Three new species of Turcinoemacheilus from Iran and Turkey ( Teleostei : Nemacheilidae )

Abstract

Three new species of Turcinoemacheilus are described from Iran and Turkey raising the number of species in this genus to six, five of them in the Middle East. Turcinoemacheilus bahaii, new species, from the Zayandeh River in Iran is distinguished by having the anus situated in a posterior position and a dark brown blotch on each side of the anal-fin base in both sexes. Turcinoemacheilus minimus, new species, from the upper Euphrates drainage in Turkey is distinguished by having the anus situated in an anterior position, a slender and long caudal peduncle and a very small maximum size (up to 38 mm SL). Turcinoemacheilus saadii, new species, from the Karoun drainage in Iran is distinguished by having the anus situated in an anterior position and an unique colour pattern of large dark brown saddles. In the Middle East, all Turcinoemacheilus species are well distinguished by molecular characters and show between 5.3 and 8.5 % K2P sequence divergence in their COI barcode region.

Full text

Ichthyol. Explor. Freshwaters, Vol. 24, No. 3
257
Ichthyol. Explor. Freshwaters, Vol. 24, No. 3, pp. 257-273, 16 figs., 4 tabs., March 2014
© 2014 by Verlag Dr. Friedrich Pfeil, München, Germany – ISSN 0936-9902
Three new species of Turcinoemacheilus
from Iran and Turkey
(Teleostei: Nemacheilidae)
Hamid Reza Esmaeili*, Golnaz Sayyadzadeh*, Müfit Özulug**,
Matthias Geiger*** and Jörg Freyhof***
Three new species of Turcinoemacheilus are described from Iran and Turkey raising the number of species in this
genus to six, five of them in the Middle East. Turcinoemacheilus bahaii, new species, from the Zayandeh River in
Iran is distinguished by having the anus situated in a posterior position and a dark brown blotch on each side of
the anal-fin base in both sexes. Turcinoemacheilus minimus, new species, from the upper Euphrates drainage in
Turkey is distinguished by having the anus situated in an anterior position, a slender and long caudal peduncle
and a very small maximum size (up to 38 mm SL). Turcinoemacheilus saadii, new species, from the Karoun drain-
age in Iran is distinguished by having the anus situated in an anterior position and an unique colour pattern of
large dark brown saddles. In the Middle East, all Turcinoemacheilus species are well distinguished by molecular
characters and show between 5.3 and 8.5 % K2P sequence divergence in their COI barcode region.
* Department of Biology, College of Sciences, Shiraz University, Shiraz, Iran.
E-mail: esmaeili@susc.ac.ir, golnaz_sayad@yahoo.com
** Istanbul University, Science Faculty, Department of Biology, 34134 Vezneciler, Istanbul, Turkey.
E-mail: mozulu@istanbul.edu.tr
*** Zoological Research Museum Alexander Koenig, Leibniz Institute for Animal Biodiversity, Adenauerallee
160, 53113 Bonn, Germany. E-mail: joerg.freyhof@idiv.de
Introduction
Since the description of the Zagros dwarf loach
Turcinoemacheilus kosswigi from headwaters of the
Great Zab River in Turkey (Bânârescu & Nalbant,
1964), this genus was so rarely recognized that
we learned only recently about its distribution.
Breil & Bohlen (2001) published the first records
of Turcinoemacheilus from the Euphrates drainage
(now referred to T. minimus), Golzarianpour et
al. (2009) first reported the genus from Iran (now
referred to T. hafezi), Golzarianpour et al. (2013)
recorded T. kosswigi from Sirvan, Great and Little
Zab rivers in Iraq and described T. hafezi from
Iran. This scarcity of records is surprising, since
loaches of the genus Turcinoemacheilus are now
known to be very widespread, often common,
and easy to distinguish from all other nemachei-
lids in the Middle East by the pelvic fin origin
situated in front of the dorsal fin origin and an
anterior position of the anus, a particular colour
pattern and a very slender body (Bânârescu &
Nalbant, 1964; Freyhof et al., 2011; Golzarianpour
et al., 2013). While Turcinoemacheilus was a mono-

258
Esmaeili et al.: Three new Turcinoemacheilus
typic genus for 47 years, two new species have
been described in the last years (Conway et al.,
2011; Golzarianpour et al., 2013). There were al-
ready indications that more undescribed species
might exist in the Middle East. Breil & Bohlen
(2001) observed that the examined fishes from
the Tigris drainage were relatively large, but those
from the Euphrates were much smaller. Golzari-
anpour et al. (2013) found two sympatric species
of Turcinoemacheilus in the Karoun drainage, one
with a more anterior and one with a more poste-
rior position of the anus. They did not identify
the species with the more anterior position of the
anus. Finally, fishes superficially similar to T. hafe-
zi were discovered in the Iranian endorheic Zay-
andeh drainage. In this study, the morphological
characters as well as the colour patterns of all
these populations is analysed, and we also se-
quenced their COI barcode region. These data
together supported the view that five species of
Turcinoemacheilus are present in the Middle East,
three of them still undescribed. We describe these
three new Turcinoemacheilus based on combined
findings from morphology and molecular ge-
netic characters.
Material and methods
After anaesthesia, all fishes were fixed in 5 %
formaldehyde and stored in 70 % ethanol. Mea-
surements were made with dial calliper and re-
corded to 0.1 mm. All measurements are made
point to point, never by projections. Methods for
counts and measurements follow Kottelat &
Freyhof (2007). Standard length (SL) is measured
from the tip of the snout to the end of the hypural
complex. The length of the caudal peduncle is
measured from behind the base of the last anal-fin
ray to the end of the hypural complex, at mid-
height of the caudal-fin base. The last two branched
rays articulating on a single pterygiophore in the
dorsal and anal fins are noted as “1 1
/
2”. The ho-
lotype is included in the calculation of means and
SD.
Abbreviations used: SL, standard length; HL,
lateral head length; K2P, Kimura 2-parameter;
CMK, Collection of Maurice Kottelat, Cornol;
FSJF, Fischsammlung J. Freyhof, Berlin; IUSHM,
Istanbul University, Science Faculty, Hydrobiol-
ogy Museum, Istanbul; KU, University of Kansas
Natural History Museum and Biodiversity Re-
search Center, Lawrence; ZFMK, Zoological
Research Museum Alexander Koenig, Leibniz
Institute for Animal Biodiversity, Bonn; ZM-
CBSU, Zoological Museum of Shiraz University,
Collection of Biology Department, Shiraz; and
ZMH, Zoologisches Museum, Hamburg.
DNA extraction and PCR. Genomic DNA was
extracted using Machery & Nagel NucleoSpin®
Tissue kits following the manufacturer’s protocol
on an Eppendorf EpMotion® pipetting-roboter
with vacuum manifold. The standard vertebrate
DNA barcode region of the COI (cytochrome c
oxidase subunit 1) was amplified using a M13
tailed primer cocktail including FishF2_t1
(5' TGTAAAACGACGGCCAGTCGACTAAT-
CATAAAGATATCGGCAC), FishR2_t1 (5' CAG-
GAAACAGCTATGACACTTCAGGGTGAC-
CGAAGAATCAGAA), VF2_t1 (5' TGTAAAAC-
GACGGCCAGTCAACCAACCACAAAGACAT-
TGGCAC) and FR1d_t1 (5' CAGGAAACAGC-
TATGACACCTCAGGGTGTCCGAARAAYCAR-
AA) (Ivanova et al., 2007). Sequencing of the
ExoSAP-IT (USB) purified PCR product in both
directions was conducted at Macrogen Europe
Laboratories with forward sequencing primer
M13F (5' GTAAAACGACGGCCAGT) and re-
verse sequencing primer M13R-pUC (5' CAG-
GAAACAGCTATGAC).
Molecular data analysis. Data processing and
sequence assembly was done in Geneious (Bio-
matters, 2013) and the Muscle algorithm (Edgar,
2004) was used to create a DNA sequence align-
ment. Modeltest (Posada & Crandall, 1998), imple-
mented in the MEGA 5 software (Tamura et al.,
2011) was used to determine the most appropri-
ate sequence evolution model for the given data,
treating gaps and missing data with the partial
deletion option under 95 % site coverage cutoff.
The model with the lowest BIC scores (Bayesian
Information Criterion) is considered to best de-
scribe the substitution pattern. We generated
neighbor-joining (Saitou & Nei, 1987), maximum
parsimony (Swofford, 2002; with PAUP4b) and
maximum likelihood phylogenetic trees with 1000
bootstrap replicates to explore species phyloge-
netic affinities. Screening for diagnostic nucleotide
substitutions was performed manually from the
resulting sequence alignment.

