ArticlePDF Available

Misidentification of Saprochaete clavata as Magnusiomyces capitatus in clinical isolates: Utility of ITS sequencing, MALDI-TOF and Importance of reliable databases.

Journal of Clinical Microbiology

May 2014
52(6)

DOI:10.1128/JCM.00039-14

Source
PubMed

Authors:

Marie desnos-ollivier

Institut Pasteur

Dea Garcia-Hermoso

Institut Pasteur International Network

Show all 6 authorsHide

Saprochaete clavata and Magnusiomyces capitatus are human pathogens that are frequently mistaken for each other due to their similar phenotypes and erroneous or limited databases. Based on internal transcribed spacer (ITS) sequences, we propose species-specific carbon assimilation patterns and matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) fingerprints that enable the identification of S. clavata, M. capitatus, and Galactomyces candidus to the species level.

Examples of PCR fingerprints obtained by using M13 primer for clinical isolates of Saprochaete clavata (lanes 1, 3, 4, 5, and 7) and Magnusiomyces capitatus (lanes 2, 6, 8, and 9) and type strains of S. clavata (CBS 425.71), M. capitatus (CBS 162.80), and Galactomyces candidus (CBS 178.71).

…

Raw MALDI-TOF MS spectra for 19 clinical isolates and the type strains CBS 425.71 (Saprochaete clavata), CBS 178.71 (Galactomyces candidus), and CBS 162.80 (Magnusiomyces capitatus) after 24-h subculture on 2% malt dextrose agar plates plus gentamicin and chloramphenicol.

…

Figures - available from: Journal of Clinical Microbiology

This content is subject to copyright. Terms and conditions apply.

A preview of this full-text is provided by American Society for Microbiology.

Learn more

Content available from Journal of Clinical Microbiology

This content is subject to copyright. Terms and conditions apply.

Misidentiﬁcation of Saprochaete clavata as Magnusiomyces capitatus in

Clinical Isolates: Utility of Internal Transcribed Spacer Sequencing

and Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass

Spectrometry and Importance of Reliable Databases

Marie Desnos-Ollivier,

a,b

Catherine Blanc,

a,b

Dea Garcia-Hermoso,

a,b

Damien Hoinard,

a,b

Alexandre Alanio,

a,b,c,d

Françoise Dromer

a,b

Institut Pasteur, Unité de Mycologie Moléculaire, Centre National de Référence Mycoses Invasives et Antifongiques, Paris, France

; CNRS URA3012,

Laboratoire de

Parasitologie-Mycologie, Groupe Hospitalier Saint-Louis-Lariboisière-Fernand-Widal, Assistance Publique-Hôpitaux de Paris,

and Université Paris-Diderot, Sorbonne Paris-

Cité,

Paris, France

Saprochaete clavata and Magnusiomyces capitatus are human pathogens that are frequently mistaken for each other due to their

similar phenotypes and erroneous or limited databases. Based on internal transcribed spacer (ITS) sequences, we propose spe-

cies-speciﬁc carbon assimilation patterns and matrix-assisted laser desorption ionization–time of ﬂight mass spectrometry

(MALDI-TOF MS) ﬁngerprints that enable the identiﬁcation of S. clavata,M. capitatus, and Galactomyces candidus to the spe-

cies level.

Saprochaete clavata (de Hoog, Smith, and Guého) de Hoog and

Smith 2004 (synonym Geotrichum clavatum de Hoog, Smith,

and Guého 1986) is an ascomycetous fungus (1,2). Colonies are

white farinose and dry and consist of true hyphae that branch at

acute angles and disarticulate into arthroconidia. This species has

rarely been isolated from human samples. Its ecology, reservoir,

and importance in agriculture and food are unknown (3). This

species is closely related to the known human pathogen Magnusio-

myces capitatus (de Hoog, Smith, and Guého) de Hoog and Smith

2004 (previously known as Geotrichum capitatum)(

4). Magnusio-

myces capitatus is reported to have caused invasive infections, es-

pecially in patients with hematological malignancies (5,6), and it

has even been involved in several outbreaks, often associated with

contaminated dairy products (7–9). Initially, de Hoog et al. de-

scribed the new species G. clavatum to distinguish strains identi-

ﬁed as G. capitatum that show distinct growth on cellobiose, sali-

cin, and arbutin (2). However, commercially available strips lack

salicin and arbutin and are thus useless for obtaining an accurate

identiﬁcation. Furthermore, the databases that come with the au-

tomated platforms for microbial identiﬁcation based on sugar as-

similation patterns or mass spectrometry proﬁles lack this species

(10) or show low discrimination for M. capitatus (11,12).

From analysis of D1/D2 sequence divergence, Phaff et al. men-

tioned the apparent conspeciﬁcity of G. clavatum,Dipodascus

spicifer, and G. capitatum (13). In fact, the D1/D2 sequences of the

three species have 99% similarity. But, Kurtzman and Robnett

considered only G. clavatum and D. spicifer to be synonymous

(14). Based on internal transcribed spacer (ITS) sequence analysis,

it was demonstrated that G. clavatum differed from G. capitatum

(96% similarity) and that it belongs to the Saprochaete/Magnusio-

myces clade; therefore, G. clavatum was transferred to the ana-

morph genus Saprochaete (1). Despite the use of ITS region se-

quencing, the majority of clinical isolates of S. clavata are identiﬁed as

M. capitatus because nucleotide sequences of S. clavata available in

public databases, such as GenBank, are either misidentiﬁed or too

short (163 bp). In order to provide clues for species identiﬁcation

without using ITS sequencing, we analyzed phenotypic character-

istics of clinical isolates identiﬁed as Geotrichum spp. based on

proﬁles generated by routinely available techniques (sugar assim-

ilation pattern [ID32C; bioMérieux] or matrix-assisted laser de-

Received 8 January 2014 Returned for modiﬁcation 14 February 2014

Accepted 27 March 2014

Published ahead of print 2 April 2014

Editor: D. W. Warnock

Address correspondence to Françoise Dromer, dromer@pasteur.fr.

