ArticlePDF Available

A molecular phylogeny reveals paraphyly of the large genus Eulophia (Orchidaceae): A case for the reinstatement of Orthochilus</I

February 2014
Taxon 63(1):9-23

February 2014
63(1):9-23

DOI:10.12705/631.6

Authors:

Craig Peter

Rhodes University

Benny Bytebier

University of KwaZulu-Natal

Phylogenetic relationships were inferred for the African-centred orchid subtribe Eulophiinae, which includes the large genus Eulophia and three closely related genera, Oeceoclades, Pteroglossaspis and Acrolophia. We sequenced one nuclear (ITS) and four chloroplast (rbcL, trnK-matK, rpl32-trnL, trnQ-5′ rps16) markers for 86 samples, representing 58 species (62 taxa) and one outgroup. The combined sequence matrix had 6525 characters and was analysed using parsimony and Bayesian criteria. Our results show that Acrolophia and Oeceoclades are monophyletic but are nested in Eulophia as currently circumscribed, thus rendering it paraphyletic. We argue for retaining Acrolophia and Oeceoclades, and splitting Eulophia into two genera on the basis of evidence that each of these four clades is genetically and morphologically distinct. We propose to reinstate the genus name Orthochilus for one of the Eulophia clades and transfer 35 taxa, including those assigned to Pteroglossaspis, to Orthochilus. Thirty-two of these are new combinations.

Fig. . Bayesian consensus tree inferred from 6525 bp including one nuclear locus (nrITS) and four chloroplast loci (rbcL, trnK-matK, rpl32trnL, trnQ5′ rps16). This tree was obtained after running two independent MCMC runs over 5 million generations and sampling across the GTR model space. Posterior probabilities are shown above branches. Bootstrap values from a parsimony analysis are shown below branches. Arrows indicate nodes that collapse in the parsimony strict consensus tree. Asterisks and diamond indicate species that have in the past been assigned to Lissochilus and Pteroglossaspis respectively.

…

Figures - uploaded by Craig Peter

Content may be subject to copyright.

Content uploaded by Craig Peter

Content may be subject to copyright.

Martos & al. • Phylogeny of Eulophiinae orchids

TAX ON

63 (1) • February 2014: 9–23

9Version of Record (identical to print version).

Received: 10 Jul 2013 | returned for revision: 4 Oct 2013 | revision received: 11 Nov 2013 | accepted: 11 Nov 2013 | not published online ahead of

inclusion in print and online issues || © International Association for Plant Taxonomy (

IAPT

) 2014

INTRODUCTION

Eulophia R.Br. ex Lindl. is the largest genus in the orchid

subtribe Eulophiinae (subfamily

Epidendroideae

; tribe

Cym-

bidieae; Pridgeon & al., 2009)

. Eulophiinae orchids are mostly

found in the palaeotropics, although six species extend into

the neotropics, and their centre of diversity is undoubtedly

Africa

(Pridgeon & al., 2009)

. Two hundred species of Eulo-

phia are currently accepted of which 156 are distributed over

sub-Saharan Africa and the Western Indian Ocean Islands

(WCSP, 2013). This terrestrial genus shows an extraordinary

morphological diversity and occupies a surprisingly wide

variety of habitats, from semi-arid regions and coastal dunes to

swamps, and from grasslands to tropical forests, but is most di-

verse in the Brachystegia (miombo) woodlands of south-central

Africa (Williamson, 1977; La Croix & Cribb, 1998). This habi-

tat diversity is reflected in their phenotypic diversity, e.g., their

perennating organs (fleshy rhizomes, tubers or pseudobulbs

;

Pridgeon & al., 2009)

, their ploidy levels (Poggio & al., 1986),

their

nutritional strategies

from

autotrophic

fully

myco-

heterotrophic species (Ogura-Tsujita & Yukawa, 2008)

, their

diverse breeding systems

from autonomous self-fertilization to

obligate cross-pollination (Peter & Johnson, 2006, 2009a, b, c)

and perhaps principally through specialised pollination sys-

tems by a diverse suite of bee and beetle pollinators (Peter

& Johnson, 2013).

Eulophia was established by Lindley (1823) based on

E. guineensis Lindl. The name Eulophus was first suggested by

Brown (1821) in a paper in which he described an allied genus,

i.e., Lissochilus R.Br., but was later changed to Eulophia upon

the suggestion of Brown, when Lindley formally described it.

Although there has been some controversy over the issue (see

Cribb, 1989: 422), all modern authors now consider Eulophia

and Lissochilus to be congeneric. Eulophia was later conserved

over the less widely used Lissochilus and several other earlier

names (see Summerhayes & Hall, 1962). Over time, several

other genera were established which are now also considered

synonyms of Eulophia. Lindley (1833: 189–191), who accepted

both Lissochilus and Eulophia, even though he admitted that he

could barely distinguish them from one another, added Cyrto-

pera Lindl. for similar species with a spurless subventricose lip.

Richard (1850) described Orthochilus Hochst. ex A.Rich. based

on O. abyssinicus (Rchb.f.) Hochst. ex A.Rich. (≡ E. abyssi-

nica Rchb.f.). Reichenbach (1878) established Ptero glossaspis

Rchb.f. for P. eustachya Rchb.f. (≡ E. eustachya (Rchb.f.)

Geerinck), a species in which the gynostemium lacks a foot

and the lip has no spur, but which otherwise has a Eulophia-like

habit. Most authors of recent floristic treatments have main-

tained Pteroglossaspis as distinct, except for Geerinck (1987,

1992) who considered it congeneric with Eulophia. Indeed,

lack of a spur or column foot is not restricted to Pterogloss-

aspis but also occurs in Eulophia. Although their preliminary

A molecular phylogeny reveals paraphyly of the large genus Eulophia

(Orchidaceae): A case for the reinstatement of Orthochilus

Florent Martos,1 Steven D. Johnson,1 Craig I. Peter2 & Benny Bytebier1

1 School of Life Sciences, University of KwaZulu-Natal, Private Bag X01 Scottsville, Pietermaritzburg 3209, South Africa

2 Department of Botany, Rhodes University, P.O. Box 94, Grahamstown 6140, South Africa

Author for correspondence: Florent Martos, f lorentmartos@gmail.com

ORCIDs: F.M., 0000-0003-1213-5466; C.I.P., 0000-0002-9741-6533; B.B., 0000-0002-4661-5727

DOI

http://dx.doi.org/10.12705/631.6

Abstract

Phylogenetic relationships were inferred for the African-centred orchid subtribe Eulophiinae, which includes the large

genus Eulophia and three closely related genera, Oeceoclades, Pteroglossaspis and Acrolophia. We sequenced one nuclear (ITS)

and four chloroplast (rbcL, trnK-matK, rpl32-trnL, trnQ -5′ r ps16 ) markers for 86 samples, representing 58 species (62 taxa) and

one outgroup. The combined sequence matrix had 6525 characters and was analysed using parsimony and Bayesian criteria.

Our results show that Acrolophia and Oeceoclades are monophyletic but are nested in Eulophia as currently circumscribed,

thus rendering it paraphyletic. We argue for retaining Acrolophia and Oeceoclades, and splitting Eulophia into two genera

on the basis of evidence that each of these four clades is genetically and morphologically distinct. We propose to reinstate the

genus name Orthochilus for one of the Eulophia clades and transfer 35 taxa, including those assigned to Pteroglossaspis, to

Orthochilus. Thirty-two of these are new combinations.

Keywords

Acrolophia; Africa; Cape Floristic Region; Eulophia; monophyly testing; Oeceoclades; Pteroglossaspis

Supplementary Material

Electronic Supplement (Fig. S1) and alignment are available in the Supplementary Data section of

the online version of this article at http://www.ingentaconnect.com/content/iapt/tax

TAX ON

63 (1) • February 2014: 9–23Martos & al. • Phylogeny of Eulophiinae orchids

10 Version of Record (identical to print version).

molecular evidence is inconclusive,

Pridgeon & al. (2009

fig. A5) followed Geerinck (1992) and placed Pteroglossaspis

within Eulophia. Most authors, apart from Geerinck (1987,

1992), have also accepted Oeceoclades Lindl. (Lindley, 1832)

as a distinct genus (consisting of 39 species). Nevertheless,

the generic boundaries between Oeceoclades and Eulophia

have remained unresolved and whether certain species, such

as for instance E. pulchra (Thouars) Lindl., are better placed

in Eulophia or Oeceoclades is a matter of opinion (Clements

& Cribb, 1989; Thomas, 1996; La Croix & Cribb, 1998; Cribb

& Hermans, 2009; WCSP, 2013).

A monographic treatment of Eulophia is urgently needed,

particularly in view of the fact that many species are widespread

and show considerable regional variation, which has led to a

proliferation of names (Hall, 1965; Thomas, 1998). Regional

treatments for Africa, which could form the basis for a mon-

ograph, have been prepared for southern Africa (Hall, 1965),

south-central Africa (La Croix & Cribb, 1998), Madagascar

(Du Puy & al., 1999; Hermans & al., 2007), Central Africa

(Geerinck, 1992), Gabon (Szlachetko & al., 2004), East Africa

(Cribb, 1989), Ethiopia (Cribb & Thomas, 1997), West Africa

(Summerhayes, 1968), Cameroon (Szlachetko & Olszewski,

1998) and Guinea (Szlachetko & Kowalkowska, 2007). Despite

all this floristic attention, no workable infrageneric treatment

of Eulophia exists. Some very early attempts (see Thomas,

1998 and

Pridgeon & al., 2009

for details) are no longer use-

ful. Cribb in

Pridgeon & al. (2009

: 102–103) suggested seven

potential sections but refrained from formalising them in the

absence of a proper morphological and/or molecular analysis

that clarifies whether or not Eulophia and closely related gen-

era, as currently circumscribed, are monophyletic.