Ichthyol. Explor. Freshwaters, Vol. 24, No. 3
259
Results
Maximum Likelihood based estimation of the
phylogenetic relationships based on the mito-
chondrial COI barcode region place the sequenced
fishes into five groups (Fig. 1), which show be-
tween 5.3 and 8.5 % K2P sequence divergence in
their COI barcode region. Two of these groups
correspond to the described species T. kosswigi
and T. hafezi. The other three groups correspond
to the new species described below. A map with
all records of Turcinoemacheilus species in the
Middle East is shown in Figure 2.
Key to species of Turcinoemacheilus
in the Middle East
1 – Anus situated behind middle between
pelvic-fin and anal-fin origins.
........................................................................2
– Anus situated at or in front of middle be-
tween pelvic-fin and anal-fin origins.
........................................................................3
2 – An elongated, irregularly shaped dark
blotch on sides of anal-fin base; anal-fin
origin situated at vertical of tip of dorsal fin
when adpressed to body.
............................................................T. bahaii
– No dark blotch on side of anal-fin base;
anal-fin origin situated behind vertical of
tip of dorsal fin when adpressed to body.
............................................................T. hafezi
3 – Lateral stripe or row of blotches absent along
lateral midline, 7-9 distinct dark saddles on
body.
............................................................T. saadii
– Prominent row of dark brown blotches along
lateral midline, usually fused into a lateral
stripe.
........................................................................4
4 – Standard length up to at least 53 mm; cau-
dal peduncle depth 1.9-2.2 times in its
length.
........................................................T. kosswigi
– Standard length up to at least 38 mm; cau-
dal peduncle depth 2.6-3.2 times in its
length.
.......................................................T. minimus
Turcinoemacheilus bahaii, new species
(Figs. 3-5)
Holotype. ZM-CBSU 7193B, 52.2 mm SL; Iran:
Esfahan prov.: Zayandeh River between Azade-
gan and Qalee Shahrokh, 32°40'54" N 50°27'47" E;
H. R. Esmaeili, A. Gholamifard, G. Sayyadzadeh,
B. Parsi, R. Zamanian Nejad, S. Mirghiasi & M.
Ghasemeian, 16 Aug 2011.
Paratypes. ZM-CBSU 7192B, 1, 38.6 mm SL; ZM-
CBSU 7194B-7208B, 15, 24.1-53.9 mm SL; same
data as holotype. – ZM-CBSU 7209B-7221B, 13,
26.2-45.1 mm SL; FSJF 3449, 4, 28.9-33.8 mm SL;
Iran: Esfahan prov.: Zayandeh River at Eskanda-
ri village, 32°49'26" N 50°25'47" E; H. R. Esmaeili,
A. Gholamifard, G. Sayyadzadeh, B. Parsi, R.
Zamanian Nejad, S. Mirghiasi & M. Ghasemeian,
16 Aug 2011.
Additional material (non types). Material used in the
molecular genetic analysis: ZM-CBSU T550F, T551F;
GenBank accession numbers: KJ179246, KJ179247; same
data as holotype.
Diagnosis. Turcinoemacheilus bahaii is the only
species of Turcinoemacheilus having a dark brown
blotch on each side of the anal-fin base (Fig. 6)
(vs. absent) and it is the only species in which the
anal-fin origin is situated at a vertical of the tip
of the dorsal fin when adpressed to the body (vs.
anal-fin origin clearly behind vertical of tip of
dorsal fin). It is further distinguished from all
other species of Turcinoemacheilus in the Middle
East except T. hafezi by the more posterior position
of the anus (distance from anus to anal-fin origin
0.1-0.4 times in distance from pelvic-fin to anal-fin
origins). Compared to all its four congeners in
the Middle East, T. bahaii is characterized by five
fixed nucleotide substitutions in the mtDNA COI
barcode region studied (Table 1).
Description. See Figures 3-5 for general appear-
ance and Table 2 for morphometric data of holo-
type and 29 paratypes. Small, very slender and
roundish bodied species with short head. Body
deepest at about pelvic-fin base, depth decreasing
towards caudal-fin base. No hump at nape. Great-
est body width at pectoral-fin base or at middle
between pectoral- and pelvic-fin bases, body al-
most equally wide until dorsal-fin origin. Section
of head roundish, flattened on ventral surface.
Caudal peduncle compressed laterally, 1.8-2.5