doi:10.1128/JCM.00039-14

FIG 1 Examples of PCR ﬁngerprints obtained by using M13 primer for clin-

ical isolates of Saprochaete clavata (lanes 1, 3, 4, 5, and 7) and Magnusiomyces

capitatus (lanes 2, 6, 8, and 9) and type strains of S. clavata (CBS 425.71), M.

capitatus (CBS 162.80), and Galactomyces candidus (CBS 178.71).

2196 jcm.asm.org Journal of Clinical Microbiology p. 2196 –2198 June 2014 Volume 52 Number 6

sorption ionization–time of ﬂight mass spectrometry [MALDI-

TOF MS]).

For the 101 clinical isolates received as Geotrichum species

since 2003 at the National Reference Center for Mycoses and An-

tifungals (NRCMA), purity was checked by using a chromogenic

medium (BBL CHROMagar; Becton, Dickinson, USA). The ure-

ase activity (urea-indole medium; bioMérieux, Marcy l’Etoile,

France) and carbon assimilation patterns (ID32C and 50CH;

bioMérieux) were determined. The D1/D2 and ITS1–5.8S-ITS2

regions of the ribosomal DNA were sequenced by using universal

primers (NL1/NL4 [15] and V9D/LS266 [16,17], respectively).

The sequences of the ITS1–5.8S-ITS2 regions were delimited by

the sequences of the primers ITS1 and ITS4 (TCCGTAGGTGAA

CCTGCGG and GCATATCAATAAGCGGAGGA, respectively),

and the sequences were compared with the nucleotide sequences

of the S. clavata CBS 425.71 type strain (GenBank accession num-

ber KF984489), the M. capitatus CBS 162.80 type strain (accession

number KF984490), and the Galactomyces candidus (teleomorph

of Geotrichum candidum) CBS 178.71 type strain (accession num-

ber KF984491). For each clinical isolate and type strain, a PCR

ﬁngerprinting technique was performed with the core sequence of

phage M13 (5=-GAGGGTGGCGGTTCT-3=) and OPE4 (5=-GTG

ACATGCC-3=) as a single primer (7,18). For 19 clinical isolates

(15 S. clavata,4M. capitatus) and the 3 type strains, MALDI-TOF

ﬁngerprints were obtained using mass spectrometry technology

on the Vitek MS automate (bioMérieux) after 24 h and after 48 h

of growth on malt extract agar plates with gentamicin and chlor-

amphenicol (Merck) and on Sabouraud agar slants with gentami-

cin and chloramphenicol (Bio-Rad), and they were analyzed using

the Vitek MS version 2.0 reference strain database.

Based on ITS region sequencing, 59/101 isolates were eventu-

ally identiﬁed as S. clavata,27asM. capitatus, and 15 as G. candi-

dus. The delimited sequences of ITS and D1/D2 regions between S.

clavata (464 bp) and M. capitatus (454 bp) have 96% and 99%

similarity, respectively. Random ampliﬁed polymorphic DNA

(RAPD) analysis suggests that species-speciﬁc ﬁngerprints may be

obtained (Fig. 1). This technique, however, cannot be envisioned

as a routine means for species identiﬁcation. Comparison of

ID32C proﬁles allowed for the differentiation of species-speciﬁc

carbon assimilation proﬁles (Table 1), with 10 codes speciﬁc for

M. capitatus,8forS. clavata, and 4 for G. candidus. Using the Vitek

MS and its corresponding database, the identiﬁcations were con-

ﬁrmed for the 4 clinical isolates and the type strain of M. capitatus,

but no identiﬁcations were obtained for the other 17 isolates in the

v2.0 database. However, when analyzing MALDI-TOF MS pro-

TABLE 1 ID32C proﬁles for the 101 Geotrichum sp. clinical isolates

identiﬁed by ITS region sequencing

Species (no. of isolates)

No. (%) of isolates with

the indicated proﬁle ID32C proﬁle

Magnusiomyces capitatus (27) 6 (22.2) 20000100010

6 (22.2) 32000100030

3 (11.1) 22000100010

3 (11.1) 22000100030

3 (11.1) 32000100010

2 (7.4) 30000100010

1 (3.7) 20000100020

1 (3.7) 22000100011

1 (3.7) 30400100030

1 (3.7) 32001100031

Saprochaete clavata (59) 23 (38.9) 30100100031

16 (27.1) 30100100011

9 (15.2) 32100100031

3 (5) 30000100030

3 (5) 30000100031

2 (3.4) 30000100011

2 (3.4) 30100100010

1 (1.6) 32100100011

Galactomyces candidus (15) 6 (40) 32003100130

6 (40) 32003100131

2 (13.3) 32003100031

1 (6.6) 32003100150

FIG 2 Raw MALDI-TOF MS spectra for 19 clinical isolates and the type strains CBS 425.71 (Saprochaete clavata), CBS 178.71 (Galactomyces candidus), and CBS

162.80 (Magnusiomyces capitatus) after 24-h subculture on 2% malt dextrose agar plates plus gentamicin and chloramphenicol.

Misidentiﬁcation of Geotrichum sp. Clinical Isolates

June 2014 Volume 52 Number 6 jcm.asm.org 2197

ﬁles of the 22 isolates, three groups corresponding to the three

species can be delineated based on speciﬁc peaks (Fig. 2).

