the first colonizers on
newly dead organic plant material (Samuels et al. 1990;
Brayford et al. 2004). It is common in disturbed areas with
recently fallen or cut plant material and is rarely found in old
growth forests (Chaverri and Vilchez 2006). Rarely collected
on living plant m aterial, one variety of this species,
“Neonectria” discophora var. rubi (Osterw.) Brayford &
Samuels 2004, has been associated with a distinctive basal
canker of cultivated Rubus idaeus and R. fruticosus (Brayford
1991;Cedeñoetal.2004). Even though this variety causes a
disease, it has been regarded as a secondary or weak pathogen
because the disease out breaks are mostly correlated with
stressed plants following wind damage or waterlogging
(Brayford 1991;Brayfordetal.2004). “ Neonectria”
discophora var. rubi belongs to Thelonectria; however, it
has not been formally transferred to this genus and has not
been included in molecular studies. Because T. discophora
was assumed to be common and cosmopolitan, many names
of morphologically similar species were considered taxonom-
ic synonyms (see Brayford et al. 2004; Chaverri et al. 2011).
Based on the modification of the code governing the names of
fungi, the generic name “Cylindrocarpon”, previously applied
to the asexual state of T. discophora, should no longer be used.
In spite of that, the names previously applied to the asexual
states of T. discophora and related species, C. ianthothele and
C. ianthothele var. majus, have not been formally recognized
as synonyms of T. discophora. The name Cylindrocarpon
sensu stricto is regarded as the asexual state name for
Neonectria sensu stricto and is thus a synonym of that generic
name (Chaverri et al. 2011; Rossman et al. 2013).
Because Thelonectria discophora was determined to be a
species complex (Salgado-Salazar et al. 2013), the main goal of
this paper is to provide a phylogenetic overview of the species
in this complex. Many recently collected and herbarium spec-
imens with their sexual and asexual states were studied, and
analyses were conducted using sequences from six nuclear loci.
These analyses combined with morphological observations
allowed us to assess the genetic and phenotypic diversity of
the group and assign species limits. Each species is defined
using molecular and informative morphological characters with
descriptions and illustrations to identify the species.
Materials and methods
Fungal isolates
A total of 77 isolates from different localities and hosts were
included in this study (Online Resource 1). From those, 56
correspond to Thelonectria cf. discophora,fiveto
“ Neonectria” discophora var. rubi,twoto
“Cylindrocarpon” ianthothele var. majus ,andoneto
C. ianthothele. “Cylindrocar pon ” ianthothele var. majus
and C. ianthothele ar e include d as they belong to the
T. discophora species complex (Salgado-Salazar et al. 2013).
Eight isolates representing T. lucida (Höhn.) P. Chaverri &
Salgado 2011, two representing T. t r a c h o s a (Samuels &
Brayford) P. Chaverri, C. Salgado & Samuels 2011, and four
representing T. westlandica (Dingley) P. Chaverri & C.
Salgado 2011 were used as outgroups in the phylogenetic
analyses. Specimens and cultures were obtained from CABI
Bioscience (IMI); Centraalbureau voor S chimmelcultures
(CBS); Japanese Ministry of Agriculture, Fisheries and Food
Collection (MAFF); New York Botanical Garden (NY); and
U.S. National Fungus Collection (BPI, G.J.S, A.R., now
deposited in CBS).
DNA extraction, PCR, sequencing and alignments
Strains listed in Table 1 were grown in Petri dishes (6 cm diam.)
containing Difco™ potato-dextrose broth.Plateswereincubat-
ed at 25ºC for ca. 1 week. DNA was extracted from the
mycelial mat harvested from the surface of the broth using the
PowerPlant™ DNA Isolation Kit (MO BIO Laboratories, Inc.,
Carlsbad, California, USA). Six nuclear loci were sequenced
for this study: partial large nuclear ribosomal subunit (LSU, ca.
900 bp), complete internal transcribed spacers 1 and 2 (ITS,
including 5.8S of the nuclear ribosomal DNA, ca.600bp),
partial β-tubulin (tub, ca. 500 bp), α-actin (act, ca. 600 bp),
RNA polymerase II subunit 1 (rpb1, ca. 700 bp), and transla-
tion elongation factor 1α (tef1, ca. 700 bp) (Table 1). These
nuclear loci are commonly used for phylogenetic studies of
nectriaceous fungi proving useful for species level studies
(Chaverri et al. 201 1; Hirooka et al. 2012; Salgado-Salazar
et al. 2012). Protocols for PCR were carried out as described
by Chaverri et al. (2011). Clean PCR products were sequenced
in both directions at the University of Maryland DNA
Sequencing Facility (Center for Agricultural Biotechnology,
University of Maryland, College Park, Maryland, USA).
Sequences were assembled and edited using the program
Sequencher 4.9 (Gene Codes, Madison, Wisconsin, USA).
Alignments were performed using PRANK (Loytynoja and
Goldman 2005) implemented by The GUIDANCE Server
(http://guidance.tau.ac.il/index.html,Pennetal.2010)using
default settings.
Concatenated phylogenetic analyses
Posterior distributions of trees were reconstructed from the
combined nuclear genes using Bayesian Inference analysis
(BI) in MrBayes v. 3.1 (Huelsenbeck et al. 2001; Ronquist
and Huelsenbeck 2003). Previous studies by Salgado-Salazar
et al. (2013) using the program CONCATERPILLAR v1.4
(Leigh et al. 2008) detected phylogenetic incongruence be-
tween the ITS loci and the rest of the data sets (act, LSU, tef1,
tub, rpb1) (See Figures 4S and 5S in Salgado-Salazar et al.
2013). It was determined that this incongruence did not affect
the recovery of the true species relationships, as it has no effect
in the species tree reconstruction using dif ferent appro aches
(Salgado-Salazar et al. 2013). Consequently, a combined data
set was directly created to obtain the total evidenc e phylogeny
from which to infer the relationship between cryptic species.
JModeltest v 0.1.1 (Posada 2008) was used to determine the
best nucleotide substitution model using AIC criteria (Table 2).
For the concatenated analyses, we used a partitioned approach
with model parameters estimated previously. The analyses were
initiated from random starting trees, run for 15 million gener-
ations with four chains (Metropolis-coupled Markov Chain
Monte Carlo, Huelsenbeck and Rannala 2004)andsampled
at intervals of 1000 generations . Default priors were used in all
analyses. Two independent BI analyses were run. To evaluate
stationarity and convergence between runs, log-likelihood
scores were plotted using TRACER v. 1.5 (Rambaut and
Drummond 2007). T rees generated prior to stationarity were
discarded and the rest of the trees were summarized in a
majority-rule consensus tree from the four independ ent runs
(Huelsenbeck et al. 2001). Bayesian posterior probabilities (PP)
were assessed at all nodes, and clades with PP ≥0.95 were
considered well supported (Huelsenbeck and Rannala 2004).
Maximum likelihood (ML) analyses were performed in
RAxML (Stamatakis 2006), using the RAxML GUI vs. 1.1.1
(Silvestro and Michalak 2012). Branch support was assess ed
with 1000 nonparametric bootstrapping replicates using the
same model parameters settings as BI analyses. Final trees were
visualized with FigTree v1.3.1 (Rambaut 2005).
In order to better visualize differenc es among clades, we
calculated nucleotide divergence (Dxy, pairwise average
number of nucleotide substitutions per site between groups;
Nei 1987) using the program DnaSP v.5 (Librado and Rozas
2009). For these calculations, groups to be compared were
defined based on clade assignment of each individual in the
concatenated ML and Bayesian phylogeny. The randomization
test to assess the significance of Dxy values between groups of
clades was calculated using 1000 permutations in DnaSP v.5
(Hudson et al. 1992
; Librado and Rozas 2009). Singletons or
orphan isolates were not included in these calculations since
these methods compare clades of multiple isolates.
Morphological studies
The morphology of species in the T. discophora complex
including specimens and associated cultures was studied ac-
cording to Salgado-Salazar et al. (2012). For the sexual state,
only the length and width of ascospores were recorded, as these
are the most informative characters (Samuels et al. 1990;
Brayford and Samuels 1993; Samuels and Brayford 1994).
The asexual structures studied on SNA (Synthetic Nutrient-
Deficient Agar, Nirenberg 1976), SNA + soil extract, and ¼
Table 1 List of molecular markers and descriptive statistics for the six loci used in this study
Locus Substitution
model
Aligned
length
Variable
sites (%)
Parsimony
informative
sites (%)
%GC Primers Reference
act GTR + I + G 550 20 (3.6) 60 (10.9) 56.6 F 5′TGGCACCACACCTTCTACAATGA3′ Samuels et al. 2006
R5′TCCTCCGCTTATTGATATGC3′
ITS TPM2uf + I + G 723 24 (3.3) 107 (14.8) 55.4 F 5′GGAAGTAAAAGTCGTAACAAGG3′ White et al. 1990
R5′TCCTCCGCTTATTGATATGC3′
LSU TrN + I + G 808 7 (0.8) 53 (6.5) 53.7 F 5′ACCCGCTGAACTTAAGC3′ Vilgalys n.d.
R5′TCCTGAGGGAAACTTCG3′
tef TPM3uf + I + G 955 49 (5.1) 194 (20.3) 55.7 F 5′CATCGAGAAGTTCGAGAAGG3′ Carbone and Kohn 1999
R5′ACHGTRCCRATACCACCRAT3′
tub TrN + G 588 44 (7.4) 172 (29.2) 56.5 F 5′AACATGCGTGAGATTGTAAGT3′ O’Donnell and Cigelnik 1997
R5′TAGTGACCCTTGGCCCAGTTG3′
rpb1 TrN + I + G 642 29 (4.5) 230 (35.8) 53.3 F 5′CAYCCWGGYTTYATCAAGAA3′ Castlebury et al. 2004
R5′CCNGCDATNTCRTTRTCCATRTA3′
Fungal Diversity (2015) 70:1–29 3
PDA (Difco potato-dextrose-agar) media were incubated under
a day/night light treatment for the required time to observe
conidiation. Growth rates and colony characteristics were de-
termined on plates containing 20 mL of PDA inoculated with 4-
mm-diam mycelium plugs. Four different temperatures were
evaluated, namely 15, 20, 25, 30; cultures growing at 20C were
selected to describe colony characteristics and standard growth.
Color terminology is based on Rayner (1970).
Statistical analysis of morphological characters
Measurements of continuous characters for both asexual and
sexual structures (length, width) were mad e using Scion
Imagesoftwarev.4.0.2(Scion Corporation, Frederick,
Maryland, USA) and are based on 30 units per structure.
Descriptive statistics for the morphological characters, such
as mean, minimum and maximum values, standard deviation
and 95 % confidence intervals, were obtained using SYSTAT
Software v. 12.02.00 (Systat Software Inc. Chicago, Illinois,
USA). Ranges are reported as the extremes (maximum and
minimum) in brackets separated by the mean ± one standard
deviation, followed by average values.
Results
Phylogenetic analyses
The nucleotide sequences generated in this study were depos-
ited in GenBank (Online Resource 1). The concatenated data
set including the six loci contained 4306 characters of which
3317 were constant, 173 parsimony-uninformative, and 816
parsimony informative (Table 1). The data from the
concatenated data set have been deposited under doi:10.
5061/dryad.q3s66 at the DRYAD data repository (http://
datadryad.org/).
Based on the concatenated phylogenetic analyses, a total of
16 cryptic species in the Thelonectria discophora species
complex were recovered, having significant ML bootstrap
(>70 % ) and B I posteri or probabil ity (>0.95 ) support
(Fig. 1). The ML best tree topology shown in Fig. 1 was the
same as the majority rule consensus tree from MrBayes anal-
ysis; consequently only ML best tree topology is shown in
Fig. 1. The majority of the internal nodes in the phylogeny are
resolved and well supported, and the topology of the tree
obtained using the combined data set corresponds to the
species tree inferred in previous studies (Salgado-Salazar
et al. 2013). The 16 cryptic species group into three large
groups: the first containing clades I to VI, the second contain-
ing clades VII to X, the third containing the clades XIII to XV.
Clades XI and XII appear basal to clades I to X and are
Table 2 Nucleotide divergence (Dxy*) for all pairwise comparisons of putative species identified within T. discophora species-complex. All positions
containing gaps were eliminated for a total of 3559 positions. Numbers across the top row correspond to putative species numbers in the first column
12345678910111213141516
1. T. purpurea
2. T . violaria 0.004
3. T. brayfordii 0.006 0.008
4. T. pinea 0.006 0.008 0.002
5. T. japonica 0.008 0.010 0.007 0.007
6. T. ianthina 0.013 0.015 0.009 0.009 0.013
7. T. conchyliata 0.014 0.013 0.012 0.012 0.013 0.015
8. T. phoenicea 0.016 0.015 0.014 0.013 0.013 0.017 0.008
9. T. porphyria 0.012 0.012 0.011 0.010 0.011 0.014 0.009 0.008
10. T. tyrius 0.013 0.012 0.012 0.011 0.012 0.016 0.009 0.009 0.005
11. T. ostrina 0.026 0.026 0.025 0.025 0.026 0.028 0.023 0.024 0.022 0.023
12. T. blattea 0.035 0.036 0.034 0.033 0.033 0.037 0.034 0.034 0.031 0.033 0.034
13. T. mammoidea 0.061 0.062 0.060 0.059 0.059 0.063 0.061 0.060 0.058 0.058 0.064 0.057
14. T. discophora 0.057 0.058 0.056 0.055 0.055 0.058 0.057 0.055 0.054 0.056 0.059 0.052 0.031
15. T. asiatica 0.054 0.055 0.053 0.052 0.052 0.054 0.053 0.052 0.051 0.052 0.056 0.048 0.028 0.015
16. T. rubi 0.044 0.045 0.043 0.042 0.044 0.046 0.043 0.044 0.042 0.043 0.048 0.039 0.046 0.044 0.040
*p<0.001
4 Fungal Diversity (2015) 70:1–29
Fig. 1 Majority rule Bayesian phylogram showing relationships among
isolat es of Thelonectria dis cophora-like species based on the
concatenated analysis of six loci. Thick branches indicate Bayesian
posterior probabilities >0.95 and ML bootstrap >70 %. No thick
branches indicate branch was not recovered/supported. “*” indicates the
start of T. discophora species complex. Underlined isolates indicate ex-
type cultures. Thelonectria lucida, T. t r a c h o s a and T. westlandica were
used as outgroups
Fungal Diversity (2015) 70:1–29 5
6 Fungal Diversity (2015) 70:1–29
surrounded by singletons (single-isolate lineages) (Fig. 1).
