The RNA-binding protein Mex3b regulates the spatial organization of the Rap1 pathway

Abstract

The four related mammalian MEX-3 RNA-binding proteins are evolutionarily conserved molecules for which the in vivo functions have not yet been fully characterized. Here, we report that male mice deficient for the gene encoding Mex3b are subfertile. Seminiferous tubules of Mex3b-deficient mice are obstructed as a consequence of the disrupted phagocytic capacity of somatic Sertoli cells. In addition, both the formation and the integrity of the blood-testis barrier are compromised owing to mislocalization of N-cadherin and connexin 43 at the surface of Sertoli cells. We further establish that Mex3b acts to regulate the cortical level of activated Rap1, a small G protein controlling phagocytosis and cell-cell interaction, through the activation and transport of Rap1GAP. The active form of Rap1 (Rap1-GTP) is abnormally increased at the membrane cortex and chemically restoring Rap1-GTP to physiological levels rescues the phagocytic and adhesion abilities of Sertoli cells. Overall, these findings implicate Mex3b in the spatial organization of the Rap1 pathway that orchestrates Sertoli cell functions.

Full text

RESEARCH ARTICLE
The RNA-binding protein Mex3b regulates the spatial organization
of the Rap1 pathway
Maïlys Le Borgne
1
, Nicolas Chartier
1
, Karine Buchet-Poyau
2
, Olivier Destaing
1
, Eva Faurobert
1
, Chantal Thibert
1
,
Jean-Pierre Rouault
3
, Julien Courchet
4
, Didier Negre
5
, Daniel Bouvard
1
, Corinne Albiges-Rizo
1
,
Sophie Rousseaux
1
, Saadi Khochbin
1
, Dominique Segretain
6,7
, Pascale Crepieux
8
, Florian Guillou
8
,
Philippe Durand
3
, Marie-Helene Perrard
3
and Marc Billaud
1,
*
ABSTRACT
The four related mammalian MEX-3 RNA-binding proteins are
evolutionarily conserved molecules for which the in vivo functions
have not yet been fully characterized. Here, we report that male mice
deficient for the gene encoding Mex3b are subfertile. Seminiferous
tubules of Mex3b-deficient mice are obstructed as a consequence of
the disrupted phagocytic capacity of somatic Sertoli cells. In addition,
both the formation and the integrity of the blood-testis barrier are
compromised owing to mislocalization of N-cadherin and connexin 43
at the surface of Sertoli cells. We further establish that Mex3b acts to
regulate the corticallevel of activated Rap1, a smallG protein controlling
phagocytosis and cell-cell interaction, through the activation and
transport of Rap1GAP. The active form of Rap1 (Rap1-GTP) is
abnormallyincreased at the membrane cortex and chemically restoring
Rap1-GTPto physiologicallevels rescuesthe phagocyticand adhesion
abilities of Sertoli cells. Overall, these findings implicate Mex3b in the
spatial organization of the Rap1 pathway that orchestrates Sertoli
cell functions.
KEY WORDS: MEX-3, RNA-binding proteins, Rap1, Phagocytosis,
Sertoli cell, Mouse
INTRODUCTION
RNA-binding proteins (RBPs) are central effectors in the control of
co- and post-transcriptional mechanisms that contribute to a diverse
array of cellular events (Hogan et al., 2008). Recent large scale
analyses have further revealed the role of RBPs and their cognate
target RNAs in the assembly of multimolecular complexes at specific
cellular sites and in the morphological organization of cells (de Hoog
et al., 2004; Lécuyer et al., 2007). However, although mRNA
interactome studies have provided evidence that RBPs constitute a
very large family comprising >1100 proteins in human (Baltz et al.,
2012; Castello et al., 2012; Ray et al., 2013), their functions in
mammals have not been extensively explored in vivo yet.
We and others have characterized a novel family of four
mammalian RBPs, called MEX3A to MEX3D (Buchet-Poyau
et al., 2007; Donnini et al., 2004). The MEX-3 gene, initially
discovered in Caenorhabditis elegans (Draper et al., 1996; Hunterand
Kenyon, 1996), was found to encode an RBP acting as a translation
repressor that specifies the fate of posterior blastomeres during early
embryogenesis (Hunter and Kenyon, 1996). Furthermore, MEX-3
together with the RNA-binding protein GLD-1 is essential in
maintaining the germline totipotency in the nematode (Ciosk et al.,
2006). MEX-3 proteins contain two tandem KH (hnRNP K
homology) domains that bind RNA, and mammalian MEX-3
orthologs possess a RING finger motif located at the carboxy-
terminal end(Buchet-Poyau etal., 2007). A consensus RNAsequence
bound by the C. elegans MEX-3, consisting of a bipartite recognition
element named MRE, has been defined and mapped in the 30UTR of
>25% of the worm genes (Pagano et al., 2009).
Since their initial description, several reports have sustained
the idea that mammalian MEX-3 proteins play several roles in the
control of RNA metabolism (Pereira et al., 2013a). MEX3A and
MEX3B proteins localize in P-bodies and stress granules, two
structures involved in the storage and turnover of mRNAs (Buchet-
Poyau et al., 2007; Courchet et al., 2008). MEX3A controls
the polarity and stemness of intestinal epithelial cells through the
downregulation of the mRNA encoding the CDX2 transcription
factor (Pereira et al., 2013b) and, in addition, exhibits a transforming
activity when overexpressed in gastric epithelial cells (Jiang et al.,
2012). Furthermore, MEX3C and an isoform of MEX3D called
TINO control, respectively, the stability of the transcripts coding for
the HLA-A2 MHC class I molecule and the anti-apoptotic protein
BCL2 (Cano et al., 2012; Donnini et al., 2004). Interestingly,
MEX3C acts as a suppressor of chromosomal instability (Burrell
et al., 2013), but the RNA-dependent mechanisms involved in this
process remain to be determined. Finally, mice with a gene trap
insertion in the Mex3c locus display postnatal growth retardation, a
skeletal phenotype linked to the impaired translation of the mRNA
encoding the insulin-like growth factor 1 in bone-forming cells (Jiao
et al., 2012a). This Mex3c mutation has also been found to enhance
mouse energy expenditure, probably through the action of Mex3c in
a subpopulation of hypothalamic neurons controlling energy
metabolism (Jiao et al., 2012b).
To gain further insight into the function of mammalian MEX-3
homologs, we disrupted the Mex3b gene in mouse. We now report
that null mice are subfertile owing to a dysfunction of somatic cells
in the gonads. In males, the lack of Mex3b impaired the phagocytic
properties of Sertoli cells and led to a disorganization of the
junctional complexes created between adjacent Sertoli cells that
form the blood-testis barrier (BTB). Investigation of the underlying
mechanism revealed an unexpected function of Mex3b in the
Received 29 January 2014; Accepted 14 March 2014
1
INSERM, U823; UniversiteJoseph Fourier-Grenoble 1; Institut Albert Bonniot,
Grenoble F-38700, France.
2
Hospices Civils de Lyon, Po
le Information Medicale
Evaluation Recherche, Lyon F-69003, France.
3
Institut de Genomique
Fonctionnelle de Lyon, UMR5242 CNRS/INRA/UCBL/ENS, Ecole Normale
Superieure de Lyon, 46, alleed’Italie, Lyon 69364, Cedex 07, France.
4
Columbia
University Department of Neurosciences, New York, NY 10032, USA.
5
Universitede
Lyon, Inserm, EVIR, U758, Human Virology Department, Ecole Normale Superieure
de Lyon, UniversiteLyon 1, Lyon F-69007, France.
6
UMR S775, University Paris
Descartes, 45 rue des Saints Peres, Paris 75006, France.
7
University of Versailles,
Saint Quentin 78035, France.
8
Physiologie de la Reproduction et des
Comportements, UMR 7247 INRA-CNRS-Universitede Tours, Nouzilly 37380,
France.
*Author for correspondence (Marc.Billaud@ujf-grenoble.fr)
2096
© 2014. Published by The Company of Biologists Ltd
|
Development (2014) 141, 2096-2107 doi:10.1242/dev.108514
DEVELOPMENT

regulation of the spatial activation of Rap1 (Rap1a –Mouse
Genome Informatics), a small GTPase protein implicated in the
control of phagocytosis and cell adhesion, through the stimulation
and the recruitment of the Rap1 GTPase-activating protein
(Rap1GAP) at the inner face of the plasma membrane.
RESULTS
Histological structure of the gonads is disorganized in Mex3b
null mice
To explore Mex3b functions in vivo, we generated mice carrying a
conditional Mex3b allele with two loxP DNA sequences framing
exon 2, which encodes 463amino acids out of the 576 amino acids of
the Mex3b protein (Fig. 1A). Heterozygous mice carrying one copy
of the null allele were generated through crosses with Nestin-Cre
transgenic strains that led to the excision of the floxed allele during
gametogenesis (Betz et al., 1996). The intercross of Mex3b
+/−
mice
and the genotyping of the resulting offspring confirmed the
generation of Mex3b null mice (Fig. 1B). Subsequent molecular
analyses showed the absence of the Mex3b mRNA (supplementary
material Fig. S1A) and protein in both mouse embryonic fibroblasts
(MEFs) and testis extracts prepared from Mex3b
−/−
animals (Fig. 1C;
supplementary material Fig. S1B). Mex3b null mice were born at
expected Mendelian ratio, but 30% of these mice died on the first day
after birth (supplementary material Fig. S1C). However, no gross
abnormalities were observed upon macroscopic examination. The
animals surviving to adulthood were smaller and displayed reduced
body weight, a statural and weight deficit that was maintained
throughout their lives. Upon breeding of the Mex3b
+/−
heterozygous
mice, we observed that the number of pups per month and per female
was significantly reduced (0.66 for the breeding of male and female
Mex3b
+/−
mice compared with 0.8 for the breeding of wild-type
mice) (Table 1). This decrease was even more pronounced when null
male or females were crossed to the wild-type mice (0.39 and 0.35,
respectively) or when Mex3b
−/−
animals were intercrossed (0.33).
This effect could not be ascribed to a sexual behavior phenotype of
Mex3b
+/−
or Mex3b
−/−
animals, because vaginal plugs were daily
observed in females after pairing.
Because MEX-3 contributes to the maintenance of the C. elegans
germline, we decided to investigate further the effects of its deletion
on the histology of mouse gonads. Examination of secondary
follicle in ovaries of 6-month-old Mex3b
−/−
female mice revealed a
gross disorganization of the granulosa layers with apparent cellular
piknosis (supplementary material Fig. S1D). In Mex3b
−/−
males, the
analysis of testes cross-sections of animals ranging from 3 to
6 months of age showed that the architecture of the seminiferous
epithelium was altered significantly (Fig. 1E). At 6 months, the
lumen within a third of the seminiferous tubules was obstructed
(Fig. 1E), a phenotype that did not worsen with aging up to
18 months. We predicted that this obstructive phenotype would
decrease the effective sperm count in Mex3b null males. Indeed,
when we quantified the number of sperm cells flushed from the
caudal epididymis of Mex3b
−/−
males versus wild-type males, we
found a two- to threefold reduction in the sperm count compared
with that of the wild type at 40 days and at 3 months (Fig. 1D).
However, under microscopic observation we observed neither overt
abnormalities of spermatozoan morphology, nor sperm cell motility
Fig. 1. Genetic ablation of Mex3b causes
fertility defects in mice. (A) Schematic of the
wild-type Mex3b allele flanked by LoxP
sequences. (B) Genotyping of heterozygous
Mex3b floxed mice (Mex3bFlox
/+
), wild-type
(Mex3b
+/+
), heterozygous (Mex3b
+/−
) and
nullizygous (Mex3b
−/−
) mice. Positions of the
different alleles are indicated. (C) Western
blot analysis of endogenous Mex3b
immunoprecipitated from mouse embryonic
fibroblasts (MEFs) with the indicated Mex3b
genotypes. (D) Number of sperm cells isolated
from the epididymis of wild-type and Mex3b-
deficient mice at different ages (n=5 mice per
group; error bars indicate s.e.m.). (E) Periodic
Acid Schiff staining of testes sections from mice
with the indicated Mex3b genotypes. Areas
within dashed boxes are shown at higher
magnification on the right, showing
representative stage seminiferous tubes. The
tubular lumen were empty in control mice
(stages IV and XI), whereas those of Mex3b
−/−
mice were obstructed even in early stages of
the seminiferous epithelium (stages I-II and VI).
2097
RESEARCH ARTICLE Development (2014) 141, 2096-2107 doi:10.1242/dev.108514
DEVELOPMENT