Besides Eulophia and Oeceoclades, the other genera cur-

rently considered to belong to the Eulophiinae are Geodorum

Jacks. (12 spp.),

Acrolophia Pfitzer (7), Eulophiella Rolfe (5),

Cymbidiella Rolfe (3), Grammangis Rchb.f. (2), Paralophia

P.J.Cribb & Hermans (2)

, and

Cyanaeorchis Barb.Rodr. (2)

(Pridgeon & al., 2009;

WCSP, 2013). Based on a preliminary

phylogenetic analysis using a combination of morphological

and molecular characters,

Pridgeon & al. (2009)

provided some

insight into relationships between some of these genera. Their

phylogeny indicates that

Eulophiella, Cymbidiella, Gramman-

gis and Paralophia form sister clades to the

Eulophia-Oeceo-

clades-Pteroglossaspis clade (

Pridgeon & al., 2009

: fig. A5).

However, it is clear that much more work is needed, principally

to clarify the generic boundaries of Eulophia. For instance,

its relationship to Acrolophia, which is largely endemic to the

Cape Floristic Region and morphologically very similar to

Eulophia (Linder & Kurzweil, 1999;

Pridgeon & al., 2009)

is unknown since it has never been included in any molecular

phylogenetic analysis. Although Acrolophia has been treated

in several floristic accounts (Rolfe, 1912; Stewart & al., 1982;

Linder & Kurzweil, 1999), it has never been critically revised

and a type species has not been selected.

In this study, we address the phylogenetic relationships

between species of Eulophia, Pteroglossaspis and Oeceo-

clades—three genera that form a monophyletic clade within

Eulophiinae according to

Pridgeon & al. (2009

: fig. A5)—and

also include the genus Acrolophia because of its morphologi-

cal similarity with Eulophia. Our objective was to reconstruct

a robust multi-gene molecular phylogeny from an extensive

sampling of mainly South African and Western Indian Ocean

representatives. We specifically aimed to test monophyly of

Eulophia. We hypothesized that this genus as currently circum-

scribed (

Pridgeon & al., 2009; WCSP, 2013)

may not represent

a monophyletic group.

MATERIALS AND METHODS

Plant sampling. —

Eighty-six samples, representing

58 species (62 taxa) of Eulophiinae and one outgroup were

included in this analysis (see Appendix 1). The samples in-

cluded 46 Eulophia species (with one formerly included in

Pterogloss aspis), 7 Acrolophia species and 5 Oeceoclades spe-

cies. This covered 35 of 41 (85%) Eulophia species, and 7 of 7

(100%) Acrolophia species, occurring in South Africa (Linder

& Kurzweil, 1999). Our sampling included the type species

for Eulophia (E. guineensis) and Oeceoclades (O. maculata

(Lindl.) Lindl.). The genus Acrolophia has not been typified

(

Pridgeon & al., 2009)

but was comprehensively sampled.

Ansellia africana Lindl. (subtribe Cymbidiinae) was used to

root the trees based on

Pridgeon & al. (2009

: fig. A5). Voucher

specimens were collected at flowering time, dried and mostly

deposited at the Bews (NU) or Selmar Schonland (GRA) her-

barium (see Appendix 1). In the case of rarely encountered

species we only retained one or two flowers preserved in spirit

and/or photographs as vouchers (see Appendix 1). Names used

in the text, figures, and appendix, follow the World Checklist

of Selected Plant Families (WCSP, 2013).

DNA isolation amplification and sequencing. —

Fresh

plant material was dried in silica gel and DNA was extracted

with DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany).

The internal transcribed spacers of the 18S-5.8S-26S nuclear

ribosomal DNA (= nrITS) were amplified using the primer

pair 17SE/26SE (Sun & al., 1994) also called AB101/AB102 by

Douzery & al. (1999). Four chloroplast markers were ampli-

fied, i.e., the ribulose-1,5-bisphosphate carboxylase oxygenase

gene (= rbcL), the tRNA-Lys gene and intron and maturase K

gene (= trnK-matK), the ribosomal protein L32-trnL intergenic

spacer (= rpl32-trnL) and trnQ-ribosomal protein S16 (= trnQ-

5′ rp s16 ) non-coding regions (Electr. Suppl.: Fig. S1). These

were amplified using the primer pairs 1F/1360R (Kores & al.,

2000), -19F/R1 (Kocyan & al., 2004), rpl32-F/trnL

(UAG )

and

rps16x1/t r nQ

(UUG)

(Shaw & al., 2007), respectively (Electr.

Suppl.: Fig. S1). However, R1, designed for the orchid sub-

family Apostasioideae (Kocyan & al., 2004), was modified

to R1mod (CAGTTTTCATTGCACACGAC) to match the

chloroplast genome of the orchid subfamily Epidendroideae

based on the complete chloroplast genomes of Phalaenopsis

aphrodite Rchb.f. (Chang & al., 2006) and Oncidium Gower

Ramsey (Wu & al., 2010). PCR reactions contained 1× Color-

less GoTa q Flexi Buffer, 2.5 mM MgCl

solution, 2 μg bovine

serum albumin, 0.2 mM of each of the dNTPs, 0.5 μM for-

ward primer, 0.5 μM reverse primer, 1.25 u GoTaq Flexi

Martos & al. • Phylogeny of Eulophiinae orchids

TAX ON

63 (1) • February 2014: 9–23

11Version of Record (identical to print version).

DNA Polymerase (Promega, Madison, Wisconsin, U.S.A.),

0.3–0.5 μg template DNA, and nuclease-free water to 50 μL

volume. PCR amplification was performed in a Veriti Thermal

Cycler (Applied Biosystems, Life Technologies, Carlsbad, Cali-

fornia, U.S.A.) as follows: 2 min initial denaturation at 95°C; 35

cycles of 1 min denaturation at 95 °C—1 min annealing at 59°C

for ITS, 50°C for rbcL, 52°C for matK, 55°C for rpl32-trnL, and

60°C for trnQ-5′ r ps16 —3 min elongation at 72°C; followed by

a 5 min final elongation at 72°C. PCR products were visualised

by electrophoresis on 1.5% agarose gels. We did not detect

paralogous copies of nrITS during this study. In about 20% of

the samples we could not amplify the long fragment trnK-matK

of approximately 1700 bp with the use of the external primers

-19F and R1mod only. In such cases we made use of the internal

primers, 1326R (Cuénoud & al., 2002) and 580F (Kocyan & al.,

2004) to amplify the trnK-matK in two parts.

PCR products were purified using a Macherey-Nagel

Nucleic Acid and Protein Purification Kit NucleoFast 96 PCR

Plate on a Tecan EVO150. Sense and antisense sequencing was

carried out with BigDye Terminator v.3.1 Cycle Sequencing

Kit (LTC/Applied Biosystems) using the same primer sets as

for PCRs, except for trnK-matK which required an extra inter-

nal sequencing primer namely 1326R (Cuénoud & al., 2002).

Sequencing products were treated with SDS before they were

transferred onto Sephadex columns (LTC/Applied Biosystems)

using a Tecan EVO150 and then centrifuged. Cleaned products

were dried using a heated vacuum drier and re-suspended in

Hi-Di (LTC/Applied Biosystems). Electrophoresis was per-

formed on either an ABI3130xl or an ABI3730xl machine using

a 50 cm capillary array and POP7 (all supplied by LTC/Applied

Biosystems).

Phylogenetic analysis. —

Sequence chromatograms were

imported into Geneious Pro v.6 (Drummond & al., 2005), au-

tomatically trimmed at both ends using a 5% chance of error

per base, after which the sense and antisense chromatograms

were assembled to generate a consensus sequence. All incon-

gruities and ambiguities were manually checked and edited,

and 382 sequences were then submitted to GenBank (Appen-

dix 1). Consensus sequences of each locus were aligned using

MUSCLE and MAFFT v.7.017 (Katoh & al., 2002) as inte-

grated into Geneious Pro. Alignments were visually checked

and edited wherever necessary. We then concatenated the five

loci into a single alignment matrix prior to phylogenetic anal-

ysis. This matrix included 86 samples and 6525 characters and

was partitioned with MacClade v.4.08 (Maddison & Maddison,

2000) as follows: a character partition was created between

nuclear- (822 bp) and chloroplast-derived (5703 bp) characters

in order to assess phylogenetic congruence between nuclear

and chloroplast DNA; a generic partition was created to test

monophyly of each of the three genera under study.