Isolates of “Cylindrocarpon” ianthothele var. ianthoth ele
(=Neonectria discophora var. rubi), known to be pathogenic
to Rubus spp. (clade XVI), were recovered as the most basal
clade of the group being distantly related to the rest of
T. discophora-like species and even to the outgroup species
T. l u c i d a . Since the type specime n of T. discophora was
originally described from Chile, clade XV (Fig. 1)ishere
recognized as the type clade thus as true T. discophor a.
Three other cryptic species and three singletons are closely
related to the type clade (XV), which include isolates from
China and Japan (clade XVI), and New Zealand, Scotland and
Switzerland (clade XIII).
In total, nine isolates were found to be singletons. These
singletons or orphan isolates either do not cluster with the
closest related putative species having significant branch sup-
port, i.e., the branch support decreases if they are included, or
they are separated from them by a long branch (Fig. 1). Single
gene tree analyses recovered the 16 putative species an d
singletons a s observed in the concatenated analyses (see
Salgado-Salazar et al. 2013). In the single gene phylogenies,
the Bayesian and ML analyses recovered the same clades.
However, the species positions in the trees and those of some
singleton isolates differ from the positions seen in the com-
bined analyses (data not shown). Although some of the clades
were not significantly supported, they were also not contra-
dicting the general clustering, consequently fitting the criteria
for species delimit ation us ing genea logic al concor danc e
(Dettman et al. 2003).
Zeng and Zhuang (2013) reported two new species with
affinities to the T. discophora species complex, T. beijingensis
Z.Q. Zeng, J. Luo & W.Y. Zhuang 2013 and T. yunnanica
Z.Q. Zeng & W.Y. Zhuang 2013, based on a phylogenetic
analysis of ITS and partial β-tubulin regions. To investigate
the relationship of these species to T. discophora species
complex, we constructed a two-loci (ITS + tub)datasetof
the isolates used in this study and those by Zeng and Zhuang
(2013) and analyzed it using ML analysis following the set-
tings included in Materials and Methods. As depicted by
Online Resource 2, T. beijingensis clusters with isolate
MAFF241569, here identified as a singleton lineage, and
T. yunnanica clusters with isolates of T. ostrina.
Genetic distances, as measured by Dxy values obtained
between all pairs of species, ranged from 0.002 to 0.064
(Table 2). The highest average genetic distances were ob-
served between groups of clades 1 (I–XII) and 2 (XIII–XV)
with values ranging from 0.031 to 0.064. The species contain-
ing the pathogenic isolates (clade XVI) is the most distantly
related to groups 1 and 2, with genetic distances ranging from
0.039 to 0.048 (Table 2). The species T. brayfordii and
T. pinea showed the lowest genetic divergence in the group
of species (0.002). The degree of genetic distance between
pairs of species was not related to geographic distance. For
example, T. brayfordii and T. mammoidea contain isolates
from New Zealand (Table 2)
Ecology and geographic distribution of species
Even though geographical segregation at various levels was
observed, it is not a strong character for defining species in
this complex (Online Resource 1, Fig. 1). From the combined
phylogenetic analyses, we could observe species consisting of
isolates from the same geographic region (T. brayfordii, T.
japonica, T. pinea, T. porphyria, T. tyrus); isolates from close
regions (T. blattea, T. conchyliata, T. phoenicea, T. purpurea);
and isolates from distant regions (T. ianthina, T. mammoidea,
T. ostrina, T. violaria, among others) (Online Resource 1,
Fig. 1). Interestingly, a correlation with ecology was observed
for all species. With the exception of T. blattea, the isolates of
most species were collected in their sexual state, i.e., as
sporocarps (perithecia) on decaying plant material. Isolates
in T. blattea were collected as saprobes in soil in their asexual
state. One isolate of T. mammoidea (CBS 32881) was also
collected in its asexual state (Online Resource 1;Brayford
1991). Thelonectria rubi, a plant pathogen on several species
of Rubus, was also collected in its sexual state. None of the
remaining species has been found on Rubus and causing
disease. Isolates in the outgroup and sister species T. lucida,
T. trachosa and T. westlandica were collected in the sexual
state on decaying plant material. Based on our observations,
no host specificity was shown by the putative species, except
for T. pinea, which here is redefined to include T. discophora-
like isolates collected on Pinus radiata in New Zealand. One
isolate belonging to T. mammoidea was collected on Pinus
radiata (ICMP 5287). These species can be distinguished
based on growth rate at 25C, morphology and genetic diver-
gence estimates. The lack of information about the host on
which some of the species were collected makes it impossible
to reach a definite conclusion about host specificity or prefer-
ence (Online Resource 1).
Morphological analyses
Sexual state
We could not detect significant differences in the morphology
of the sexual state. The variation in perithecial morphology,
such as size, formation of flattened ostiolar disk or appearance
of the external layer of cells in the wall of perithecia, and the
size of asci and ascospores do not present discontinuities. A
high intraspecific variation of these characters could be seen in
each one of the species, including those described by Zeng
and Zhuang (2013). Ascospore size ranges from 10 to 15×4–
6 μm in all species. Thelonectria phoenicea has on average
the smallest ascospores (10.6×4.7 μm), and T. mammoidea
Fungal Diversity (2015) 70:1–29 7
and T. pinea have on average the largest ascospores (16.5×
7.4 μmand18×7.5μm, respectively).
Asexual state
As the published descriptions of T. discophora have stated
(Booth 1966; Samuels et al. 1990;Brayfordetal.2004;Guu
et al. 2007; Chaverri et al. 2011), the asexual state produces
characteristic purple to cinnamon-colored colonies and pig-
ments in the media, with the intensity of the color varying
from species to species and dependent on growth temperature
(See Taxonomy section). Higher quantities of pigments are
produced when colonies are grown at low temperatures (15C),
and none of the species, except T. tyrus, produced pigments at
high temperatures such as 30C. Zeng and Zhaung (2013)did
not report pigments diffusing in media by T. beijingensis and
T. yunnanica. In all species in the T. discophora complex,
optimum temperatures for colony growth range between 20
and 25C; however, reduced colony growth can be observed at
15C. Only six species (T. conchyliata, T. ianthina, T. ostrina,
T. phoenicea, T. porphyria, T. tyrus) showed the ability to grow
at 30C (Online Resource 3). There are no significant differ-
ences among the species growing at 15C, 20C and 30C;
however, significant differences at 25C among T. asiatica, T.
discophora, T. mammoidea and T. rubi and the rest of the
species could be observed (Online Resource 3). These species
mentioned above have low growth rates at 25C when com-
pared with the rest of the species in the complex.
The morphological characters of the asexual state are more
informative than those of the sexual state. As opposed to the
previously published description of members in the genus
Thelonectria (Booth 1966; Samuels et al. 1990; Brayford
et al. 2004;Chaverrietal.2011), we observed that, although
rare, some species produce microconidia and chlamydospores
in culture. Two species (T. asiatica and T. r u b i )inthe
T. discophora complex produce microconidia and T. blattea
produces chlamydospores in culture. None of the remaining
species in the complex produce microconidia or chlamydo-
spores in culture.
Macroconidia in the T. discophora complex present the
typical ‘cylindrocarpon’ shape, with long conidia that can be
cylindrical and straight or curved with round ends. The num-
ber of septa, which varies from 1 to 6, is a characteristic of
groups of species. Thus, macroconidia of Thelonectria
asiatica and T. v i o l a r i a are 1–3 septate;
T. pinea 1–4;
T. t y r u s 2–5 septate; T. b r a y f o rd i i , T. mammoidea, T.
phoenicea and T. p u r p u re a 1–5 septate; T. conchyliata,
T. discophora, T. ianthina and T. porphyria 3–5septate;and
T. blattea, T. japonica and T. ostrina 3–6 septate. The differ-
ences in septation among species do not correlate with bioge-
ography or genetic divergence. Among these species, the
ability to produce a certain number of septa has been gained
and lost multiple times over their evolutionary history (Fig. 1,
Online Resource 3). Thelonectria asiatica and T. violaria are
the only species to produce 1–3 septate macroconidia; how-
ever, T. asiatica produces microconidia in culture. Among the
species that produce 1-septate macroconidia, T. phoenicea and
T. rubi, showed length sizes significantly smaller than the
other species with this character. Thelonectria rubi has the
smallest 1-septate macroconidia, significantly different from
T. phoenicea (Online Resource 3). Among the species that
produce them, T. japonica and T. ostrina have significantly
longer 6-septate macroconidia compared to T. asiatica and
T. blattea. In species having 2–5 septate macroconidia, the
size is overlapping with values that are not significantly dif-
ferent, even t hough average values are slightly di fferent.
There are no differences in width of micro- and macroconidia,
whose values range from 4 to 7 μm, nor in length and width of
phialides.
Thelonectria beijingensis and T. yunnanica have clear ge-
netic affinities with species in the T. discophora complex;
however, discrepancies were observed in the morphology
presented by Zeng and Zhuang (2013) and the one provided
here. In the phylogenetic analyses, T. beijingensis clusters with
T. ostrina; however, the description of the morphological
characters of T. beijingensis does not a gr ee with that of
T. ostrina. Thelonectria beijingensis produces microconidia
and 1–3 septate macroconidia in culture. On the other hand,
T. ostrina described here does not produce microconidia and
macroconidia are 3–6septate.Thelonectria yunnanica is also
reported to produce microconidia in culture; however, the
isolate MAFF241569 from Japan does not produce them in
culture.
Ta x o n o m y
We use a combination of phylogenetic analyses, DNA se-
quence divergence tests and morphological observations to
define spe cies i n the Thelonectria discophora co mplex.
Because these species show extensive morphological
conservationism, confident species recognition can only be
achieved when these three analyses are combined. Sixteen
lineages that correspond to species ar e described here as
new. For the newly described species only a brief description
is provided, mainly including t hose characters that are
different or diagnostic from the narrowly defined true
T. discop h ora . Based on the modification of the code of
nomenclature (Hawksworth 2011), the generic name
“Cylindrocarpon”, which was previously applied to the
asexual state of T. discop hora, sh ould not be used
(Rossman et al. 2013). Cylindrocarpon names related
to T. discophora are here regarded as synonyms of the
T. discophora species described below. For a detailed
description of the perithecial anatomy of T. discophora,
see Samuels et al. (1990) and Chaverri et al. (2011).
8 Fungal Diversity (2015) 70:1–29
Thelonectria discophora (Mont.) P. Chaverri & C. Salgado
Mycobank MB518569
Figure 2a–f.
Basionym: Sphaeria discophora Mont., Ann. Sci. Nat.
Bot. II 3: 353. 1835.
≡ Neonectria discophora (Mont.) Mantiri & Samuels.,
Canad. J. Bot. 79: 339. 2001
= Nectria tasmanica Berk. in Hooker, Flora Tasmaniae 2:
279. 1860.
= Nectria umbilicata Henn., Hedwigia 41: 3. 1902.
= Creonectria discostiolata Chardón, Bol. Soc. Venez. Ci.
Nat. 5: 341. 1939.
Holotype of Sphaeria discophora: Chile. Juan Fernandez,
sur cortice arborum, date unk nown, Bertero 1700 (PC!;
ISOTYPE PC!).
Description. Mycelium not visible on host. Perithecia glo-
bose to subglobose, (250–)300–550(−650) μm high,
(100–)240–300(−400) μm wide, surface smooth and shiny
or slightly roughened, solitary or gregarious in groups of 20
or less, superficial or with the base immersed in substratum on
a minute stroma, not collapsed when dry, red to rust with the
ostiolar area often darker (chestnut), red to rose in 3 % KOH,
yellow in lactic acid, nonpapillate or with a broad mammiform
apex 150–200 μm wide. Cells at surface of perithecial wall
lacking a definite outline, appearing to be intertwined hyphae
with lumina irregular in shape 2–2.5 μm, 2–4 μm thick.
Perithecial wall 30–50 μm wide of two intergrading regions:
outer region 20–30 μm wide, continuous over perithecium to
form a un iform palisade of hyphal cells perpendicular to
surface of perithecium, lumina <1 μm wide and tips rounded;
inner region of perithecial wall 10–20 μm wide, cells lacking a
definite outline but with long axes parallel to surface of
perithecial wall, cells increasingly more compacted, thin-
walled towards perithecial locule; perithecial apex of vertical-
ly elongated cells, continuous with lateral perithecial wall
forming a disk around perithecial opening. Asci cylindrical
to clavate, (66–)72–95(−
119)× 7–10(−15) μm, 8-spored, apex
with a refractive ring. Ascospores ellipsoid to fusiform,
(10.5–)11.5–15.5(−16.5)×(4.5–)5.0–6.5(−7. 0) μm(mean
13.5×5.5 μm), symmetrically two-celled, sometimes with
one side curved and one side flattened, not constricted at
septum, spinulose, hyaline becoming yellowish. Colonies on
PDA 17–28 mm diam (mean 23 mm) after 12 day at 20C,
aerial mycelium floccose, mauve to pale vinaceous, producing
purple pigment into media at 15–20C, no pigment produced at
>20C, colony reverse mauve to dark vinaceous. Conidia on
SNA forming in hyaline, slimy droplets in aerial mycelium or
on agar surface; pionnotes sometimes formed close to filter
paper on SNA. Phialides borne apically on irregularly
branching clusters of cells or directly from hyphae, cylindrical
or slightly swollen (13–)16–20.5(−23.5)×(−2.5)3.5–4.5(−5)
μm (mean 18×4), with periclinal thickening and collarette.
Macroconidia slightly fusiform, curved with round ends, 3–
5(−6)-septate: 3-septate (40.5–)47–59(−71.5)×(4.5–)5–6(−7)
μm (mean 53.5 ×5.5 μm), 4-septate (44.5– )55–
67.5(−74.5)×(4.5–)5–6(−6.5) μm (mean 61×5.5 μm), 5-
septate (60–)65.5–77(−82.5)×(4.5–)5–6(−6.5) μ
m (mean
71×6 μm). Microconidia and chlamydospores not produced
on SNA.
Habitat and distribution. Saprobic on decaying bark of
shrubs and trees. Known from Chile (type locality) and
Scotland; possibly distributed in temperate regions of
Europe and the Americas.
Additional specimens ex amined: CHILE. Llanquihue
Province: Los Lagos Region, Vicente Perez Rosales
National Park, on wood of a recently killed Tepualia stipularis
tree, April 2011, Andrés de Errasti (BPI 892687, culture A.R.
4742 = CBS 134034). SCOTLAND. Cowal Peninsula, Argyll
Forest Park, ca. 10 km north of Dunoon, Yourger Botanic
Garden 50–100 m, on Aesculus sp. dead branchlets, 11–13
April 1992, G.J. Samuels, D. Brayford (BPI 802901, culture
G.J.S. 92–48 = CBS 134031).