defects. We confirmed that Mex3b is expressed in Sertoli cells as
well as in pachytene spermatocyte and round spermatids; although
the level of Mex3b mRNA was very low in pachytene spermatocytes
(supplementary material Fig. S1E). The three other Mex3 genes are
also expressed in total testis and have a pattern of expression similar
to that of Mex3b (supplementary material Fig. S1E). Importantly,
we did not observe any compensatory increase in the expression of
the three other mex-3 homologs in Mex3b
−/−
testes and in Mex3b
−/−
Sertoli cells (supplementary material Fig. S1F). Thus, these data
indicate that the knockout of Mex3b adversely affects the
histological architecture of the gonads in females and males and
further suggest that the lack of Mex3b perturbs the functions of
gonadal somatic cells, i.e. granulosa and Sertoli cells, resulting in
the observed subfertility.
The loss of Mex3b specifically affects Sertoli cells
Taking these findings into consideration, we chose to focus our
study on the role of Mex3b in spermatogenesis. The seminiferous
epithelium is composed of two cell types: the germ and Sertoli cells.
Somatic Sertoli cells are large polarized cells that extend from the
basement membrane to the lumen of the tubules. These cells act as a
stem cell niche and a nurturing microenvironment for the germ cells
during their differentiation from diploid spermatogonia to haploid
spermatozoa (Russell and Peterson, 1985). About 30 germ cells at
different stages of their maturation interact with each Sertoli cell.
Specific types of junctions between adjacent Sertoli cells form
the BTB, which constitutes an immune-privileged site protecting
postmeiotic germ cells (Cheng and Mruk, 2012). Finally, Sertoli
cells clear apoptotic germ cells and residual bodies that are derived
from the excess cytoplasmic content and organelles shed by
spermatids during their differentiation.
To investigate whether the phenotype observed in the seminiferous
tubules resulted from a perturbation of the Sertoli or of the germ cell
functions, cross-section of tubules were immunostained with an anti-
vimentin antibody. In the testis, vimentin is specifically expressed in
Sertoli cells, allowing us to quantify the number of Sertoli cells,
pachytene spermatocytes and round spermatids (see Materials and
Methods) (Fig. 2A). In male mice aged from 1 to 18 months, we
reproducibly observed a significant increase of the number of Sertoli
cells in the Mex3b
−/−
seminiferous tubules compared with the wild type
(supplementary material Fig. S2A). However, the ratio between germ
and Sertoli cells was significantly decreased in the Mex3b
−/−
testes
(Fig. 2B), indicating that the increase of the numberof Sertoli cells was
not accompanied by a similar augmentation of t he number of germ cells.
This effect may reflect a decrease of tubule diameters in the Mex3b
−/−
testes and a clustering of Sertoli cells secondary to a reduction in
the number of germ cells. However, measurement of the average
diameter of the tubules in Mex3b
+/+
and Mex3b
−/−
testes did not show
asignificantdifference,rulingoutthisexplanation(supplementary
material Fig. S2B). Altogether, the observed phenotypewas compatible
with a Sertoli cell defect leading to an unbalanced ratio between the
number of Sertoli and germ cells.
We then investigated whether the disruption of Mex3b impacted on
the differentiation of Sertoli cells. For that purpose, we determined by
quantitative RT-PCR the level of the mRNA coding for clusterin, the
major protein synthesized by differentiated Sertoli cells that is
deposited on sperm membranes (Plotton et al., 2005). As shown in
Fig. 2C, there was no significant difference of the clusterin/vimentin
mRNA ratio between wild-type and Mex3b
−/−
Sertoli cells. We also
quantified transferrin, inhibin and lactate dehydrogenase A (Ldha)
mRNA. Transferrin is an iron transporter implicated in the regulation
of residual bodies phagocytosis by Sertoli cells (Yefimova et al.,
2008); inhibin B is produced in the testis, mainly by Sertoli cells
and its expression positively correlates with Sertoli cell function and
spermatogenesis (O’Connor and de Kretser, 2004); finally, lactate
dehydrogenase A (LDHA) is expressed by differentiated Sertoli cells
and the lactate produced from pyruvate by LDHA is exported and
used by germ cells as an energy metabolite (Boussouar and
Benahmed, 2004). As indicated in Fig. 2C, we observed solely a
weak but significant increase of Ldha transcript in the Mex3b
−/−
Sertoli cells. Takentogether,these dataindicate that the lack of Mex3b
results in a significant increase in the number of Sertoli cells, and
alters the germ cell/Sertoli cell ratio, but without affecting the
apparent differentiation of Sertoli cells.
To ascertain that the testis phenotype was due to an intrinsic defect
specific to Sertoli cells, we generated mice with a disruption of Mex3b
targeted to this cell type. For that purpose, we crossed Mex3b
Flox/Flox
mice with transgenic mice expressing the Cre recombinase under the
transcriptional control of the anti-Müllerian hormone (Amh) gene
promoter (Lécureuil et al., 2002). In male testis, AMH is uniquely
expressed in Sertoli cells and not in germ cells. Previous studies using
this AMH::Cre transgenic strain have shown that the Cre activity is
detectable in Sertoli cells from mouse embryonic day 15 to adulthood
(Lécureuil et al., 2002). Breeding of Mex3b floxed males expressing
the Cre recombinase under the control of the Amh promoter with
Mex3b floxed females leads to the samereduction offertility thanthat
observed upon breeding of Mex3b null male mice with wild-type
females (Table 2). These data indicate that the targeted invalidation of
Mex3b to Sertoli cells recapitulates the male subfertility phenotype
observed with the total Mex3b knockout.
Consistently, histological examination of cross-sections of testis
of 1- and 2-month-old offspring revealed obstructed seminiferous
tubules at a ratio that was highly similar to that observed in Mex3b
null mice (Fig. 2D). However, we observed neither a perinatal
lethality nor an effect on postnatal growth of these mice. We further
confirmed that the Mex3b mRNA was specifically decreased in the
testis and not in other organs (Fig. 2E). Quantification of the number
of germ cells and Sertoli cells showed a decrease in their ratio that
was in the same order of magnitude as the effect observed in Mex3b
null mice (Fig. 2F). Thus, these data establish that the testis
phenotype caused by the lack of Mex3b is largely due to a defect
specific to Sertoli cells.
Mex3b function promotes phagocytosis
The clogged lumen of seminiferous tubules observed in the Mex3b
null mice could result from an aberrant accumulation of residual
bodies as a consequence of a disruption of Sertoli cell phagocytic
function. Accordingly, residual bodies were present in early stages of
the cycle of Mex3b null mice and Mex3b
Flox/Flox
; AMH::Cre mice
seminiferous epithelium (stages II-III, V and VI), indicating the
persistence of material released from elongated spermatids at previous
stages (stages VIII-XI) that were not eliminated by Sertoli cells. To
test the hypothesis of a Sertoli cell phagocytic dysfunction in the
absence of Mex3b, we immunolabeled 15-lipoxygenase (15-LOX;
Table 1. Fertility assessment of Mex3b knockout mice
Crosses Fertility*
Male +/+ ×female +/+ (n=5) 0.8
Male +/–×female +/–(n=9) 0.66
Male –/–×female +/+ (n=6) 0.39
Male +/+ ×female –/–(n=6) 0.35
Male –/–×female –/–(n=6) 0.33
*The average number of pups per female per month during the period of fertility.
2098
RESEARCH ARTICLE Development (2014) 141, 2096-2107 doi:10.1242/dev.108514
DEVELOPMENT