260
100-98-95
100-100-97
99-99-99
100-100-97
99-99-89
100-100-98
74-53-65
100-99-94
100-100-98
Paraschistura bampurensis Iran Baluchestan_KJ179269
Paraschistura bampurensis Iran Baluchestan_KJ179268
Paracobitis malapterura Iran Namak_KJ179267
Paracobitis malapterura Iran Namak_KJ179266
T. hafezi Iran Karoun_KJ179259
T. bahaii Iran Zayandeh _KJ179246
T. bahaii Iran Zayandeh _KJ179247
T. hafezi Iran Karoun_KJ179252
T. hafezi Iran Karoun_KJ179254
T. hafezi Iran Karoun_KJ179264
T. saadii Iran Karoun_KJ179257
T. saadii Iran Karoun_KJ179248
T. saadii Iran Karoun_KJ179261
T. kosswigi Iran Sirvan_KJ179258
T. kosswigi Iran Sirvan_KJ179245
T. kosswigi Iraq Little Zab_KJ179255
T. kosswigi Iraq Little Zab_KJ179262
T. kosswigi Iraq Little Zab_KJ179260
T. kosswigi Iraq Great Zab_KJ179265
T. minimus Turkey Euphrates_KJ179256
T. saadii Iran Karoun_KJ179250
T. saadii Iran Karkheh_KJ179253
T. minimus Turkey Euphrates_KJ179251
T. minimus Turkey Euphrates_KJ179263
T. minimus Turkey Euphrates_KJ179249
Fig. 1. Maximum Likelihood (ML) estimation of the phylogenetic relationships based on the mitochondrial COI
barcode region. Nucleotide positions with less than 95 % site coverage were eliminated before analysis. Numbers
of major nodes indicate bootstrap values from the Neighbour joining-, Maximum Parsimony-, and Maximum
Likelihood method from 1000 pseudo-replicates. Branch lengths are not drawn to scale.
Table 1. List of the diagnostic nucleotide substitutions for the Middle-East species of Turcinoemacheilus found in
the mtDNA COI barcode region. Nucleotide position is given with reference to the complete mitochondrial genome
of Oryzias latipes (GenBank accession number AP004421). The * denotes and amino acid change from isoleucine
to valine.
5529
5553
5593
5601
5673
5707
5715
5736
5766
5775
5793
5844
5850
5862
5874
5901
5904
5910
5919
5955
5980
6000
6012
6027
6042
6051
6066
6069
codon position 3333313333333333333913333333
T. hafezi (n = 4) GTCCCCTCCCAGAATAAGTAAAGCTACA
T. bahaii (n = 2) GTCCCCTCCCAGAATAGGCGAAACCACA
T. kosswigi (n = 6) GTCCCCTCCAAGAATAACAAACGCTACC
T. minimus (n = 4) ATCCCCTTTTAGACTAACTA
G* T GCTGTG
T. saadii (n = 5) GCTTTTCCCCGAGACGAAAAACGTTACA

Ichthyol. Explor. Freshwaters, Vol. 24, No. 3
261
(mean 2.2) times longer than deep. Pectoral fin
reaching approximately 50 % of distance from
pectoral-fin origin to pelvic-fin origin. Pelvic
axillary lobe present, fully attached to body.
Pelvic-fin origin distinctly in front of dorsal-fin
origin. Pelvic fin reaching slightly beyond or not
reaching to anus. Distance from anus to anal-fin
origin 0.1-0.4 times in distance from pelvic-fin to
anal-fin origins. Anal-fin origin at vertical of tip
of dorsal fin when adpressed to body. Anal fin
reaching beyond middle of caudal peduncle. No
adipose crest on caudal peduncle. Margin of
dorsal fin straight. Caudal fin emarginated. Larg-
est known specimen 53.9 mm SL.
Dorsal fin with 7
1
/
2 branched rays. Anal fin
with 5
1
/
2 branched rays. Caudal fin with 8 + 8
branched rays. Pectoral fin with 8-10 (usually 8)
and pelvic fin with 6 branched rays. Body without
scales. Lateral line incomplete, with 12-33 pores,
not reaching to dorsal-fin origin. Anterior nostril
opening on anterior side of a low, pointed and
flap-like tube. Nostrils separate, posterior tip of
anterior nostril not reaching posterior nostril
when folded backwards. No suborbital flap or
groove in males. Mouth small, slightly arched
(Fig. 7a). Lips moderately thick. A median inter-
ruption in lower lip. Upper lip without median
incision. Processus dentiformis small and blunt.
No median notch in lower jaw. Barbels short,
inner rostral barbel not reaching base of maxillary
barbel; outer one reaching slightly beyond base
of maxillary barbel, not reaching vertical of ante-
rior margin of eye. Maxillary barbel reaching
vertical of middle of eye. No external sexual di-
morphism observed.
Coloration. In alcohol, body pale yellow with
pale or dark brown mottled colour pattern. Ir-
regular blotches on body forming irregularly set
and shaped bars in some individuals or blotches
more prominent along lateral midline. Flank
below a line between pectoral- and pelvic-fin
bases without pigmentation. An irregularly
shaped, dark brown or black bar at posterior
extremity of caudal peduncle, usually most
prominent at the middle. In front of this bar, a
whitish or yellowish irregular quadratic or trian-
gular patch. Cheeks and ventral surface of head
E
E
u
p
h
r
a
t
e
s
T
i
g
r
i
s
Caspian
Caspian
Sea
Sea
Karkheh
Karkheh
Isfahan
Isfahan
Karun
Karun
Persian
Persian
Gulf
Gulf
E
u
p
h
r
a
t
e
s
T
i
g
r
i
s
Caspian
Sea
Karkheh
Isfahan
Karun
Persian
Gulf
Fig. 2. Records of Turcinoemacheilus species in the Middle East.
&
, T. minimus; %, T. kosswigi; (, T. saadii; , T. hafe-
zi;
)
, T. bahaii.

262
Fig. 3. Turcinoemacheilus bahaii, ZM-CBSU 7193B, holotype, 52.2 mm SL; Iran: Zayandeh River.
Fig. 4. Turcinoemacheilus bahaii, Iran: Zayandeh River; paratypes; a, ZM-CBSU 7194B, 49.1 mm SL; b, ZM-CBSU
7192B, 41.7 mm SL; and c, ZM-CBSU 7195B, 38.6 mm SL.
Fig. 5. Turcinoemacheilus bahaii, ZM-CBSU 7198b, paratype, 44.1 mm SL; Iran: Zayandeh River.
a
b
c

Ichthyol. Explor. Freshwaters, Vol. 24, No. 3
263
Fig. 6. Turcinoemacheilus bahaii, ZM-CBSU 7194B,
49.1 mm SL; diagnostic dark blotch on sides of anal-fin
origin.
cream or pale yellow, head above cheeks with
many small brown spots and blotches sometimes
fused into a marbled pattern or plain brown. An
elongated, faint, brown blotch on each side of
anal-fin base (Fig. 6). Dorsal and caudal fins hya-
line, with elongated spots on rays, forming a
mottled pattern of 1-2 dark vertical rows ap-
proximately in middle of ray length in dorsal fin
and 1-2 vertical rows in caudal fin. Last un-
branched dorsal-fin ray black at base, black at
about middle of ray and hyaline on posterior part.
Anal-, pelvic- and pectoral fins hyaline.
abc
Fig. 7. Ventral view of head of species of Turcinoemacheilus. a, T. bahaii, ZM-CBSU 7197b, paratype, 53.6 mm SL;
b, T. minimus, IUSHM 2013-1050, holotype, 35.2 mm SL; and c, T. saadii, ZM-CBSU 7170b, paratype, 46.8 mm SL.
Fig. 8. Zayandeh River between Azadegan and Qalee Shahrokh, Iran; type locality of Turcinoemacheilus bahaii.