These results underline the importance of using specialized

databases, such as that of the Centraalbureau voor Schimmel-

cultures (CBS) (see http://www.cbs.knaw.nl/collections/Biolo

MICSSequences.aspx?ﬁle⫽all), where the taxonomy is more re-

liable than that in public repositories, as pointed out by Nilsson

and colleagues (19). It also shows the importance of incrementing

databases according to the latest developments of fungal taxon-

omy.

Nucleotide sequence accession numbers. Newly determined

sequence data from this study have been deposited in GenBank

under accession numbers KF984489,KF984490, and KF984491.

ACKNOWLEDGMENTS

The technical help of the sequencing facility and speciﬁcally that of Laure

Diancourt, Anne-Sophie Delannoy, and Jean-Michel Thiberge (Genotyp-

ing of Pathogens and Public Health, Institut Pasteur) is gratefully ac-

knowledged. We thank members of the French Mycoses Study Group,

who provided the isolates used in the present study (in alphabetical order

of the cities), Nathalie Brieu and Evelyne Lagier (Aix-en-Provence), Jean-

Philippe Bouchara and Marc Pihet (Angers), Cécile Jensen (Avignon),

Frédéric Grenouillet (Besançon), Christian Chochillon (Hôpital Bichat,

Paris), Isabelle Accoceberry and Olivier Albert (Bordeaux), Julie Bon-

homme (Caen), Nathalie Fauchet (Créteil), Philippe Poirier and Monique

Cambon (Clermont-Ferrand), Pierre Cahen (Foch), André Paugam and

Marie-Thérèse Baixench (Hôpital Cochin, Paris), Dominique De Briel

(Colmar), Frédéric Dalle (Dijon), Bernadette Lebeau (Grenoble), Fran-

çoise Botterel (Hôpital Henri Mondor, Paris), Muriel Cornet (Hôpital de

l’Hôtel Dieu, Paris), Odile Eloy (Le Chesnay), Boualem Sendid (Lille),

Stéphane Ranque (Marseille), Nathalie Bourgeois and Philippe Rispail

(Montpellier), Malik Al Nakib (Montsouris, Paris), Marie Machouart

(Nancy), Florent Morio (Nantes), Marie-Elisabeth Bougnoux (Hôpital

Necker Enfants Malades, Paris), Martine Garri-Toussaint (Nice), Didier

Poisson (Orléans), Marie-Francoise David and Najiby Kassis-Chikhani

Liliana Mihaila (Villejuif), Charles Soler (Percy, Clamart), Anne Gaschet

and Philippe Geudet (Perpignan), Annick Datry and Sophie Brun (Hôpi-

tal de la Pitié-Salpêtrière, Paris), Christine Chaumeil (Quinze-Vingt,

Paris), Dominique Toubas (Reims), Jean-Pierre Gangneux (Rennes),

Stéphane Bonacorsi (Hôpital Robert Debré, Paris), Loïc Favennec and

Gilles Gargala (Rouen), Hélène Raberin (St Etienne), Stéphane Bretagne

(Hôpital Saint-Louis, Paris), Valérie Letscher-Bru (Strasbourg), and So-

phie Cassaing (Toulouse) and our European colleagues Konrad Mühle-

thaler, Stefan Zimmerli (Institute for Infectious Diseases, University of

Bern, Bern, Switzerland), Polona Zalar (Biology Department, Biotechni-

cal Faculty, University of Ljubljana, Ljubljana, Slovenia), and Ferran Sán-

chez-Reus and Merce Gurgui (Hospital de la Santa Creu i Sant Pau, Bar-

celona, Spain).

This work was supported by the Institut Pasteur and the Institut de

Veille Sanitaire.

REFERENCES

1. De Hoog GS, Smith MT. 2004. Ribosomal gene phylogeny and species

delimitation in Geotrichum and its teleomorphs. Stud. Mycol. 50:489 –

515.

2. De Hoog GS, Smith MT, Guého E. 1986. A revision of the genus Geotri-

chum and its teleomorphs. Stud. Mycol. 29:1–131.

3. de Hoog GS, Smith MT. 2011. Saprochaete Coker & Shanor ex D.T.S.

Wagner & Dawes (1970), p 1317–1330. In Kurtzman CP, Fell JW, Boek-

hout T (ed), The yeasts: a taxonomic study. Elsevier, Amsterdam, the

Netherlands.

4. de Hoog GS, Smith MT. 2011. Magnusiomyces Zender (1977), p 565–574.

In Kurtzman CP, Fell JW, Boekhout T (ed), The yeasts: a taxonomic study.

Elsevier, Amsterdam, the Netherlands.

5. Garcia-Ruiz JC, Lopez-Soria L, Olazabal I, Amutio E, Arrieta-Aguirre I,

Velasco-Benito V, Ponton J, Moragues MD. 2013. Invasive infections

caused by Saprochaete capitata in patients with haematological malignan-

cies: report of ﬁve cases and review of the antifungal therapy. Rev. Ibe-

roam. Micol. 30:248 –255. http://dx.doi.org/10.1016/j.riam.2013.02.004.

6. Girmenia C, Pagano L, Martino B, D’Antonio D, Fanci R, Specchia G,

Melillo L, Buelli M, Pizzarelli G, Venditti M, Martino P. 2005. Invasive

infections caused by Trichosporon species and Geotrichum capitatum in

patients with hematological malignancies: a retrospective multicenter

study from Italy and review of the literature. J. Clin. Microbiol. 43:1818 –

1828. http://dx.doi.org/10.1128/JCM.43.4.1818-1828.2005.