also known as Alox15), an enzyme that peroxidizes lipids and is
known to concentrate within residual bodies (Fischer et al., 2005). As
depicted in Fig. 3A, obstructed tubules present in the Mex3b
−/−
testes
showed a marked staining with the anti-15-LOX antibody compared
with the tubules of wild-type animals. The same increase of 15-LOX
labeling was observed in the tubules of mice with a disruption of the
Mex3b locus targeted to Sertoli cells (supplementary material
Fig. S3A). Furthermore, Hematoxylin and Scarlett Eosin stained
pink the tissue obstructing the tubules, thus confirming that this
material was of cytoplasmic origin (supplementary material Fig.
S3B). Thus, we conclude that residual bodies accumulate abnormally
in the lumen of the tubules of Mex3b knockout mice.
To investigate whether this phenotype resulted from a phagocytic
defect, primary culture of Sertoli cells established from Mex3b
−/−
and
wild-type mice were incubated with fluorescent latex beads and their
phagocytic capacity was assessed. As shown in Fig. 3B, Mex3b-
deficient Sertoli cells showed a reduced ability to engulf beads
compared with the wild-type Sertolicells.Thisphagocyticimpairment
was not due to a recognition defect of the latex particle as we observed
the same capacity of wild-type and Mex3b
−/−
Sertoli cells to absorb
Fig. 2. Mex3b function is specifically required in Sertoli cells. (A) Vimentin immunostaining on cross-sections from 18-month-old mouse testes with the
indicated Mex3b genotypes. (B) Ratio between germ cells ( pachytene spermatocytes or round spermatids) and Sertoli cells in seminiferous tubules from
wild-type and Mex3b-deficient mice at different ages (d, days; m, months). Sertoli cells were identified as vimentin-positive cells and germ cells as vimentin-
negative cells (n=6 mice/group, 30 seminiferous tubules/mouse). *P<0.01. (C) Expression of genes implicated in Sertoli cell differentiation (target genes)
quantified by RT-qPCR using mRNA purified from whole testis of 1-month-old mice. The ratio between target and vimentin mRNAs was used to normalize
the total number of Sertoli cells per testis. (D) Periodic Acid Schiff staining of testicular cross-sections from floxed (Mex3b
Flox/Flox
) and Sertoli-specific
deficient mice aged 1 and 2 months. Areas within dashed boxes are shown at higher magnification on the right. Tubule lumens of Mex3b
Flox/Flox
mice were
empty (stages VIII and XI) whereas those of Mex3b
Flox/Flox
; AMH::Cre were obstructed at stages V and VIII. (E) RT-qPCR analysis of Mex3b transcripts using
testis and liver extracts of 1-month-old mice. The invalidation of Mex3b in Sertoli cells was determined by quantifying Mex3b mRNA levels normalized to the
ribosomal 18S mRNA levels in whole testes extracts. Quantification of Mex3b transcript in the liver was used as a control. One representative experiment out of
three independent experiments is shown. (F) Ratio between germ and Sertoli cells in seminiferous tubules from floxed and Sertoli-specific deficient mice
aged 1 and 2 months (n=6 mice/group, 30 seminiferous tubules/mouse). Error bars represent s.e.m. n.s., not significant.
2099
RESEARCH ARTICLE Development (2014) 141, 2096-2107 doi:10.1242/dev.108514
DEVELOPMENT

beads when placed at 4°C. To confirm these results, Mex3b was
knocked down in the TM4 cell line derived from non-transformed
BALB/C mouse Sertoli cells (Mather, 1980). With this RNAi
approach, we were able to block Mex3b expression specifically
(supplementary material Fig. S4A) without affecting the expression
of other Mex3 proteins (supplementary material Fig. S4B).
Furthermore, using lentiviruses expressing human MEX3B
mRNA, which was insensitive to siRNA targeting mouse Mex3b
mRNA, we performed rescue experiments by using the human
MEX3B wild-type protein fused to the green fluorescent protein
(GFP) (supplementary material Fig. S4C). Similar to what we
observed in primary Sertoli cells, the reduction of Mex3b levels in
TM4 drastically decreased their capacity to ingest latex beads
(Fig. 3C). In addition, phagocytosis was restored upon re-
expression of the wild-type MEX3B (Fig. 3C). Finally, we
studied the expression of the Scl11a2 iron transporter (also called
Nramp2/DMT1), which is located in the phagosome of Sertoli cells
(Jabado et al., 2002), and of the class B scavenger receptor type I
(SR-BI; Scarb1 –Mouse Genome Informatics), which contributes
to the phagocytic process of this cell type (Nakagawa et al., 2004).
However, qRT-PCR analysis did not reveal significant variation
of the mRNA encoding these two proteins when TM4 cells
transfected with scramble siRNA were compared with TM4
cells knocked down for Mex3b (supplementary material Fig. S3C).
The previous data indicate that Mex3b is a regulator of
phagocytosis in Sertoli cells and thus raise the idea that this protein
may exhibit a similar function in professional phagocytic cells. To
address this question, phagocytosis assays using the same conditions
defined for Sertoli cells were applied to the primary cultures of
macrophages differentiated from bone marrow mononuclear cells and
showed a consistent 50% reduction in the number of beads per
Mex3b
−/−
macrophage compared with the wild type (supplementary
material Fig. S3D). Collectively, these results demonstrate that
Mex3b function is required for phagocytosis in Sertoli cells as well as
in macrophages.
Mex3b controls cell-cell adhesion
Sertoli cells form the BTB, allowing a physical separation between
blood vessels and the seminiferous tubules throughstrong intercellular
adhesion. Therefore, we next examined the consequences of Mex3b
ablation on cell-cell interaction between Sertoli cells. For that purpose,
we performed an ultrastructural analysis on ultra-thin sections of testes.
As depicted in Fig. 4A, Sertoli cells in control testes are well organized
and the BTB is lined with endoplasmic reticulum cisternae and clearly
delimited. By contrast, the basal region of Mex3b
−/−
Sertoli cells
appears distended and locally interrupted, revealing an expansion of
Table 2. Fertility assessment of Sertoli-specific Mex3b-deficient mice
Crosses Fertility*
Male Flox/Flox ×female Flox/Flox (n=6) 0.76
Male AMH:Cre; Flox/Flox ×female Flox/Flox (n=6) 0.37
Male AMH:Cre; Flox/Flox ×female AMH:Cre; Flox/Flox (n=6) 0.31
*The average number of pups per female per month during the period of fertility.
Fig. 3. Phagocytic function of Sertoli cells
depends on Mex3b. (A) Immunodetection of the
residual bodies component 15-lipoxygenase
(white) on cross-sections of 6-month-old mouse
testes of the indicated Mex3b genotypes. Stage
IV seminiferous tubes are shown. Nuclei were
stained with DAPI. (B) Epifluorescent images
showing latex beads (red) phagocytosed by
primary Sertoli cells isolated from wild-type and
Mex3b
−/−
mouse testes. Nuclei were stained with
DAPI. Histogram indicates the average number of
phagocytosed beads per DAPI-stained cell
(n=200 cells per condition). (C) Projection of
confocal sections showing latex beads (white)
phagocytosed by TM4 Sertoli cells depleted for
endogenous Mex3b by siRNA and re-expressing
the human MEX3B protein fused to GFP. Cells
were counterstained with phalloidin-TRITC and
z-sections of confocal acquisition are depicted to
show bead incorporation inside the cells. Histogram
indicates the average numbers of engulfed
fluorescent beads per phalloidin-TRITC-stained
cell (n=200 cells per condition). Error bars
represent s.e.m.
2100
RESEARCH ARTICLE Development (2014) 141, 2096-2107 doi:10.1242/dev.108514
DEVELOPMENT

intercellular spaces between adjacent cells. The inset in Fig. 4A shows
focal disruption of the BTB, thus confirming that the barrier integrity
was severely compromised in Mex3b
−/−
seminiferous tubules.
Then, we examined the expression of N-cadherin (N-Cad;
Cdh2 –Mouse Genome Informatics) and connexin 43 (Cx43;
Gja1 –Mouse Genome Informatics), two molecules that contribute
to the formation of the BTB and are constituent proteins of adherens
and gap junctions, respectively (Li et al., 2010; Newton et al., 1993).
Immunofluorescence staining of the wild-type mouse seminiferous
epithelium with antibodies recognizing these two proteins identified
a belt-like structure near the basal lamina that corresponds to the
BTB (Fig. 4B). By contrast, the labeling of N-Cad and Cx43 was
weaker and more diffuse in the Mex3b knockout mice seminiferous
tubules (Fig. 4B).
Abnormal permeability of the BTB may result in the release of
germ cells in the bloodstream that leads to the mounting of an
autoimmune response and the production of anti-sperm antibodies.
Therefore, we measured the level of anti-sperm antibodies in the
serum of mice with a genetic disruption of Mex3b in Sertoli cells. As
shown in Fig. 4C, anti-sperm antibodies were detected in the serum
of mice deficient for Mex3b in Sertoli cells at a level that was higher
than the limit of the test positivity, in contrast to observations in the
wild-type mouse. Consistently, a biotin marker injected under
the testicular tunica albuginea of Mex3b knockout mice was able to
diffuse in the lumen of seminiferous tubules in a reproducible
manner, whereas it was blocked by the intact BTB of wild-type mice
(Fig. 4D). These data confirm that the tightness of the BTB was
weakened in Mex3b-deficient seminiferous tubules.
Finally, to reinforce these data, we studied N-Cad and Cx43
expression in TM4 cells knocked down for Mex3b. Staining of
these two intercellular junction components decorated the surface
of TM4 cells, whereas this labeling was lost upon silencing of
Mex3b (Fig. 4E). Expression of MEX3B-GFP restored N-Cad and
Cx43 localization at the plasma membrane of Mex3b knockdown
TM4 cells. To test whether the overall mRNA and protein levels of
Cx43 and N-Cad were affected by the loss of Mex3b, their
expression were assessed by qPCR and western blot
(supplementary material Fig. S4D,F), showing a decrease of
mRNA expression for both Cx43 and N-Cad as well as a reduction
in the protein level of Cx43. These results indicate that Mex3b
modulates both the expression and the localization of these two
junction proteins.
Fig. 4. Mex3b controls adhesion properties of
Sertoli cells. (A) Electron microscopy images of
intercellular junctions in testes sections from wild-
type and Mex3b-deficient mice. Arrows indicate
cellular junctions constituting the BTB between two
adjacent Sertoli cells (Ser1 and Ser2). Insets show
magnification of the cellular junction region. Scale
bars in insets: 60 nm. (B) Confocal microscope
images of wild-type and Mex3b-deficient mice testis
sections immunostained for N-cadherin and
connexin 43 (red) (6-month-old mice). DAPI was
used to stain nuclei and white boxes indicate the
area magnified in the inserts. (C) Detection of anti-
sperm cell antibodies in serum of wild-type and
Mex3b
Flox/Flox
; AMH::Cre-deficient mice. Red line
indicates the limit of ELISA test’s significance
according to the manufacturer (threshold of test
positivity). (D) Epifluorescence images of sections
from adult wild-type and Mex3b-deficient mice testis,
previously injected with a biotin tracer that was
allowed to diffuse in the seminiferous tubes of living
mice for 30 min. (E) Confocal microscope images of
TM4 cells with endogenous Mex3b inhibited by
siRNA and re-expressing the human MEX3B
protein. N-cadherin and connexin 43 (red) were
immunostained and counterstained with DAPI.
2101
RESEARCH ARTICLE Development (2014) 141, 2096-2107 doi:10.1242/dev.108514
DEVELOPMENT