264
In life, body creamy whitish with very faint,
pale brown colour patterns.
Distribution and habitat. Turcinoemacheilus bahaii
is known from the Zayandeh River which is an
endorheic river in Central Iran flowing from the
Zagros Mountains to the Gavkhoni wetlands. At
the type locality (Fig. 8) the river is about 20 m
wide, the substrate consists of coarse gravel and
boulders and the water is fast-running.
Etymology. The species is named for Baha
–
’ al-Dı
–
n
Muh
.ammad ibn H
.usayn al-’A
–
milı
–
(also known
as Shaykh-i Baha
–
'ı
–
, Persian: ) a scholar,
philosopher, architect, mathematician, astrono-
mer and poet in 16th century Iran.
Remarks. The phylogenetic tree reconstruction
(Fig. 1) suggests that T. bahaii is closely related to
T. hafezi from the Karoun and Dez drainages, both
flowing to the deltaic area of the Arvand River
or Shatt al Arab, which is the lowermost part of
the joint Euphrates and Tigris drainages. Both
species are superficially similar in body shape
and colour pattern, and are separated by 5.3 %
K2P distance in the studied COI gene region,
which is proposed as a strong indicator that two
species are involved (see Herbert et al., 2003).
Beside molecular characters, T. bahaii is distin-
guished from T. hafezi by having a dark brown
blotch on the sides of the anal-fin base (Fig. 6) (vs.
absence). It is distinguished from T. hafezi, T. koss-
wigi and T. saadii by the anal fin situated in a more
anterior position, at a vertical of the tip of dorsal
fin when adpressed to the body (vs. anal-fin ori-
gin clearly behind vertical of tip of dorsal fin).
Turcinoemacheilus bahaii is further distinguished
from T. kosswigi, T. minimus and T. saadii by the
more posterior position of the anus, which is
behind the middle between the pelvic-fin origin
and the anal-fin origin (vs. at the middle or in
front of the middle). Turcinoemacheilus bahaii is
distinguished from T. himalaya from Nepal by a
completely scaleless body (vs. small cycloid scales
present on the posterior half of the body).
Table 2. Morphometric data of Turcinoemacheilus bahaii (holotype ZM-CBSU 7193B, paratypes, ZM-CBSU 7192B-
7208B, ZM-CBSU 7209B-7221B, n = 29).
holotype min max mean SD
Standard length (mm) 52.2 24.1 53.9
In percent of standard length
Head length 20.4 20.4 25.2 23.0 1.3
Body depth at dorsal-fin origin 12.3 11.5 16.2 13.5 1.2
Prepectoral length 17.8 17.8 24.7 21.6 1.7
Predorsal length 53.9 36.4 57.5 54.4 3.6
Postdorsal length 35.0 30.1 36.6 34.2 1.4
Preanal length 72.8 66.7 74.2 71.1 1.2
Prepelvic length 50.5 49.8 55.4 52.8 1.4
Distance between pectoral and pelvic-fin origins 31.8 29.0 33.9 31.4 1.2
Distance between pelvic and anal-fin origins 21.4 15.5 22.2 19.0 1.7
Distance between vent and anal-fin origin 6.7 2.4 7.9 4.2 1.3
Depth of caudal peduncle 8.8 8.0 10.6 9.0 0.5
Length of caudal peduncle 20.7 17.5 21.6 19.4 1.1
Dorsal-fin depth 14.6 13.9 18.7 16.3 1.4
Anal-fin base length 7.5 5.3 8.1 6.9 0.7
Pectoral-fin length 14.9 14.0 17.7 16.0 1.0
Pelvic-fin length 12.2 11.2 14.0 12.0 0.8
In percent of head length
Head depth at eye 46 42 53 47 2.8
Snout length 43 31 44 39 2.8
Eye diameter 13 11 17 14 1.5
Postorbital distance 53 42 55 48 3.0
Maximum head width 63 55 64 61 2.7
Interorbital width 25 21 32 28 3.1

Ichthyol. Explor. Freshwaters, Vol. 24, No. 3
265
Turcinoemacheilus minimus, new species
(Figs. 9-11)
Holotype. IUSHM 2013-1050, 35.2 mm SL; Tur-
key: Adıyaman prov.: Upper Göksu, 5 km north-
east of Gölbası, 37°50.22' N 37°41.09' E; M. Özulug
& J. Freyhof, 18 June 2008.
Paratypes. IUSHM 2013-1051, 5, 32.1-35.3 mm
SL; FSJF 2454, 4, 33-38 mm SL; same data as
holotype.
Additional material (non types). CMK 16824, 3, 25.7-
30.3 mm SL; Turkey: Erzincan prov.: Karasu near
Mercan, 39°45' N 40°14' E; M. Breil, 17 June 1999. – Ma-
terial used in the molecular genetic analysis: FSJF
DNA-968; GenBank accession numbers: KJ179249,
KJ179251, KJ179256, KJ179263; same data as holotype.
Diagnosis. Turcinoemacheilus minimus is distin-
guished from the other species of Turcinoemacheilus
in the Middle East by a combination of characters,
none of them unique. Turcinoemacheilus minimus
is superficially similar to T. kosswigi and both
share the same colour pattern. They are distin-
guished by the more slender and longer caudal
peduncle in T. minimus (caudal peduncle length
19.5-21.0 % SL vs. 17.7-19.0 in T. kosswigi). Tur-
cinoemacheilus minimus is distinguished from
T. hafezi and T. bahaii by the more anterior position
of the anus, which is in the middle (or in front)
of the distance between the pelvic-fin and the
anal-fin origins (vs. behind the middle in T. hafe-
zi and T. bahaii).
Turcinoemacheilus minimus is also distinguished
by its very small size, up to 38 mm SL observed
(vs. larger in all other species). Relative to its four
congeners in the Middle East, T. minimus is char-
acterized by ten fixed nucleotide substitutions in
the mtDNA COI barcode region studied (Table 1),
one of them non-silent and thus leading to an
amino-acid change from isoleucine to valine.
Description. See Figures 9-11 for general appear-
ance and Table 3 for morphometric data of holo-
type and 5 paratypes. Small, very slender and
roundish bodied species with short head. Body
deepest at about pelvic-fin base, depth decreasing
towards caudal-fin base. No hump at nape. Great-
Table 3. Morphometric data of Turcinoemacheilus minimus (holotype IUSHM 2013-1050; paratypes IUSHM 2013-
1051; n = 6).
holotype min max mean SD
Standard length (mm) 35.2 32.1 35.3
In percent of standard length
Head length 20.5 18.1 21.3 19.6 1.1
Body depth at dorsal-fin origin 9.8 9.8 11.6 10.9 0.5
Prepectoral length 20.4 19.0 21.4 20.2 0.7
Predorsal length 58.0 56.8 59.5 58.1 0.8
Postdorsal length 34.8 34.7 36.9 35.8 0.9
Preanal length 73.5 70.4 73.6 72.8 1.2
Prepelvic length 54.2 49.7 54.2 51.9 1.4
Distance between pectoral and pelvic-fin origins 32.0 29.2 32.9 31.1 1.4
Distance between pelvic and anal-fin origins 20.7 20.7 23.3 21.9 1.0
Distance between vent and anal-fin origin 11.5 11.5 15.2 12.8 1.2
Depth of caudal peduncle 7.0 6.3 7.0 6.8 0.3
Length of caudal peduncle 20.1 17.1 21.0 19.7 1.3
Dorsal-fin depth 14.3 12.8 17.0 14.3 1.3
Anal-fin base length 7.4 6.3 9.4 7.6 1.1
Pectoral-fin length 16.7 14.9 16.7 15.7 0.6
Pelvic-fin length 12.8 12.0 13.9 13.0 0.6
In percent of head length
Head depth at eye 35 35 42 38 2.4
Snout length 39 38 45 42 2.9
Eye diameter 16 16 21 18 1.5
Postorbital distance 47 45 50 48 1.5
Maximum head width 48 49 57 53 2.7
Interorbital width 28 25 29 27 1.4