7. Ersoz G, Otag F, Erturan Z, Aslan G, Kaya A, Emekdas G, Sugita T.

2004. An outbreak of Dipodascus capitatus infection in the ICU: three case

reports and review of the literature. Jpn. J. Infect. Dis. 57:248 –252.

8. Gurgui M, Sanchez F, March F, Lopez-Contreras J, Martino R, Cotura

A, Galvez ML, Roig C, Coll P. 2011. Nosocomial outbreak of Blastoschi-

zomyces capitatus associated with contaminated milk in a haematological

unit. J. Hosp. Infect. 78:274 –278. http://dx.doi.org/10.1016/j.jhin.2011

.01.027.

9. Martino P, Venditti M, Micozzi A, Morace G, Polonelli L, Mantovani

MP, Petti MC, Burgio VL, Santini C, Serra P, Mandelli F. 1990.

Blastoschizomyces capitatus: an emerging cause of invasive fungal disease

in leukemia patients. Rev. Infect. Dis. 12:570 –582. http://dx.doi.org/10

.1093/clinids/12.4.570.

10. Bader O, Weig M, Taverne-Ghadwal L, Lugert R, Gross U, Kuhns M.

2011. Improved clinical laboratory identiﬁcation of human pathogenic

yeasts by matrix-assisted laser desorption ionization time-of-ﬂight mass

spectrometry. Clin. Microbiol. Infect. 17:1359 –1365. http://dx.doi.org/10

.1111/j.1469-0691.2010.03398.x.

11. Lohmann C, Sabou M, Moussaoui W, Prevost G, Delarbre JM, Candolﬁ

E, Gravet A, Letscher-Bru V. 2013. Comparison between the Biﬂex

III-Biotyper and the Axima-SARAMIS systems for yeast identiﬁcation by

matrix-assisted laser desorption ionization–time of ﬂight mass spectrom-

etry. J. Clin. Microbiol. 51:1231–1236. http://dx.doi.org/10.1128/JCM

.03268-12.

12. Giacchino M, Chiapello N, Bezzio S, Fagioli F, Saracco P, Alfarano A,

Martini V, Cimino G, Martino P, Girmenia C. 2006. Aspergillus galac-

tomannan enzyme-linked immunosorbent assay cross-reactivity caused

by invasive Geotrichum capitatum. J. Clin. Microbiol. 44:3432–3434. http:

//dx.doi.org/10.1128/JCM.00856-06.

13. Phaff HJ, Blue J, Hagler AN, Kurtzman CP. 1997. Dipodascus starmeri

sp. nov., a new species of yeast occurring in cactus necroses. Int. J. Syst.

Bacteriol. 47:307–312. http://dx.doi.org/10.1099/00207713-47-2-307.

14. Kurtzman CP, Robnett CJ. 1998. Identiﬁcation and phylogeny of asco-

mycetous yeasts from analysis of nuclear large subunit (26S) ribosomal

DNA partial sequences. Antonie Van Leeuwenhoek 73:331–371. http://dx

.doi.org/10.1023/A:1001761008817.

15. O’Donnell K. 1993. Fusarium and its near relatives, p 225–233. In Reyn-

olds DR, Taylor JW (ed), The fungal holomorph: mitotic, meiotic and

pleomorphic speciation in fungal systematics. CAB, Wallingford, United

Kingdom.

16. de Hoog GS, Gerrits van den Ende AH. 1998. Molecular diagnostics of

clinical strains of ﬁlamentous Basidiomycetes. Mycoses 41:183–189. http:

//dx.doi.org/10.1111/j.1439-0507.1998.tb00321.x.

17. Masclaux F, Gueho E, de Hoog GS, Christen R. 1995. Phylogenetic

relationships of human-pathogenic Cladosporium (Xylohypha) species in-

ferred from partial LS rRNA sequences. J. Med. Vet. Mycol. 33:327–338.

http://dx.doi.org/10.1080/02681219580000651.

18. Gadea I, Cuenca-Estrella M, Prieto E, Diaz-Guerra TM, Garcia-Cia JI,

Mellado E, Tomas JF, Rodriguez-Tudela JL. 2004. Genotyping and

antifungal susceptibility proﬁle of Dipodascus capitatus isolates causing

disseminated infection in seven hematological patients of a tertiary hos-

pital. J. Clin. Microbiol. 42:1832–1836. http://dx.doi.org/10.1128/JCM.42

.4.1832-1836.2004.

19. Nilsson RH, Ryberg M, Kristiansson E, Abarenkov K, Larsson KH,

Köljalg U. 2006. Taxonomic reliability of DNA sequences in public se-

quence databases: a fungal perspective. PLoS One 1:e59. http://dx.doi.org

/10.1371/journal.pone.0000059.

Desnos-Ollivier et al.

2198 jcm.asm.org Journal of Clinical Microbiology

Content uploaded by Marie desnos-ollivier

Content may be subject to copyright.