Notes. As a result of the phylogenetic analysis, the follow-
ing names are no longer considered synonyms of
T. discophora because of their distinctive genetic divergence:
Nectria mammoidea (≡ Creonectria mammoidea),
N. mammoidea var. minor, N. mammoidea var. rugulosa
N. nelumbicola and N. pinea.
Thelonectria asiatica C. Salgado & Hirooka sp. nov.
Mycobank MB807886
Figure 2g–m.
Diagnosis. Similar to T. discophora,microconidiapresent,
macroconidia 1–3septate.
Holotype. JAPAN. Nagano Prefecture, Sugadaira, Ueda
City, on twigs, 02 Sept 2006, Y. Hirooka TPP-h548 (BPI
881963, ex-type culture MAFF 241576).
Etymology. Refers to the geographic range where this spe-
cies is found.
Description. Mycelium not visible on host. Perithecia glo-
bose to subglobose, 300–600 μm high, 200–300 μm wide,
surface smooth and shiny or slightly roughened, solitary or
gregarious in groups of 20 or less, superficial or with the base
immersed in substratum on a minute stroma, not collapsed
when dry, peach to orange with ostiolar area often darker
(rust), red to rose in 3 % KOH, yellow in lactic acid,
nonpapillate or with a small mammiform apex 50–100 μm
wide. Cells at surface of perithecial wall lacking a definite
outline, appear ing to be intertwined hyphae with lumina,
irregular in shape 2–2.5 μm, 2–4 μ
m thick. Perithecial wall
30–50 μm wide. Asci cylindrical, (68–)75–98(−119)×7–
10 μm, 8-spored, apex with a refractive ring. Ascospores
ellipsoid to fusiform, (13–)14–15.5(−16)×(4.5–)5–6(−6.5)
Fig. 2 a–f Thelonectria discophora sensu stricto. g–m Thelonectria
asiatica.A.T. discophora sensu stricto perithecia (A.R. 4742 = BPI
892687). b, c Asci and ascospores in KOH and cotton blue (G.J.S. 92–
48 = BPI 802901). d Macroconidia on SNA (G.J.S. 92–48 = CBS
134031). e Colony on PDA (A.R. 4742 = CBS 134034). f Colony reverse
on PDA (A.R. 4742 = CBS 134034). g T. asiatica perithecia (MAFF
241576 = BPI 881963). h, i Asci and ascospores in KOH and cotton blue
(MAFF 241576 = BPI 881963). j, k Conidiophores, macroconidia and
microconidia on SNA (G.J.S. 88–84 = IMI 348190). l Colony on PDA
(MAFF 241576). m Colony reverse on PDA (MAFF241576). Bars: a, g
=500μm; b–d, h–k =50μm
Fungal Diversity (2015) 70:1–29 9
10 Fungal Diversity (2015) 70:1–29
μm (mean 14.5×5.5 μm), symmetrically two-celled, some-
times with one side curved and one side flattened, not
constricted at septum, spinulose, hyaline. Colonies on
PDA 16–1 7 mm diam after 1 2 day at 20C, aerial
mycelium floccose, pale vinaceous to lilac, producing
purple to cinnamon pigment into media at temperatures
≤25C, no pigment produced at >25C, colony reverse
sienna to livid purple. Conidia on SNA forming in
hyaline, slimy droplets in aerial mycelium or on agar
surface; pionnotes sometimes formed close to filter pa-
per on SNA. Phialides borne apically on irregularly
branching clusters of cells or directly from hyp hae,
cylindrical or slightly swollen (13.5– )18.5–
26.5(−30.5)×(−2.5)3–4(−4.5) μm (mean 22.5×3.5), with
periclinal thickening and collarette. Macroconidia cylin-
drical or slightly fusiform, curved with round ends, 1–3-
septate: 1-septate (20– )28.5– 40.5(− 50) ×(3.5– )4–
5.5(−6.5) μm (mean 34.5×5 μm), 2-septate (32–)37.5–
48.5(−54)×(3.5–)4.5–5.5(−6) μm(mean42.5×5μm), 3-
septate (34–)42.5–52(−57.5)×(4–)4.5–6(−7) μm (mean
47×5 μm). Microconidia produced in culture, cylindri-
cal with round ends, (6.5–)7–9(−9.5) μm (mean 8×
4 μm). No chlamydospores formed in culture.
Habitat and distribution. Saprobic on decaying bark of
shrubs and trees. Known from Japan (type locality) and
China. Possibly distributed throughout Asia.
Additional culture examined. CHINA. Yunnan Province,
Lijiang region, on bark submerged in stream, 4 Nov 1988,
R.P. Korf (only culture examined G.J.S. 88 –84 = IMI
348190).
Notes. This species is sister to the type clade. It produces
microconidia in culture and 1–3-septate macroconidia, both of
which are lacking in true T. discophora. Two additional newly
described species from Taiwan, T. beijingensis and
T. yunnanica, are reported to be related to T. discophora and
produce microconidia in culture (Zeng and Zhuang 2013). As
explained in the results and discussion section, there is dis-
agreement about the species reported in this study and those
by Zeng and Zhuang (2013).
Thelonectria blattea C. Salgado & P. Chaverri sp. nov.
Mycobank MB807887
Figure 3a–f.
Diagnosis. Only known from the asexual state. Asexual
state similar to T. discophora. Isolated from soil.
Holotype. GERMANY. Kiel-Kitzeberg, in wheat field soil,
Dec 1968, W. Gams (BPI 892880, ex-type culture CBS
95268).
Etymology. Refers to the purple appearance of the colony
of this fungus.
Description. Colonies on PDA 32–35 mm diam (mean
33 mm) after 12 day at 20C, aerial mycelium floccose, white
to livid vinaceous, no pigment produced into media, colony
reverse also white to livid vinaceous. Conidia on SNA
forming in hyaline, slimy droplets in aerial mycelium or on
agar surface; pionnotes sometimes formed close to filter paper
on SNA. Phialides borne apically on irregularly branching
clusters of cells or directly from hyphae, cylindrical or slightly
swollen (13–)16–20.5(−23.5)×(−2.5)3.5–4.5(−5) μm(mean
18×4 μm), with periclinal thickening and collarette.
Macroconidia cylindrical or slightly fusiform, curved with
round ends, 3– 5(− 6)-septate: 3-septate (40.5– )47–
59(−71.5)×(5–)6–7(−8) μm (mean 54.5×6.5 μm), 4-septate
(42–
)55–67.5(−74)×(6–)6.5–7(−7.5) μm (mean 60.5×
6.5 μm), 5-septate (45.5–)60–70(−84)×(6–)6.5–6.8(−7) μm
(mean 63×6.6 μm), 6-septate (55–)58.5–63.5(−76)×(3.5–)4–
4.5(−5) μm(mean60×6.5μm). Microconidia not produced
in culture. Chlamydospores globose to subglobose formed in
culture (mean 8.5×7.5 μm),
Habitat and distribution. Isolated from soil in agricultural
settings. Known from Germany and The Netherlands.
Additional culture/specimens examined. THE
NETHERLANDS. Wageningen, on roots in clay soil, Jan
1977, J.W. Veenbaas-Rijks (culture CBS 14277).
Thelonectria brayfordii C. Salgado & Samuels sp. nov.
Mycobank MB807888
Figure 3g–l.
Diagnosis. Similar to T. discophora.Macroconidia1–5-
septate, found only in New Zealand on hosts other than
Pinus radiata.
Holotype. NEW ZEALAND. Auckland, on Quercus robur,
March 2005, C.F. Hill (BPI 892881, ex-type culture CBS
118612).
Etymology. In honor of David Brayford, a British mycolo-
gist who contributed greatly to the taxonomy of hypocrealean
fungi.
Description. Colonies on PDA 31–34 mm diam (mean
32 mm) after 12 day at 20C, aerial mycelium floccose, white
to mauve, purple to cinnamon pigment diffusing into media at
temperatures ≤25C, no pigment produced at >25C, colony
reverse rosy vinaceous to rust. Conidia on SNA forming in
hyaline, slimy droplets in aerial mycelium or on agar surface;
pionnotes sometimes formed close to filter paper on SNA.
Phialides borne apically on irregularly branching clusters of
cells or directly from hyphae, cylindrical or slightly swollen
(13.5–)14.5
–22.5(−29.5)×(−3.0)3.5–4.5(−5) μm (mean
18.5×4 μm), with periclinal thickening and collarette.
Macroconidia cylindrical or slightly fusiform, curved with
round ends, 1– 5-septate: 1-septate (23– )28–
38.5(−44)×(3–)3.5–4.5(−5) μm(mean33×4μm), 2-septate
(30–)36.5–56.5(−58)×(4–)4.5–6(−6.5) μm (mean 51.5×
5.5 μm), 3-septate (65.5–)50.5–59.4(−65.5)×(4.5–)5–6(−7)
μm (mean 55 ×5.5 μ m), 4-septate (49.5– )56.5–
66(−72.5)×(4.5–)5.5–6.5(−7) μm (mean 61×6 μm), 5-
septate (55.5–)63.5–71.5(−77. 5)×(5–)5.5–6.5(−7.5) μm
(mean 67.5×6 μ
m). Chlamydospores and microconidia not
produced in culture.
Habitat and distribution. On decaying bark of Quercus
robur and roots of various plants. Known only from New
Zealand.
Additional specimens examined. NEW ZEALAND. Bay of
Plenty, Tauranga locality, on rotting root of unknown
proteaceous plant, April 1 2000, C.F. Hill (culture only
Fig. 3 a–f Thelonectria blattea. g–l Thelonectria brayfordii. a–b
T. blattea conidiophores and macroconidia on SNA (CBS 14277). c
Colony on PDA (CBS 14277). d Colony re verse on PDA (C BS
14277). e Colony on PDA (CBS 95268). f Colony reverse on PDA
(CBS 95268). g–hT. brayfordii macroconidia on SNA (ICMP 14105). i
Colony on PDA (ICMP 14015). j Colon y reverse on PD A (ICMP
14105). k Colony on PDA (IMI 384045). l Colony reverse on PDA
(IMI 384045). Bars: a–b, g–h =50μm
Fungal Diversity (2015) 70:1–29 11
12 Fungal Diversity (2015) 70:1–29
ICMP 14105). Ibid. on root of unknown dead plant, April
2000, H.M. Dance, LYN10 (culture only IMI 384045).
Notes. The description of this species is based only on
characters obtained from the asexual state. Three species in
the T. discophora complex occur in New Zealand,
T. brayfordii, T. mammoidea and T. pinea. However T. pinea
occurs only on P. radiata and has macroconidia 1–4-septate,
and T. mammoidea is genetically highly divergent.
Thelonectria conchyliata C. Salgado & P. Chaverri sp. nov.
Mycobank MB MB807889
Figure 4a–g.
Diagnosis. Similar to T. discophora. Macroconidia 3–5
septate, average colony diameter on SNA at 30C >13 mm
after 12 days.
Holotype. GUYANA. Cuyuni-Marazuni: Mazaruni
Subregion, VII-2, along Koatse river, ca. 2 km east of Pong
River, ca. hr walk west of Chinoweing, 05°28′N60°04′W,
600–650 m, Feb-March 1987, on wood, G.J. Samuels, J.
Pipoly, G. Gharbarran, J. Chin, R. Edwards (BPI 747133,
ex-type culture G.J.S. 87–45 = IMI325855).
Etymology. Refers to the purple color of the colony and
pigment that this species produces in culture.
Description. Mycelium not visible on host of some speci-
mens. Perithecia globose to subglobose, 400–500 μmhigh,
340–400 μm wide, surface smooth, shiny or slightly rough-
ened, solitary or gregarious in groups of 20 or less, superficial
or with base immersed in substratum on a minute stroma, not
collapsed when dry, peach to bay with ostiolar area often
darker (rust), red to rose in 3 % KOH, yellow in lactic acid,
nonpapillate or with a broad mammiform apex 150–200 μm
wide. Perithecial wall 30–50 μm wide of two intergrading
regions: outer region 20–30 μm wide. Asci cylindrical,
(75–)85–100(−120)×8–10 μm, 8-spored, apex with a refrac-
tive ring. Ascospores ellipsoid to fusiform, (8.5–
)9.5–
15.5(−20)×(3–)4.5–6.5(−8) μm (mean 12.5×5.5 μm), sym-
metrically two-celled, sometimes with one side curved and
one side flattened, not constricted at septum, spinulose, hya-
line becoming yellowish in mature ascospores. Colonies on
PDA 27–44 mm diam (mean 33 mm) after 12 d at 20C, aerial
mycelium floccose, white to lilac, producing purple to cinna-
mon pigment into media in some isolates at temperatures
<30C, colony reverse mauve to bay. Conidia on SNA forming
in hyaline, slimy droplets in aerial mycelium or on agar
surface; pionnotes sometimes formed close to filter paper on
SNA. Phialides borne apically on irregularly branching clus-
ters of cells or directly from hyphae, cylindrical or slightly
swollen (9.5–)12.5–17.5(−23)×(−2.5)3.5–4.5(−6) μm(mean
15×4 μm), with periclinal thickening and collarette.
Macroconidia slightly fusiform, curved with round ends, 3–
5-septate: 3-septate (39–)45.5–55.5(−64)×(4.5–)6–7(−8) μm
(mean 50.5×6.5 μ m), 4-septate (47.5– )51.5–
60.5(−66)×(5.5–)6–7(−8) μm(mean56×6.5μm), 5-septate
(52.5–)57–66.5(−74)×(5–)6–7(−8.5) μm(mean62×6.5μm).
Microconidia and chlamydospores not produced on SNA.
Habitat and distribution. Saprobic on decaying bark of
Ocotea sp., palms and possibly other hardwood species.
Known from tropical South America and Central America.
Additional specimens examined. GUYANA. Cuyuni-
Marazuni: Mazaruni Subregion, VII-2, along Koatse river,
ca. 2 km east of Pong River, ca hr walk west of
Chinoweing, 05°28′N60°04′W, 600–650 m, 28 Feb 1987,
on branchlets of recently dead tree, G.J. Samuels, J. Pipoly, G.
Gharbarran, J. Chin, R. Edwards (BPI 744725, culture G.J.S.
87–49 = CBS 112461); Potaro-Siparuni Region, base of Mt.
Wokomung, ca 5.5 h walk NE of Kopinang Village in legume-
dominated forest, 05°05′N59°49′W, 27 Jun 1989, on bark of
recently fallen tree, G.J. Samuels 6269A, B.M. Boom, G.
Bacchus (NY, culture G.J.S. 89–57 = CBS 112459); 720 m,
G.J. Samuels 6281, B.M. Boom, G. Bacchus (NY, culture
G.J.S. 89–60); Mt. Wokomung, Wokomung Base Camp, ca.
8 h walk NE of Kopinang Village in wet forest dominated by
Euphorbiaceae, 05°05′N59°50′W, 1070 m, Jun-Jul 1989, G.J.
Samuels 6318, B.M. Boom, G. Bacchus (NY, culture G.J.S.