266
Fig. 9. Turcinoemacheilus minimus, IUSHM 2013-1050, holotype, 35.2 mm SL; Turkey: Göksu River.
Fig. 10. Turcinoemacheilus minimus, Turkey: Göksu River: paratypes, IUSHM 2013-1051; a, 35.3 mm SL; b, 35.0 mm
SL; and c, 33.3 mm SL.
Fig. 11. Turcinoemacheilus minimus, collected with IUSHM 2013-1051, about 35 mm SL; Turkey: Göksu River.
a
b
c

Ichthyol. Explor. Freshwaters, Vol. 24, No. 3
267
est body width at pectoral-fin base or at middle
between pectoral- and pelvic-fin bases, body al-
most equally wide until dorsal fin-origin. Section
of head roundish, flattened on ventral surface.
Caudal peduncle compressed laterally, 2.6-3.2
(mean 2.9) times longer than deep. Pelvic axillary
lobe present, its tip not attached to body. Pelvic-
fin origin distinctly in front of dorsal-fin origin.
Pectoral fin reaching approximately 50 % of dis-
tance from pectoral-fin origin to pelvic-fin origin.
Pelvic fin reaching beyond anus. Distance from
anus to anal-fin origin 0.5-0.6 times in distance
from pelvic-fin to anal-fin origins. Anal-fin origin
behind vertical of tip of dorsal fin when adpressed
to body. Anal fin not reaching to middle of caudal
peduncle. No adipose crest on caudal peduncle.
Margin of dorsal fin straight. Caudal fin slightly
emarginated. Largest known specimen 38 mm
SL.
Dorsal fin with 6-7 1
/
2 (usually 6 1
/
2) branched
rays. Anal fin with 5 1
/
2 branched rays. Caudal fin
with 8 + 8 or 8 + 7 branched rays. Pectoral fin with
8-9 and pelvic fin with 7 branched rays. Body
without scales. Lateral line incomplete, with 15-
20 pores, reaching beyond tip of pectoral fin but
not reaching to dorsal-fin origin. Anterior nostril
opening on anterior side of a low, blunt and flap-
like tube. Nostrils closely together, posterior tip
of anterior nostril reaching into posterior nostril
when folded backwards. No suborbital flap or
groove in males. Mouth small, slightly arched
(Fig. 7b). Lips moderately thick. A median inter-
ruption in lower lip. Upper lip without median
incision. Processus dentiformis small and blunt.
No median notch in lower jaw. Barbels short,
inner rostral barbel reaching base of outer rostral
barbel; outer one reaching to base of maxillary
barbel. Maxillary barbel reaching vertical of an-
terior part of eye. No external sexual dimorphism
observed.
Coloration. In alcohol and life, body pale cream
yellow. A row of large irregular, brown, longitu-
dinally elongated blotches along lateral midline,
often fused into a prominent irregular lateral
stripe. Large, brown saddles on back, connected
to lateral blotches along whole body. On predor-
sal back, saddles sometimes dissociated into a
marbled pattern, reaching downwards to stripe.
Flank below lateral stripe without pigmentation.
Fig. 12. Upper Göksu River northeast of Gölbası, Turkey; type locality of Turcinoemacheilus minimus.

268
An irregularly shaped, dark brown or black bar
at caudal-fin base. In front of this bar, a whitish
or yellowish triangular patch on upper and
lower caudal peduncle. Cheeks and ventral sur-
face of head cream or pale yellow, head above
cheeks plain brown. Dorsal and caudal fins hya-
line, with elongated spots on rays, forming 1-2
dark vertical rows, approximately in middle of
ray length in dorsal fin and 1-2 vertical rows in
caudal fin. Last unbranched dorsal-fin ray hyaline
at base, black at anterior half and hyaline on
posterior half. Anal-, pelvic- and pectoral fins
hyaline.
Distribution and habitat. Turcinoemacheilus mini-
mus is known from two localities in the upper
Euphrates drainage in Turkey. The Göksu at the
type locality of the species (Fig. 12) is about 30 m
wide, the substrate consists of coarse gravel and
boulders and the water is fast-running.
Etymology. The species is named for its small
size. An adjective.
Remarks. The phylogenetic tree reconstruction
suggests that T. minimus is most closely related
to T. kosswigi from the Tigris drainage. It had
initially been identified as T. kosswigi by Breil &
Bohlen (2001). The most striking character of
T. minimus, the very small maximum size (up to
38 mm SL vs. 53 in T. kosswigi), was not considered
as a difference by Breil & Bohlen (2001), as only
five individuals of T. kosswigi were known then.
When MÖ & JF collected this species again in the
Euphrates, the small fishes were considered as
juveniles. When fresh materials of T. kosswigi
became available from the Iraqi Tigris drainage,
no such small juveniles were found despite the
fact that both samplings were conducted in June
and the same fishing device, with a 150 mm anode
ring that caught small juvenile cyprinids without
problems. When molecular data became available,
it turned out that both species are well distin-
guished. Based on the complete COI barcode
fragment mean smallest K2P distance of T. mini-
mus is 5.9 % to T. kosswigi, its closest relative.
While there is discussion about a priori thresholds
and their use in species delimitation and recogni-
tion (e. g. Meier et al., 2006; Srivathsan & Meier,
2012), a 5.9 % distance between two populations
is strongly indicative that two species are involved
(see Herbert et al., 2003).
Interestingly, the fishes described by Breil &
Bohlen (2001) (now CMK 16824) were kept about
one year in captivity before they were preserved,
and they did not grow during this time (J. Bohlen,
pers. comm.). This observation and the absence
of larger fishes in our samples suggest that the
Turcinoemacheilus from the upper Euphrates is a
dwarf species. Taking this information and the
molecular data together, we do not consider the
available material from the upper Euphrates as
juveniles and we treat their small size as a diag-
nostic character distinguishing it from T. koss-
wigi. Beside its small size and molecular charac-
ters, T. minimus is superficially very similar to
T. kosswigi and both share the same colour pattern.
They are distinguished by several morphometric
characters, but as no individuals of similar sizes
were available, it cannot be totally excluded that
these differences are the result of allometric
growth. The most obvious difference is the more
slender and longer caudal peduncle in T. mini-
mus.
Turcinoemacheilus minimus is distinguished
from T. hafezi and T. bahaii by the more anterior
position of the anus, which is in the middle (or
in front) of the distance between the pelvic-fin
and the anal-fin origins (distance from anus to
anal-fin origin 0.5-0.6 times in distance from
pelvic-fin to anal-fin origins) while it is behind
the middle (0.2-0.4 times) in T. hafezi and T. ba-
haii.
Turcinoemacheilus minimus is distinguished
from T. himalaya by a completely scaleless body
(vs. presence of small cycloid scales on the pos-
terior half of body).
Turcinoemacheilus saadii, new species
(Figs. 13-15)
Holotype. ZM-CBSU 7169B, 47.1 mm SL; Iran:
Fars prov.: stream Tang-e-Tizab, a tributary to
Bashar River which drains to the Karoun, 30°23'
12" N 51°46'50" E; H. R. Esmaeili, G. Sayyadzadeh,
M. Masoudi, S. H. Aminaghai, 5 Sep 2012.
Paratypes. ZM-CBSU 7166b-7175B, 9, 44.6-
63.6 mm SL; ZM-CBSU 7165B, 1, 45.4 mm SL;
same data as holotype.
Additional material (non types). FSJF 1512, 10, 41.4-
52.6 mm SL; Iran: Kohrang river at Kaj village,
32°03'16.97" N 50°34'46" E. — FSJF 3232, 2, 30-44 mm