Magnusiomyces capitatus strain CBS 162.80 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Nucleotide Sequence

December 2013

M. Ollivier · D. Hermoso · C. Blanc · D. Hoinard

Saprochaete clavata strain CBS 425.71 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Nucleotide Sequence

December 2013

M. Ollivier · D. Hermoso · C. Blanc · D. Hoinard

Galactomyces candidum strain CBS 178.71 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Nucleotide Sequence

December 2013

M. Ollivier · D. Hermoso · C. Blanc · D. Hoinard

Phenotypic and molecular genetics study of Geotrichum candidumLink (1809) and Geotrichum silvicola Pimenta (2005) cultivated on mitis salivarius agar

Article

Full-text available

Jun 2023
MOL BIOL REP

Background Geotrichum is a genus of fungi found in different habitats throughout the world. Although Geotrichum and its related species have been extensively reclassified and taxonomically revised, it is still the target for many researches. Methods and results In this study, phenotypic and molecular genetics comparisons were performed between Geotrichum candidum and Geotrichum silvicola. Mitis Salivarius Agar was used as the growing medium for the phenotypic comparison study, which was carried out at two temperatures (20–25 and 37 °C). For genotypic comparison, we compared the 18 S, ITS, and 28 S sequences of universal DNA barcode regions of both species. Important findings on the new culture media for fungal isolation were revealed by the results. The phenotypic variation between the two species’ colonies, including their shapes, sizes, textures and growth rates, were strikingly different. DNA sequences of both species showed that pairwise identities of the species were 99.9% for 18 S, 100% for ITS and 99.6% for 28 S regions. Conclusions Contrary to what is commonly seen, the results showed that 18 S, ITS and 28 S failed to discriminate the species. The first investigation into the performance of Mitis Salivarius Agar as a fungus culture medium is reported in this work, and proved its efficiency. Additionally, this is the first study to compare G. candidum with G. silvicola by means of both phenotypic and genotypic analysis.

Bloodstream Infections Caused by Magnusiomyces capitatus and Magnusiomyces clavatus: Epidemiological, Clinical, and Microbiological Features of Two Emerging Yeast Species

Article

Full-text available

Feb 2022
ANTIMICROB AGENTS CH

Background: Magnusiomyces clavatus and Magnusiomyces capitatus are emerging yeasts with intrinsic resistance to many commonly used antifungal agents. Identification is difficult, and determination of susceptibility patterns with commercial and reference methods is equally challenging. For this reason, few data on invasive infections by Magnusiomyces spp. are available. Objectives: To determine the epidemiology and susceptibility of Magnusiomyces isolates from bloodstream infections (BSI) isolated in Germany and Austria from 2001-2020. Methods: In seven institutions a total of 34 Magnusiomyces BSI were identified. Identification was done by ITS sequencing and MALDI-TOF MS. Antifungal susceptibility was determined by EUCAST broth microdilution and gradient tests. Results: Of the 34 isolates, M. clavatus was more common (N=24) compared to M. capitatus (N=10). BSI by Magnusiomyces spp. were more common in men (62%) and mostly occurred in patients with haemato-oncological malignancies (79%). The highest in vitro antifungal activity against M. clavatus / M. capitatus was observed for voriconazole (MIC 50 0.03/0.125 mg/L), followed by posaconazole (MIC 50 0.125/0.25 mg/L). M. clavatus isolates showed overall lower MICs compared to M. capitatus . With the exception of amphotericin B, low essential agreement between gradient test and microdilution was recorded for all antifungals (0-70%). Both species showed distinct morphologic traits on ChromAgar Orientation and Columbia blood agar, which can be used for differentiation if no MALDI-TOF or molecular identification is available. Conclusion: Most BSI were caused by M. clavatus. The lowest MICs were recorded for voriconazole. Gradient tests demonstrated unacceptably low agreement and should preferably not be used for susceptibility testing of Magnusiomyces spp.

Invasive Fungal Infection Caused by Magnusiomyces capitatus in an Immunocompromised Pediatric Patient with Acute Lymphoblastic Leukemia in Mexico City: A Case Report

Article

Full-text available

Aug 2022
J. Fungi

Magnusiomyces capitatus (also denominated “Geotrichum capitatum” and “the teleomorph stage of Saprochaete capitata”) mainly affects immunocompromised patients with hematological malignancies in rare cases of invasive fungal infections (IFIs). Few cases have been reported for pediatric patients with acute lymphoblastic leukemia (ALL), in part because conventional diagnostic methods do not consistently detect M. capitatus in infections. The current contribution describes a systemic infection in a 15-year-old female diagnosed with ALL. She arrived at the Children’s Hospital of Mexico City with a fever and neutropenia and developed symptoms of septic shock 4 days later. M. capitatus ENCB-HI-834, the causal agent, was isolated from the patient’s blood, urine, bile, and peritoneal fluid samples. It was identified with matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) and a phylogenetic reconstruction using internal transcribed spacer (ITS) and 28S ribosomal sequences. The phylogenetic sequence of M. capitatus ENCB-HI-834 clustered with other M. capitatus-type strains with a 100% identity. In vitro antifungal testing, conducted with the Sensititre YeastOne susceptibility system, found the following minimum inhibitory concentration (MIC) values (μg/mL): posaconazole 0.25, amphotericin B 1.0, fluconazole > 8.0, itraconazole 0.25, ketoconazole 0.5, 5-flucytosine ≤ 0.06, voriconazole 0.25, and caspofungin > 16.0. No clinical breakpoints have been defined for M. capitatus. This is the first clinical case reported in Mexico of an IFI caused by M. capitatus in a pediatric patient with ALL. It emphasizes the importance of close monitoring for a timely and accurate diagnosis of neutropenia-related IFIs to determine the proper treatment with antibiotics, antifungals, and chemotherapy for instance including children with ALL.

Saprochete capitata: Emerging Infections from Uncommon Microorganisms in Hematological Diseases

Article

Full-text available

Mar 2022

Infections occurring in immunocompromised patients after intensive chemotherapy are often difficult to eradicate and are capable of even being fatal. New emergent and dangerous drug-resistant micro-organisms are likely to appear in these specific scenarios. Clinical features mainly include progressive pneumonia, bacteriemia/fungemia, or extrapulmonary dissemination among infections. The treatment of these microorganisms is still an open challenge since there is a lack of clear treatment guidelines. Indeed, infections from these microorganisms can lead to a rapidly fatal clinical course in immunocompromised patients, especially those who have acute leukemia. We describe the case of a young patient with acute myeloid leukemia who contracted an infection from Saprochaete capitata during post-chemotherapy aplasia.