Under the parsimony criterion, we applied an heuris tic

search using the tree-bisection-reconnection (TBR) branch-

swapping algorithm with 1000 replicates starting from random

taxon addition, followed by a bootstrap analysis with 1000

repetitions, in PAUP* v.4.0b10 (Swofford, 2002); gaps were

treated as missing data. Under the Bayesian criterion, we used

two independent parallel runs, each one with one cold chain and

three heated chains, over 5 million Markov Chain Monte Carlo

(MCMC) generations in MrBayes v.3.2 (Ronquist & al., 2012).

Trees were sampled every 500 generations across General Time

Reversible (GTR) model space. This approach was preferred

over selecting a best-fit substitution model (i.e., a model testing

approach) because it integrates out the uncertainty of choosing

the correct model by sampling across the entire GTR model

space (Ronquist & al., 2011). We assessed convergence by

making sure that probabilities of the sampled models were the

same across the two independent parallel runs. Subsequently,

we repeated a Bayesian analysis by setting the best-fit model

as selected by AIC in MrModeltest v.2.3 (Nylander, 2004), i.e.,

the GTR + I + G model for each partition.

Monophyly testing. —

Our main objective was to test the

monophyly of Eulophia. Specifically we wanted to contrast

the hypotheses H0—Eulophia is monophyletic—against H1—

Eulophia is not monophyletic. In order to do this we specified

two different constraints: a hard constraint forcing continuous

monophyly along the tree sampling (i.e., model H0); and a neg-

ative constraint allowing sampling across all trees that did not

respect the monophyly (i.e., model H1). We then ran a Bayesian

analysis enforcing either the hard or the negative constraint, and

using a stepping-stone sampling method (Ronquist & al., 2011:

52–57). Unlike MCMC runs, stepping-stone runs move from

the posterior to the prior through a number of steps in which

the sampled distribution is a mixture of varying proportions

of the two, hence it provides a more accurate estimation of the

model likelihood. A comparison of the marginal likelihood

estimate then allows H0 or H1 to be selected as the best model

for explaining the data. We repeated this procedure to test the

monophyly of Oeceoclades and Acrolophia.

RESULTS

Sequence variation. —

There was extensive length vari-

ation in the trnK-matK, trnQ-5′ rps16 and rpl32-trnL regions

but much less in nrITS and none in rbcL. The trnK-matK se-

quences varied between 608 and 1680 bp. This large variation

was mostly due to a single sequence (E. litoralis Schltr.) which

was only 608 bp, whereas all others varied between 1392 and

1680 bp. Substantial length variation was also noticed in trnQ-

5′ r ps16 (331–1225 bp) and rpl32-trnL (519–788 bp). On the

other hand, nrITS varied between 751 and 796 bp, and all

rbcL sequences were 1231 bp long. Based on the alignments,

the average percentage of pairwise variability was higher for

trnQ-5′ r ps16 (25.9%) than for rpl32-trnL (19.9%), nrITS (11%),

trnK-matK (5.1%), or rbcL (0.8%). Therefore, the chloroplast

non-coding regions trnQ-5′ r ps16 and rpl32-trnL were by

far the most variable loci in this study. Together with nrITS,

these markers proved efficient in resolving phylogenetic rela-

tionships between closely related species, whereas the more

conserved markers trnK-matK and rbcL were important to

resolve deeper nodes.

Phylogenetic congruence between nuclear and chloro-

plast loci. —

Convergence between the two parallel MCMC

runs was reached before 5 million generations for all locus

TAX ON

63 (1) • February 2014: 9–23Martos & al. • Phylogeny of Eulophiinae orchids

12 Version of Record (identical to print version).

partitions (i.e., nrITS, four chloroplast loci, or five concatenated

loci). The overall topology generated from the nuclear dataset

was congruent with that generated from the chloroplast dataset

except for the placement of one species, namely E. callichroma

Rchb.f., which switched from one clade to another (Fig. 1).

To make sure that the inclusion of this species did not affect

the general topology, we reran the analysis after excluding it

from the alignment matrix. This resulted in nuclear and chlo-

roplast trees identical to those seen in Fig. 1. In view of the

fact that the nuclear and chloroplast markers were congruent,

we concatenated all loci to increase the number of informative

characters. The result of the Bayesian analysis based on the

concatenated dataset is presented in Fig. 2. The general topol-

ogy did not change when the tree sampling was set to follow

the best-fit model (GTR + I + G) instead of sampling across the

entire GTR model space (data not shown).

Under the parsimony criterion, 937 out of 1471 variable

characters in the alignment matrix were parsimony-informative.

The parsimony analysis yielded 5203 equally most parsimo-

nious trees (MPTs) with a length of 2626 steps, a consistency

Eulophia spp.

(clade 1)

Eulophia spp.

(clade 2)

Acrolophia spp.

Oeceoclades spp.

Ansellia africana (outgroup)

Eulophia pulchra

A B

Fig. 1.

Plot of congruence between two Bayesian consensus trees inferred from

nuclear ITS and

four chloroplast loci. Most perceived incon-

gruence is as a result of polytomies. Only E. callichroma resolves in a different major clade in the two trees (bold line). Graph generated using

cophyloplot in the R package ape 3.0-7 (Popescu & al., 2012).

Martos & al. • Phylogeny of Eulophiinae orchids

TAX ON

63 (1) • February 2014: 9–23

13Version of Record (identical to print version).

E. streptopetala*

E. horsfallii*

O. bernetii

E. stricta

E. mechowii

E. clitellifera*

E. milnei

E. ovalis var. ovalis

E. ruwenzoriensis♦

E. macowanii

E. hereroensis

A. bolusii

E. longisepala

O. ugandae

O. saundersiana

E. parviflora form long spur*

E. streptopetala*

E. odontoglossa

O. maculata

E. petersii

E. parviflora form Port Elizabeth*

O. saundersiana

A. capensis

E. ensata form cream

E. tuberculata*

O. bernetii

E. hians var. hians

E. tenella

E. ovalis var. ovalis

A. cochlearis

E. horsfallii*

O. sp

E. leontoglossa

A. sp. aff. cochlearis

E. pulchra

E. litoralis

E. aculeata

E. foliosa

E. ensata form cream

E. angolensis*

A. lamellata

E. hians var. nutans

E. stachyodes

E. hians var. inaequalis

E. guineensis

E. schweinfurthii*

E. ensata form yellow

E. tabularis

A. micrantha

E. acutilabra

E. hians var. hians

A. cochlearis

E. welwitschii

A. lunata

E. ? schnelliae

E. pulchra

E. huttonii

E. chlorantha

E. odontoglossa

E. pulchra

E. flavopurpurea*

E. foliosa

E. coeloglossa

Ansellia africana

E. parvilabris

A. bolusii

A. ustulata

E. calanthoides

E. meleagris

E. streptopetala var. stenophylla

E. platypetala

E. speciosa*

E. graminea

E. hians var. hians

E. livingstoneana*

E. parviflora form long spur*

E. petersii

E. parviflora form short spur*

E. vinosa

E. cucullata*

E. callichroma

O. maculata

E. zeyheriana

E. streptopetala*

E. ovalis var. bainesii

100

Acrolophia

Oeceoclades

Eulophia [Eulophia s.str.]

Eulophia [Orthochilus]

100

Fig. .

Bayesian consensus tree inferred from 6525 bp including one nuclear locus (nrITS) and four chloroplast loci (rbcL, trnK-matK, rpl32-trnL,

trnQ-5′ r p s16). This tree was obtained after running two independent MCMC runs over 5 million generations and sampling across the GTR

model space. Posterior probabilities are shown above branches. Bootstrap values from a parsimony analysis are shown below branches. Arrows

indicate nodes that collapse in the parsimony strict consensus tree. Asterisks and diamond indicate species that have in the past been assigned to

Lissochilus and Pteroglossaspis respectively.

TAX ON

63 (1) • February 2014: 9–23Martos & al. • Phylogeny of Eulophiinae orchids

14 Version of Record (identical to print version).

index (CI) of 0.676, a homoplasy index (HI) of 0.324, a retention

index (RI) of 0.864, and a rescaled retention index (RC) of

0.505. The strict consensus tree derived from MPTs (not shown)

was congruent with the Bayesian majority-rule consensus tree

seen in Fig. 2.

Marginal likelihood estimates from tested topologies.

—

Model H0Eu, which enforced the monophyly of Eulophia,

resulted in a considerably lower likelihood estimate than the

alternative model H1

. Whereas a difference in marginal like-

lihood above 5 natural log units is generally considered very

strong evidence in favour of the better model (Kass & Raftery,

1995), the difference between H1Eu and H0Eu was 61 natural

log units (Table 1), and thus the monophyly of Eulophia could

be confidently rejected. The paraphyly of Eulophia is indeed

clear and well supported in the consensus cladogram (Fig. 2)

and indicates that Eulophia s.l. consists of two clades which we

will refer to as the “Eulophia s.str.” and “Orthochilus” clade.

Conversely, the models H0Oe and H0Ac forcing monophly on

Oeceoclades and Acrolophia respectively, led to greater like-

lihood estimates than their alternative models H1Oe and H1Ac

(Table 1). The log difference between H0 and H1 for Oeceo-

clades was 31.5 natural log units, whereas that for Acrolophia

was 11.5—both considerably above the threshold of 5. There-

fore, the Bayes factor test provided strong evidence in favour

of a monophyletic origin of Oeceoclades and Acrolophia.