89–65 = CBS 123970). PUERTO RICO. 350–400 m, on
Ocotea sp. twigs, 20 Feb 1996, G.J. Samuels, H.J. Schroers,
D.J. Lodge (BPI 744683, culture G.J.S. 96–22 = I M I
370946). VENEZUELA. Sucre State, NW of Irapa, trail
between Los Pocitos and peak of Cerro Humo, on stem
of unidentified p alm, 12 Ju l 1972, K.P. Dumont VE
4769,R.F.Cain,G.J.Samuels,G.Morillo,J.Farian
(NY, culture C.T.R. 72–90); Aragua State, Henri Pittier
National Park, Rancho Grande Biological Station, trail
to Guacamayo, 1250–1400 m, 10°21′N, 67°41′W, on
bark of unidentified tree, 04 Dec 1990, G.J. Samuels,
B. Hein, S.M. Huhndorf (BPI 842123, culture G.J.S.
90–212 = CBS 134028).
Notes. This species is similar to T. ianthina, which also
produces 3– 5 septate macroconidia. On average,
T. conchyliata has a faster growth rate on PDA at 30C than
T. ianthina.
Thelonectria ianthina C.Salgado&GuuJ.-R.,sp.nov.
Mycobank MB807890
Figure 4h–n.
Diagnosis. Similar to T. discophora.Macroconidia3–5-
septate, average colony growth on SNA at 30C <13 mm after
12 days.
Holotype. COSTA RICA. Heredia Province, Braulio
Carrillo National Park, Zurquí Street entrance, 10°02′N
84°01′W, 1562 m, on bark, 13 March 2010, C. Salgado, C.
Herrera, Y. Hirooka, A. Rossman, G.J. Samuels, P. Chaverri
PC1001 (BPI 892691, ex-type culture G.J.S. 10–118 = CBS
134023).
Fig. 4 a–g Thelonectria conchyliata. h–n Thelonectria ianthina. a
T. conchyliata perithecia (G.J.S. 89–57 = NY Samuels 6269A). b, c Asci
and ascospores in KOH and cotton blue (G.J.S. 87–49 = BPI 744725). d–
e Conidiophores and macroconidia on SNA (G.J.S. 89–57 = CBS
112459). f Colony on PDA (G.J.S. 87–49 = CBS 112461). g Colony
reverse on PDA (G.J.S. 87–49 = CBS 112461). h T. ianthina perithecia
(G.J.S. 10–118 = BPI 892691). i–j Asci and ascospores in KOH and
cotton blue (Guu 92122107 = BPI 892688). k–l Conidiophores and
macroconidia on SNA (G.J.S. 10–1 18 = CBS 134023). m Colony on
PDA (G.J.S. 10–118 = CBS 134023). n Colony reverse on PDA (G.J.S.
10–118 = CBS 134023). Bars: a, h =500μm; b–e, i–l =50μm
Fungal Diversity (2015) 70:1–29 13
14 Fungal Diversity (2015) 70:1–29
Etymology. Refers to the purple color of the colony and
pigment produced by this species.
Description. Mycelium not visible on host. Perithecia glo-
bose to subglobose, 300–600 μm high, 200–350 μm wide,
surface smooth and shiny or slightly roughened, solitary or
gregarious in groups of 15 or less, superficial or with base
immersed in substratum on a minute stroma, not collapsed
when dry, red to bay with ostiolar area often darker (bay to
umber),redtorosein3%KOH,yellowinlacticacid,
papillate or with a small mammiform apex 50–100 μmwide.
Cells at surface of perithecial wall lacking a definite outline,
appearing to be intertwined hyphae with lumina irregu-
lar in shape 2–2.5 μm, 2– 4 μ m thick. Perithecial wall
35–50 μm wide. Asci cylindrical or slightly clavate,
(60–)70–90(−111) × 7–10 μm, 8-sp ore d, ape x wit h a re-
fractive ring. Ascospores ellipsoidtofusiform,
(11.5–)12– 14(−15)×(5– )5.5–6(−6.5) μm(mean13×
6 μm), symmetrically two-celled, sometimes with one
side curved and one side flattened, not constricted at
septum, spinulose, hyaline. Colonies on PDA 31–
35 mm diam (mean 33 mm) after 12 day at 20C, aerial
mycelium floccose, white to purple, producing purple
pigment in media at temperatures ≤25C, colony reverse
white to bay. Conidia on SNA forming in hyaline, slimy
droplets in aerial mycelium or on agar surface;
pionnotes sometimes formed close to filter paper on
SNA agar. Phialides borne apically on irregularly
branching clusters of cells or directly from hyp hae,
cylindrical or slightly swollen (12– )13.5–
20.5(−26)×(−2.5) 3–4(−5) μm (mean 17×3.5 μm), with
periclinal thickening and collarette. Macroconidia cylindrical
or slightly fusiform, curved with round ends, 3–5-septate: 3-
septate (38–)46–57(−64.5)×(4.5–)5.5–7(− 8.5) μ m (mean
51.5×6 μm), 4-septate (50–)55–63(−68)×(6–)6.5–7.5(−8.5)
μ m(mean60×7μ m), 5-septate (52– )59.5–
62.5(− 70)×(3.5–)6.5–8(−8.5) μm(mean61×7μm). No
microconidia or chlamydospores produced in culture.
Habitat and distribution. Saprobic on decaying bark of
trees and shrubs. Known from Costa Rica (type locality) and
Taiwan.
Additional specimens examined. TAIWAN. Taipei County,
Jingtung, Jungtung historical trail, on bark, 21 Dec 2003, J.-R.
Guu 92122107 (BPI 892688, culture Guu 92122107 = CBS
134038).
Notes. This species is similar to T. conchyliata, which also
produces macroconidia 3–5-septate. They can be distin-
guished by the slower average growth rate on PDA at 30C
of T. ianthina.
Thelonectria japonica C. Salgado & Hirooka sp. nov.
Mycobank MB807891
Figure 5a–f.
Diagnosis. Similar to T. discophora.Macroconidia3–6-
septate. Known only from Japan.
Holotype. JAPAN. Okutama-gun, on twigs of undeter-
mined plant, 20 Nov 2003, Y. Hirooka TPP-h-229-2 (BPI
882092, ex-type culture MAFF 241524).
Etymology. Refers to the geographic location where this
species was found.
Description. Mycelium not visible on host. Perithecia glo-
bose to subglobose, 300–610 μm high, 200–350 μ
m wide,
surface smooth and shiny or slightly roughened, solitary or
gregarious in groups of 15 or less, superficial or with base
immersed in substratum on a minute stroma, not collapsed
when dry, peach to sienna with ostiolar area often darker
(rust), red to rose in 3 % KOH, yellow in lactic acid,
papillated. Cells at surface of perithecial wall lacking a defi-
nite outline, appearing to be intertwined hyphae with lumina
irregular in shape, 2–2.5 μm, 2–4 μm thick. Perithecial wall
25–40 μm wide. Asci cylindrical, (50–)68–90(−100)×7–
11 μm, 8-spored, apex with a refractive ring. Ascospores
ellipsoid to fusiform, (10.5–)11.5–13.5(−15.5)×(4.5–)5–
6(−6.5) μm (mean 12.5×5.5 μm), symmetrically two-celled,
sometimes with one side curved and one side flattened, not
constricted at septum, spinulose, hyaline. Colonies on
PDA 33– 44 mm diam (mean 38 mm) after 12 day at
20C, aerial mycelium floccose, white to purple, no
pigment produced in media, colony reverse also white
to purple. Conidia on SNA forming i n hyaline, slimy
droplets in aerial mycelium or on agar surface;
pionnotes sometimes formed close to filter paper on
SNA. Phialides borne apically on irregularly branching
clusters of cells or directly from hyphae, cylindrical or
slightly swollen (9.5–)11.5–18(−22.5)×(−3)3.5 –5(−5.5)
μm (mean 15×4 μm), with periclinal thickening and
collare tte. Macrocon i dia cylindrical or slightly fusiform,
curved with round ends, 3–6-septate: 3-septate (45–)54–
67.5(−80)×(4.5–)5.5–6.5(−7) μm (mean 60.5×6 μm), 4-
septate (57–)64.5–75.5(−89)×(4
–)5.5–6.5(− 7.5) μm (mean
70×6 μm), 5-septate (64.5–)72–82.5(− 90.5)×(5–)5.5–
6.5(−7.5) μm (mean 77.5×6 μm), 6-septate (87–)86.5–
90(− 91. 5)×(5.5– )6–6.5(−7) μm (mean 88.5×6 μm). No
microconida or chlamydospores formed in culture.
Habitat and distribution. Saprobic on decaying bark of
Fagus crenata, and possibly on bark of other shrubs and trees.
Known only from Japan.
Additional specimens examined. JAPAN. Miyagi
Prefecture, Kenminnomori, Rifu-cho, Miyagi-gun, on twigs
of unknown plant, 5 Aug 2004, Y. Hirooka TPP-305-2 (BPI
882109, culture MAFF 241543). Kanagawa Prefecture,
Yamakitagawayose, Ashigarakami-gun, on bark of undeter-
mined dead tree, 30 Oct 2004, Y. Hirooka TPP-h374-2 (BPI
881926, culture MAFF 241554); on bark of dead Fagus
crena ta, 17 Apr 2005, Y. Hirooka TPP-h-433-2 (BPI
881944, culture MAFF 241563).
Notes. There is one other species that can also be found in
Japan, T. porphyria.HoweverT. japonica produces
macroconidia 3-6-septate, while T. porphyria produces
macroconidia 3-5-septate.
Thelonectria mammoidea (W. Phillips & Plowr.) C.
Salgado & R.M. Sanchez comb. nov.
Fig. 5 a–f Thelonectria japonica. g–l Thelonectria mammoidea. a
T. japonica perithecia (MAFF 241524 = BPI 882092). b, c Asci and
ascospores in KOH and cotton blue (MAFF 241524 = BPI 882092). d
Conidiophores and macroconidia on SNA (MAFF 241554). e Colony on
PDA (MAFF 241543). f Colony reverse on PDA (MAFF 241543). g
T. mammoidea perithecia (G.J.S. 83–206 = PDD 46410). h, i Asci and
ascospores in KOH and cotton blue (G.J.S. 83–206 = PDD 46410). j
Conidiophores and macroconidia on SNA (G.J.S. 86–206 = IMI 326258).
l Colony on PDA (IMI 69361). m Colony reverse on PDA (IMI 69361).
Bars: a, g =500μm; b–d, h–j =50μm
Fungal Diversity (2015) 70:1–29 15
Description. Mycelium sometimes visible on host. Stroma
arising from cortex of host, cells angular to circular in outline,
continuous with cells of outer region of perithecial wall.
Perithecia globose to subglobose, 400–700 μm high, 240–
340 μm wide, surface smooth and shiny or slightly rough-
ened, solitary or gregarious in groups of 20 or less, superficial
or with base immersed in substratum on a minute stroma, not
collapsed when dry, peach to sienna with the ostiolar area
often darker (rust), red to rose in 3 % KOH, yellow in lactic
acid, nonpapillate or with a broad mammiform apex 150–
190 μm wid e. Perithecial wall 30–50 μmwideoftwo
intergrading regions; outer region 20–30 μm wide, continuous
over perithecium to form a uniform palisade of hyphal cells
perpendicular to surface of perithecium, lumina <1 μmwide
and tips rounded; inner region of perithecial wall 10–25 μm
wide, cells lacking a definite outline but with long axis parallel
to surface of perithecial wall, cells increasingly more
compacted, thin- walled towards perithecial locule; perithecial
apex of vertically elongated cells, continuous with lateral
perithecial wall, forming disk around perithecial opening.
Asci cylindrical, (70–)80–100(−
130)×8–10 μm, 8-spored,
apex with a refractive ring. Ascospores ellipsoid to fusiform,
(12.5–)15.5–17.5(−19)×(6–)6.5–8.0(−9.5) μm (mean 16.5×
7.5 μm), symmetrically two-celled, sometimes with one side
curved and one side flattened, not constricted at se ptum,
spinulose, hyaline becoming yellowish. Colonies on PDA
25–27 mm diam (mean 26 mm) after 12 day at 20C, aerial
mycelium floccose, white to lilac or rosy buff, with cinnamon
pigment produced in media, colony reverse white to mauve or
cinnamon. Conidia on SNA forming in hyaline, slimy droplets
in aerial mycelium or on agar surface; pionnotes sometimes
formed close to filter paper on SNA. Phialides borne apically
on irregularly branching clusters of cells or directly from
hyphae, cylindrical or slightly swollen, (13– )16.5–
21(−23.5)×( −3)3.5–4.5(−5) μm (mean 17.5×4 μm), with
periclinal thickening and collarette. Macroconidia slightly
fusiform, curved with round ends, 1–5-septate: 1-septate
(28.5–)29.5–37(−39.5)×(5.0–)5.5–6(−6.5) μm (mean 33×
6 μm), 2-septate (36–)39.5–48(−50.5)×(6 – )6–7(−7.5) μm
(mean 44×6.5 μm), 3-septate (41–)46–58(−64)×(5–)5.5–
7(−8) μ m (mean 52× 6.5
μm), 4-septate (52– )57–
67(−73.5)×(5–)6–7(−7.5) μm(mean62×6.5μm), 5-septate
(70.5–)69.5–74(−75) ×(6 – )6.5 –7(−7. 5) μm (mean 72×
6.5 μm). No microconidia or chlamydospores produced on
SNA.
Habitat and distribution. Saprobic on Fuchsia excorticata,
Pinus radiata and possibly on diverse hardwood trees. Also
on herbaceous plants (e.g., Smyrnium olusatrum)and
decaying plant organic matter. Known from Europe and
New Zealand, proba bly distributed throughout temperate
regions.
Additional specimens examined. NEW ZEALAND.
Southland, Catlin’s State Forest Park, Lake Wilkie, on
bark of unidentified tree, 18 Apr 1985, G.J. Samuels,
P.K. Buchanan, L.M. Kohn (PDD 50050, BPI 802469,
culture G.J.S. 85–27 = CBS 112457); South Island,
Westland, Franz Joseph, track to Lake Wombat, on bark
of Fuchsia excorticata, 10 Apr 1983, G.J. Samuels,
R.H. Petersen (PDD 46365, BPI 1109329, culture
G.J.S. 83–188 = IMI 3 26256); Waitomo, on bark of
indetermined tree, 26 Apr 1983, G.J. Samuels, P.R.
Johnston, R.H. Petersen (PDD 46410, culture G.J.S.
83–206 = IMI 326258); on Pinus radiata,01Nov
1965, J. M. Dingley (culture ICMP 5287).