Ichthyol. Explor. Freshwaters, Vol. 24, No. 3
269
SL; Iran: Kermanshah prov.: Sepidbarg river west of
Javanrud, 34°48'21" N 46°27'29" E. – Material used in the
molecular genetic analysis: FSJF DNA-1995; Iran: Ker-
manshah prov.: Sepidbarg river west of Javanrud,
34°48'21" N 46°27'29" E, GenBank accession numbers:
KJ179250, KJ179257. – ZM-CBSU T540, T542; same data
as holotype, GenBank accession numbers: KJ179248,
KJ179261. – ZM-CBSU T524; Iran: Gamasiab, Karkheh,
Tigris drainage, 34°23'16" N 47°41'14" E, GenBank ac-
cession number: KJ179253.
Diagnosis. Turcinoemacheilus saadii is distin-
guished from the other species of Turcinoemacheilus
in the Middle East by its unique colour pattern
organized in 7-9 distinct dark saddles never
forming a lateral stripe (vs. mottled colour pattern
or presence of a lateral stripe). It is further distin-
guished by the combination of a deeply emargin-
ated caudal fin and the distance from anus to
anal-fin origin 0.4-0.5 times in the distance from
pelvic-fin to anal-fin origins. Relative to its four
congeners in the Middle East, T. saadii is charac-
terized by 13 fixed nucleotide substitutions in the
mtDNA COI barcode region studied (Table 1).
Description. See Figures 13-15 for general ap-
pearance and Table 4 for morphometric data of
holotype and 10 paratypes. Small, very slender
and roundish bodied species with short head.
Body deepest at about pelvic-fin base, depth
decreasing towards caudal-fin base. No hump at
nape. Greatest body width at pectoral-fin base or
at middle between pectoral- and pelvic-fin bases,
body almost equally wide until dorsal fin-origin.
Section of head roundish, flattened on ventral
surface. Caudal peduncle compressed laterally,
2.4-3.2 (mean 2.7) times longer than deep. Pelvic
axillary lobe present, not attached to body. Pelvic-
fin origin distinctly in front of dorsal-fin origin.
Pectoral fin reaching approximately 40 % of dis-
tance from pectoral-fin origin to pelvic-fin origin.
Pelvic fin reaching to anus. Distance from anus
to anal-fin origin 0.4-0.5 times in distance from
pelvic-fin to anal-fin origins. Anal-fin origin be-
hind vertical of tip of dorsal fin when adpressed
to body. Anal fin not reaching to middle of caudal
peduncle. No adipose crest on caudal peduncle.
Margin of dorsal fin straight or convex. Caudal
Table 4. Morphometric data of Turcinoemacheilus saadii (holotype ZM-CBSU 7169B; paratypes ZM-CBSU 7166b-
7175B, ZM-CBSU 7165B; n = 11).
holotype min max mean SD
Standard length (mm) 47.1 44.6 56.4
In percent of standard length
Head length 19.4 17.3 20.0 19.0 0.8
Body depth at dorsal-fin origin 13.3 11.8 13.4 12.5 0.6
Prepectoral length 18.4 16.9 19.6 18.0 0.9
Predorsal length 53.5 51.6 54.7 52.7 1.0
Postdorsal length 39.6 36.5 39.6 37.9 1.0
Preanal length 73.3 70.4 74.4 72.9 1.0
Prepelvic length 48.6 48.1 51.3 49.8 1.0
Distance between pectoral and pelvic-fin origins 32.2 30.9 33.8 32.5 0.9
Distance between pelvic and anal-fin origins 23.2 20.9 24.3 22.6 1.0
Distance between vent and anal-fin origin 8.6 8.6 12.1 9.8 1.1
Depth of caudal peduncle 7.9 6.8 8.1 7.6 0.4
Length of caudal peduncle 21.1 17.8 21.9 20.6 1.2
Dorsal-fin depth 15.5 12.5 15.5 14.4 1.0
Anal-fin base length 6.7 5.9 7.2 6.5 0.5
Pectoral-fin length 15.3 13.3 16.0 14.9 0.8
Pelvic-fin length 13.8 11.7 13.8 12.4 0.7
In percent of head length
Head depth at eye 43 37 49 43 2.9
Snout length 44 38 45 42 1.9
Eye diameter 11 11 16 13 1.4
Postorbital distance 44 40 48 44 2.1
Maximum head width 57 57 66 60 3.0
Interorbital width 25 22 28 26 2.1

270
Fig. 13. Tucinoemacheilus saadii, ZM-CBSU7169B, holotype, 47.1 mm SL; Iran: stream Tang-e-Tizab.
Fig. 14. Turcinoemacheilus saadii, Iran: stream Tang-e-Tizab; paratypes; a, ZM-CBSU 7168B, 56.4 mm SL; b, ZM-
CBSU 7166B, 49.5 mm SL; c, ZM-CBSU 7171B, 47.1 mm SL.
Fig. 15. Turcinoemacheilus saadii, collected with ZM-CBSU7169B, about 50 mm SL; Iran: stream Tang-e-Tizab.
fin deeply emarginated. Largest known specimen
63.6 mm SL.
Dorsal fin with 7
1
/
2 branched rays. Anal fin
with 4 1
/
2-5 1
/
2 (usually 5 1
/
2) branched rays. Caudal
fin with 8 + 8 branched rays. Pectoral fin with 7-8
and pelvic fin with 5-6 (usually 5) branched rays.
Body without scales. Lateral line incomplete, with
18-24 pores, not reaching to dorsal-fin origin.
Anterior nostril opening on anterior side of a low,
pointed and flap-like tube. Anterior nostril open-
a
b
c