Finally, we could also reject the monophyletic hypothesis for

species formerly assigned to the genus Lissochilus (likelihood

estimates not shown). These species indeed appeared to be

scattered across the Eulophia s.str. clade (indicated in Fig. 2

with asterisk s).

DISCUSSION

Our results convincingly show that the monophyletic gen-

era Acrolophia and Oeceoclades are nested within Eulophia as

currently circumscribed, thus rendering Eulophia paraphyletic.

In order to maintain an evolutionarily meaningful classification,

we are thus faced with the decision of either including Oeceo-

clades and Acrolophia in an enlarged Eulophia, or splitting

Eulophia into two separate genera and thereby keeping Acro-

lophia and Oeceoclades virtually unchanged. Although there

is a trend to recognise larger genera (Humphreys & Linder,

2009), we argue below that the best option in this case is to

retain Acrolophia and Oeceoclades and to split Eulophia into

two genera on the basis that each of these four clades is genet-

ically and morphologically distinct.

Acrolophia. —

All recent authors (e.g., Hall, 1965; Linder

& Kurzweil, 1999; Pridgeon & al., 2009) have accepted Acro -

lophia as a well-circumscribed and morphologically distinct

genus. Our comprehensive sampling confirms that it is indeed

a monophyletic entity that is embedded within Eulophia s.l.

and sister to Eulophia s.str. The seven species of Acrolophia

share some unique characteristics amongst the Eulophiinae.

In particular, the inflorescence is apical and often branched

(Fig. 3G), whereas it is lateral and usually simple in both Eulo-

phia s.l. (Fig. 3B) and Oeceoclades.

The leaves are equitant,

distichous and fan-like

(Fig. 3G)

, which is not the case in

Eulophia

s.l.

and Oeceoclades. Furthermore, the typical per-

ennating organs of Eulophiinae (i.e., pseudobulb, corm, or

swollen rhizome) are absent in Acrolophia and the stem is

reduced to such an extent that the

leaves appear to be directly

connected to the roots.

Oeceoclades. —

As is the case for Acrolophia, all recent

authors (e.g., Cribb, 1989; La Croix & Cribb, 1998; Du Puy

& al., 1999; Hermans & al., 2007), except Geerinck (1992),

have also accepted Oeceoclades as a distinct genus. Our anal-

ysis indicates that it indeed forms a clade, although we only

sampled 5 out of 39 species. Oeceoclades is morphologically

distinct from Eulophia. Species of Oeceoclades share a quad-

rilobed labellum with two short calli at the base (Fig. 3F). The

lip lacks long keels and hairlike outgrowths (Fig. 3F). The spur

is short and often swollen. The pseudobulbs are heteroblastic,

and the leaves are petiolate and conduplicate (Summerhayes,

1957; Garay & Taylor, 1976).

Garay & Taylor (1976) considered the heteroblastic pseu-

dobulbs and conduplicate leaves as important taxonomic char-

acters and consequently did not include Eulophia pulchra in

Oeceoclades because it has homoblastic pseudobulbs and plicate

leaves. Despite the fact that the vegetative characteristics of

E. pulchra resemble those of Eulophia, its floral morphology

is typical of Oeceoclades (Thomas, 1996). Because of this am-

biguity, some authors have assigned it to Eulophia (Thomas,

1996; La Croix & Cribb, 1998; Hermans & al., 2007), whereas

others thought it was better placed in Oeceoclades (Clements

& Cribb, 1989; Cribb, 1989). In our analysis, E. pulchra is sister

to the rest of Oeceoclades and therefore would be better placed

in Oeceoclades, or in a separate genus altogether. Since our

sampling of Oeceoclades is as yet limited, we suggest the use

of the name Oeceoclades pulchra (Thouars) P.J.Cribb & M.A.

Clem. for the time being and until a more extensive analysis will

show whether this species is nested within Oeceoclades or is

truly sister to all other members of the genus. In the latter case,

a new generic name might be more appropriate for this taxon.

Eulophia s. str., Pteroglossaspis and the reinstatement of

Orthochilus. —

Acrolophia and Oeceoclades are long-estab-

lished and morphologically well-circumscribed genera. It would

therefore be preferable, in our opinion, to keep these genera

and split the currently paraphyletic Eulophia into two genera,

particularly in view of the fact that clear morphological dif-

ferences exist between Eulophia s.str. and the segregate clade

(Fig. 3A–J). The latter clade was identified by A.V. Hall (1963,

Table 1.

Marginal likelihood estimates (in natural log units) derived

from six topological hypotheses. Each value is the mean of two mar-

ginal likelihood estimates calculated for two independent runs, each

one using a stepping-stone sampling method. Bold indicates the better

model between H0 and H1.

Genera H0: monophyletic H1: non-monophyletic

Eulophia −26981.0 −26920.0

Oeceoclades −26873.5 −26905.0

Acrolophia −26870.5 −26882.0

Martos & al. • Phylogeny of Eulophiinae orchids

TAX ON

63 (1) • February 2014: 9–23

15Version of Record (identical to print version).

1965) in a phenetic analysis of the South African species of

Eulophia based on 93 characters as the morphologically most

distinct group. In Hall’s “Eulophia nigricans aggregate” all

species shared the following characters: petals usually as wide

as sepals; leaves usually erect and plicate; sepals usually not

marked with brown or purple; leaf sheaths about halfway along

the scape usually more than half the length of the internode they

cover; distal crests usually papillose (Hall, 1965). Cribb (1989),

La Croix & al. (1991) and La Croix & Cribb (1998), agreed

with Hall’s conclusion that all species in which the petals and

Fig. 3.

Morphological synapomorphies for:

A–E,

Eulophia s.str.;

Oeceoclades;

Acrolophia;

H–J,

Orthochilus.

E. zeyheriana Sond. show-

ing fleshy verrucose ridges on the mid-lobe of the labellum;

E. parviflora (Lindl.) A.V.Hall showing the lateral inflorescence;

E. tubercu-

lata Bolus showing the lax inf lorescence;

E. petersii (Rchb.f.) Rchb.f. and

E. cucullata (Afzel. ex Sw.) Steud. showing petals and sepals

of different size, shape or colour;

O. maculata (Lindl.) Lindl. showing the quadrilobed labellum;

A. lamellata (Lindl.) Pfitzer showing the

terminal, branched inflorescence;

O. mechowii Rchb.f. showing the dense inflorescence clustered near the apex;

O. vinosus (McMurtry &

G.McDonald) Bytebier showing petals and sepals similar in size, shape and colour;

O. welwitschii Rchb.f. showing papillae on mid-lobe of the

labellum. — All pictures by the authors, except G reproduced with kind permission of H. Staerker.

TAX ON

63 (1) • February 2014: 9–23Martos & al. • Phylogeny of Eulophiinae orchids

16 Version of Record (identical to print version).

sepals are similar in shape, colour and size, and the flowers are

bell-shaped, form a distinct group within Eulophia (Fig. 3H–I).

Cribb in Pridgeon & al. (2009: 103) went as far as to suggest

that this group should be accorded the rank of section. We pro-

pose, on the basis of the current phylogenetic analysis and its

morphological synapomorphies, to raise it to the rank of genus.

The correct name for this newly circumscribed genus would

be Orthochilus, since Orthochilus abyssinicus (≡ Eulophia

abyssinica) is part of this clade and is the oldest available

name. Eulophia abyssinica, E. aurantiaca Rolfe, E. carsonii

Rolfe, E. euantha Schltr., E. subulata Rendle, E. thomsonii

Rolfe, E. welwitschii (Rchb.f.) Rolfe and E. mechowii (Rchb.f.)

T.Durand & Schinz form a group of very closely related spe-

cies, two of which, namely E. welwitschii and E. mechowii,

were included in our sampling. Geerinck (1992) considered the

latter two species as conspecific with E. abyssinica, although

he later changed his opinion on this matter (Geerinck, 2005).

Species assigned to the genus Pteroglossaspis (recently

considered as synonymous with Eulophia; see Pridgeon & al.,

2009: 103) form part of the Orthochilus and not the Eulophia

s.str. clade (indicated in Fig. 2 with diamond). This is not to-

tally surprising, as, apart from the fact that they lack a column

foot and a spur, which are the diagnostic characters for Ptero-

glossaspis, they are similar in all other morphological aspects

to the remainder of Orthochilus. We were not able to sample

Pteroglossaspis eustachya, the type of the genus, but there

seems little doubt that this species is closely related to Eulophia

ruwenzoriensis Rendle, which is included in our phylogeny and

is placed within the Orthochilus clade.

We have taken a conservative approach in our taxonomic

treatment and so far assigned only 35 taxa to Orthochilus. There

are potentially a few more species that could be part of this ge-

nus, but until their DNA has been sampled and/or a long-awaited

revision of Eulophia has been done, we prefer to keep them in

Eulophia rather than create more names that would potentially

end up in synonymy. By and large, and based on morphology, we

do not expect a substantial increase of the Orthochilus clade, and

we believe it to be largely restricted to the continent of Africa,

with three species occurring in the Americas.

The reinstatement of Orthochilus and Oeceoclades pul-

chra reduces the size of Eulophia from 201 to 165 species, of

which we only sampled 31 species (19%). Furthermore, our

sampling is biased towards southern Africa. For these reasons

we refrain from making inferences that would impact on the

classification of Eulophia s.str. until more extensive sampling

has been achieved.