A case of Magnusiomyces capitatus isolated during monitoring in an Antimicrobial Diagnostic Stewardship context.

Article

Apr 2024

Magnusiomyces capitatus (M. capitatus) is an emerging opportunistic yeast in the Mediterranean region typically isolated from immunocompromised patients, usually affected by blood malignancies. We reported a rare case of M. capitatus infection, isolated from a drainage fluid in a patient affected by lung cancer recovered in the University Hospital of Campania “Luigi Vanvitelli”, Naples, Italy. The isolate was identified by phenotypic methods, i.e., Gram and Lactophenol cotton blue (LCB) staining, and matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) analysis. We identified M. capitatus on the third day from Sabouraud Dextrose Agar supplemented with chloramphenicol and gentamicin. Antifungal susceptibility test revealed that 5-fluorocytosine was the most active drug against M. capitatus, followed by itraconazole and voriconazole, micafungin, amphotericin B and fluconazole, posaconazole, anidulafungin, and caspofungin. Our data showed the importance of an early cultural and fast microbiology diagnosis based on the characteristic morphologic features observed in Gram-stained smears of blood culture positive bottles, and the validation via MALDI-TOF MS. This dual approach has significant impact in the clinical management of infectious diseases and antibiotic stewardship, by integrating sample processing, fluid handling, and detection for rapid bacterial diagnosis.

Saprochaete/Magnusiomyces: identification, virulence factors, and antifungal susceptibility of a challenging rare yeast

Article

Full-text available

Jan 2024

Saprochaete/Magnusiomyces is among rare yeasts which might emerge as causes of breakthrough infections and nosocomial outbreaks. Identification to the species level might be a challenge in clinical laboratories. Data on virulence factors are scarce and antifungal susceptibility testing methodology is not definite. The aim of this study was to confirm species identification of clinical Saprochaete/Magnusiomyces isolates, find out their virulence factors, and obtain antifungal minimum inhibitory concentrations with two reference methods. Of the 57 isolates included, 54 were Saprochaete capitata and four were Saprochaete clavata as identified by ID32C, MALDI-TOF MS, and sequencing. When tested using phenotypic methods, all isolates were negative for coagulase, hemolysis, acid proteinase, and phospholipase, 56.1% were positive for esterase, and 19.3% had intermediate surface hydrophobicity. All isolates formed biofilms, with 40.4% of the isolates producing more biomass than biofilm-positive reference strain Candida albicans MYA-274. Antifungal susceptibility testing needed an adjusted spectrophotometric inoculum than recommended in reference methods for Candida/Cryptococcus. In conclusion, Saprochaete/Magnusiomyces species could be identified using methods available in the clinical laboratories. Despite the disadvantages of the phenotypic methods, esterase positivity was observed for the first time. A high biomass production was observed in biofilms. The need for standardization of antifungal susceptibility testing was brought to attention.

Disseminated fungal disease caused by Magnusiomyces clavatus in a pediatric cancer patient: Case report and review of the literature

Article

Mar 2023

Clinical features and prognostic factors of Magnusiomyces (Saprochaete) infections in haematology. A multicentre study of SEIFEM/Fungiscope

Article

Sep 2022

Background: Our multicenter study aims to identify baseline factors and provide guidance for therapeutic decisions regarding Magnusiomyces-associated infections, an emerging threat in patients with hematological malignancies. Methods: HM patients with proven M. capitatus or M. clavatus (formerly Saprochaete capitata and Saprochaete clavata) infection diagnosed between January 2010 and December 2020 were recorded from the SEIFEM (Sorveglianza Epidemiologica Infezioni nelle Emopatie) group and FungiScope (Global Emerging Fungal Infection Registry). Cases of Magnusiomyces fungemia were compared with candidemia. Results: Among 90 Magnusiomycescases (60 [66%] M. capitatus and 30 (34%) M. clavatus), median age was 50 years (range 2-78), 46 patients (51%) were female and 67 (74%) had acute leukemia. Thirty-six (40%) of Magnusiomyces-associated infections occurred during antifungal prophylaxis, mainly with posaconazole (n=13, 36%) and echinocandins (n=12, 34%). Instead, the candidemia rarely occurred during prophylaxis (p<0.0001). First-line antifungal therapy with azoles, alone or in combination, was associated with improved response compared to other antifungals (p=0.001). Overall day-30 mortality rate was 43%. Factors associated with higher mortality rates were septic shock (HR 2.696, 95%CI 1.396-5.204, p=.003), corticosteroid treatment longer than 14 days (HR 2.245, 95%CI 1.151-4.376, p=.018), and lack of neutrophil recovery (HR 3.997, 95%CI 2.102-7.601, p<.001). The latter was independently associated with poor outcome (HR 2.495, 95%CI 1.192-5.222, p=.015). Conclusions: Magnusiomyces-associated infections are often breakthrough infections. Effective treatment regimens of these infections remain to be determined, but neutrophil recovery appears to play an important role in the favorable outcome.