SCOTLAND. Cowal Peninsula, Argyll Forest Park, ca
5 km south of Strachur along river Cur, vic Glenbranter
Village, Lauder Broadleaf Walk ca 50 m, on bark of
unidentified dead hardwood tree, 12 Apr 1992, G.J.
Samuels, D. Brayford (BPI 802649, culture G.J.S. 92–
34 = CBS 134030). SWITZERLAND. May 1981, O.
Petrini (culture CBS 32881).
Notes.TheisolateICMP5287wascollectedinNew
Zealand on Pinus radiata; however, it is genetically divergent
from isolates in T. pinea (5.9 % D xy) and produces
macroconidia 1–5-septate. Th elonectr ia pinea produces
macroconidia 1–4-septate.
Thelonectria phoenicea C. Salgado & P. Chaverri sp. nov.
Mycobank MB807914
Figure
6a–f.
Diagnosis. Similar to T. discophora. Macroconidia 1–5-
septate. Found in Australia, Indonesia and Taiwan.
16 Fungal Diversity (2015) 70:1–29
Mycobank MB807913
Figure 5g–l.
Basionym: Nectria mammoidea W. Phillips & Plowr.,
Grevillea 3: 126. 1875
≡ Creonectria mammoidea (W. Phillips & Plowr.) Seaver.
Mycologia 1: 188. 1909.
≡ Cucurbitaria mammoidea (W. Plowr. & Plowr.) Kuntze,
[as ‘mammodea’] Revis. gen. pl. (Leipzig) 3: 461. 1898.
= Nectria mammoidea var. rugulosa Weese, Sber. Akad.
Wiss. Wien, Math.-naturw. Kl., Abt. 1 125(7 & 8): 552. 1916.
= Nectria nelumbicola Henn., Verh. Bot. Vereins. Prov.
Brandenburg 40: 151. 1898.
= Cylindrocarpon ianthothele var. majus Wollenw., Z.
Parasitenk. (Berlin) 1: 161. 1928.
= Cylindrocarpon ianthothele var. rugulosum C. Booth,
Mycol. Pap. 104: 25. 1966.
Type specimens. ENGLAND. Norfolk County: North
Wootton, on bark of unknown plant, Jan 1897, C.B.
Plowright (Holotype E 00456070); Surlingham City, on seeds
of Smyrnium olusatrum, 1957, E.A. Ellis ex-type culture IMI
69361).
Fig. 6 a–f Thelon ectria ph oenicea. g–m Thelonectria p inea. a
T. phoenicea perithecia (Guu 94031007 = BPI 892685). b, c Asci and
ascospores in KOH and cotton blue (Guu 94031007 = BPI 892685). d
Conidiophores and macroconidia on SNA (Guu 94031007 = CBS
134039). e Colony on PDA (Guu 94031007 = CBS 134039). f Colony
reverse on PDA (Guu 94031007 = CBS 134039). g–h T. pinea
conidiophores and macroconidia perithecia (A.R. 4321 = CBS 134033).
i Colony on PDA (A.R. 4321 = CBS 134033). J. Colony reverse on PDA
(A.R. 4321 = CBS 134033). k Colony on PDA (A.R. 4324 = CBS
125153). l Colony on PDA (A.R. 4324 = CBS 125153). Bars: a =
500 μm; b–d, g–h =50μm
Fungal Diversity (2015) 70:1–29 17
Holotype. INDONESIA. North Sulawesi, Eastern
Dumoga-Bone National Park, at confluence of Toraut and
Tumpa Rivers, Project Wallace Base Camp, 0°34′N123°57′
E, 211 m, on twig of unidentified tree, Sep-Nov 1985, G.J.
Samuels (NY 2222A, ex-type culture G.J.S. 85–179 = IMI
329113).
Etymology. Refers to the purple coloration of the asexual
state and pigment produced in culture.
Description. Mycelium not visible on host. Perithecia glo-
bose to subglobose, 300–600 μm high, 200–350 μm wide,
surface smooth and shiny or slightly roughened, solitary or
gregarious in groups of 15 or less, superficial or with base
immersed in substratum on a minute stroma, not collapsed
when dry, peach to sienna with ostiolar area often darker
(bay),redtorosein3%KOH,yellowinlacticacid,
papillated. Cells at surface of perithecial wall lacking a defi-
nite outline, appearing to be intertwined hyphae with lumina
irregular in shape 2–2.5 μm, 2–4 μm thick. Perithecial wall
25–40 μm wide. Asci cylindrical, (50–)66–89(−105)×7–
11 μm, 8-spored, apex with a refractive ring. Ascospores
ellipsoid to fusiform, (9–)9.5–11.5(−13)×(4–)4.5–5(−5.5)
μm (mean 10.5×4.5 μm), symmetrically two-celled, some-
times with one side curved and one side flattened, not con-
stricted at septum, spinulose, hyaline. Colonies on PDA 29–
30 mm diam after 12 day at 20C, aerial mycelium floccose,
white to purple, producing purple pigment at ≤25C, colony
reverse white to bay. Conidia on SNA forming in hyaline,
slimy droplets in aerial mycelium or o n agar surface;
pionnotes sometimes formed close to filter paper on SNA.
Phialides borne apically on irregularly branching clusters of
cells or directly from hyphae, cylindrical or slightly swollen
(10.5–)11–22(−59)×(−3)3.5 –4.5(−6.5) μm (mean 16.5×
4 μ m), with periclinal thickening and collarette.
Macroconidia cylindrical or slightly fusiform, curved of round
ends, 1–5-septate: 1-septate (18–)22.5–30.5(−31.5)×(4–)4–
5(−5.5) μm (mean 26.5×4.5 μm), 2-septate (28–)28.5–
37(−37.5)×(4.5– )5–5.5(−6) μm (mean 32.5×5.5 μm), 3-
septate (31.5–)45–58.5(−65)×(4–)5.5–6. 5( −7) μm (mean
51.5×6 μm), 4-septate (50–)59–67.5(−72.5)×(5–)6–7(−7.5)
μ m (mean 63.5 ×6.5 μ m), 5-septate (58– )62.5–
70.5(− 76.5)×(5–)6– 7( −8) μm (mean 66.5×6.5 μm). No
microconidia or chlamydospores formed in culture.
Habitat and distribution. Saprobic on decaying Acacia
celsa and other plants. Known from the type locality
(Indonesia), Australia and Taiwan.
Additional specimens examined. AUSTRALIA.
Queensland: Atherton City, Davis Creek, on Acacia celsa,2
Feb 2009, A.Y. Rossman, P. Chaverri PC 883 (BPI 879019,
culture G.J.S. 09
–509). INDONESIA. Sulawesi, Demoga-
Bone National Park, 0°28′N, 123° N, 47′E, ca. 810 m, 18
Oct. 1985, G.J. Samuels GJS 2278 (NY GJS 2278, culture
G.J.S. 85–187 = ATCC 76478). TAIWAN. Kaohsiung
County, Liou-guei, Shan-ping, on bark of unidentified tree,
10 Mar 2005, J. –R. Guu (BPI 892688, culture Guu 94031007
= CBS 134039).
Notes. Species that produce 1–5-septate macroconidia can
be distinguished based on their geographic locations:
T. phoenicea in Australia, Indonesia and Taiwan;
T. purpurea in Central and northern South America.
Thelonectria pinea (Dingley) C. Salgado & P. Chaverri
comb. nov.
Mycobank MB807915
Figure 6g–l.
≡ Nectria pinea Dingley, Trans. Roy. Soc. New Zealand
79: 198. 1951.
= Cylindrocarpon pineum C. Booth, Mycol. Pap. 104: 26.
1966.
Type specimens. NEW ZEALAND. Bay of Plenty:
Rotorua, Whakarewarewa, on bark of Pinus radiata, Sept
1949, G.B. Rawlings (Holotype PDD 7510); Bay of Plenty,
Rotorura, on Pinus rad iata, coll. M. Dick NZFS 1793
(Epitype designated here BPI 892882; ex epitype culture
A.R. 4324 = CBS 125153).
Description. Mycelium visible on host. Perithecia globose
to subglobose, 400–800 μm high, 200–350 μm wide, surface
smooth and shiny or slightly roughened, solitary or gregarious
in groups of 3–25, superficial or with base immersed in
substratum on a minute stroma, not collapsed when dry,
orange to sienna with ostiolar area often darker (bay), mainly
in young perithecia, red to rose in 3 % KOH, yellow in lactic
acid, papillated. Cells at surface of perithecial wall lacking a
definite outline, appearing to be intertwined hyphae with
lumina irregular in sha pe 2– 2.5 μm, 2– 4 μmthick.
Perithecial wall 40–50 μm wide. Asci cylindrical, 100–
130×8– 9 μm, 8- spored, ape x with a refractive ring.
Ascospores ellipsoid to fusiform, 17–19×7–8 μm (mean
18×7.5 μm), symmetrically two-celled, sometimes with one
side curved and one side flattened, not constricted at septum,
spinulose, hyaline. Colonies on PDA 31 mm diam after
12 day at 20C, aerial mycelium floccose, white to lilac,
producing purple pigment in media at temperatures ≤20C,
colony reverse also white to lilac. Conidia on SNA forming
in hyaline, slimy droplets in aerial mycelium or on agar
surface; pionnotes sometimes formed close to filter paper on
SNA. Phialides borne apically on irregularly branching clus-
ters of cells or directly from hyphae, cylindrical or slightly
swollen (13.5–)15–22.5(−27.5)×(−3)3.5–4.5(−5) μm(mean
18.5×4 μm), with periclinal thickening and collarette.
Macroconidia cylindrical or slightly fusiform, curved with
round ends, 1– 4-septate: 1-septate (23– )28–
38.5(−44)×(3–)3.5–4.5(−5) μm(mean33×4μm), 2-septate
(30–)36.4–45.4(−56.4)×(4–)4.5–5.5(−6) μm(mean41×
4.5 μm), 3-septate (34.5– )41.5–48(−60.5)×(3.5 –)4.5–
5.5(−6) μm (mean 46.5×5 μm), 4-septate (44–)48–
61.5(−71)×(5–)5.5–6.5( −7) μm (mean 55×6 μm). No
microconidia or chlamydospores formed in culture.
18 Fungal Diversity (2015) 70:1–29
Habitat and distribution. Saprobic on decaying bark of
Pinus radiata. This species has only been repor ted from
New Zealand.
Additional specimens examined. NEW ZEALAND.
Northland: on Pinus radiata, 10 Sep 2003, M. Dick NZFS
1069 (culture only, A.R. 4321 = CBS 134033)
Notes. This species is only known from New Zealand,
however, the original author, Dingley (1951) described this
species as occurring in New Zealand as well as Europe and
North America. Here the name T. pinea is circumscribed to
include species only found on Pinus radiata in New Zealand.
Isolates of Nectria-like fungi on Pinus in other parts of the
world probably constitute different species.
Thelonectria porphyria C. Salgado & Hirooka sp. nov.
Mycobank MB807916
Figure 7a–f.
Diagnosis. Similar to T. discophora.Macroconidia3–5-
septate. Known only from Japan.
Holotype. JAPAN. Kochi Prefecture, Tosa-cho, on bark of
dead tree, 04 Aug 2004, Y. Hirooka TPP-h171-1 (BPI 882162,
ex-type culture MAFF 241515).
Etymology. Refers to the purple coloration of the asexual
state and pigment produced in culture conditions.
Description. Mycelium not visible on host. Perithecia glo-
bose to subglobose, 300–600 μm high, 200–350 μm wide,
surface smooth and shiny or slightly roughened, solitary or
gregarious in groups of 20 or less, superficial or with base
immersed in substratum on a minute stroma, not collapsed
when dry, orange to sienna with ostiolar area of same color
than rest of perithecium, red to rose in 3 % KOH, yellow in
lactic acid, papillated. Cells at surface of peritheci al wall
lacking a definite outline, appearing to be intertwined hyphae
with lumina irregular in shape 2–2.5 μm, 2–4 μm thick.
Perithecial wall 25–40 μm wide. Asci cylindrical, (55–)69–
89(−100)×7–11 μm, 8-spored, apex with a refractive ring.
Ascospores ellipsoid to fusiform, (12– )13–
14.5(−16)×(5–)5.5–7(−8)
μm (mean 13.5×6.5 μm), symmet-
rically two-celled, sometimes with one side curved and one
side flattened, not constricted at septum, spinulose, hyaline.
Colonies on PDA 30–35 mm diam (mean 33 mm) after 12 day
at 20C, aerial mycelium floccose, white to purple, producing
purple to cinnamon pigment diffusing into media at tempera-
tures ≤25C, colony reverse also white to bay. Conidia on SNA
forming in hyaline, slimy droplets in aerial mycelium or on
agar surface; pionnotes sometimes formed close to filter paper
on SNA. Phialides borne apically on irregularly branching
clusters of cells or directly from hyphae, cylindrical or slightly
swollen (11.5–)15– 20.5(−25)×(−3) 3.5–4.5(−5) μm(mean
17.5×4 μm), with periclinal thickening and collarette.
Macroconidia cylindrical or slightly fusiform, curved with
round ends, 3– 5-septate: 3-septate (42.5– )48–
59(−69)×(4.5– )5.5–6.5(−7.5) μm (mean 53.5×6 μm), 4-
septate (44.5–)51–66.5(−79.5)×(4.5–)5.5–6.5(− 7.5) μm
(mean 58.5×6 μ m), 5-septate (51– )62–
77.5(−88.5)×(5–)5.5–7(−7.5) μm (mean 69.7×6.3 μm). No
microconidia or chlamydospores formed in culture.
Habitat and distribution. Saprobic on decaying bark of
Cryptomeria japonica and other woody substrates. Known
only in Japan.
Additional specimens examined. JAPAN. Kochi
Prefecture, Tosakitakaido, Tosa-cho, on twigs of
Cryptomeria japonica, 04 Aug 2003, Y. Hirooka TPP-h178-
2 (BPI 882164, culture MAFF 241517); Miyagi Prefecture,
Akiuootaki, Aki-cho, Taihaku-ku, on twigs of undetermined
dead tree, 04 Aug 2004, Y. Hirooka TPP-h292-2 (BPI 882106,
culture MAFF 241539).
Notes. See notes for
T. japonica.
Thelonectria purpurea C. Salgado & P. Chaverri sp. nov.
Mycobank MB807917
Figure 7g–l.
Diagnosis. Similar to T. discophora. Macroconidia 1–5-
septate. Known only from Central America (Costa Rica) and
northern South America (Venezuela).
Holotype. COSTA RICA. Heredia Province, Braulio
Carrillo National Park, Zurquí Street entrance, 10°03′N
84°01′W, 1734 m, on bark of undetermined twigs, 14 March
2010, C. Salgado, C. Herrera, Y. Hirooka, A. Rossman, G.J.
Samuels, P. Chaverri PC1060 (BPI 892689, ex-type culture
G.J.S. 10–131 = CBS 134024).