Eulophia s.str. still contains a considerable amount of mor-

phological variation. For instance, different forms of perennat-

ing organs (i.e., aerial pseudobulbs, underground corms, and

rhizomes) are all represented in this clade. Some species show

a great variation in size and colour between petals and sepals,

whereas others do much less so (Fig. 3A–E). The former species

were often grouped into a separate genus, Lissochilus, in which

at least 206 epithets have been coined. Summerhayes (1936)

pointed out that Eulophia and Lissochilus could not be kept

separate and most authors have followed his objections against

the use of Lissochilus. Perrier de la Bâthie (1941) was probably

the last author to keep them separate. Hall (1963, 1965), on

the basis of a phenetic study, also presented evidence why the

two should not be upheld. Our work corroborates the views

of Summerhayes (1936), Hall (1963, 1965), and several other

authors, as the species formerly assigned to Lissochilus failed

a test for monophyly (results not shown) and appear scattered

across the Eulophia clade (Fig. 2).

Eulophia callichroma presents a conundrum. It was first

described by Reichenbach (1881) who pointed out that it was

closely related to Eulophia tristis (L.f.) Spreng. (now a syn-

onym of Acrolophia capensis (P.J.Bergius) Fourc.). Cribb

(1977) re-described it in the genus Acrolophia as A. panicu-

lata P.J.Cribb. Indeed, the inflorescence in this species is a

terminal panicle and therefore closely resembles the habit of

Acrolophia (seen in Fig. 3G). However, based on the fact that

it is hysteranthous, that the leaves are not fan-like, and that it

has pseudobulbs, most authors thought it better placed in Eulo-

phia (Williamson, 1977; Cribb, 1989; La Croix & al., 1991; La

Croix & Cribb, 1998; Linder & Kurzweil, 1999). Our phyloge-

netic analysis confirms that it does not belong to Acro lophia.

Nevertheless, the phylogenetic position of E. callichroma re-

mains somewhat ambiguous as the chloroplast (Fig. 1B) and

concatenated datasets (Fig. 2) place it sister to Eulophia s.str.,

whereas the limited nuclear dataset seems to suggest that it is

related to Oeceoclades(Fig. 1A). Morphologically, however,

E. callichroma certainly does not fit within the concept of

Oeceoclades. Consequently we suggest to retain E. callichroma

within Eulophia. The DNA sequences for the various loci of

E. callichroma appear quite divergent from those of its closest

relatives, which suggests that E. callichroma may belong to

a branch in the phylogeny for which sampling is underrepre-

sented due to collection bias or extinctions.

TAXONOMIC TREATMENT

Artificial key to the genera of Eulophiinae

(modified from Cribb in Pridgeon & al., 2009: 94)

1. Plants lacking chlorophyll, leaves absent or reduced to

scales ................................. 460. Eulophia (in part)

1. Plants with one or more green leaves ...................... 2

2. Inflorescence erect but recurved apically so that the apex

points towards the ground ................ 462. Geodorum

2. Inflorescence not as above ................................... 3

3. Plants terrestrial with subterranean tubers, swollen rhi-

zomes or epigeous pseudobulbs, often born in strings,

rarely lacking pseudobulbs, tubers or fleshy rhizomes .. 4

3. Plants epiphytic with pseudobulbs, clustered or remote;

rarely terrestrial and then with an elongate rhizome and

lacking pseudobulbs .......................................... 8

4. Stems usually pseudobulbous, heteroblastic and naked or

rarely homoblastic and covered by leaf sheaths; labellum

usually distinctly four-lobed or if apparently trilobed then

the midlobe emarginate and with 2 lobules when flat-

tened .........................................464. Oeceoclades

4. Stems cylindrical, tuberous, rhizomatous or pseudobul-

Martos & al. • Phylogeny of Eulophiinae orchids

TAX ON

63 (1) • February 2014: 9–23

17Version of Record (identical to print version).

bous, usually several-noded, often covered by leaf bases,

rarely lacking pseudobulbs, swollen rhizomes or tubers;

labellum trilobed .............................................. 5

Plants lacking pseudobulbs, swollen rhizomes or tubers

5. Plants with pseudobulbs, swollen rhizomes or tubers ... 7

6. Inflorescence often branched; sepals spreading; pollinia

2, on stipe .................................... 457. Acrolophia

6. Inflorescence simple; sepals connivent; pollinia 4, ses-

sile ........................................ 458. Cyanaeorchis

7. Inflorescence usually lax; petals and sepals of different

size, shape or colour ............... 460. Eulophia (i n pa r t)

7. Inflorescence usually dense and often clustered near the

apex; flowers campanulate, petals and sepals similar in

size, shape and colour ................... 460a. Orthochilus

8. Pseudobulbs angular; sepals more than 20 mm long; petals

porrect; labellum entire ................. 463. Grammangis

8. Plants with prominent, elongate stout rhizomes, often lack-

ing pseudobulbs; flowers with white, rose-purple, pink,

green or pale green sepals and petals ...................... 9

9. Flowers more or less rotate, pinkish white to rose-

purple ........................................ 461. Eulophiella

9. Flowers strongly bilaterally symmetrical, green, often

marked with red or black on labellum .................... 10

10. Labellum spurred at base ..................465. Paralophia

10. Labellum lacking a spur at base ......... 459. Cymbidiella

Eulophia R.Br. in Bot. Reg. 7: ad t. 573. Oct 1821 (“Eulophus”),

nom. et orth. cons. – Ty p e: E. guineensis Lindl., typ. cons.

= Wolf i a Dennst., Schlüssel Hortus Malab.: 38. 1818, non

Schreb. 1791, nom. illeg. – Type: W. spectabilis Dennst.

(≡ Eulophia spectabilis (Dennst.) Suresh).

= Lissochilus R.Br. in Bot. Reg. 7: t. 573. Oct. 1821, nom. rej.

– Type: L. speciosus R.Br. (≡ Eulophia speciosa (R.Br.)

Bolu s).

= Cyrtopera Lindl., Gen. Sp. Orchid. Pl.: 189. 1833 – Type:

C. woodfordii (Sims) Lindl. (≡ Cyrtopodium wood-

fordii Sims; = Eulophia alta (L.) Fawc. & Rendle).

Cribb (in Pridgeon & al., Gen. Orchid. 5(2): 100. 2009)

indicated that a type has not been selected, but Farr & al.

(Index Nom. Gen. (Pl.) 1 (= in Regnum Veg. 100): 482.

1979) state that the genus was typified with C. woodfordii

(Sims) Lindl. by A. Richard (in Orbigny, Dict. Univ. Hist.

Nat. 4: 561. 1844).

= Thysanochilus Falc. in Proc. Linn. Soc. London 1: 14. 1839

– Type: not designated.

= Hypodematium A.Rich., Tent. Fl. Abyss. 2: 286. 1850, non

Kunze 1833 nec A.Rich. 1848, nom. illeg. – Type: H. abys-

sinicum A.Rich. (= Eulophia streptopetala Lindl. var.

streptopetala).

= Platypus Small & Nash in Small, Fl. S.E. U.S.: 329. 1903 –

Type: P. papilliferus Small & Nash (= Eulophia alta (L.)

Fawc. & Rendle).

= Donacopsis Gagnep. in Bull. Mus. Natl. Hist. Nat., sér. 2, 4:

593. 1932 – Type: D. laotica Gagnep. (= Eulophia pauci-

flora Guillaumin).

= Semiphajus Gagnep. in Bull. Mus. Natl. Hist. Nat., sér. 2, 4:

598. 1932 – Type: not designated.

Terrestrial or less commonly lithophytic herbs, autotrophic

or mycoheterotrophic. Roots basal, often with well-defined

white velamen. Perennating organ stem-like or pseudobulbous

when above ground, rhizomatous or tuberous when subter-

ranean, cylindrical, fusiform, conical or ovoid, homoblastic.

Leaves linear, lanceolate, ovate or elliptic, acute to acuminate,

coriaceous, articulate or not to a sheathing base; rarely lack-

ing chlorophyll and scale-like in mycoheterotrophic species.

Inflorescence lateral, simple or rarely branching, generally

lax; bracts persistent. Flowers green or brown to coloured,

occasionally bicoloured. Dorsal sepal free, oblong, elliptic,

lanceolate or oblanceolate, reflexed, erect or porrect; lateral

sepals oblique at base and decurrent on column foot, otherwise

similar to dorsal sepal. Petals free, dissimilar to sepals, often

larger, broader and distinctly coloured compared to sepals.

Labellum free to base or fused to base of column, trilobed,

generally spurred at base, lateral lobes free or fused to base of

column, midlobe flat or convex, callus with two or three ridges

or papillose. Column usually with a foot; pollinia two, globose;

stipe solitary, triangular to oblong; viscidium oblong, elliptic

to lunate. Ovary cylindrical, grooved. (description modified

from Cribb in Pridgeon & al., 2009: 100).

Distribution. – Most diverse in sub-Saharan Africa, with

substantial diversity elsewhere only in Madagascar and tropi-

cal Asia. Extending to Yemen and Socotra, Réunion, tropical

and subtropical America, temperate central Asia; northwestern

Australia and the southwestern Pacific Islands.