Mex3b interacts with Rap1GAP
While exploring possible mechanisms accounting for the role of
Mex3b in phagocytosis and in intercellular adhesion, our attention
was drawn to a large-scale yeast two-hybrid screen that found that
the GTPase-activating protein Rap1GAP binds to MEX3B (Stelzl
et al., 2005). Rap1 is a small GTP-binding protein that cycles
between an active, GTP-bound, and an inactive, GDP-bound state
(Caron, 2003; Gloerich and Bos, 2011). Interestingly, Rap1 proteins
Fig. 5. Mex3b functionally interacts with Rap1GAP. (A) Endogenous interaction between MEX3B and Rap1GAP assessed by immunoprecipitation from
human epithelial BOSC cells and whole mouse testis lysates. (B) Immunoprecipitation of Myc-MEX-3B and Rap1GAP-HA after RNase A treatment of the
cell lysates. Immunoprecipitation of HA-tag and detection with Myc, HA and tubulin antibodies are shown. (C) BOSC cells were transfected with plasmids
expressing Rap1GAP-HA and Myc-MEX-3B constructs as depicted in the right-hand panel. Point mutations in different domains are represented by an
asterisk. Left-hand panel shows immunoprecipitation with the anti-HA tag antibody followed by western blot analysis using Myc, HA and tubulin antibodies.
Immunoprecipitated MEX3B mutants are indicated by black arrowheads. Blots are representative of three independent experiments. (D) TM4 cells treated with
scramble or Rap1GAP siRNA were incubated with latex beads (pseudocolored in green), fixed and stained with phalloidin-TRITC before observation under
epifluorescent microscope (top panel). Histograms (bottom left panel) indicate the average number of phagocytosed fluorescent beads per phalloidin-TRITC
stained cell (n=200 cells per condition). Western blot analysis of Rap1GAP levels after siRNA knockdown in TM4 cells (bottom right panel). Error bars represent
s.e.m. (E) N-cadherin and connexin 43 localization were assessed after siRNA Rap1GAP treatment by immunofluorescence using confocal microscopy. TM4
cells were counterstained with DAPI.
2102
RESEARCH ARTICLE Development (2014) 141, 2096-2107 doi:10.1242/dev.108514
DEVELOPMENT

are key regulators of phagocytosis and cell-cell adhesion.
Rap1GAP, the putative MEX3B interactor, belongs to a group of
related molecules which increase the intrinsic GTPase activity
of Rap1, thereby antagonizing the function of Rap1 guanine
nucleotide exchange factors (Rap1-GEFs) that load GTP on Rap1
(Polakis et al., 1991; Rubinfeld et al., 1991).
We first examined w hether endogenous MEX3B and Rap1 GAP
proteins interacted in cells. Immunoprecipitation of the endogenous
human MEX3B from a lysate of human kidney epithelial cells (BOSC
cells) followed by a western blot with an anti-Rap1GAP antibody
revealed a specific interaction between these two molecules (Fig. 5A).
The complex between endogenous Mex3b and Rap1GAP was also
detected in mouse Mex3b
+/+
testis extracts and, as expected, no
Rap1GAP was co-immunoprecipitated with the polyclonal serum
recognizing MEX3B when testis extracts were prepared from the
Mex3b
−/−
mice (Fig. 5A). As RBPs may indirectly bind to another
protein through RNA bridging, we expressed epitope-tagged Myc-
MEX-3B and Rap1GAP-HA and incubated transfected BOSC cell
extracts with RNase A after lysis. As shown in Fig. 5B, the complex
between Myc-MEX-3B and Rap1GAP-HA did not dissociate upon
RNase A treatment, but, on the contrary, the binding between these two
proteins was even slightly strengthened under this condition. Thus, our
data confirm that MEX3B and Rap1GAP physically interact in an
RNA-independent manner.
In order to map the regions of MEX3B involved in Rap1GAP
binding, we constructed a series of Myc-tagged MEX3B deletion
mutants. Immunoblotting with the anti-HA and anti-Myc
antibodies confirmed that Rap1GAP-HA and mutants Myc-
MEX-3B were expressed at similar levels after transfection
(Fig. 5C). As shown in Fig. 5C, deletion of the first 239 amino
acids (MEX-3B 239-569 mutant) did not abolish this interaction
whereas truncation of MEX3B after the second KH domain (MEX-
3B 1-239) prevented the binding of Rap1GAP-HA. Together, these
data show that Rap1GAP interaction surface of MEX3B
encompasses the region between the second KH domain and the
ring finger motif.
We next wondered whether phagocytic and adhesion defects
observed in Mex3b-depleted cells could be linked to the effect on
Rap1GAP and the Rap1 pathway. If this hypothesis is true, the
silencing of Rap1GAP in TM4 cells should phenocopy the lack of
Mex3b. Using this approach, we found that Rap1GAP knockdown
resulted in the reduction of both phagocytosis (Fig. 5D) and of N-Cad
Fig. 6. Mex3b regulates Rap1 activity through the recruitment
of Rap1GAP at the plasma membrane. (A) Rap1-GTP pulldown
from whole testis and purified Sertoli cells lysates assessed by
western blot. The ratio of Rap1-GTP/Total Rap1 for each condition
is indicated underneath the western blot. (B) Rap1-GTP pulldown
from lysates of TM4 cells treated with siRNA targeting mouse
Mex3b mRNA and re-expressing human MEX3B-GFP protein.
(C) N-cadherin and connexin 43 localization after siRNA and
GGTI-298 treatment was visualized by immunofluorescence
using confocal microscopy. Cells were counterstained with DAPI.
(D) Immunolocalization of Rap1GAP-HA in TM4 cells knocked
down for Mex3b expression by siRNA and re-expressing
MEX3B-GFP after serum stimulation. (E) Localization of
GFP-RBD
ralGDS
in TM4 cells knocked down for Mex3b expression
by siRNA. Cells were exposed to phalloidin-TRITC prior to
observation by confocal microscopy. White arrowheads indicate
the accumulation of GFP-RBD
ralGDS
.
2103
RESEARCH ARTICLE Development (2014) 141, 2096-2107 doi:10.1242/dev.108514
DEVELOPMENT

and Cx43 at the cell surface, a phenotype that wascomparable to what
was observed when Mex3b expression was downregulated (Fig. 5E).
Furthermore, expression of a truncated version of MEX3B unable to
bind RAP1GAP (MEX-3B 1-239) in TM4 cells previously knocked
down for Mex3b did not restore membrane localization of N-cadherin
and connexin 43 as full-length MEX3B did (Fig. 4E; supplementary
material Fig. S5). Altogether, these data are consistent with a positive
coupling between MEX3B and Rap1GAP in the regulation of
phagocytosis and cell-cell interaction.
Mex3b regulates the activity and the spatial localization of
Rap1GAP
Mex3b interaction with Rap1GAPmight impact its abilityto modulate
Rap1 activity. Thus, to determinewhether Mex3b could regulate Rap1
activity, we performed a series ofpulldown assaysto precipitate GTP-
bound Rap1 using the Rap1 substrate Ral-GDS (van Triest et al.,
2001). A robust and reproducible increase of Rap1-GTP was observed
in Mex3b
−/−
testis extracts compared with the Mex3b
+/+
control
(Fig. 6A). A similar enhancement of Rap1-GTP was revealed in
Mex3b
−/−
primary cultures of Sertoli cells compared with Mex3b
+/+
Sertoli cells (Fig. 6A). We further confirmed these data in TM4 cells
after Mex3b silencing. In addition, expression of human MEX3B in
TM4 cells treated with siRNA targeting mouse Mex3b reduced the
level of Rap1-GTP to that observed in TM4 cells transfected with
scrambled siRNA (Fig. 6B) without modification of Rap1GAP RNA
or protein levels (supplementary material Fig. S4D,E). Thus, we
conclude that Mex3b positively regulates Rap1GAP function and
thereby restrains Rap1 activity.
As Mex3b depletion reduces intercellular adhesion and regulates
the activity of Rap1 through Rap1GAP, we tested whether the
effect of Mex3b on cell-cell contact was dependent on Rap1
activation. We speculated that a mild reduction of Rap1 signaling
could rescue the proper localization of N-Cad and Cx43 at the cell
surface. To test this idea, Mex3b was silenced in TM4 cells and
exposed to the Rap1 inhibitor GGTI-298 (Efuet and Keyomarsi,
2006). Analysis of Rap1-GTP levels by pulldown confirmed the
partial inhibition of Rap1 activity after 30 min of exposure to
12.5 μM GGTI (supplementary material Fig. S6A). As shown in
Fig. 6C, this treatment led to the redistribution of N-Cad and Cx43
to the cell surface in TM4 cells knocked down for Mex3b. Thus, a
sustained activation of Rap1 subsequent to the loss of Mex3b is
responsible for the failure of N-Cad and Cx43 to be localized and
stabilized at the cell surface.
It has been previously reported that the spatial gradient of Rap1-
GTP depends on Rap1GAP activity, which is higher in the periphery
than in the central region of the cells (Mochizuki et al., 2001; Ohba
et al., 2003). These results prompted us to examine whether Mex3b
could regulate Rap1GAP subcellular localization. As previously
described (Buchet-Poyau et al., 2007), exogenously expressed
MEX3B-GFP fusion is localized in the nucleus, in the cytoplasm
and also decorates the cell cortex (supplementary material Fig. S6B).
Accordingly, an epitope-tagged Rap1GAP-HA construct localizes to
the cortical plasma membrane of TM4 cells under serum stimulation
(Fig. 6D). Strikingly, Mex3b silencing perturbed this cortical
localization and led to a more diffuse cytoplasmic pattern.
Furthermore, re-expression of MEX3B in Mex3b knocked down
cells restored Rap1GAP-HA localization to the plasma membrane
(Fig. 6D). These results indicate that Mex3b is required for the proper
targeting of Rap1GAP to the inner face of the plasma membrane.
To address this hypothesis directly, we used the fusion protein
GFP-RBD
RalGDS
, which interacts with Rap1-GTP and allows the
visualization of active Rap1 through GFP signal (Bivona et al.,
2004). Under control conditions, Rap1-GTP was detected in the
cytoplasm and was weakly enriched at the plasma membrane of
TM4 cells in basal conditions (Fig. 6E). However, upon silencing
of Mex3b, we observed a marked increase of the GFP signal with a
clear enhancement of the labeling at the plasma membrane, thus
reflecting a higher Rap1-GTP concentration at the cell cortex.
Furthermore, GGTI treatment reduced the overall GFP signal and
clearly diminished the decoration of the inner face of the plasma
membrane with the GFP-RBD
RalGDS
(supplementary material
Fig. S6C). Overall, these results indicate that Mex3b regulates the
expression of intercellular adhesion molecules by controlling
the level and the localization of Rap1-GTP via its effect on both
Rap1GAP activity and transport.
DISCUSSION
We report here that Mex3b-deficient mice are subfertile. Investigation
of the pathophysiological processes in Mex3b-deficient males
showed that residual bodies released by spermatids during their
differentiation obstruct a fraction of mouse seminiferous tubules,
thus causing a net decrease in the spermatozoa yield. In addition, the
BTB is loosened and anti-sperm antibodies are produced. These
effects were found to arise from a disruption of phagocytosis and
adhesive abilities of Mex3b-deficient Sertoli cells. Exploration
of the underlying mechanisms revealed the causative role of
a sustained activation of Rap1 at the Sertoli cell cortex that is a
consequence of a perturbation of Rap1GAP function, activity and
subcellular localization of which are controlled by Mex3b. Thus,
this work unveils a key role for Mex3b in the spatial organization of
the Rap1 signaling pathway, which regulates Sertoli cell biological
properties.
Our results indicate that a third of seminiferous tubules was
obstructed in Mex3b null mice testes and a similar proportion of
tubules was affected in males with a Mex3b locus specifically
disrupted in Sertoli cells. This incomplete penetrance could be
linked to the modifying effects of the genetic makeup of the mice,
but we cannot formally exclude a compensatory effect of other
Mex3 genes that are expressed in Sertoli cells. We also observed that
the multilayers of granulosa cells surrounding the oocyte showed an
abnormal histology in Mex3b
−/−
female ovaries. As granulosa cells
share the same embryonic origin than Sertoli cells and communicate
via gap junctions containing Cx43 (Patek et al., 1991), it is possible
that Mex3b regulates granulosa functions and folliculogenesis
through the same mechanisms identified in Sertoli cells.
It is well documented that Sertoli cells have a key scavenger
function as they eliminate apoptotic germ cells and remove residual
bodies released during the cytoplasmic reduction phase of
spermiogenesis (Nakanishi and Shiratsuchi, 2004). However, we
did not notice a decrease in the clearance of apoptotic germ cells in
Mex3b null mice. Spermiation occurs at the apical adluminal
compartment of the tubules, which contains round elongating/
elongated spermatids attached to Sertoli cells via an actin-based
adherens junction (AJ) type designated as the apical ectoplasmic
specialization (ES) (Lee and Cheng, 2004). Thus, in vivo, the action
of Mex3b may be compartmentalized to this region of the Sertoli-
germ cell interface to control phagocytic removal of residual bodies,
a question that remains to be explored. Although we did not observe
an overt reduction of Mex3b
−/−
sperm cell motility, we cannot
formally exclude that this Sertoli phagocytic defect may also affect
spermiogenesis and consequently decrease the sperm fertilizing
fitness.
A net reduction of N-Cad and Cx-43, two junction molecules that
contribute to the establishment of the BTB, is observed in the
2104
RESEARCH ARTICLE Development (2014) 141, 2096-2107 doi:10.1242/dev.108514
DEVELOPMENT