Ichthyol. Explor. Freshwaters, Vol. 24, No. 3
271
ing on anterior side of a low, blunt and flap-like
tube. Nostrils close together, posterior tip of an-
terior nostril reaching into posterior nostril when
folded backward. No suborbital flap or groove
in males. Mouth small, slightly arched (Fig. 7c).
Lips moderately thick. A median interruption in
lower lip. Upper lip without median incision.
Processus dentiformis small and blunt. No me-
dian notch in lower jaw. Barbels short, inner
rostral barbel not reaching base of maxillary
barbel; outer one reaching slightly beyond base
of maxillary barbel, not reaching vertical of ante-
rior margin of eye. Maxillary barbel reaching
vertical of middle of eye. No external sexual di-
morphism observed.
Coloration. In alcohol and in life, body pale
cream yellow. Seven to nine wide, irregularly
shaped dark brown saddles on body; three to four
in front of dorsal fin, sometimes dissociated or
partly dissociated into two narrow bars on flank.
One wide saddle starting in front of and reaching
below dorsal-fin origin and one saddle at poste-
rior part of dorsal-fin base reaching behind dorsal-
fin base. Two or three saddles on caudal pedun-
cle. Predorsal saddles reaching slightly below
lateral midline, saddles behind dorsal-fin base
reaching to ventral body. Some saddles, usually
those on predorsal flank, Y-shaped in few indi-
viduals. Saddles usually wider on back than on
flank and wider on lateral midline than below
and above lateral midline. Saddles always discon-
nected from each other, never fused to form a
lateral stripe. A very faint inner axial streak vis-
ible in preserved specimens. A dark brown or
black bar at posterior extremity of caudal pedun-
cle. In front of this bar, a whitish or yellowish
blotch on upper caudal peduncle. Cheeks and
ventral surface of head cream or pale yellow, head
above cheeks dark brown without spots or
blotches. Fins hyaline.
Distribution and habitat. Turcinoemacheilus saa-
dii is known from the Bashar River which flows
to the Karoun and from the Gamasiab River which
flows to Karkheh. At the type locality, the stream
Tang-e-Tizab (Fig. 16) is about 20 m wide, the
substrate consists of coarse gravel and boulders
and the water is fast-running.
Fig. 16. Stream Tang-e-Tizab, a tributary to Bashar River, Iran; type locality of Turcinoemacheilus saadii.

272
Etymology. The species is named for Abu
–
-Mu-
hammad Muslih al-Dı
–
n bin Abdalla
–
h Shı
–
ra
–
zı
–
,
Saadii Shirazi (Persian:
) better known by his pen-name as Sa’dı
–
(Persian: ) or, simply, Saadi, one of the major
Persian poets of the medieval period.
Remarks. The phylogenetic tree reconstruction
(Fig. 1) suggests that T. saadii is the sister species
of the pair T. kosswigi and T. minimus. It is sepa-
rated from T. kosswigi by 8.5 % and from sympat-
ric T. hafezi by 18.2 % K2P COI sequence diver-
gence, which is considered as a strong indicator
that these fishes represent different species (see
Herbert et al., 2003). Turcinoemacheilus saadii is
further distinguished from T. kosswigi and T. mini-
mus by colour pattern (7-9 distinct saddles vs.
lateral stripe made by a series of blotches con-
nected to dorsal blotches). In T. saadii, the caudal
fin is always deeply emarginated and the central
rays of the caudal fin are 60-80 % of the length
of the lower caudal-fin lobe. In T. kosswigi, the
caudal fin is only slightly emarginated in most
individuals and the central rays of the caudal fin
are 80-95 % of the length of the lower caudal-fin
lobe. However, in some individuals of T. koss-
wigi, the caudal fin is more deeply emarginate
and the ratio is down to 70-80 % and largely
overlapping with T. saadii.
Turcinoemacheilus saadii occurs in sympatry
with T. hafezi. It is distinguished from this species
by the more anterior position of the anus, which
is in front of the middle or in the middle between
the pelvic-fin origin and the anal-fin origin (dis-
tance from anus to anal-fin origin 0.4-0.5 times
in distance from pelvic-fin to anal-fin origins)
while it is behind the middle (0.2-0.4 times) in
T. hafezi. Turcinoemacheilus saadii is further distin-
guished by a free distal part of the axillary pelvic
lobe (vs. completely attached to body), a nar-
rower caudal peduncle (depth 2.4-3.2 times in its
length vs. 1.9-2.4), anterior and posterior nostrils
very closely together (vs. separated), tip of ante-
rior nostril reaching into posterior nostril when
folded down (vs. not) and differences in colour
patters (7-9 distinct saddles vs. lateral stripe
present, disconnected from dorsal blotches or
mottles colour pattern in T. hafezi).
Turcinoemacheilus saadii is distinguished from
T. himalaya by a completely scaleless body (vs.
small cycloid scales present on the posterior half
of the body).
Comparative material. Turcinoemacheilus hafezi: all
from Iran: FSJF 3222, 33, 24-46 mm SL; Yasouj prov.:
Beshar (Bashar) river at Doruhan, 30°51'07" N 51°20'
31" E. – FSJF 3002, 3, 32.4-45.8 mm SL; Sezar river, a
tributary of Dez river, 33°28'N 49°03'E. – ZFMK 48841,
holotype, 41.0 mm SL; ZFMK 48842-48848, paratypes,
7, 34.1-66.7 mm SL; FSJF 1649, 10, 34.4-54.7 mm SL;
Chaharmahal and Bakhtiari prov.: stream Shalamzar
10 km after Joneghan in the direction to Ardal, a tribu-
tary of Ab-Kohrang River, 32°05'22" N 50°39'58" E.
Material used in the molecular genetic analysis: FSJF
DNA-1985; Yasouj prov.: Bashar river at Doruhan,
30°51'07" N 51°20'31" E (GenBank accession numbers:
KJ179254, KJ179259). – ZM-CBSU T497, ZM-CBSU T539;
Fars prov.: stream Tang-e-Tizab, a tributary to Bashar
river which drains to the Karoun, 30°23'12" N 51°46'50" E
(GenBank accession numbers: KJ179252, KJ179264).
T. himalaya: paratypes, all from Nepal: KU 40557,
2, 38.0, 59.3 mm SL; Indrawati river at Melamchi town-
ship, 27°49'42" N 85°34'37" E. – KU 40568, 3, 39.0-
51.4 mm SL; Melamchi river, 3 miles upstream from
confluence with Indrawatir river, 27°57'22" N 85°32'
27" E. – KU 40280, 4, 44.9-49.7 mm SL; Gaundi river at
Gumti, 28°03'54" N 83°33'36" E. – KU 40281, 2, 36.4,
38.8 mm SL; Seti river at Khairenitar, 28°02'00" N 84°04'
00" E.
T. kosswigi: ZMH H1884, holotype, 53 mm SL; ZMH
H1885, 5 paratypes, 41-52 mm SL; Turkey: Hakkari
prov.: Kapozik Kadun. – FSJF 3345, 7, 41.3-50.8 mm SL;
Iraq: stream north-west of Saburawa, a tributary of
Tabin river, a tributary to Little Zab, 35°50'01" N 45°06'
16" E. – FSJF 3350, 7, 40.9-50.2 mm SL; Iraq: Kuna
Massi stream in Sevanja, a tributary to Little Zab,
35°47.35' N 45°24.18' E. – FSJF 3358, 1, 52.3 mm SL; Iraq:
stream Zalm at Khurmal, a tributary to Sirvan, 35°
18.38' N 45°58.26' E. – FSJF 3370, 4, 40.1-45.9 mm SL;
Iraq: stream Suraw near Suraw village, a tributary to
Little Zab, 35°45.76' N 45°59.09' E. – FSJF 3377, 3, 41.5-
46.1 mm SL; Iraq: Chami Rean river near Ziraran, a
tributary to Great Zab, 36°56.60' N 44°11.72' E. Material
used in the molecular genetic analysis: FSJF DNA-2214;
Iraq: stream Suraw near Suraw village, a tributary to
Little Zab, 35°45.76' N 45°59.09' E (GenBank accession
number: KJ179260). – FSJF DNA-2222; Iraq: stream
north-west of Saburawa, a tributary of Tabin river, a
tributary to Little Zab, 35°50'01" N 45°06'16" E (GenBank
accession number: KJ179255). – FSJF DNA-2226; Iraq:
Chami Rean river near Ziraran, a tributary to Great Zab,
36°56.60' N 44°11.72' E (GenBank accession number:
KJ179265). – FSJF DNA-2232; Iraq: Kuna Massi stream
in Sevanja, a tributary to Little Zab, 35°47.35' N 45°
24.18' E (GenBank accession number: KJ179262). – ZM-
CBSU T507, ZM-CBSU T509; Iran: Sirvan river, 35°06'
43" N 46°15'24" E (GenBank accession numbers: KJ179258,
KJ179245).
Paracobitis malapterura: material used in the mo-
lecular genetic analysis: FSJF DNA-1992; Iran: Albroz
prov.: Kordan river near Karaj, 35°57'11" N 50°50'15" E
(GenBank accession numbers: KJ179266, KJ179267).