Etymology. – From the Greek eu “well, good” and lophos

“a crest, plume” in reference to the crest on the labellum of

some species (Quattrocchi, 2000).

Orthochilus Hochst. ex A.Rich., Tent. Fl. Abyss. 2: 284. 1850

– Type: O. abyssinicus (Rchb.f.) Hochst. ex A.Rich.

= Pteroglossaspis Rchb.f., Otia Bot. Hamburg. 1: 67. 1878 –

Type: P. eustachya Rchb.f.

= Trio r chos Small & Nash in Small, Fl. S.E. U.S.: 329. 1903 –

Type: T. ecristatus (Fernald) Small.

= Smallia Nieuwl. in Amer. Midl. Naturalist 3: 158. 1913, nom.

nov. pro Triorc h o s Small & Nash.

Terrestrial herbs. Perennating organs subterranean, tuber-

ous, irregularly shaped, in chains, with slender roots mostly

from the new growth. Leaves 1–3 [5], mostly erect, plicate,

linear to lanceolate, acute to acuminate, often with 2–3 ba-

sal sheaths. Inf lorescence lateral, simple, produced before or

with young leaves, sometimes few but more often many-flow-

ered, sometimes lax but more often dense to subspherical;

peduncle slender to stout with several papery sheaths; bracts

persistent, often conspicuous, erect to spreading or reflexed.

Flowers mostly subnutant, not opening widely, concolorous,

variously coloured, sometimes with a conspicuous and differ-

ently coloured disc or papillae on the labellum. Dorsal sepal

oblong, elliptic, ovate, lanceolate or linear, acute to acuminate;

lateral sepals similar to dorsal sepal, often oblique at base.

Petals similar in shape and colour to the sepals, but usually

slightly broader and shorter. Labellum trilobed, mostly porrect,

midlobe flat, sometimes reflexed at tip, generally larger than

the side lobes; callus of 2 [3–7] papillose ridges in basal half,

TAX ON

63 (1) • February 2014: 9–23Martos & al. • Phylogeny of Eulophiinae orchids

18 Version of Record (identical to print version).

often ending in short or long papillae on the midlobe, or calli of

scattered warts on midlobe; spur cylindrical to clavate, or ab-

sent. Column with or without a foot; pollinia two, subglobose to

globose; stipe solitary, triangular to oblong; viscidium oblong,

elliptic to lunate. Ovary cylindrical, grooved. Fruit pendent.

Distribution. – Sub-Saharan Africa, Madagascar, tropical

and subtropical America.

Etymology. – From the Greek orthos “upright, straight”

and cheilos “a lip” the long claw (Quattrocchi, 2000).

Orthochilus abyssinicus (Rchb.f.) Hochst. ex A.Rich., Tent.

Fl. Abyss. 2: 284. 1850 ≡ Eulophia abyssinica Rchb.f. in

Linnaea 22: 866. 1850 ≡ Graphorkis abyssinica (Rchb.f.)

Kuntze, Revis. Gen. Pl. 2: 662. 1891 – Holotype: ETHIO-

PIA. Adde Schum Eschet, 25 Jul 1840, Schimper 1700 sectio

tertia (W n.v.; isotypes: BR barcode BR000008419248!, K

barcodes K000078600!, K000078598 [fragment and draw-

ing]!, P barcodes P00359045!, P00359046!, P00359047!,

S No. S07-5002!).

Orthochilus aculeatus (L.f.) Bytebier, comb. nov. ≡ Sat-

yrium aculeatum L.f., Suppl. Pl.: 402. 1782 ≡ Serapias

aculeata (L.f.) Thunb., Prodr. Pl. Cap.: 3. 1794 ≡ Cymbid-

ium aculeatum (L.f.) Sw. in Nova Acta Regiae Soc. Sci.

Upsal. 6: 77. 1799 ≡ Epidendrum aculeatum (L.f.) Poir. in

La marc k, En cycl., Suppl. 1: 376. 1810 ≡ Eulophia aculeata

(L.f.) Spreng., Syst. Veg. 3: 720. 1826 – Holotype: SOUTH

AFRICA. Cape of Good Hope [Caput Bona Spei], Thun-

be rg 291 (LINN No. 1055.2!).

Orthochilus aculeatus subsp. huttonii (Rolfe) Bytebier, comb.

nov. ≡ Eulophia huttonii Rolfe in Harvey, Fl. Cap. 5(3): 52.

1912 ≡ Eulophia aculeata subsp. huttonii (Rolfe) A.V.Hall

in J. S. African Bot., Suppl. 5: 183. 1965 – Lectotype (des-

ignated by Hall in J. S. African Bot., Suppl. 5: 187. 1965):

SOUTH AFRICA. Eastern Cape, Katberg, Hutton s.n. (K

barcode K000410474 [excl. foliis]!).

Orthochilus adenoglossus (Lindl.) Bytebier, comb. nov. ≡

Cymbidium adenoglossum Lindl. in J. Proc. Linn. Soc.,

Bot. 6: 134. 1862 ≡ Eulophia adenoglossa (Lindl.) Rchb.f.,

Otia Bot. Hamburg.: 66. 1878 – Holotype: NIGERIA.

Nupe, 1859, Barter s.n. (K barcode K000078602!).

Orthochilus albobrunneus (Kraenzl.) Bytebier, co mb. nov.

≡ Eulophia albobrunnea Kraenzl. in Bot. Jahrb. Syst.

33: 69. 1902 – Holotype: ETHIOPIA. Diddah, 27 Jul

1900, E llenbeck 1510 (B†; record of holotype: K barcode

K000078630 [flower and photo]!).

Orthochilus aurantiacus (Rolfe) Bytebier, comb. nov. ≡

Eulophia aurantiaca Rolfe in Oliver, Fl. Trop. Afr. 7:

67. 1897 ≡ Eulophia abyssinica var. aurantiaca (Rolfe)

Geerinck, Fl. Afr. Centr., Sperm., Orch.(2): 679. 1992 ≡

Eulophia welwitschii subsp. aurantiaca (Rolfe) Geerinck

in Taxonomania 14: 12. 2004 – Syntypes: TANZANIA.

Tanganyika Plateau, 1889, Carson s.n. (K barcode

K000078607!); TANZANIA. Lake Tanganyika, Sep 1893,

Carson 104 (K barcode K000078607!); TANZANIA. Be-

tween Lakes Tanganyika and Malawi [Nyassa], Apr 1890,

Johnston s.n. (K barcode K000078608!).

Orthochilus carsonii (Rolfe) Bytebier, comb. nov. ≡ Eulo

phia carsonii Rolfe in Oliver, Fl. Trop. Afr. 7: 64. 1897

≡ Eulophia welwitschii subsp. carsonii (Rolfe) Geerinck

in Taxonomania 16: 9. 2005 – Holotype: ZAMBIA. Tan-

ganyika Plateau, Fwambo, 1889, Carson s.n. (K barcode

K000078609!).

Orthochilus chloranthus (Schltr.) By tebier, comb. nov. ≡ Eulo-

phia chlorantha Schltr. in Bot. Jahrb. Syst. 20(Beibl. 50): 9.

1895 – Lectotype (designated by Hall in Linder & Kurzweil,

Orch. S. Afr.: 392. 1999): SWA ZI LAN D. Havelock Conces-

sion, Sep 1889, Saltmarshe in herb. Galpin 652 (BOL n.v.).

Orthochilus clandestinus (Börge Pett.) Bytebier, comb. nov. ≡

Pteroglossaspis clandestina Börge Pett. in Garcia de Orta,

Sér. Bot. 6: 79. 1984 ≡ Eulophia clandestina (Börge Pett.)

Bytebier in Strelitzia 22: 190. 2008 – Holotype: ANGOLA.

Cuando-Cubango, Menogue, Vila Serpa Pinto, valley of

the Cambumbé, 27 Feb 1960, Mende s 2778 (LISC barcode

LISC003336!; isotypes: C barcode C10001090!, COI bar-

code COI00005853!, ? EA n.v., K barcodes K000306605!,

K000306606 [fragment and photocopy of holotype]!, LMU

n.v., LUAI n.v., M n.v., MO n.v., SRGH n.v., UPS n.v., ? WAG

n.v.).

Orthochilus corymbosus (G.Will.) Bytebier, comb. nov. ≡

Ptero glossaspis corymbosa G.Will. in Pl. Syst. Evol.

134: 68. 1980 – Holotype: ZAMBIA. Mwinilunga, River

Kasompa, 31 Oct 1937, Milne-Redhead 3028 (K barcode

K000306604!).

Orthochilus distans (Summerh.) Bytebier, comb. nov. ≡ Ptero-

glossaspis distans Summerh. in Kew Bull. 13: 82. 1958 –

Holotype: SIERRA LEONE. Bonthe, Taigbe SE of Bendu,

15 Oct 1946, Adame s 92 (K barcode K000306603!).

Orthochilus ecristatus (Fernald) Bytebier, comb. nov. ≡ Cyr-

topodium ecristatum Fernald in Bot. Gaz. 24: 433. 1897

≡ Triorchos ecristatus (Fernald) Small, Fl. S.E. U.S.:

329. 1903 ≡ Eulophia ecristata (Fernald) Ames in Contr.