seminiferous tubules of Mex3b-deficient mice. Consistently,
electron microscopy analysis shows a focal disruption of the BTB
in the Mex3b
−/−
testis and experiments using a biotin tracer confirm
that the tightness of the BTB is indeed altered. The detection of anti-
sperm antibodies in the serum of mice deficient for Mex3b in Sertoli
cells convincingly strengthens the notion that the integrity of the
BTB is impaired in the absence of Mex3b.
Our conclusion that Mex3b is a regulator of the Rap1 pathway
involved in BTB formation is based on the following series of
complementary results: (1) endogenous Mex3b binds to Rap1GAP;
(2) Mex3b inactivation in mouse prevents Rap1GAP localization at
the cell cortex and leads to aberrant Rap1 activation as revealed by
biochemical approaches and imaging techniques that identify Rap1-
GTP in cells; (3) the membrane localization of N-Cad and Cx43
depends on the ability of Mex3b to bind Rap1GAP and treatment of
TM4 cells deficient for Mex3b with the Rap1 inhibitor GGTI-298
rescues the proper cell surface expression of these two cell junction
molecules; and finally, (4) Rap1GAP RNAi phenocopies the
phagocytosis and cell-cell interactions defects generated by the lack
of Mex3b. Thus, these data, together with the observed diminution
of the levels of N-Cad and Cx43 transcripts in the absence of Mex3b,
raise the idea that this RBP acts at successive steps to regulate the
proper expression of these junction molecules at the cell surface: (1)
in the post-transcriptional stabilization of N-Cad and Cx43
transcripts, possibly involving the direct binding of Mex3b on
these mRNAs; and (2) in the spatial control of the Rap1 pathway to
achieve the appropriate localization and stabilization of these
adhesion molecules at the plasma membrane.
In macrophages, activation of Rap1 has been reported to promote
phagocytosis of opsonized targets in macrophages (Caron et al.,
2000). However, our study indicates that an aberrant activation of
Rap1 at the cell cortex is responsible for the loss of phagocytic
capacity of Sertoli cells. Consistently, activation of Rap1 has also
been shown to suppress phagocytosis of polystyrene beads by
microglial cells (Steininger et al., 2011). Thus, it is possible that the
contribution of the Rap1 pathway in phagocytosis depends on
the nature of the particles engulfed and also on the cell type involved.
Rap1GAP activity has been found to be higher at the plasma
membrane and the preferential localization of this protein is believed
to contribute to the establishment of an intracellular gradient of Rap1-
GTP (Ohba et al., 2003). Furthermore, the Rap1GAP ortholog Bud2
in Saccharomyces cerevisiae is targeted to the membrane of the
incipient bud throughinteraction with proteinsthat specify the cortical
landmark where it constitutes with Rsr1/Rap1 and Bud5/Rap1GEF,
the module that positions the bud formation at a particular site (Park
and Bi, 2007). Even more relevant to this topic, Rap1 (Roughened –
FlyBase) signaling in a group of somatic cells of Drosophila testes,
called the hub, controls stem cell anchoring via the appropriate
positioning of DE-cadherin (Shotgun –FlyBase) at the interface
between these cell types (Wang et al., 2006). Our findings are fully
consistent with these results and further reveal a novel level of
regulation with Mex3b mediating the localization of Rap1GAP to the
plasma membrane. However, the underlying mechanisms remain to
be determined. It is possible that Mex3b, associated or not with target
RNAs, binds directly to the cytoskeleton or to cytoskeletal motors
ferrying the Mex3b-Rap1GAP complex to the cell cortex. The
contribution of long non-coding (lnc)RNA in the stabilization and the
transport of the Mex3b-Rap1GAP complex merits exploration in
view of the recent demonstration that the lncRNA HOTAIR binds to
MEX3B (Yoon et al., 2013).
In conclusion, this study provides insights into the in vivo function
of mammalian MEX-3 proteins by ascribing a role to Mex3b in the
spatial assembly of the Rap1 pathway, which proves necessary for
normal Sertoli cell physiology. This work is congruent with recent
large-scale analyses that discovered a general scaffolding role for RBPs
in the dynamic organization of localized signaling centers (de Hoog
et al., 2004; Lécuyer et al., 2007). As alterations of the integrity of the
BTB is a frequent cause of male infertility, it is plausible that mutations
affecting either MEX3B or genes coding for components of the Rap1
pathway may account for cases of human spermatogenic defects.
MATERIALS AND METHODS
Mice
Total and Sertoli cell-specific Mex3b null mice were generated using
embryonic stem cell technology as described (Hogan et al., 1994). For details
of generation and genotyping, see supplementary materials and methods.
All animal experiments were conducted according to the standard ethical
guidelines of the Institut National de la Santé et de la Recherche Médicale
(INSERM).
Reproductive ability of micewas assessed by mating 2-month-old mice of
the indicated genotype for 9 months. For the counting of sperm cells, caudae
epididymidis and vasa deferentia were excised. Semen was allowed to exude
for 15 min at 37°C and counted using a Malassez grid.
Cell lines
MEFs were isolated from E12.5 embryos as previously described. Sertoli cells
were isolated from ∼10- to 14-day-old mice and cultured as described
previously (Weiss et al., 1997). The mouse TM4 Sertoli and human BOSC cell
lines were obtained from the American Tissue Culture Collection (ATCC).
Phagocytosis assay
Monolayers of cells were incubated with 2-μm diameter carboxylate-
modified FluoSpheres (Invitrogen) for 2 hours at 37°C with a ratio of 40
beads per cell (adapted from Park et al., 2007). z-stack acquisitions were
performed using a biphotonic confocal microscope (LSM510 META NLO).
The number of beads per cells was determined by counting random fields on
the glass with LSM image browser software.
Western blot and immunoprecipitation
Cells were lysed 48h post-transfection and immunoprecipitation and western
blot analyses were performed as described previously (Nony et al., 2003).
When indicated, protein extracts were treated with RNAse A (0.2 mg/ml;
Roche) prior to immunoprecipitation. When performed, Rap1 activation assay
was carried out according to the manufacturer’s protocol (Rap1 activation
assay kit; Millipore) and quantification of Rap1-GTP/total Rap1 was
performed using ImageJ software.
Antibodies and reactives
Mouse monoclonal anti-myc (9E10), anti-GFP (Roche Applied Science),
anti-HA (16B12, Covance), anti-tubulin (gift from L. Lafanache
re, INSERM,
U823; Université Joseph Fourier-Grenoble; Institut AlbertBonniot, Grenoble
F-38700, France), and anti-Rap1GAP (H-93, Santa Cruz Biotechnology)
antibodies were used in western blots at 1:5000, 1:1000, 1:1000, 1:250,000
and 1:1000, respectively. Rabbit polyclonal anti-Mex3b antibody was used
for western blots at 1:750 and recognizes both mouse and human Mex3b.
Rap-1 inhibitor GGTI-298 was purchased from Sigma-Aldrich.
Histological sections, immunofluorescence staining and
electron microscopy
Tissues samples were placed in 4% formaldehyde or Alcoholic Bouin’s
overnight and embedded in paraffin or directly frozen at −80°C. For details
of staining, see supplementary materials and methods.
After the staining, vimentin-positive cells (Sertoli cells) were counted as
well as germ cells with the Hematoxylin counterstain in seminiferous tubules.
For stages I-VII, all round spermatids were counted and for stages VII-XII, all
pachytene spermatocytes were numerated based on the established
classification of seminiferous tubules staging (Russell and Peterson, 1985)
(n=100 seminiferous tubules on six male mice at each age point).
2105
RESEARCH ARTICLE Development (2014) 141, 2096-2107 doi:10.1242/dev.108514
DEVELOPMENT