Ichthyol. Explor. Freshwaters, Vol. 24, No. 3
273
Paraschistura bampurensis: Material used in the
molecular genetic analysis: FSJF DNA-2001; Iran: Sistan
and Baluchestan prov.: Karvander river at bridge north
of Karevander, 27°51'18" N 60°46'03" E (GenBank acces-
sion numbers: KJ179268, KJ179269).
Acknowledgments
We are pleased to thank Ralf Thiel (ZMH), Andrew
Bentley (KU) and Maurice Kottelat (CMK) for allowing
JF to examine material of Turcinoemacheilus under their
care, Rahman Patimar and Kiavash Golzarianpour (both
Gonbad) for providing JF with material of T. saadii,
P. malapterura and P. bampurensis, and Jörg Bohlen
(Libechov) for sharing unpublished observations on
T. minimus. We also thank Shiraz University for finan-
cial supports to first and second authors and Environ-
ment Department of Fars and Isfahan provinces for
their collaborations in fish collection in Iran. Support
also came from the project FREDIE (Freshwater Diver-
sity Identification for Europe, www.fredie.eu), funded
by the Joint Initiative for Research and Innovation
(PAKT) program of the Leibniz Association.
Literature cited
Bânârescu, P. & T. T. Nalbant. 1964. Süsswasserfische
der Türkei. 2. Teil Cobitidae. Mitteilungen des
Hamburger Zoologischen Museums und Institutes,
61: 159-201.
Breil, M. & J. Bohlen. 2001. First record of the loach fish
Turcinoemacheilus kosswigi in the basin of Euphrates
river, with first observations on habitat and behav-
iour. Zoology in the Middle East, 23: 71-76.
Conway, K. W., D. R. Edds, J. Shrestha & R. L. Mayden.
2011. A new species of gravel-dwelling loach (Os-
tariophysi: Nemacheilidae) from the Nepalese Hi-
malayan foothills. Journal of Fish Biology, 79:
1746-1759.
Edgar, R. C. 2004. MUSCLE: multiple sequence align-
ment with high accuracy and high throughput.
Nucleic acids research, 32: 1792-1797.
Freyhof, J., F. Erk’akan, C. Özeren & A. J. Perdices. 2011.
An overview of the western Palaearctic loach genus
Oxynoemacheilus (Teleostei: Nemacheilidae). Ich-
thyological Exploration of Freshwaters, 22: 301-
312.
Biomatters. 2013. Geneious Pro. Available: http://www.
geneious.com
Golzarianpour, K., A. Abdoli, B. Kiabi & J. Freyhof.
2009. First record of the miniature loach Turcino-
emacheilus kosswigi (Teleostei: Nemacheilidae) in the
Karoun drainage, Iran. Zoology of the Middle East,
47: 57-62.
Golzarianpour, K., A. Abdoli, R. Patimar & J. Freyhof.
2013. Turcinoemacheilus hafezi, a new loach from
Karoun River drainage, Iran (Teleostei: Nem-
acheilidae). Ichthyological Exploration of Freshwa-
ters, 24: 41-48.
Hebert, P. D. N., A., Cywinska, S. L., Ball & J. R. de
Waard. 2003. Biological identifications through
DNA barcodes. Proceedings Biological Sciences.
The Royal Society, 270: 313-321.
Ivanova, N. V., T. S. Zemlak, R. H. Hanner & P. D. N.
Hebert. 2007. Universal primer cocktails for fish
DNA barcoding. Molecular Ecology Notes 7: 544-
548.
Kottelat, M. & J. Freyhof. 2007. Handbook of European
freshwater fishes. Kottelat, Cornol and Freyhof,
Berlin, xiv + 646 pp.
Meier, R., K. Shiyang, G. Vaidya & P. K. L. Ng. 2006.
DNA barcoding and taxonomy in Diptera: a tale of
high intraspecific variability and low identification
success. Systematic Biology 55: 715-728.
Posada, D. & K. A. Crandall. 1998. MODELTEST: test-
ing the model of DNA substitution. Bioinformatics,
14: 817-818.
Saitou, N. & M. Nei. 1987. The Neighbor-Joining
Method – a new method for reconstructing phylo-
genetic trees. Molecular Biology and Evolution, 4:
406-425.
Srivathsan, A. & R. Meier. 2012. On the inappropriate
use of Kimura-2-parameter (K2P) divergences in
the DNA-barcoding literature. Cladistics, 28: 190-
194.
Swofford, D. L. 2002. PAUP*. Phylogenetic Analysis
Using Parsimony (*and other methods). Version 4.
Sinauer Associates, Sunderland.
Tamura, K., D. Peterson, N. Peterson, G. Stecher, M.
Nei & S. Kumar. 2011. MEGA5: Molecular Evolu-
tionary Genetics Analysis using Maximum Likeli-
hood, Evolutionary Distance, and Maximum Par-
simony Methods. Molecular Biology and Evolution,
28: 2731-2739.
Received 16 July 2013
Revised 11 February 2014
Accepted 12 February 2014