Etymology. Refers to the purple coloration of the colony of
the asexual state and pigment produced under culture
conditions.
Description. Mycelium visible on host. Perithecia globose
to subglobose, 350–740 μm high, 210–350 μm wide, surface
smooth and shiny or slightly roughened, solitary or gregarious
in groups of up to 20, superficial or base immersed in sub-
stratum on a minute stroma, not collapsed when dry, sienna
with ostiolar area often darker (umber) mainly in mature
perithecia, red to rose in 3 % KOH, yellow in lactic acid,
papillate. Cells at surface of perithecial wall lacking a definite
outline, appearing to be intertwined hyphae with lumina ir-
regular in shape, 2–2.5 μm, 2–4 μm thick. Perithecial wall
43–52 μm wide. Asci cylindrical, (55–)68–82(−98)×7–
10 μm, 8-spored, apex with a refractive ring. Ascospores
ellipsoid to fusiform, (11–)12–14(−15.5)×(4–)5–6(−6.5) μm
(mean 13×5.5 μm), symmetrically two-celled, sometimes
with one side curved and one side flattened, not constricted
at septum, spinulose, hyaline. Colonies on PDA 33–38 mm
diam (mean 35 mm) after 12 day at 20C, aerial mycelium
floccose, white to purple or saffron, producing purple pigment
in media at temperatures ≤25C, colony reverse white to purple
or saffron. Conidia on SNA forming in hyaline, slimy droplets
in aerial mycelium or on agar surface; pionnotes sometimes
formed close to filter paper on SNA. Phialides borne apically
on irregularly branching clusters of cells or directly from
hyphae, cylindrical or slightly swollen (11.5–)16–
Fungal Diversity (2015) 70:1–29 19
23(−30.5)×(−4)4.5–5(−5.5) μm (mean 19.5×4.5 μm), with
periclinal thickening and collarette. Macroconidia cylindrical
or slightly fusiform, curved with round ends, 1–5-septate: 1-
septate (21–)22–44.5(−67)×(4.5–)5–6(−7) μm (mean 32.5×
20 Fungal Diversity (2015) 70:1–29
Fig. 7 a–f Thelonectria porphyria. g–l Thelonectria purpurea. a
T. porphyria perithecia (MAFF 241515 = BPI 882162). b, c Asci and
ascospores in KOH and cotton blue (MAFF 241515 = BPI 882162). d
Macroconidia on SNA (MAFF 241539). e Colony on PDA (MAFF
241517). f Colony reverse on PDA (MAFF 241517). g T. purpurea
perithecia (G.J.S. 10–131 = BPI 892689). h Asci and ascospores in
KOH (G.J.S. 10–131 = BPI 892689). i, j Conidiophores and
macroconidia on SNA (G.J.S. 90–155 = CBS 123966). k Colony on
PDA (G.J.S. 10–145 = CBS 134025). m Colony reverse on PDA (G.J.S.
10–145 = CBS 134025). Bars: a, g =500μm; b–d, h–j =50μm
5.5 μm), 2-septate (32–)33–46(−48)×(5–)5.5–6(−6.5) μm
(mean 39.5×5.5 μ m), 3-septate (4– )47.5–
60.5(−69)×(4.5–)5.5–6.5(−7.5) μm (mean 54.5×6 μm), 4-
septate (50–)57.5–67.5(−76.5)×(4.5–)5.5–6.5(−7.5) μ m
(mean 62.5. × 6 μ m), 5-septate (57.5– )62–
72(−81)×(5–)5.5–7(−7.5) μm(mean67×6.5μm). No
microconidia or chlamydospores formed in culture.
Habitat and distribution. Saprobic on decaying bark of
woody substrates. Known from Venezuela and Costa Rica,
possibly widely distributed in the Neotropics.
Additional specimens examined. COSTA RICA. Heredia
Province, Braulio Carrillo National Park, Zurquí Street en-
trance, 10°03′N84°01′W, 1734 m, on bark of undetermined
dead tree, 14 March 2010, C. Salgado, C. Herrera, Y. Hirooka,
A. Rossman, G.J. Samuels, P. Chaverri PC1081 (BPI 882335,
culture G.J.S. 10–145 = CBS 134025). VENEZUELA.
Aragua State, Henry Pittier National Park, ca. 20 km above
Maracay, on Maracay-Choroni road, on wood of unidentified
dead tree, 13 Jul 1971, K.P. Dumont, J.H. Haines, G.J.
Samuels (NY Dumont-VE 2173, culture C.T.R. 71–281 =
CBS 112458). Merida State: Sierra Nevada National Park,
above Tabay, Qda. Coromoto, La Mucuy, 08°36′N71°02′W,
ca. 2000 m, on palm fruit, G.J. Samuels et al. GJS 7244A (BPI
1109900, culture G.J.S. 90–155 = CBS 123966)
Notes. See notes for
T. phoenicea.
Thelonectria ostrina C. Salgado & P. Chaverri sp. nov.
Mycobank MB807918
Figure 8a–f.
Diagnosis. Similar to T. discophora.Macroconidia3–6-
septate. Collected only in the sexual state, saprobic, from
Puerto Rico, Venezuela and Japan.
Holotype. PUERTO RICO. Caribbean National Forest,
Luquillo Mountains, Rio Grande, trail to El Toro from Rt.
186, 650–750 m, on bark of unidentified recently dead tree, 24
Feb 1996, G.J . Samue ls, H.-J Schroers, D.J. Lodge (BPI
745542, ex-type culture G.J.S. 96–23 = IMI 370947).
Etymology. Refers to the purple coloration of the colony of
the asexual state in culture.
Description. Mycelium not visible on host. Perithecia glo-
bose to subglobose, 300–600 μm high, 200–350 μm wide,
surface smooth and shiny or slightly roughened, solitary or
gregarious in groups of 20 or less, superficial or with base
immersed in substratum on a minute stroma, not collapsed
when dry, peach to sienna with ostiolar area darker (bay), red
to rose in 3 % KOH, yellow in lactic acid, papillate. Cells at
surface of perithecial wall lacking a definite outline, appearing
to be intertwined hyphae with lumina irregular in shape 2–
2.5 μm, 2–4 μm thick. Perithecial wall 25–40 μm wide. Asci
cylindrical, (56–)67–86(−98)×7–12 μm, 8-spored, apex with
a refractive ring. Ascospores ellipsoid to fusiform, (10.5–)11–
12.5(−13.5)×(4–)4.5–5.5(−6) μm(mean12×5μm), symmet-
rically two-celled, sometimes with one side curved and one
side flattened, not constricted at septum, spinulose, hyaline.
Colonies on PDA 31–34 mm diam (mean 32 mm) after 12 day
at 20C, aerial mycelium floccose, white to purple, not produc-
ing pigment in media, colony reverse white to purple. Conidia
on SNA forming in hyaline, slimy droplets in aerial mycelium
or on agar surface; pionnotes sometimes formed close to filter
paper on SNA agar. Phialides borne apically on irregularly
branching clusters of cells or directly from hyphae, cylindrical
or slightly swollen (12–)15–19.5(−
23)×(−3.5)4–5(−6) μm
(mean 17×4.5 μm), with periclinal thickening and collarette.
Macroconidia cylindrical or slightly fusiform, curved with
round ends, 3– 5-septate: 3-septate (40– )45.5–
66.5(−69)×(5–)5.5–7.5(−9) μm (mean 56×6.5 μm), 4-
septate (53.5–)62.5–76(−82)×(5–)6–8(−9) μm (mean 69.5×
7 μm), 5-septate (66–)68–88.5(−108)×(5–)6–8(−9) μm
(mean 78×7 μm). No microconidia or chlamydospores
formed in culture.
Habitat and distribution. Saprobic on woody substrates.
Found in Puerto Rico, Venezuela and Japan; possibly widely
distributed in the tropics and subtropics around the world.
Additional specimens examined. JAPAN. Tokyo,
Sakaigatake, Hahajima, Ogasawara-mura, on bark of uniden-
tified dead tree, 22 Jun 2005, Y. Hirooka TPP-h488-2 (BPI
881951, culture MAFF 241564). VENEZUELA. Bolivar
State, The Gran Sabana National Park, 1139 m, on wood of
unidentified dead tree, 29 Jun 2009, C. Salgado, Y. Hirooka
YH09-124 (BPI 882679, culture G.J.S. 09–1327 = CBS
134022).
Notes. This species is similar to T. blattea. Thelonectria
blattea has been collected only in the asexual state on soil
while T. ostrina has been collected in the sexual state as a
sabrobe of decaying plant material.
Thelonectria rubi (Osterw.) C. Salgado & P. Chaverri, stat.
nov. et comb. nov.
Mycobank MB807921
Figure 8g–l.
≡ Nectria rubi
Osterw., Ber. Deutsch. Bot. Ges. 29: 620.
1911.
≡ Hypomyces rubi (Ostew.) Wollenw., Phytopathology 3:
224. 1913.
≡ Neonectria discophora var. rubi (Osterw.) Brayford &
Samuels, Mycologia 96: 572. 2004.
=Cylindrocarpon ianthothele var. ianthothele Wollenw.,
Ann. Mycol. 15: 56. 1917.
Holotype. SWITZERLAND. Horgen District: Wadenswill
Locality, on Rubus idaeus roots, 1911, A. Osterwalder (holo-
type culture CBS 113.12 = IMI 113918).
Description. Mycelium not visible on host. Perithecia glo-
bose to subglobose, 300–500 μm diam, smooth, solitary or
gregarious in groups up to 5, on poorly developed erumpent
stroma, not collapsed when dry, bright red to umber with
ostiolar area same color than rest of perithecium, red to rose
in 3 % KOH, yellow in lactic acid, papillate. Perithecial wall
80–100 μm. Asci cylindrical to clavate 80–120 × 5–6 μm, 8-
Fungal Diversity (2015) 70:1–29 21
spored, ascospores ellipsoid, 1-septate (11.5– )12–
16(−23)×(4.5–)5.5–6.5(−8) μm (mean 14×6 μm), not
constricted at septum, becoming pale yellow when mature,
spinulose. Colonies on PDA 23–29 mm diam (mean 24 mm)
Fig. 8 a–f Thelonectria ostrina. g–l Thelonectria rubi. a T. ostrina
perithecia (G.J.S. 96–23 = BPI 745542). b Ascospores in KOH (G.J.S.
96–23 = BPI 745542). c–d Conidiophores and macroconidia on SNA
(MAFF 241564). e Colony on PDA (MAFF 241564). f Colony reverse
on PDA (MAFF 241564). g T. rubi chlamydospores on SNA (CBS
11312). h–i Conidiophores and macroconidia on SNA (CBS 11312). j
Chlamydospores forming on macroconidia on SNA (CBS 17727). k
Colony on PDA (CBS 11312). m Colony reverse on PDA (CBS
11312). Bars: a =500μm; b–d, g–j =50μm
22 Fungal Diversity (2015) 70:1–29
Fungal Diversity (2015) 70:1–29 23
after 12 day at 20C, aerial mycelium floccose, white to purple,
no pigment produced in media, colony reverse white to pur-
ple. Conidia on SNA forming in hyaline, slimy droplets in
aerial mycelium or on agar surface; pionnotes sometimes
formed close to filter paper on SNA. Phialides borne apically
on irregularly branching clusters of cells or directly from
hyphae, cylindrical or slightly swollen (15– )17–
23.5(−29)×( −3)3.5–5(−5.5) μm (mean 20×4.5 μm), with
periclinal thickening and collarette. Macroconidia cylindrical
or curved with round ends, with one end thicker than the other,
1–6-septate (except 2-septate): 1-septate (9.5– )10–
13(−14)×(4–)4.5–5.5(−6) μm(mean11.5×5μm), 3-septate
(38– )47–62(−68.5)×(5–)5.5–6.5(−7) μm (mean 54.5×
6.5 μm), 4-septate (42–)56.5–67(−74)×(5.5–)6–7(−7.5) μm
(mean 63×6.5 μm), 5-septate (45.5–)56–69.5(−84)×(5–)6–
7(−7.5) μm ( mean 60.5×6.5 μm), 6-septate (46–)47–
77(− 79) ×(5– )6
– 7(− 8) μ m(mean60.5×6.5μm).
Microconidia produced in culture, cylindrical with round
ends, (7.5–)8–10(−11.5)×(4–)4.5–5.5(−6.5) μm (mean 9×
5 μm). Chlamydospores formed in culture, subglobose, 4×
5 μm.
Habitat and distribution. On roots of diseased Rubus spe-
cies. Found in the type locality (Switzerland); also United
Kingdom including Scotland and one report from Venezuela
(Cedeño et al. 2004).
Additional cultures examined. SCOTLAND. Locality un-
known, 1929, H.M. Wollenweber (CBS 241.29 = IMI
113919). UNITED KINGDOM. England, location unknown,
R.M. Nattrass (culture CBS 177.27 = IMI 113917).
Notes. Brayford et al. (2004) observed that perithecia of
T. rubi were morphologically and anatomically indistinguish-
able from those of T. discophora. However, our data suggest
that true T. rubi is only found in association with roots and
crown s of Rubus species. Although the type locality i s
Switzerland (Wadenswill), it is possible to find this species
wherever Rubus species are found.
Thelonectria tyrus C. Salgado & P. Chaverri sp. nov.
Mycobank MB807922
Figure 9g–l.
Diagnosis. Similar to T. discophora.Macroconidia3–5-
septate. Only found in the eastern United States.
Holotype. UNITED STATES. North Carolina: Macon
County, Ellicott Rock Trail, off of Bull Pen Road, 35°02′N
83°08′W, 915 m, on bark of living Quercus sp., 14 Oct 1990
G.J. Samuels, A.Y. Rossman, Y. Doi (BPI 1107126, ex-type
culture G.J.S. 90–46 = CBS 134029).
Etymology. Refers to the purple coloration of the culture of
the asexual state and pigment diffusing into the media in
cultural conditions.