Immunofluorescence analyses on frozen section and cells were performed
as described previously (Carette et al., 2010). N-cadherin, connexin 43 and
15-lipoxygenase (gift from P. Sutovsky, University of Missouri, Columbia,
USA) antibodies were used at 1:100. Immunolocalization of Rap1GAP-HA
and human MEX3B-GFP protein was determined after overnight
deprivation of serum and a short activation (10 min).
For electron microscopy, testis pieces were fixed with glutaraldehyde, post-
fixed in reduced osmium, dehydrated and embedded in Epon as previously
described (Lablack et al., 1998). The sections were analyzed with a JEOL
1200EX electron microscope (Institut des Neurosciences, Grenoble, France).
Detection of anti-sperm cell antibodies
Sperm antibodies were measured in the serum of 3-month-old wild-type and
Mex3b
Flox/Flox
; AMH::Cre deficient mice using the ELISA kit from Cusabio
as specified by the manufacturer’s instructions.
Biotin tracer studies
The permeability of the BTB was assessed by using a biotin tracer as
described previously (Meng et al., 2005). For details, see supplementary
materials and methods.
Cloning and transfection
Myc-Mex-3b and Myc-Mex-3b mutants were cloned in Myc-pCMV-Tag3B
vector (Stratagene) as described previously (Buchet-Poyau et al., 2007).
pmT2/Rap1GAP-HA and GFP-RBD
RalGDS
(gift from R. Philips, University
of North Carolina, Chapel Hill, USA) constructs were also used. For the
rescue experiments, pLENTI CAG-human MEX3B fused with GFP were
designed to infect TM4 cells and ensure that siRNA against mouse Mex3b
did not reduce expression of human MEX3B-GFP.
Short interfering RNAs (siRNAs) against the mouse Mex3b and Rap1GAP
gene and the non-targeting control siRNA were purchased from Dharmacon
(ON-TARGET plus SMART pool RKHD3 ref. L-056400-01-0020 and ON-
TARGET plus Non-targeting Pool ref. D-001810-10-05, Dharmacon).
siRNAs were transfected into TM4 cells using Lipofectamine 2000 RNAi
max (Invitrogen) following the manufacturer’s protocol. For details of
transfection and infection, see supplementary materials and methods.
RNA isolation and RT-PCR analysis
Total RNAwas extracted from cell lines or tissues using the RNeasy Mini Kit
(Qiagen) according to the manufacturer’s instructions. Then, RNAs were
reverse transcribed to cDNA using the Omniscript Reverse Transcription Kit
(Qiagen) and real-time RT-PCR was performed using the MXP-3000P PCR-
system (Stratagene). RNA of pachytene spermatocytes (PS) or round
spermatids (RS) were obtained by centrifugal elutriation.
The sequences of the different primers used for RT-PCR are listed in
supplementary material Table S1.
Statistical analysis
All experiments were carried out in triplicate or with a significant number
of individuals and statistical analyses were performed with the statistical
package GraphPad Prism using the unpaired Student’st-test (confidence
intervals 99%). Values are given as mean and standard error of the mean
(s.e.m.).
Acknowledgements
We thank HerveLe Hir, Kiran Padmanabhan, Karin Sadoul and AndreVerdel for
critical reading of the manuscript. We thank Peter Sutovsky for the kind gift of the
polyclonal serum anti-15-LOX; Mark R. Philips for the kind gift of the vectorexpressing
the GFP-RBD
RalGDS
; and Gisele Froment and Caroline Costa from the lentivectors
production facility (SFR BioSciences Gerland–Lyon Sud UMS3444/US8).
Competing interests
The authors declare no competing financial interests.
Author contributions
M.L.B., K.B.-P., N.C., J.C. and M.B. conceived and designed the experiments.
M.L.B., K.B.-P., C.T. and N.C. performed a large part of the experiments from mouse
phenotyping to molecular biology studies. O.D., E.F. and C.A.-R. contributed to
biochemistry and imaging experiments. J.-P.R. engineered the lentiviral vectors
expressing MEX3 proteins and D.N. produced lentiviral particles. D.S. contributed to
the interpretation of the electron microscopic images. S.R. and S.K. discussed
regularly the results concerning the fertility phenotype, suggested experiments and
shared protocols and expertise. D.B., P.C. and F.G. participated to the generation of
the mouse models. P.D. and M.-H.P. were involved in the characterization of the
testis phenotype, in the primary culture of Sertoli cells and in the phagocytosis
assays. M.B., M.L.B. and N.C. wrote the manuscript.
Funding
This work was supported by a grant from the Association pour la Recherche sur le
Cancer (ARC) [20110603000]; a fellowship from ARC (to M.L.B.); and a fellowship
from the Fondation Pour la Recherche Medicale (FRM) (to N.C.).
Supplementary material
Supplementary material available online at
http://dev.biologists.org/lookup/suppl/doi:10.1242/dev.108514/-/DC1
References
Baltz, A. G., Munschauer, M., Schwanha
usser, B., Vasile, A., Murakawa, Y.,
Schueler, M., Youngs, N., Penfold-Brown, D., Drew, K., Milek, M. et al. (2012).
The mRNA-bound proteome and its global occupancy profile on protein-coding
transcripts. Mol. Cell 46, 674-690.
Betz, U. A. K., Vosshenrich, C. A. J., Rajewsky, K. and Mu
ller, W. (1996). Bypass
of lethality with mosaic mice generated by Cre-loxP-mediated recombination.
Curr. Biol. 6, 1307-1316.
Bivona, T. G., Wiener, H. H., Ahearn, I. M., Silletti, J., Chiu, V. K. and Philips,
M. R. (2004). Rap1 up-regulation and activation on plasma membrane regulates T
cell adhesion. J. Cell Biol. 164, 461-470.
Boussouar, F. and Benahmed, M. (2004). Lactate and energy metabolism in male
germ cells. Trends Endocrinol. Metab. 15, 345-350.
Buchet-Poyau, K., Courchet, J., Le Hir, H., Seraphin, B., Scoazec, J.-Y., Duret, L.,
Domon-Dell, C., Freund, J.-N. and Billaud, M. (2007). Identification and
characterization of human Mex-3 proteins, a novel family of evolutionarily
conserved RNA-binding proteins differentially localized to processing bodies.
Nucleic Acids Res. 35, 1289-1300.
Burrell, R. A.,, McClelland, S. E., Endesfelder, D., Groth, P., Weller, M.-C.,
Shaikh, N., Domingo, E., Kanu, N., Dewhurst, S. M., Gronroos, E. et al. (2013).
Replication stress links structural and numerical cancer chromosomal instability.
Nature 494, 492-496.
Cano, F., Bye, H., Duncan, L. M., Buchet-Poyau,K., Billaud, M., Wills, M. R. and
Lehner, P. J. (2012). The RNA-binding E3 ubiquitin ligase MEX-3C links
ubiquitination with MHC-I mRNA degradation. EMBO J. 31, 3596-3606.
Carette, D., Weider, K., Gilleron, J., Giese, S., Dompierre, J., Bergmann, M.,
Brehm, R., Denizot, J.-P., Segretain, D. and Pointis, G. (2010). Major
involvement of connexin 43 in seminiferous epithelial junction dynamics and
male fertility. Dev. Biol. 346, 54-67.
Caron, E. (2003). Cellular functions of the Rap1 GTP-binding protein: a pattern
emerges. J. Cell Sci. 116, 435-440.
Caron, E., Self, A. J. and Hall, A. (2000). The GTPase Rap1 controls functional
activation of macrophage integrin alphaMbeta2 by LPS and other inflammatory
mediators. Curr. Biol. 10, 974-978.
Castello, A., Fischer, B., Eichelbaum, K., Horos, R., Beckmann, B. M., Strein, C.,
Davey, N. E., Humphreys, D. T., Preiss, T., Steinmetz, L. M. et al. (2012).
Insights into RNA biology from an atlas of mammalian mRNA-binding proteins.
Cell 149, 1393-1406.
Cheng, C. Y. and Mruk, D. D. (2012). The blood-testis barrier and its implications for
male contraception. Pharmacol. Rev. 64, 16-64.
Ciosk, R., DePalma, M. and Priess, J. R. (2006). Translational regulators maintain
totipotency in the Caenorhabditis elegans germline. Science 311, 851-853.
Courchet, J., Buchet-Poyau, K., Potemski, A., Bre
s, A., Jariel-Encontre, I. and
Billaud, M. (2008). Interaction with 14-3-3 adaptors regulates the sorting of hMex-
3B RNA-binding protein to distinct classes of RNA granules. J. Biol. Chem. 283,
32131-32142.
de Hoog, C. L., Foster, L. J. and Mann, M. (2004). RNA and RNA binding proteins
participate in early stages of cell spreading through spreading initiation centers.
Cell 117, 649-662.
Donnini, M., Lapucci, A., Papucci, L., Witort, E., Jacquier, A., Brewer, G.,
Nicolin, A., Capaccioli, S. and Schiavone, N. (2004). Identification of TINO: a
new evolutionarily conserved BCL-2 AU-rich element RNA-binding protein.
J. Biol. Chem. 279, 20154-20166.
Draper, B. W., Mello, C. C., Bowerman, B., Hardin, J. and Priess, J. R. (1996).
MEX-3 is a KH domain protein that regulates blastomere identity in early
C. elegans embryos. Cell 87, 205-216.
Efuet, E. T. and Keyomarsi, K. (2006). Farnesyl and geranylgeranyl transferase
inhibitors induce G1 arrest by targeting the proteasome. Cancer Res. 66,
1040-1051.
2106
RESEARCH ARTICLE Development (2014) 141, 2096-2107 doi:10.1242/dev.108514
DEVELOPMENT