Magnusiomyces siamensis sp. nov., a yeast-like fungus isolated from food waste

Article

Jun 2022

Three yeast strains, DMKU-GTSP8-6, DMKU-GTSP8-14 T and DMKU-JED8-73, were isolated from food waste in Thailand. Based on the phenotypic characteristics and sequence analysis of the D1/D2 domain of the large subunit (LSU) rRNA gene and the internal transcribed spacer (ITS) region, it was revealed that the three strains clustered with the Magnusiomyces / Saprochaete clade. These strains were distinguished from the closely related species Saprochaete quercus CBS 750.85, Magnusiomyces ovetensis CBS 192.55 T , Magnusiomyces starmeri CBS 780.96 T , Saprochaete chiloensis CBS 8187 T and Magnusiomyces ingens CBS 517.90 T by 11.4, 13.1, 11.9, 11.2 and 12.6 % sequence divergence in the D1/D2 domain and by 34.6, 34.5, 33.6, 33.2 and 34.9 % sequence divergence in the ITS region, respectively. The new species, which does not produce ascospores, is described as Magnusiomyces siamensis . The holotype of Magnusiomyces siamensis is TBRC 15056 T , and the isotypes are DMKU-GTSP8-14 T and PYCC 9023 T .

Management of Invasive Infections Due to a Rare Arthroconidial Yeast, Saprochaete capitata, in Two Patients with Acute Hematological Malignancies

Article

Full-text available

Nov 2021

Saprochaete capitata is an arthroconidial yeast, found principally in the environment, even if it belongs also to the normal microbial flora that colonize human subjects. This yeast is increasingly associated with invasive infections in hematological patients, in particular in those affected by acute leukemia. An important risk factor that predisposes to this infection is the profound neutropenia present in such immunocompromised patients. Saprochaete spp. were found resistant to both echinocandins and fluconazole so the treatment is often difficult. Here, we report two cases of sepsis in two patients with acute leukemia. All of them had fatal events, due to the worsening of their clinical condition. An early diagnosis and appropriate management of these pathogens is important in consideration of the poor prognosis associated to these fungal invasive infections.

Comparison between the Biflex III-Biotyper and the Axima-SARAMIS Systems for Yeast Identification by Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry

Article

Full-text available

Mar 2013
J CLIN MICROBIOL

Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF) is emerging in laboratories as a new diagnostic tool for microorganism identification. We prospectively compared the performances of the Biflex III-Biotyper (Bruker Daltonics) and of the Axima (Shimadzu)-SARAMIS (Anagnostec) systems for the identification of 312 yeasts isolated from clinical specimens (249 Candida spp. including 19 C. albicans and 230 non-albicans species, 63 isolates belonging to different species of the genera Saccharomyces (20), Rhodotorula (8), Cryptococcus (8) Trichosporon (7), Pichia (7), Geotrichum (12) and 1 Sporopachydermia cereana). Species were identified by using routine conventional phenotypical methods and ITS sequencing in case of discrepancy. We used expanded thresholds for species identification (log score ≥ 1.7 with 3 identical consecutive propositions and no discrepancy between the duplicates for the Bruker Daltonics system and similitude ≥ 40% with 5 successive identical propositions and no discrepancy between the duplicates for the Shimadzu system). Of the 312 isolates, 272 (87.2%) and 258 (82.7%) were successfully identified on Bruker Daltonics and Shimadzu systems, respectively. All isolates were successfully identified within the most frequent and clinically-relevant Candida species on the two systems. Non valid results corresponded mainly to species not or poorly represented in the databases. A major misidentification was observed for 2 isolates (0.6%) on Bruker Daltonics and 4 isolates (1.3 %) on the Shimadzu system. In conclusion, the performances of the Bruker Daltonics and the Shimazu systems for yeast identification were good and comparable under clinical routine conditions, despite their differences in sample preparation, database content and spectra analysis.

Fusarium and its near relatives

Chapter

Full-text available

Jan 1993

K. O'Donnell

A revision of the genus Geotrichum and teleomorphs

Article

Jan 1986

Saprochaete Coker & Shanor ex D.T.S. Wagner & Dawes (1970)

Chapter

Dec 2011

This chapter studies the genus Saprochaete. In the asexual reproduction it is seen that thallus growth is initially mostly pseudohyphal with inflated cells. Hyphae are branched at acute angles with acuminate apices and disarticulate into arthroconidia. Additional sympodial and annellidic blastoconidiogenesis may be present. Chlamydospores are mostly absent. Septa have micropores. In sexual reproduction it is found that Magnusiomyces represents the teleomorph state of Saprochaete. The chapter also discusses physiology/biochemistry and phylogenetic placement of the genus in which assimilation of D-xylose is mostly absent, nitrate is not assimilated, urease activity is absent, and extracellular starch is not produced. The diazonium blue B reaction is negative and small subunit rRNA genes have deletions in domains V2, V3, and V8. The type species taken is Saprochaete saccharophila. Several Saprochaete species produce remarkably large, somewhat alga-like thalli, which are strictly hyphal and do not produce budding cells. Most species have only rarely been isolated, and thus it is difficult to establish any ecological trends in each species.

Magnusiomyces Zender (1977)

Chapter

Dec 2011

This chapter studies the genus Magnusiomyces. In the determination of the asexual reproduction, it is seen that colonies are white, farinose or hairy, usually dry, and consist of true hyphae that branch at acute angles with acuminate apices and disarticulate into arthroconidia. Additional sympodial and annellidic conidiogenesis may be present. Septa have micropores. In sexual reproduction it is found that gametangia form on opposite sides of hyphal septa, become broadly ellipsoidal, soon fuse entirely, and are transformed to an ascus. Asci are hyaline, subspherical to broadly ellipsoidal, and contain four ascospores. Ascospores are ellipsoidal to broadly ellipsoidal, hyaline, and have smooth walls surrounded by regular slime sheaths. The chapter also discusses physiology/biochemistry and phylogenetic placement of the genus. The type species taken is Magnusiomyces magnusii. The key characters of species assigned to the genus Magnusiomyces are presented. In the systematic discussion of the species, anamorph, synonyms, growth on 4% malt extract/0.5% yeast extract agar, growth radius on glucose-peptone-yeast extract agar, formation of ascospores, gene sequence accession numbers, type strain, cell carbohydrates, origin of the strains studied, complementary mating types, and systematics are determined.