Ames Bot. Lab. 1: 19. 1904 ≡ Pteroglossaspis ecristata

(Fernald) Rolfe in Orchid Rev. 12: 136. 1904 – Syntypes:

U.S.A. Florida, Duval, near Jacksonville and borders of

Indian River, Curtiss 2808 (AMES No. 82164 [now GH

barcode 00098728]!, AMES No. 87532 [now GH bar-

code 00098729]!, AMES No. 82166 [now GH barcode

00098730]!).

The Oakes Ames Orchid Herbarium contains three sheets

of Curtiss 2808. Specimens 82164 and 87532 were both col-

lected in August and can be considered as duplicates. Specimen

82166, however, was collected in June. Because these three

sheets are the results of two botanical collection events, AMES

Martos & al. • Phylogeny of Eulophiinae orchids

TAX ON

63 (1) • February 2014: 9–23

19Version of Record (identical to print version).

Nos. 82164, 87532 and 82166 should be considered syntypes,

despite the fact that they have the same collector name and

number.

Orthochilus ensatus (Lindl.) Bytebier, comb. nov. ≡ Eulophia

ensata Lindl. in Bot. Reg. 14: t. 1147. 1828 ≡ Graphorkis

ensata (Lindl.) Kuntze, Revis. Gen. Pl. 2: 662. 1891 – Lec-

totype (designated by Hall in J. S. African Bot., Suppl.

5: 202. 1965): SOUTH AFRICA. Cape of Good Hope,

Lindley t. 1147 (illustration in Bot. Reg. 14: tab. 1147!).

Orthochilus euanthus (Schltr.) Bytebier, com b. nov. ≡ Eulophia

euantha Schltr. in Bot. Jahrb. Syst. 53: 586. 1915 ≡ Eulophia

abyssinica var. euantha (Schltr.) Geerinck, Fl. Afr. Cent r.,

Sperm., Orch.(2): 680. 1992 – Holotype: TANZANIA.

Rungwe, Masukulu [Mwasukulu] Forest, Dec 1906, Stolz

197 (B†; record of holotype: K barcode K000078610!).

(K000078610!, K000078611!, L0061223!, L0061224!,

M0103426!, WAG0114789! all have the same collector number

and have therefore been indicated as isotypes, but are either

from a different locality or were collected at a later date.)

Orthochilus eustachyus (Rchb.f.) Bytebier, comb. nov. ≡

Ptero glossaspis eustachya Rchb.f., Otia Bot. Hamburg.: 67.

1878 ≡ Eulophia eustachya (Rchb.f.) Geerinck, Fl. Rwanda

4: 572. 1988 – Holotype: ETHIOPIA. Tigre and Begem-

de r, 1863–1868, Schimper 1235 (miscited by Reichenbach

as 1735 ) (W n.v.; isotypes: CGE barcode CGE00093!, K

barcodes K000306613!, K000306614 [fragment, drawing

and tracing of holotype]!).

Orthochilus foliosus (Lindl.) Bytebier, comb. nov. ≡ Cyrto-

pera foliosa Lindl. in Compan. Bot. Mag. 2: 203. 1837 ≡

Eulophia foliosa (Lindl.) Bolus in J. Linn. Soc., Bot. 19:

337. 1882 – Lectotype (designated by Hall in J. S. Afri-

can Bot., Suppl. 5: 180. 1965): SOUTH AFRICA. East-

ern Cape, between Bashee and Umtata [inter Basche et

Omtala], Drége s.n. (K [drawi ng] n.v.).

Orthochilus holubii (Rolfe) Bytebier, comb. nov. ≡ Eulo-

phia holubii Rolfe in Oliver, Fl. Trop. Afr. 7: 60. 1897

– Lectotype (designated by Hall in Linder & Kurzweil,

Orch. S. Afr.: 370. 1999): BOTSWANA. Leshumo Valley,

Jan 1876, Holub s.n. (K ba rcode K00 0410163!).

In the protologue, Rolfe lists two specimens as follows:

“Northern Bechuanaland: Leshumo Valley, Holub !; Near the

Zambesi River, N.W of Sheseheke, Holub !.” These were thus to

be treated as syntypes (see for instance Geerinck, 1992: 674).

At Kew there are two sheets referable to the protologue. One

of these, K000410163, bears a label “Leshumo Valley, Jan 76,

Northern Bechuanaland”; the other, K000078612!, bears two

labels “13 M. NNW from Shesheke on the Zambesi River,?

76” and “Leshumo Valley, Feb 76”. Hall (1999: 370) lecto-

typified this species as follows “Botswana, Leshumo Valley,

Holub (K!, lecto.)”, which could apply to both sheets. Although

sheet K000078612, bears a conf. slip by Hall (with no indica-

tion to the type status of this specimen), we assume that the

lectotypification refers to the other sheet, K000410163, that

bears only a “Leshumo Valley” label.

Orthochilus leontoglossus (Rchb.f.) Bytebier, comb. nov.

≡ Eulophia leontoglossa Rchb.f. in Flora 64: 329. 1881

– Lectotype (designated by Hall in Linder & Kurzweil,

Orch. S. Afr.: 394. 1999): SOUTH AFRICA. Mpumalanga

[Transvaal], chiefly near Lydenburg, Dec 1873–Jan 1874,

Atherstone s.n. (K barcode K000410469!; isolectotype:

W n .v.).

Orthochilus litoralis (Schltr.) Bytebier, comb. nov. ≡ Eulophia

litoralis Schltr. in Bot. Jahrb. Syst. 26: 338. 1899 – Holo-

type: SOUTH AFRICA. Western Cape, Caledon, Hawston,

28 Nov 1896, Schlechter 9468 (B†; isotypes: BOL barcode

BOL149993!, BM barcode BM000525657!, BR barcode

BR0000008811974!, GRA barcode GRA0000799-0!, HBG

barcode HBG-501701!, K barcode K000410481!, L bar-

code L0061226!, P barcode P00365264!, PH barcodes

PH00013316!, PH00013317!, PRE barcodes PRE0057153-0!,

PRE0588835-0!, PRE0588836-0!, S No. S07-5055!, W n.v.,

WAG barcode WAG0002531!, Z barcode Z-000016429!).

Orthochilus mechowii Rchb.f. in Flora 65: 532. 1882 ≡ Eulo-

phia mechowii (Rchb.f.) T.Durand & Schinz, Consp. Fl.

Afric. 5: 23. 1894 – Holotype: ANGOLA. Malange, Oct/

Nov 1879, von Mechow 300 (W n.v.; isotypes: K [fragment

and drawing], Z000016431!).

Orthochilus milnei (Rchb.f.) Bytebier, comb. nov. ≡ Eulo-

phia milnei Rchb.f., Otia Bot. Hamburg.: 116. 1881 ≡

Graphorkis milnei (Rchb.f.) Kuntze, Revis. Gen. Pl. 2:

662. 1891 – Holotype: ?CAMEROON/GABON/EQUA-

TORIAL GUINEA. Nimbo River, Benito Ground, Milne

s.n. (W n.v.; record of holotype: K barcode K000410405!).

Orthochilus montis-elgonis (Summerh.) Bytebier, comb.

nov. ≡ Eulophia montis-elgonis Summerh. in Bull. Misc.

Inform. Kew 1932: 509. 1932 – Holotype: KEN YA.

Mount Elgon, May–Jun 1931, Lugard 663 (K barcodes

K000078633 [sheet I]!, K000078632 [sheet II]!).

Orthochilus nuttii (Rolfe) Bytebier, comb. nov. ≡ Eulophia nuttii

Rolfe in Oliver, Fl. Trop. Afr. 7: 63. 1897 – Holotype: ZAM-

BIA. Fwambo, 1896, Nutt s.n. (K barcode K000078634!).

Orthochilus odontoglossus (Rchb.f.) Bytebier, comb. nov. ≡

Eulophia odontoglossa Rchb.f. in Linnaea 19: 373. 1846

≡ Graphorkis odontoglossa (Rchb.f.) Kuntze, Revis. Gen.

Pl. 2: 662. 1891 – Holotype: SOUTH AFRICA. Durban

[Port Natal], Gueinzius ( W n .v.).

Orthochilus pottsii (P.M.Br. & DeAngelis) Bytebier, comb.

nov. ≡ Pteroglossaspis pottsii P.M.Br. & DeAngelis

in N. Amer. Native Orchid J. 13: 31. 2007 – Holotype:

U.S.A. Florida, Citrus, Potts Preserve, 20 Oct 2006,

DeAngelis s.n. (FLAS n.v.).

TAX ON

63 (1) • February 2014: 9–23Martos & al. • Phylogeny of Eulophiinae orchids

20 Version of Record (identical to print version).

Orthochilus rarus (Schltr.) Bytebier, comb. nov. ≡ Eulophia

rara Schltr. in Bot. Jahrb. Syst. 53: 582. 1915 – Holotype:

TANZANIA. Rungwe, Mulinda Forest, Jan 1913, Stolz

1815 (B†; record of holotype: K n.v.).

Orthochilus rutenbergianus (Kraenzl.) Bytebier, comb. nov.

≡ Eulophia rutenbergiana Kraenzl. in Abh. Naturwiss.