Fischer, K. A., Van Leyen, K., Lovercamp, K. W., Manandhar, G., Sutovsky, M.,
Feng, D., Safranski, T. and Sutovsky, P. (2005). 15-Lipoxygenase is a
component of the mammalian sperm cytoplasmic droplet. Reproduction 130,
213-222.
Gloerich, M. and Bos, J. L. (2011). Regulating Rap small G-proteins in time and
space. Trends Cell Biol. 21, 615-623.
Hogan, B., Beddington, R., Costantini, F. and Lacy, E. (1994). Manipulating the
Mouse Embryo: A Laboratory Manual, pp. 311e5. Cold Spring Harbor, New York:
CSH Press.
Hogan, D. J., Riordan, D. P., Gerber, A. P., Herschlag, D. and Brown, P. O.
(2008). Diverse RNA-binding proteins interact with functionally related sets of
RNAs, suggesting an extensive regulatory system. PLoS Biol. 6, e255.
Hunter, C. P. and Kenyon, C. (1996). Spatial and temporal controls target pal-1
blastomere-specification activity to a single blastomere lineage in C. elegans
embryos. Cell 87, 217-226.
Jabado, N., Canonne-Hergaux, F., Gruenheid, S., Picard, V. and Gros, P. (2002).
Iron transporter Nramp2/DMT-1 is associated with the membrane of phagosomes
in macrophages and Sertoli cells. Blood 100, 2617-2622.
Jiang, H., Zhang, X., Luo, J., Dong, C.,Xue, J., Wei, W.,Chen, J., Zhou, J., Gao, Y.
and Yang, C. (2012). Knockdown of hMex-3A by small RNA interference
suppresses cell proliferation and migration in human gastric cancer cells. Mol.
Med. Rep. 6, 575-580.
Jiao, Y., Bishop, C. E. and Lu, B. (2012a). Mex3c regulates insulin-like growth
factor 1 (IGF1) expression and promotes postnatal growth. Mol. Biol. Cell 23,
1404-1413.
Jiao, Y., George, S. K., Zhao, Q., Hulver, M. W., Hutson, S. M., Bishop, C. E. and
Lu, B. (2012b). Mex3c mutation reduces adiposity and increases energy
expenditure. Mol. Cell. Biol. 32, 4350-4362.
Lablack, A., Bourdon, V., Defamie, N., Batias, C., Mesnil, M., Fenichel, P.,
Pointis, G. and Segretain, D. (1998). Ultrastructural and biochemical evidence
for gap junction and connexin 43 expression in a clonal Sertoli cell line: a potential
model in the study of junctional complex formation. Cell Tissue Res. 294, 279-287.
Lecureuil, C., Fontaine, I., Crepieux, P. and Guillou, F. (2002). Sertoli and
granulosa cell-specific Cre recombinase activity in transgenic mice. Genesis 33,
114-118.
Lecuyer, E., Yoshida, H., Parthasarathy, N., Alm, C., Babak, T., Cerovina, T.,
Hughes, T. R., Tomancak, P. and Krause, H. M. (2007). Global analysis of
mRNA localization reveals a prominent role in organizing cellular architecture and
function. Cell 131, 174-187.
Lee, N. P. Y. and Cheng, C. Y. (2004). Ectoplasmic specialization, a testis-specific
cell-cell actin-based adherens junction type: is this a potential target for male
contraceptive development? Hum. Reprod. Update 10, 349-369.
Li, M. W. M., Mruk, D. D., Lee, W. M. and Cheng, C. Y. (2010). Connexin 43 is
critical to maintain the homeostasis of the blood-testis barrier via its effects on tight
junction reassembly. Proc. Natl. Acad. Sci. U.S.A. 107, 17998-18003.
Meng, J., Holdcraft, R. W., Shima, J. E., Griswold, M. D. and Braun, R. E. (2005).
Androgens regulate the permeability of the blood-testis barrier. Proc. Natl. Acad.
Sci. U.S.A.102, 16696-16700.
Mather, J. P. (1980). Establishment and characterization of two distinct mouse
testicular epithelial cell lines. Biol. Reprod. 23, 243-252.
Mochizuki, N., Yamashita, S., Kurokawa, K., Ohba, Y., Nagai, T., Miyawaki, A.
and Matsuda, M. (2001). Spatio-temporal images of growth-factor-induced
activation of Ras and Rap1. Nature 411, 1065-1068.
Nakagawa, A., Nagaosa, K., Hirose, T., Tsuda, K., Hasegawa,K., Shiratsuchi, A.
and Nakanishi, Y. (2004). Expression and function of class B scavenger receptor
type I on both apical and basolateral sides of the plasma membrane of polarized
testicular Sertoli cells of the rat. Dev. Growth Differ. 46, 283-298.
Nakanishi, Y. and Shiratsuchi, A. (2004). Phagocytic removal of apoptotic
spermatogenic cells by Sertoli cells: mechanisms and consequences. Biol.
Pharm. Bull. 27, 13-16.
Newton, S. C., Blaschuk, O. W. and Millette, C. F. (1993). N-cadherin mediates
Sertoli cell-spermatogenic cell adhesion. Dev. Dyn. 197, 1-13.
Nony, P., Gaude, H., Rossel, M., Fournier, L., Rouault, J. P. and Billaud, M.
(2003). Stability of the Peutz-Jeghers syndrome kinase LKB1 requires its binding
to the molecular chaperones Hsp90/Cdc37. Oncogene 22, 9165-9175.
O’Connor, A. E. and de Kretser, D. M. (2004). Inhibins in normal male physiology.
Semin. Reprod. Med. 22, 177-185.
Ohba, Y., Kurokawa, K. and Matsuda, M. (2003). Mechanism of the spatio-
temporal regulation of Ras and Rap1. EMBO J. 22, 859-869.
Pagano, J. M., Farley, B. M., Essien, K. I. and Ryder, S. P.(2009). RNA recognition
by the embryonic cell fate determinant and germline totipotency factor MEX-3.
Proc. Natl. Acad. Sci. U.S.A. 106, 20252-20257.
Park, H.-O. and Bi, E. (2007). Central roles of small GTPases in the development of
cell polarity in yeast and beyond. Microbiol. Mol. Biol. Rev. 71, 48-96.
Park, D., Tosello-Trampont, A. C., Elliott, M. R., Lu, M., Haney, L. B., Ma, Z.,
Klibanov, A. L., Mandell, J. W. and Ravichandran, K. S. (2007). BAI1 is an
engulfment receptor for apoptotic cells upstream of the ELMO/Dock180/Rac
module. Nature 450, 430-434.
Patek, C. E., Kerr, J. B., Gosden, R. G., Jones, K. W., Hardy, K., Muggleton-
Harris, A. L., Handyside, A. H., Whittingham, D. G. and Hooper, M. L. (1991).
Sex chimaerism, fertility and sex determination in the mouse. Development 113,
311-325.
Pereira, B., Le Borgne, M., Chartier, N. T., Billaud, M. and Almeida, R. (2013a).
MEX-3 proteins: recent insights on novel post-transcriptional regulators. Trends
Biochem. Sci.38, 477-479.
Pereira,B., Sousa,S., Barros,R., Carreto,L., Oliveira,P., Oliveira,C., Chartier,N. T.,
Plateroti, M., Rouault, J.-P., Freund, J.-N. et al. (2013b). CDX2 regulation by the
RNA-binding protein MEX3A: impact on intestinal differentiation and stemness.
Nucleic Acids Res.41, 3986-3999.
Plotton, I., Sanchez, P., Perrard, M. H., Durand, P. and Lejeune, H. (2005).
Quantification of stem cell factor mRNA levels in the rat testis: usefulness of
clusterin mRNA as a marker of the amount of mRNA of Sertoli cell origin in post
pubertal rats. J. Endocrinol. 186, 131-143.
Polakis, P. G., Rubinfeld, B., Evans, T.and McCormick, F. (1991). Purification of a
plasma membrane-associated GTPase-activating protein specific for rap1/Krev-1
from HL60 cells. Proc. Natl. Acad. Sci. U.S.A. 88, 239-243.
Ray, D., Kazan, H., Cook, K. B., Weirauch, M. T., Najafabadi, H. S., Li, X.,
Gueroussov, S., Albu, M., Zheng, H., Yang, A. et al. (2013). A compendium of
RNA-binding motifs for decoding gene regulation. Nature 499, 172-177.
Rubinfeld, B., Munemitsu, S., Clark, R., Conroy, L., Watt, K., Crosier, W. J.,
McCormick, F. and Polakis, P. (1991). Molecular cloning of a GTPase activating
protein specific for the Krev-1 protein p21rap1. Cell 65, 1033-1042.
Russell, L. D. and Peterson, R. N. (1985). Sertoli cell junctions: morphological and
functional correlates. Int. Rev. Cytol. 94, 177-211.
Steininger, T. S., Stutz, H. and Kerschbaum, H. H. (2011). Beta-adrenergic
stimulation suppresses phagocytosis via Epac activation in murine microglial
cells. Brain Res. 1407, 1-12.
Stelzl, U., Worm, U., Lalowski, M., Haenig, C., Brembeck, F. H., Goehler, H.,
Stroedicke, M., Zenkner, M., Schoenherr, A., Koeppen, S. et al. (2005). A
human protein-protein interaction network: a resource for annotating the
proteome. Cell 122, 957-968.
van Triest, M., de Rooij, J. and Bos, J. L. (2001). Measurement of GTP-bound
Ras-like GTPases by activation-specific probes. Methods Enzym. 333, 343-348.
Wang, H., Singh, S. R., Zheng, Z., Oh, S.-W., Chen, X., Edwards, K. and Hou, S. X.
(2006). Rap-GEF signaling controls stem cell anchoring to their niche through
regulating DE-cadherin-mediated cell adhesion in the Drosophila testis. Dev. Cell
10, 117-126.
Weiss, M., Vigier, M., Hue, D., Perrard-Sapori, M. H., Marret, C., Avallet, O. and
Durand, P. (1997). Pre- and postmeiotic expression of male germ cell-specific
genes throughout 2-week cocultures of rat germinal and Sertoli cells. Biol. Reprod.
57, 68-76.
Yefimova, M. G., Sow, A., Fontaine, I., Guilleminot, V., Martinat, N., Crepieux, P.,
Canepa, S., Maurel, M.-C., Fouchecourt, S., Reiter, E. et al. (2008). Dimeric
transferrin inhibits phagocytosis of residual bodies by testicular rat Sertoli cells.
Biol. Reprod. 78, 697-704.
Yoon, J. H., Abdelmohsen, K., Kim, J., Yang, X., Martindale, J. L., Tominaga-
Yamanaka, K., White, E. J., Orjalo, A. V., Rinn, J. L., Kreft, S. G. et al. (2013).
Scaffold function of long non-coding RNA HOTAIR in protein ubiquitination. Nat
Commun. 4, 2939.
2107
RESEARCH ARTICLE Development (2014) 141, 2096-2107 doi:10.1242/dev.108514
DEVELOPMENT

Supplemental information
Supplemental material and methods
Mice Generation and Genotyping.
For generation of Mex-3b null mice, the second exon was flanked by loxP
sequences, and the Neo selectable marker was removed by transient expression of
Cre recombinase in the ES cells. The Mex-3b null allele was obtained by breeding
conditional floxed Mex-3b animals with Nestin-Cre mice expressing Cre in the germ
line (Betz et al., 1996). Heterozygous Mex-3b +/- animals negative for Cre were bred
to each other to obtain the Mex-3b knock-out mice. For the generation of Sertoli cells
specific Mex-3b null mice, conditional Mex-3b floxed mice were bred with AMH-Cre
mice expressing Cre (Lecureuil et al., 2002).
Embryos and mice were genotyped by multiplex PCR using 3 primers as described in
figure 1A:
Mex-3b (1) 5' (GCTCAGTTGGATACCAGCAGC)
Mex-3b (2) 3' (CAAGCATCGTCAGCTGTGTGTAATG)
Mex-3b (3) 5’ (GGGCCTTTAACCTCATGGTC)
The wild-type allele produced a band of 433 bp, the floxed allele a band of 559 bp
and the knock-out allele a band of 387 bp. Survival of wild type, Mex-3b +/- and Mex-
3b -/- mice was monitored for 60 days after birth.
Transfection and Infection.
For transfection, cells were plated for 24h and plasmids transfected into cells using
ExGen 500 (Upstate Biotechnologies) or Jet Pei (Ozyme) according to the
manufacturer's instructions. For infections, cells were plated for 24h and lentiviruses
were added to the culture media at a MOI of 30 in the presence of polybren (8 !g/ml).
Expression of GFP proteins was controlled by microscopy and Western blot.
Histological sections and Staining.
Serial sections (3µm) were stained with Periodic Acid-Schiff and Gill’s Hematoxilin
solution (Sigma-Aldrich). For immunohistochemistry, sections were deparafinized,
deshydrated and incubated with primary antibody (mouse anti-vimentin (1:100,

Sigma-Aldrich)). The ABC MOM and AEC peroxidase substrate kits (Vector
laboratories) and Hematoxylin QS were used.
Biotin Tracer Studies.
Mice (5 months old) were anesthetized and their testes exposed. Before injection of
50 µl of 10 mg/ml EZ-Link Sulfo-NHS-LC-Biotin (Pierce Chemical Co.), into the
interstitium of one testis and 50 µl of 1 mM CaCl2 in PBS in the other, as a control.
After 30 min the animals were euthanized, and their testes were immediately
removed and frozen on dry ice. Cryosections of 5-µm thickness were fixed for 10 min
with 4% PFA, rinced with PBS and treated with Alexa Fluor 488 streptavidin. The
sections were rinsed twice with PBS for 10 min and mounted in DAPI containing
mounting medium.