Ribosomal gene phylogeny and species delimitation in Geotrichum and its teleomorph

Article

Jan 2004

A taxonomic revision is presented of all filamentous Hemiascomycetes that reproduce with predominantly arthric conidiogenesis. On the basis of SSU rDNA data, two widely divergent groups (1 and 2) are known to exist. Both are distantly related to the Hemiascomycetes, and show remarkable diversity in ITS rDNA, leading to the supposition that phylogenetically ancient fungi are concerned. The teleomorph / anamorph genera occurring in Groups 1 vs. 2 are classified in (1) Galactomyces and Dipodascus with Geotrichum anamorphs, vs. (2) Magnusiomyces with Saprochaete anamorphs. Taxonomy at the species level is based on ITS rDNA sequences and nDNA/DNA reassociation data. In total, 32 taxa are recognized. The phenetic data set applied is nutritional physiology. A key to the species is provided.

Invasive infections caused by Saprochaete capitata in patients with haematological malignancies: Report of five cases and review of the antifungal therapy

Article

Apr 2013

Background: Saprochaete capitata (formerly known as Geotrichum capitatum and Blastoschizomyces capitatus) is a ubiquitous fungus found in soil, water, air, plants and dairy products. It colonizes the skin, and bronchial and intestinal tract of healthy people producing serious opportunistic infections in patients with haematological malignancies, especially in those with acute leukaemia. Since 1960s its presence is being increasingly recognized in this group of patients. The clinical spectrum of S. capitata disseminated infections is very similar to that produced by Candida, being easily misinterpreted. The associated high mortality and low susceptibility to fluconazole and echinocandins of S. capitata require the acknowledgement of this emergent infection so that it can be properly treated. Case report: We report 5 new cases of S. capitata disseminated infection in patients with advanced haematological malignancies observed in the haematology unit between the years 2004 and 2010, and review the state-of-the-art for diagnosis and treatment of this infection. Conclusions: Based on our experience, the prophylactic use of or the empirical antifungal treatment with fluconazole and/or echinocandins would not be adequate for oncohaematological patients in those hospitals where S. capitata infection may be highly prevalent.

Nosocomial outbreak of Blastoschizomyces capitatus associated with contaminated milk in a haematological unit

Article

Jun 2011

In July 2002, Blastoschizomyces capitatus was isolated from four neutropenic patients in a haematology unit. Two patients died due to disseminated infection while the other two had oropharyngeal colonisation. Nosocomial acquisition of the fungus was suspected and epidemiological and environmental studies were undertaken. To determine the potential source for the acquisition of the fungus, epidemiological relationships between the patients were investigated. We performed surveillance cultures on all patients and took environmental cultures of air, inanimate surfaces, food samples, blood products and chemotherapy drugs. No direct contact transmission between patients was found and B. capitatus was isolated only in vacuum flasks used for breakfast milk distribution. All isolates were compared by four independent molecular typing methods: pulsed-field gel electrophoresis, genomic DNA restriction endonuclease analysis, randomly amplified polymorphic DNA, and polymerase chain reaction fingerprinting using a single primer specific for one minisatellite or two microsatellite DNAs. Milk vacuum flasks and clinical strains were genetically indistinguishable by all typing techniques. Milk vacuum flasks were withdrawn from all hospital units and no further B. capitatus infection was detected. Our findings suggest that clonal dissemination of a single strain of B. capitatus from vacuum flasks used for milk distribution was responsible for this nosocomial outbreak in the haematological unit.

The Yeasts. A taxonomic Study

Article

May 1971

Improved clinical laboratory identification of human pathogenic yeasts by matrix-assisted laser desorption ionization time-of-flight mass spectrometry

Article

Oct 2010
CLIN MICROBIOL INFEC

Clin Microbiol Infect 2011; 17: 1359–1365 The key to therapeutic success with yeast infections is an early onset of antifungal treatment with an appropriate drug regimen. To do this, yeast species identification is necessary, but conventional biochemical and morphological approaches are time-consuming. The recent arrival of biophysical methods, such as matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS), in routine diagnostic laboratories holds the promise of significantly speeding up this process. In this study, two commercially available MALDI-TOF MS species identification systems were evaluated for application in clinical diagnostics, using a geographically diverse collection of 1192 clinical yeast and yeast-like isolates. The results were compared with those of the classical differentiation scheme based on microscopic and biochemical characteristics. For 95.1% of the isolates, all three procedures consistently gave the correct species identification, but the rate of misclassification was greatly reduced in both MALDI-TOF MS systems. Furthermore, several closely related species (e.g. Candida orthopsilosis/metapsilosis/parapsilosis or Candida glabrata/bracarensis) could be resolved by both MALDI-TOF MS systems, but not by the biochemical approach. A significant advantage of MALDI-TOF MS over biochemistry in the recognition of isolates novel to the system was observed. Although both MALDI-TOF MS systems employed different approaches in the database structure and showed different susceptibilities to errors in database entries, these were negligible in terms of clinical usefulness. The time-saving benefit of MALDI-TOF MS over biochemical identification will substantially improve fungal diagnostics and patient treatment.