Description. Mycelium not visible on host. Perithecia glo-
bose to subglobose, 300–600 μm high, 200–
400 μm wide,
surface smooth and shiny or slightly roughened, solitary or
gregarious in groups of 20 or less, superficial or with base
immersed in substratum with no visible stroma, not collapsed
when dry, peach to sienna with ostiolar area same color as rest
of perithecium, red to rose in 3 % KOH, yellow in lactic acid,
papillate. Cells at surface of perithecial wall lacking a definite
outline, appearing to be intertwined hyphae with lumina ir-
regular in shape 2–2.5 μm, 2–4 μm thick. Perithecial wall 35–
42 μm wide. Asci cylindrical, (57–)60–81(−100)×7–12 μm,
8-spored, apex with a refractive ring. Ascospores ellipsoid to
fusiform, (12–)13–14(−15)×(5.5–)6–6.5(−7) μm (mean 14×
6 μm), symmetrically two-celled, sometimes with one side
curved and one side flattened, not constricted at se ptum,
spinulose, hyaline. Colonies on PDA 21–27 mm diam (mean
24 mm) after 12 day at 20C, aerial mycelium floccose, white
to purple, producing purple pigment in media at temperatures
≤30C, colony reverse white to bay. Conidia on SNA
forming in hyaline, slimy droplets in aerial mycelium
or on agar surface; pionnotes sometimes formed close
to filter paper on SNA. Phialides borne apically on
irregularly branching clusters of cells or directly from
hyphae, cylindrical or slightly swollen (13.5– )15.5–
21(−24)×(−3)3.5–4.5(−5) μm (mean 18.5×4 μm), with
periclinal thickening and collarette. Macroconidia cylin-
drical or slightly fusiform, curved with round ends, 2–5-
septate: 2-septate (35–)34.5–36.5(−37)×(5–)5.5–6(−6.5)
μm(mean35.5×5.5μm), 3-septate (42–
)47.5–
56(−61)×(5– )5.5–6.5(−7) μm (mean 52×6 μm), 4-
septate (51–)52–60.5(−65)×(5 .5–)6– 7(−7.5) μm(mean
57.5×6.5 μm), 5-septate (57– )60–65.5(−67.5)×(6.5–)7–
7.5(− 8) μm (mean 62.5×7 μm). No microconidia or
chlamydospores formed in culture.
Habitat and distribution. Saprobic on decaying bark of
woody substrates including Quercus sp. and Fagus
grandifolia. Found in Connecticut and North Carolina.
Additional specimens examined. UNITED STATES.
Connecticut: New Haven, West Rock Ridge State Park, on
bark of dead Fagus grandifolia, Oct 2007, R. Marra (BPI
878945, culture A.R. 4499 = CBS 125172).
Notes. This species is similar to T. conchyliata, T. ianthina
and T. porp hyria in that th ey also produc e 3–5-septate
macroconidia. However, only T. tyrus is found in the eastern
United States.
Thelonectria violaria C. Salgado & R.M. Sanchez sp. nov.
Mycobank MB807923
Figure 9a–f.
Diagnosis. Similar to T. discophora. Macroconidia 1–3
septate only, no microconidia produced in culture.
Holotype.ARGENTINA.TucumanProvince:roadto
Catamarca, Camino Las Lenguas, near to Rio Cochuna,
400 m, on bark of a rotting fallen tree, 18 Apr 2011 C.
Salgado, A.Y. Rossman, A. Romero (BPI 892690, ex-type
culture A.R. 4766 = CBS 134035).
Etymology. Refers to the purple coloration of the colony of
the asexual state under culture conditions.
Description. Mycelium not visible on host. Perithecia glo-
bose to subglobose, 300–600 μm high, 200–350 μm wide,
surface smooth and shiny or slightly roughened, solitary or
gregarious in groups of 20 or less, superficial or with base
Fig. 9 a–f Thelonectria tyrus. g–l Thelonectria violaria. a T. tyrus
pionnotes on SNA (G.J.S. 90–46 = CBS 134029). b–d Conidiophores
and macroconidia (G.J.S. 90–46 = CBS 134029). e Colony on PDA
(G.J.S. 90–46 = CBS 134029). f Colony reverse on PDA (G.J.S. 90–46
=CBS134029).g T . violaria perithecia (A.R. 4766 = BPI 892690). h–i
Asci and ascospores in KOH (A.R. 4766 = BPI 892690). j Conidiophores
and macroconidia on SNA (A.R. 4766 = CBS 134035). k Colony on
PDA (C.T.R. 72–188 = CBS 134040). m Colony reverse on PDA (C.T.R.
72–188 = CBS 134040). Bars: a =250μm; b–d, h–j =50μm; g =
500 μm
24 Fungal Diversity (2015) 70:1–29
Fungal Diversity (2015) 70:1–29 25
immersed in substratum with no visible stroma, not collapsed
when dry, sienna to chestnut with the ostiolar area darker
(blood color), red to rose in 3 % KOH, yellow in lactic acid,
papillate. Cells at surface of perithecial wall lacking a definite
outline, appearing to be intertwined hyphae with lumina ir-
regular in shape 2–2.5 μm, 2–4 μm thick. Perithecial wall 35–
45 μm wide. Asci cylindrical, (57–)68–86(−98)×7–11 μm, 8-
spored, apex with a refractive ring. Ascospores ellipsoid to
fusiform, (10–)10.5–13(−14)×( 4– )4.3 –6(−7) μm (mean
11.3×5.3 μm), symmetrically two-celled, sometimes with
one side curved and one side flattened, not constricted at
septum, spinulose, hyaline. Colonies on PDA 30–35 mm diam
(mean 33 mm) after 12 d at 20C, aerial mycelium floccose,
white to mauve, producing purple to cinnamon pigment in
media at temperatures <20C colony, reverse white to bay.
Conidia on SNA forming in hyaline, slimy droplets in aerial
mycelium or on agar surface; pionnotes sometimes formed
close to filter paper on SNA. Phialides borne apically on
irregularly branching clusters of cells or directly from hyphae,
cylindrical or slightly swollen (13–)14.5–20(−24.5)×(3–)4–
5(−5.5) μm(mean17×4μm), with periclinal thickening and
collarette. M acroconidia cylindrical or slightly fusiform,
curved with round ends, 1–3-septate: 1-septate (31.5–)39–
47.5(−49)×(3.5–)4.5–5.5(−6) μm (mean 43.5×5 μm), 2-
septate (48–)48–54.5(−57)×(4.5–)5
–5.5(−6) μm (mean 51×
5.5 μm), 3-septate (36.5–)47.5–57.5(−68.5)×(4.5–)5–6(−7)
μm (mean 52.5×5.5 μm). No microconidia or chlamydo-
spores formed in culture.
Habitat and distribution. Saprobic on decaying bark
woody substrates. Found in the type locality (Argentina) and
Venezuela; possibly distributed widely in tropical and sub-
tropical regions of South America.
Additional specimens examined. VENEZUELA. 13 km
NE of Colonia Tovar on road between Colonia Tovar and El
Tigre, Dto. Fed., on bark of unidentified tree, 19 Jul 1972, K.P
Dumont, R.F. Cain, G.J. Samuels, B. Manara (NY Dumont-
VE 6503, culture C.T.R. 72–188 = CBS 134040).
Notes. This species is similar to T. asiatica and T. rubi in
that 1–3-septate m acroconidia are produced in culture.
However, T. violaria can be distinguished by the lack of
microconidia and the lack of macroconidia with septations
greater than 4.
Possible additional species
Thelonectria beijingensis Z.Q. Zeng, J. Luo & W.Y. Zhuang
Mycobank MB564936
Brief description (b ased on Zeng and Zhuang 201 3).
Ascospores ellipsoid to fusiform, 13–17×4–7 μm. Colony
reaching 22 mm after 7 days on PDA at 25C. Macroconidia
1–3-septate: 1-septate 32–46×3–4 μm, 2-septate 43–51×3–
4 μm, 3-septate 41–54×3–5 μm. Microconidia 41–51×3–
5.5 μm. Chlamydospores absent.
Notes. See Zeng and Zhuang (2013) for full description and
illustrations.
Thelonectria yunnanica Z.Q. Zeng & W.Y. Zhuang
Mycobank MB564937.
Brief description (b ased on Zeng and Zhuang
2013).
Ascospores ellipsoid to fusiform, 13–17×6–8 μm. Colony
reaching 32 mm after 7 days on PDA at 25C. Macroconidia
3–9-septate: (59– )60–93(−93.5) ×(5.5– )6–9(−9) μm.
Microconidia 1-septate, (8–)8.2–16(−16.5)×(3–)3.5–4.5(−5)
μm. Chlamydospores absent.
Notes. See Zeng and Zhuang (2013) for full description and
illustrations.
Discussion
Historically, specimens with similar sexual and asexual states
morphology to that of the type species were labeled
Thelonectria discophora sensu lato. Because collections hav-
ing this morphology have been found in many regions of the
world, T. discophora was assumed to have a cosmopolitan
distribution. Our phylogenetic and morphological analyses of
a large number of specimens and cultures of T. discophora
revealed at least 16 previously unrecognized cryptic species.
Using the genealogical concordance phylogenetic species
concept principles (Dettman et al. 2003), we have formally
described those 16 cryptic species. The genetic distances
between putative species mostly exceeded standard values of
genetic distance (0.01–0.03) used to delimit operational taxo-
nomic units (OTU), revealing them as separate and indepen-
dent entities (Salgado-Salazar et al. 2013). This indicates a
>16-fold increase in the species diversity in the genus
Thelonectria, a genus recently established for nectriaceous
fungi that typically have a broad mammiform (nipple-like)
perithecial apex.
Our phylogenetic analyses also detected nine single isolate
lineages or singletons. These lineages, together with those
found by Zeng and Zhuang (2013), T. beijingensis and
T. yunnanica (Online Resource 2), constitute additional dis-
tinctive evolutionary entities that make up a considerable
portion of the diversity of species in this complex. In system-
atics, no consensus exists on how singleton lineages should be
treated (Seifert and Rossman 2011). In phylogenetic analyses,
singleton lineages are located in branches with unknown
support (i.e., bootstrap, posterior probability), as a clade
should have at least two representatives to obtain statistical
support. Even though T. beijingensis and T. yunnanica were
found to have affinities to species described here, their lack of
agreement in the morphological characters of the asexual
states prevents us from reaching a definite conclusion about
them. Further increase in taxon and molecular sampling would
determine if the singleton lineages here and the species de-
scribed by Zeng and Zhuang (2013) represent different
26 Fungal Diversity (2015) 70:1–29
species. In spite of this, many of these singletons likely con-
stitute rare taxa, which highlight even more the importance of
preserving the habitat where they can be found (Dahlberg and
Mueller 2011).
Species in the T. discophora complex appear not only to be
consistent with allopatric but also sympatric speciation
(Giraud et al. 2008). The T. discophora complex includes
species that correlate with geographic origin, i.e., the species
group isolates from the same or close-by regions. However,
this complex also includes species with isolates from distant
geographic locations. Since no definite explanation can be
given for this phenomenon, this suggests that these species
have not been sampled thoroughly and, by adding more
samples, a b etter geographic structure may be obse rve d.
According to our data, ten species were found only in tem-
perate regions such as the United States, Europe, Asia and
New Zealand. Fewer species were found in tropical regions.
However, this could be a result of the lower taxon sampling
because, for exa mple, the numerous collections fr om
Venezuela represent at least four species. Thus, one may
assume that T. discophora-like species can be found in tropical
and temperate regions equally. Due to their small size and
ecological preferences, these fungi have only been collected
serendipitously resulting in limited taxon sampling. As is the
case with poorly studied organisms, increasing their collection
can further support assumptions about the geographic range of
the species or about their center of origin. The role of human-
mediated movement of species of T. discophora,con-
tributing to the actual geographic distribution of species,
cannot be discarded. However, because these species do
not include invasive or pathogens of commercial or
forest plants, their presence is often o verlooked and
movement difficult to track.
The results from our research support previous studies with
other microorganisms, including fungi, suggesting that there
are very few truly cosmopolitan species (Pringle et al. 2005;
Taylor et al. 2006; Carriconde et al. 2008; Salgado-Salazar
et al. 2013). Because T. discophora is a species complex that
includes various species with limited geographic distribution
and ecology, we hypothesize that the lack of mechanisms for
long-distance spore dispersal could be affecting their distribu-
tion. Only two sp ecies in this group have been found to
produce microconidia, which could be easily carried by wind
currents. However, they are also found to be geographically
restricted. The majority of T. discophora species have asexual
spores (macroconidia) that are colorless and long er than
30 μm, sometimes reaching 100 μm; their sexual spores
(ascospores) are also colorless or non-melanized. More im-
portantly, both sexual and asexual spores do not have shapes
that could improve dispersal, possibly landing after traveling
short distances (Roper et al. 2008; Roper et al. 2010). These
characteristics together may limit considerably the range of
dispersal of these fungi, and consequently populations
undergo independent evolutionary trajectories and, ultimately,
species divergence. The marked genetic structure observed
among the species in the T. discophora species complex likely
reflects the interplay between their poor dispersal capabilities
and the restrictions to gene flow either imposed by geograph-
ical or reproductive barriers.
With the exception of T. r u b i , all the species in the
T. discophora complex are saprobic on decaying plant mate-
rial or soil. Species occurring in unconnected, but similar
habitats and under similar selection pressures often display
strikingly comparable morphology, behavior and life history
and, without a phylogeny, it is often difficult to separate
whether similar traits are a result of in situ diversification or
independent colonization. Based on the results obtained in this
study, we determined that shared morphological and ecolog-
ical characters of these species represent a case of convergence
and are the result of their similar habitat and selection pres-
sures. As other species in the genus Thelonectria,suchas
T. c o ro n a t a , T. jungneri,
T. l u c i d a and T. veuillotiana, can also
be found in the same habitat as members of the T. discophora
species complex, it is possible that the ability of these species
to produce extracellular secondary metabolites, such as the
characteristic purple pigment, could represent an adaptive
advantage for the species (Yu and Keller 2005). Studies on
the nature of pigments produced by these species are lacking,
and further investigations may help elucidate their role in
adaptation.
Since many historical species shared morphological char-
acters with T. discophora, several monographic accounts
regarded these species as synonyms. With this study, we
revised the taxonomic synonyms and updated the current
status of the names. For exam ple, Nect ria mammoidea ,
N. pinea and Ne onectria discophora var. ru bi are herein
renamed, redefined and epitypified. In the case of
Thelonectria, names associated with the asexual states are
no longer used, consequently the name Cylindrocarpon
ianthothele var. ianthothele is a synonym of Thelonectria
rubi, C. ianthothele var. majus is a synonym of
T. mammoidea, and C. pineum is a synonym of T. pinea.
According to several taxon omic revisi ons (Booth 1966;
Samuels et al. 1990; Brayford et al. 2004; Chaverri et al.
2011), no Cylindrocarpon name was ever correctly assigned
to T. discophora,asallCylindrocarpon ianthothele names
were based on the conidial state of T. mammoidea (≡Nectria
mammoidea). One isolate of Nectria tasmanica (ICMP 5290)
was found to produce an asexual state with morphology
similar to Fusarium, thus this name needs further revision.
In conclusion, we demonstrate that a combination of both
morphological and phylogenetic analyses is effective for the
clarification of taxonomic status of species, especially those
that have been difficult to resolve using morphological char-
acters alone. The unlinked nuclear markers and phylogenetic
analyses enabled us to resolve the species level relationships
Fungal Diversity (2015) 70:1–29 27
in this group, despite the presence of recently diverged clades.