Figure'S1.'Mex-3b'depletion'affects'viability'and'fertility'in'both'male'and'female'mice.
(A)$RT'qPCR$analysis$of$Mex$3b$ transcripts$isolated$from$ MEFs$cells.$(B)$ Western$blot$analysis$of$endogenous$MEX'3B$
(indicated$by$black$arrow)$immunoprecipitated$ from$ BOSC$ cells$ and$ from$ whole$ mouse$ testis$ with$ the$ indicated$ Mex$3b$
genotypes.$One$representative$experiment$of$three$ is$shown.$(C)$Table$of$breeding$and$survival$data$of$Mex$3bGH¿FLHQW
mice.$The$average$genotypes$of$offspring$from$Mex$3b'+/$$mating$at$birth$to$day$7.$(D)$Hematoxilin$and$Scarlett$Eosin$stain'
ing$of$secondary$follicle$cross$section$from$6$months'old$mice$with$the$indicated$Mex$3b'genotypes..$(E)$RT'PCR$analysis$
of$the$levels$of$the$four$distinct$Mex$3$mRNA$in$the$testis$of$wt$and$Mex$3bGH¿FLHQWPLFHSXUL¿HG6HUWROLFHOOVDQGSXUL¿HG
pachytene$spermatocytes$(PS)$and$round$spermatids$(RS).$(F)$RT'qPCR$analysis$of$Mex$3a,'c'and'd$transcripts$isolated$
IURPWHVWLVDQGSXUL¿HG6HUWROLFHOOVRILQGLFDWHGMex$3b$genotypes$3$months'old$mice.

Figure'S2.''Mex-3b'GH¿FLHQWVHPLQLIHURXVWXEXOHVKDYHPRUH6HUWROLFHOOVEXWDQLGHQWLFDOGLDPHWHUFRPSDUHWR
FRQWURO
(A)$Counting$of$Sertoli$cells$per$seminiferous$tubules$of$wt$and$Mex$3bGH¿FLHQWPLFHDWGLIIHUHQWDJHVGIRUGD\VDQGP
IRUPRQWKV6HUWROLFHOOVZHUHLGHQWL¿HGDVFHOOVSRVLWLYHO\VWDLQHGIRUYLPHQWLQQ PLFHJURXSVHPLQLIHURXVWXEXOHV
mouse).$(B)$Representation$of$the$mean$seminiferous$tubules$diameter$of$wt$and$Mex$3bGH¿FLHQWPLFHDWGLIIHUHQWDJHVG
IRUGD\VDQGPIRUPRQWKVQ PLFHJURXSVHPLQLIHURXVWXEXOHVPRXVH

)LJXUH6'HOHWLRQRIMex-3bDIIHFWVSKDJRF\WRVLVLQ6HUWROLFHOOV
(A)$Immunodetection$of$15'Lipoxygenase$(15'LOX)$on$cross'sections$of$mouse$testes$with$the$indicated$Mex$3b'genotypes$
at$6$months$old.$(B)$Hematoxilin$and$Scarlett$Eosin$staining$of$testis$cross$section$from$mice$with$the$indicated$Mex$3b'gen'
otypes.$(C)$RT'qPCR$analysis$of$Slc11a$and$SR$BI$transcripts$isolated$from$murine$TM4$cells$depleted$in'Mex$3b$by$siRNA.$
All$levels$were$normalized$to$the$level$of$18S$mRNA.$One$representative$experiment$of$three$is$shown.$Scale$bars$and$P$
values$with$s.e.m$are$indicated.$(D).$Phagocytosis$assay$on$wild$type$and$Mex$3b''$/$$isolated$ macrophages$ Histogram$
LQGLFDWHVWKHDYHUDJHQXPEHUVRIHQJXOIHGÀXRUHVFHQWEHDGVSHUSKDOORLGLQ75,7&VWDLQHGFHOOQ FHOOVSHUFRQGLWLRQ

)LJXUH66SHFL¿FLQKLELWLRQRIPRXVHMex-3bH[SUHVVLRQDQGUHVFXHZLWKKXPDQ0(;%LQ70FHOOV
(A)$Mex'3b$protein$level$ was$determined$by$immunoprecipitation$and$Western$blot$analysis$in$TM4$cells$48h$after$siRNA$
treatment.$(B)$RT'qPCR$analysis$of$Mex$3a,'b,'c$and$d$transcripts$isolated$from$ murine$TM4$cells$depleted$in'Mex$3b$by$
siRNA.$All$ levels$were$normalized$to$the$level$of$18S$mRNA.$One$representative$experiment$of$three$is$shown.$(C)$Expres'
sion$of$human$MEX'3B'GFP$construct$in$TM4$cells$knocked$down$for$mouse$Mex$3b'expression$after$lentiviruses$infection$
Q H[SHULPHQWV7XEXOLQZDVXVHGDVDORDGLQJFRQWURO'57T3&5DQDO\VLVRIRap1GAP,''Mex$3b,'Connexin$43'and'
N$Cadherin$transcripts$isolated$from$murine$TM4$cells$depleted$in$Mex$3bE\VL51$Q H[SHULPHQWV$OOOHYHOVZHUHQRU'
malized$to$the$level$of$18S$mRNA.$(E)$Western$blot$analysis$of$Rap1GAP$protein$in$TM4$cells$depleted$in$Mex$3b.$Tubulin$
ZDVXVHG DVDORDGLQJFRQWURO ):HVWHUQEORW DQDO\VLVRI0(;% &RQQH[LQDQG1&DGKHULQSURWHLQV LQ70FHOOV
depleted$in$Mex$3b.$Tubulin$was$used$as$a$loading$control.

)LJXUH60H[EELQGLQJWR5$3*$3LVUHTXLUHGIRUMXQFWLRQVSURWHLQORFDOL]DWLRQ
Confocal$microscope$images$of$TM4$cells$inhibited$for$endogenous$Mex$3b$by$siRNA$and$re'expressing$the$human$MEX'
3B$protein$full$ length$ or$ truncated$ (1'239)$fused$to$ GFP.$N'cadherin$(A)$ and$ Connexin$ 43$ (B)$were$ immunostained$ and$
counterstained$with$DAPI.$Upon$Mex'3b$depletion$by$si'RNA,'the$re'expression$of$the$full'length$construct$allows$the$relo'
FDOL]DWLRQRIMXQFWLRQSURWHLQVWRWKHPHPEUDQHZKLWHDUURZKHDGVZKHUDVWKHUHH[SUHVVLRQRIWKHPXWDQWGRHVQRW
(empty$arrowheads).

)LJXUH60H[EUHJXODWHV5DSDFWLYLW\
(A)$Rap1'GTP$pull$down$from$lysates$of$TM4$cells$transfected$with$either$scramble$or$Mex$3b'siRNA$before$treatment$with$
WKH5DSLQKLELWRU**7,7KHUDWLR RI5DS*737RWDO5DSIRUHDFKFRQGLWLRQLVLQGLFDWHG%$IWHUDVKRUWVHUXP
VWLPXODWLRQ70FHOOVH[SUHVVLQJWKHLQGLFDWHG*)3FRQVWUXFWVZHUH¿[HGDQGVWDLQHGZLWKSKDOORLGLQ75,7&SULRUREVHUYD'
tion$by$confocal$microscopy.$White$arrowheads$indicate$the$plasma$membrane$localization$of$MEX'3B'GFP.
(C)$Localization$of$GFP'RBDralGDS$in$TM4$cells$knocked$down$for$Mex$3b'expression$by$siRNA$after$GGTI'298$treatment.$
Cells$were$exposed$to$phalloidin'TRITC$prior$observation$by$confocal$microscopy.$
%HW]8$9RVVKHQULFK&$5DMHZVN\.DQG0OOHU:$(1996).$Bypass$of$lethality$with$mosaic$mice$generated$by$
Cre'loxP'mediated$recombination.$Curr.'Biol.$6±
/HFXUHXLO&)RQWDLQH,&UHSLHX[3DQG*XLOORX)6HUWROLDQGJUDQXORVDFHOOVSHFL¿F&UHUHFRPELQDVH
activity$in$transgenic$mice.$Genesis$33±

Table S1. RT-PCR primer sequences
LEFT
RIGHT
Mex-3a
TTGATCAACTCTGCCTCCTG
TCCCAGTCACCATGAACACT
Mex-3b
GAGACTCTGGATGACCAAAGA
CGTTGAGAGCCGTGTTCTTG
Mex-3c
CTGTACGGCGGGGACGATG
ACCAGGCAGATTAGGACTACA
Mex-3d
AGTTGAACGTGATCGGGAGT
CCATCTCCACATCCTCCTTG
Clusterin
AACAGCTTCACCACCACCTC
CGAAGATGCTCAACACCTCA
Transferrin
GGCATCGGACACTAGCATCA
TGCCATCAGGGCAGAGCAAC
Inhibin
TCAGCCCAGCTGTGGTTCCACA
AGCCCAGCTCTTGGAAGGAGAT
LDHA
TTCCACTGCTCCTTGTCTGC
ACAGTCCACACTGCAAGCTG
Vimentin
AAGGAAGAGATGGCTCGTCA
TTGAGTGGGTGTCAACCAGA
18S
CGACGACCCATTCGAACGTCT
GCTATTGGAGCATGGAATTACCG
Rap1GAP
GAAAAGATGCAGGGAAGCAG
GTTGGTGCCTTCAATCCAGT
Slc11a2
TCCCCATTCCTGAGGAGGAG
ATCCGTGGGACCTTGGGATA
SR-BI
TCTTCACTGTCTTCACGGGC
CATGAAGGGTGCCCACATCT
Connexin-43
CTATCTTTGAGGTGGCCTTC
TCGCTCTTTCCCTTAACCCG
N-Cadherin
CGGACTCCGAGGCCCGCTAT
GCCTCCACAGACGCCTGAAGC
!
!