Our results confirm high lineage diversity in this group of
fungi and highlight the importance of a comprehensive delim-
itation of species within highly diverse groups to better un-
derstand the factors that drive the diversification of biota and
to correctly identify targets for conservation.
Key to the species in the Thelonectria discophora species
complex
1. Micro-andmacroconidiaproducedonSNA .......2
1. OnlymacroconidiaproducedonSNA............3
2. Causing a distinctive basal canker in Rubus spp. in
Europe, including Switzerland (type locality) and
UnitedKingdom .....................T. rubi
2. Not causing canker in Rubus spp., saprobe, in China
and Japan (type locality), macroconidia 1–3-
septate..........................T. asiatica
3. Macroconidia 1–3-septate, in Argentina (type locality)
andVenezuela.......................T. violaria
3. Macroconidia 1–4- or 1–5- septate, known from temper-
ateandtropicalregions .......................4
4. Macroconidia 1–4- septate, known from New
Zealand (type locality), saprobe, restricted to Pinus
radiata ...........................T. pinea
4. Macroconidia 1–5-septate, from New Zealand, not
on P.radiata ............................5
5. Macroconidia 1–5-septate, from New Zealand (type lo-
cality) on decaying plant material different than
P. radiata, including Quercus sp........ T. brayfordii
5. Macroconidia 1–5-septate, known from New Zealand
andelsewhere ..............................6
6. Microconidia 1–5-septate, from New Zealand,
United Kingdom (type locality) and
Switzerland ............T. mammoidea
6. Macroconidia 1–5-septate, from Central and South
AmericaandAustralasia ...................7
7. Macroconidia 1–5-septate, from Central America (Costa
Rica, type locality) and northern South America
(Venezuela) ........................T. purpurea
7. Macroconidia 1–5-septate, not from Central and South
America...................................8
8. Macroconidia 1– 5-septate, from Australia,
IndonesiaandTaiwan............T. phoenicea
8. Macroconidia 3–6-septate, widely distributed. . . . 9
9. Macroconidia 3–6-septate, known from Japan (type
locality)........................... T. japonica
9. Macroconidia 3–6-septate, found other than Japan . . 10
10. Macroconidia 3–6-septate, collected as the asexual
state in soil in Germany (type locality) and The
Netherlands......................T. blattea
10. Macroconidia 3–6-septate, collected as the sexual
state on bark of decaying plant material . . . . . . 11
11. Macroconidia 3–6-septate, collected as the sexual state,
known from Japan, Puerto Rico (type locality) and
Venezuela............................T. ostrina
11 Macroconidia 3–5 septate, from temperate regions . . 12
12. Macroconidia 3–5-septate, from Chile (type locality)
andScotland................... T. discophora
12. Macroconidia 3–5 septate, not from Chile nor
Scotland..............................13
13. Macroconidia 3–5 septate, only known from Japan (type
locality).......................... T. porphyria
13. Macroconidia 3–5 septate, known from regions other
thanJapan................................14
14. Macroconidia 3–5-septate, known from eastern
UnitedStates...................... T. tyrus
14. Macroconidia 3–5-septate, known from other than
easternUnitedStates....................15
15. Macroconidia 3–5-septate, average colony growth on
PDA at 30C >13 mm after 12 days . . . . T. conchyliata
15. Macroconidia 3–5-septate, average colony growth on
PDAat30C<13mmafter12days .......T. ianthina
Acknowledgments This study was funded by a grant from United
States National Science Foundation (PEET program) DEB-0925696:
“Monographic Studies in the Nectriaceae, Hypocreales: Nectria,
Cosmospora,andNeonectria” to University of Maryland (P. Chaverri,
G.J. Samuels & A.Y. Rossman). Special thanks to Christian Feuillet for
helping with Latin names. We are indebted to the Genetic Resources
Collecti on at CABI UK for providing various cultures, Dr. Carlos
Mendez (University of Costa Rica) for providing transportation during
collecting trips in Costa Rica, Dr. Andrea Romero for her invaluable help
during fieldwork in Argentina, Dr. Teresa Iturriaga for collaborating and
organizing the collecting trip in Venezuela, Dr. Margaret Dick for pro-
viding specimens from New Zealand, Andres de Errasti for providing the
specimen and culture from Chile, and Dr. Guu for providing specimens
and cultures from Taiwan.
References
Booth C (1966) The genus Cylindrocarpon. Mycol Pap 104:1–56
Brayford D (1991) Nectria canker. In: Ellis MA, Converse RH, Williams
RN, Williamson B (eds) Compendium of raspberry and blackberry
diseases and insects. American Phytopathological Society Press, St.
Paul, p 20
Brayford D, Samuels GJ (1993) Some didymosporous species of Nectria
with non-microconidial Cylindrocarpon anamorphs. Mycologia 85:
612–637
Brayford D, Honda BM, Mantiri FR, Samuels GJ (2004) Neonectria and
Cylindrocarpon:theNectria mammoidea group and species lacking
microconidia. Mycologia 96:572–597
Carbone I, Kohn LM (1999) A method for designing primer sets for
speciation studies in filamentous ascomycetes. Mycologia 85:612–637
Carriconde F, Gardes M, Jargeat P, Heilmann-Clausen J, Mouhamadou B,
Gryta H (2008) Population evidence of cryptic species and geo-
graphical structure in the cosmopolitan ectomycorrhizal fungus
Tricholoma scalpturatum. Microb Ecol 56:513–524
28 Fungal Diversity (2015) 70:1–29
Castlebury LA, Rossman AY, Sung G-H, Hyten AS, Spatafora JW (2004)
Multigene phylogeny reveals new lineage for Stachybotrys
chartarum, the indoor air fungus. Mycol Res 108:1–9
Cedeño L, Carrero C, Quintero K, Pino H, Espinoza W (2004)
Cylindrocarpon destructans var. destructans and Neonectria
discophora var . rubi associated with black foot rot on blackberry
(Rubus glaucus Benth.) in Merida, Venezuela. Interciencia 29:455–460
Chaverri P, Vilchez B (2006) Hypocrealean (Hypocreales, Ascomycota)
fungal diversity in different stages of succession in a tropical forest
in Costa Rica. Biotropica 38:531–543
Chaverri P, Salgado C, Hirooka Y, Rossman AY, Samuels GJ (2011)
Delimitation of Nectria and Cylindrocarp on (Nectri aceae,
Hypocreales, Ascomycota) and related genera with
Cylindrocarpon-like anamorphs. Stud Mycol 68:57–68
Dahlberg A, Mueller GM (2011) Applying IUCN red-listing criteria for
assessing and reporting on the conservation status of fungal species.
Fungal Ecol 4:147–162
Dettman JR, Jacobson DJ, Taylor JW (2003) A multilocus genealogical
approach to phylogenetic species recognition in the model eukaryote
Neurospora. Evolution 57:2703–2720
Dingley JM (1951) The Hypocreales of New Zealand. II. The genus
Nectria. Trans R Soc NZ 79:177–202
Fierer N, Jackson RB (2006) The diversity and biogeography of soil
bacterial communities. Proc Natl Acad Sci U S A 103:326–631
Finlay BJ (2002) Global dispersal of free-living microbial eukaryote
species. Science 296:1061–1063
Giraud T, Refregier G, Le Gac M, De Vienne DM, Hood ME (2008)
Speciation in fungi. Fungal Genet Biol 45:791–802
Guu J-R, Ju Y-M, Hsieh H-J (2007) Nectriaceous fungi collected from
forest in Taiwan. Bot Stud 48:187–203
Hawksworth DL (2011) A new dawn for the naming of fungi: impacts of
decisions made in Melbourne in July 2011 on the future publication
and regulation of fungal names. IMA Fungus 2:155–162
Hirooka Y, Kobayashi T (2007) Taxonomic studies of nectrioid fungi in
Japan. I: the genus Neonectria. Mycoscience 48:53–62
Hirooka Y, Rossman AY, Samuels GJ, Lechat C, Chaverri P (2012) A
monograph of Allantonectria, Nectria and Pleonectria
(Nectr iaceae, Hypoc reales, Ascomycota) and their pycnidial,
sporodochial, and synnematous anamorphs. Stud Mycol 71:1–210
Hudson RR, Boos DD, Kaplan NL (1992) A statistical test for detecting
geographic subdivision. Mol Biol Evol 9:138–151
Huelsenbeck JP, Rannala B (2004) Frequentist properties of Bayesian
posterior probabilities of phylogenetic trees under simple and com-
plex substitution models. Syst Biol 53:904–913
Huelsenbeck JP, Ronquist F, Nielsen R, Bollback JP (2001) Bayesian
inference of phylogeny and its impact on evolutionary biology.
Science 294:2310–2314
James TY, Porter D, Hamrick JL, Vilgalys R (1999) Evidence for limited
intercontinental gene flow in the cosmopolitan mushroom
Schizophyllum commune. Evolution 53:1665–1677
Leigh JW, Susko E, Baumgartner M, Roger AJ (2008) Testing congru-
ence in phylogenomic analysis. Syst Biol 57:104–115
Librado P, Rozas J (2009 ) DnaSP v5: a software for comprehen -
sive analysis of DNA polymorphism data. Bioinformatics 25:
1451–1452
Loytynoja A, Goldman N (2005) An algorithm for progressive multiple
alignment of sequences with insertions. Proc Natl Acad Sci U S A
102:10557–10562
Nei M (1987) Molecular evolutionary genetics. Columbia University
Press, New York, 521 pp
Nirenberg HI (1976) Untersuchungen uber die morphologische und
biologische Differenzierung in der Fusarium-Sektion Liseola. Mitt
Biol Bundesanst Land- Forstw Berlin-Dahlem 169:1–117
O’Donnell K, Cigelnik E (1997) Two divergent intragenomic rDNA ITS2
types within a monophyletic lineage of the fungus Fusarium are
nonorthologous. Mol Phylogenet Evol 7:103–117
Penn O, Privman E, Ashkenazy H, Landan G, Graur D, Pupko T (2010)
GUIDANCE: a web server for assessing alignment confidence
scores. Nucleic Acids Res 38(Web Server issue):W23–W28
Posada D (2008) jModelTest: phylogenetic model averaging. Mol Biol
Evol 25:1253–1256
Pringle A, Baker DM, Platt JL, Wares JP, Latgé JP, Taylor JW (2005)
Cryptic speciation in the cosmopolitan and clonal human pathogenic
fungus Aspergillus fumigatus. Evolution 59:1886–1899
Queloz V, Sieber TN, Holdenrieder O, McDonald BA, Grunig CR (2011)
No biogeographical pattern for a root-associated fungal species
complex. Glob Ecol Biogeogr 20:160–169
Rambaut A (2005) FigTree v1.3.1. http://tree.bio.ed.ac. uk/software/
figtree/
Rambaut A, Drummond AJ (2007) Tracer v. 1.5. http://beast.bio.ed.ac.
uk/Tracer
Rayner RW (1970) A mycological colour chart. Surrey, United Kingdom,
Commonwealth Mycological Institute Kew, 34 pp
Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian phylogenetic
inference under mixed models. Bioinformatics 19:1572–1574
Roper M, Pepper R E, Bren ner MP, Pringle A (2008) Explosively
launched spores of ascomycetes fungi have drag-minimizing shapes.
Proc Natl Acad Sci U S A 105:20583–20588
Roper M, Seminara A, Bandi MM, Cobb A, Dillard HR, Pringle A (2010)
Dispersal of fungal spores on a cooperatively generated wind. Proc
Natl Acad Sci U S A 107:17474–17479
Rossman AY, Seifert KA, Samuels GJ, Minus AW, Schroers HJ,
Lombard L, Crous PW, Poldma K, Cannon PF, Summerbell RC,
Geiser DM, Zhuang W, Hirooka Y, Herrera C, Salgado-Salazar C,
Chaverri P (2013) Genera in Bionectriaceae, Hypocreaceae and
Nectriaceae (Hypocreales) proposed for acceptance or rejection.
IMA Fungus 4:41–51
Rydholm C, Szakacs G, Lutzoni F (2006) Low genetic variation and no
detectable population structure in
Aspergillus fumigatus compared
to closely related Neosartorya species. Eukaryot Cell 5:650–657
Salgado-Salazar C, Rossman AY, Samuels GJ, Capdet M, Chaverri P
(2012) Multigene phylogenetic analyses of the Thelonectria coronata
and T. veuillotiana species complexes. Mycologia 104:1325–1350
Salgado-Salazar C, Rossman AY, Chaverri P (2013) Not as ubiquitous as
we thought: taxonomic crypsis, hidden diversity and cryptic speci-
ation in the cosmopolitan fungus Thelonectria discophora
(Nec triaceae, Hypocreal es, Ascomycota). PLoS ONE 8(10):
e76737. doi:10.1371/journal.pone.0076737
Samuels GJ, Brayford D (1994) Species of Nectria (sensu lato) with red
perithecia and striate ascospores. Sydowia 46:75–161
Samuels GJ, Doi Y, Rogerson CT (1990) Hypocreales. In:
Samuels GJ (ed) Contributions toward a mycobiota of
Indonesia: Hypocreales, synnematous Hyphomycetes,
Aphyllophorales, Phragmobasidiomycetes , and Myxomy cetes.
New York Botanical Garden, New York, pp 6–108
Samuels GJ, Dodd S, Lu B-S, Petrini O, Schroers H-J, Druzhinina I-S
(2006) The Trichoderma koningii aggregate species. Stud Mycol 56:
67–133
Seifert KA, Rossman AY (2011) How to describe a new fungal species.
IMA Fungus 1:109–116
Silvestro D, Michalak I (2012) raxmlGUI: a graphical front-end for
RAxML. Org Divers Evol 12:335–337
Stamatakis A (2006) RAxML-VI-HPC: maximum likelihood-based phy-
logenetic analyses with thousands of taxa and mixed models.
Bioinformatics 22:2688–2690
Taylor JW, Turner E, Townsend JP, Dettman JR, Jacobson D (2006)
Eukaryotic microbes, species recognition and the geographic limits
of species: examples from the kingdom Fungi. Philos Trans R Soc
Lond B Biol Sci 361:1947–1963
White TJ, Bruns T, Lee S, Taylor JW (1990) Amplification and direct
sequencing of fungal ribosomal RNA genes for phylogenetics. In:
Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds) PCR protocols:
A guide to methods and applications. Academic, New York, pp
315–322
Yu J-H, Keller N (2005) Regulation of secondary metabolism in filamen-
tous fungi. Annu Rev Phytopathol 43:437–458
Zeng Z-Q, Zhuang W-Y (2013) Four new taxa of Ilyonectria and
Thelonectria (Nectriaceae) revealed by morphology and
combined ITS and B-tubulin sequence data. Phytotaxa 85:
15–25
Fungal Diversity (2015) 70:1–29 29