Vereins Bremen 7: 255. 1882 ≡ Graphorkis rutenbergiana

(Kraenzl.) Kuntze, Revis. Gen. Pl. 2: 662. 1891 ≡ Lisso-

chilus kranzlinii H. Perrier in Fl. Madag. 49(2): 13. 1941

– Holotype: MADAGASCAR. Nähe von Antananarivo,

18 Dec 1877, Rutenberg s.n. (B†) – Neotype: MADA-

GASCAR. Imerina, Jan 1881, Hildebrandt 3842 (K n.v.;

isoneotype: BM n.v., M barcode M0103415!, P barcode

P00108964!, W n.v.).

The description of this species by Kraenzlin was based on

one specimen collected by Rutenberg in Madagascar. Ruten-

berg’s material was originally deposited at Bremen and the type

specimens were expropriated by Soviet troops and are thought

to be at CSR (Dorr, 1997). Kraenzlin’s types were mostly in

his own herbarium, which was acquired by B in 1907 and de-

stroyed during the bombing of B at the end of WWII. Under

these circumstances, it is not clear whether type material is

still extant. Hermans & al. (2007), assume that the type has

been destroyed at B, and designated Hildebrandt 3482 as a

“lectotype”. Since no other material than the Rutenberg spec-

imen collected on 18 Dec 1877 was mentioned by Kraenzlin,

Hildebrandt 3482 should be considered a neotype (Art. 9.7 of

the Melbourne Code) and not a lectotype.

Orthochilus ruwenzoriensis (Rendle) Bytebier, comb. nov.

≡ Eulophia ruwenzoriensis Rendle in J. Bot. 33: 166.

1895 ≡ Pteroglossaspis ruwenzoriensis (Rendle) Rolfe in

Oliver, Fl. Trop. Afr. 7: 100. 1897 – Syntypes: UGANDA.

Ruwenzori (eastern side), Apr–May 1894, Scott Elliot

7813 (BM barcode BM000911528!; isosyntype: K bar-

code K000306611!), Scott Elliot 7859 (BM barcode

BM000525768!; isosyntype; K barcode K000306610!),

Scott Elliot 7551 (BM barcode BM000911529!).

Orthochilus subulatus (Rendle) Bytebier, comb. nov. ≡ Eulo-

phia subulata Rendle in J. Bot. 33: 167. 1895 – Holotype:

UGAN DA. Katonga River South of Uganda (Victoria

Region), 26 Feb 1894, Scott Elliot 7417 (BM n.v.; isotype:

K barcode K000410218!).

Orthochilus tabularis (L.f.) Bytebier, comb. nov. ≡ Satyrium

tabulare L.f., Suppl. Pl.: 402. 1782 ≡ Serapias tabularis

(L.f.) Thunb., Prodr. Pl. Cap.: 3. 1794 ≡ Cymbidium tab-

ulare (L.f.) Sw. in Nova Acta Regiae Soc. Sci. Upsal. 6:

77. 1799 ≡ Epidendrum tabulare (L.f.) Poir. in Lamarck,

Encycl., Suppl. 1: 376. 1810 ≡ Eulophia tabularis (L.f.)

Bolus in Trans. S. African Philos. Soc. 5(1): 108. 1888 –

Holotype: SOUTH AFRICA. Western Cape, Cape Penin-

sula, Table Mountain, Thunberg s.n. (UPS-THUNB n.v.),

but see comments by Hall (1965: 191–192).

Orthochilus thomsonii (Rolfe) Bytebier, comb. nov. ≡ Eu-

lophia thomsonii Rolfe in Oliver, Fl. Trop. Afr. 7: 66.

1897 – Holotype: TANZANIA. Between Lakes Tanga-

nyika and Malawi [Nyassa], Thomson s.n. (K barcode

K000078621!).

Orthochilus trilamellatus (De Wild.) Bytebier, comb . nov.

≡ Eulophia trilamellata De Wild. in Bull. Jard. Bot. État

Bruxelles 6: 127. 1919 – Holotype: D. R. CONGO. Région

de Lualaba (Katanga), Valéé de la Kapanda, Dec 1912,

Homblé 978 (BR barcode BR0000008813879!, isotype:

BR barcode BR0000008813541!).

There are two duplicates of Homblé 978 at BR. Neither

De Wildeman in the protologue, nor Geerinck in Flore d’Afri-

que Centrale (1992: 697), indicate which one of the two is the

holotype. However, there are clear indications on specimen

BR0000008813879 that this was used to prepare the drawings

which are part of the protologue and therefore this specimen

should be considered the holotype.

Orthochilus vinosus (McMurtry & G.McDonald) Bytebier,

co mb. nov. ≡ Eulophia vinosa McMurtry & G.McDonald,

Field Guide Orch. N. South Africa Swaziland: 467. 2008 –

Holotype: SOUTH AFRICA. Mpumalanga, Dullstroom,

east of village, McMurtry 4072 (PR E n.v.).

Orthochilus walleri (Rchb.f.) Bytebier, comb. nov. ≡ Cyrt-

opera walleri Rchb.f., Otia Bot. Hamburg.: 117. 1881 ≡

Eulophia walleri (Rchb.f.) Kraenzl. in Engler, Pflanzenw.

Ost-Afrikas, C: 157. 1895 – Holotype: MALAWI. Man-

ganja Hills, 1865, Waller s.n. (K barcode K000078622!,

isotype: W n.v.).

Orthochilus welwitschii Rchb.f. in Flora 48: 186. 1865 ≡

Eulophia welwitschii (Rchb.f.) Rolfe in Bol. Soc. Brot. 7:

236. 1889 – Holotype: ANGOLA. Huilla, Proteatorum de

Monine, Jan 1860, Welwitsch 720 (W n.v.; isotypes BM

barcode BM000529534!, C barcode C10001057!, HBG bar-

code HBG-501719 [fragment from holotype]!, K barcodes

K000078623!, K000078624 [drawing]!, LISU barcodes

LISU221619!, LISU221620!).

ACKNOWLEDGEMENTS

We would like to thank: N. Barker for advice during an earlier,

pilot phase of this research; the various collectors whose names are

listed in Appendix 1 for sharing samples; Ezemvelo KZN Wildlife

and iSimangaliso Wetland Park for authorizing sampling in KwaZulu-

Natal (No. OP4364/2011); P. De Block, P. Stoffelen, R. Govaerts and

the late J.P. Roux for discussions on nomenclature; E.G.H. Oliver for

comments on the taxonomic treatment, and two anonymous reviewers

and various editors for their constructive comments. F. Martos was

funded by the University of KwaZulu-Natal and the Claude Leon

Foundation as part as a postdoctoral fellowship. The South African

National Research Foundation provided financial support.

Martos & al. • Phylogeny of Eulophiinae orchids

TAX ON

63 (1) • February 2014: 9–23

21Version of Record (identical to print version).

Brown, R. 1821. Lissochilus speciosus. Mr. Griffin’s Lissochilus. Bot.

Reg. 7: t. 573 (578).

Chang, C.-C., Lin, H.-C., Lin, I.-P., Chow, T.-Y., Chen, H.-H., Chen,

W.-H., Cheng, C.-H., Lin, C.-Y., Liu, S.-M., Chang, C.-C. &

Chaw, S.-M. 2006. The chloroplast genome of Phalaenopsis aph-

rodite (Orchidaceae): Comparative analysis of evolutionary rate

with that of grasses and its phylogenetic implications. Molec. Biol.

Evol. 23: 279–291. http://dx.doi.org/10.1093/molbev/msj029

Clements, M.A. & Cribb, P.J. 1989. Oeceoclades. P. 99 in: Clements,

M.A. (ed.), Australian Orchid Research, vol. 1, Catalogue of Aus-

tralian Orchidaceae. Victoria: Australian Orchid Foundation.

Cribb, P.J. 1977. New orchids from south central Africa. Kew Bull. 32:

137–187. http://dx.doi.org/10.2307/4117264

Cribb, P.J. 1989. Flora of tropical East Africa: Orchidaceae (Part 3).

Rotterdam: Balkema.

Cribb, P.J. & Hermans, J. 2009. Field guide to the orchids of Mada-

gascar. Kew: Royal Botanic Gardens.

Cribb, P.J. & Thomas, S.A. 199 7. Eulophia. Pp. 275–283 in: Edwards,

S., Demissew, S. & Hedberg, I. (eds.), Flora of Ethiopia and

Eritrea, vol. 6. Addis Ababa: Addis Ababa University; Uppsala:

Uppsala University.

Cuénoud, P., Savolainen, V., Chatrou, L.W., Powell, M., Grayer, R.J.

& Chase, M.W. 2002. Molecular phylogenetics of Caryophyllales

based on nuclear 18S rDNA and plastid rbcL, atpB, and matK DNA

sequences. Amer. J. Bot. 89: 132 –144.

http://dx.doi.org/10.3732/ajb.89.1.132

Dorr, L.J. 199 7. Plant collectors in Madagascar and the Comoro Is-

lands. Kew: Royal Botanic Gardens.

Douzery, E.J.P., Pridgeon, A.M., Kores, P., Linder, H.P., Kurz-

weil, H. & Chase, M.W. 1999. Molecular phylogenetics of Diseae

(Orchidaceae): A contribution from nuclear ribosomal ITS se-

quences. Amer. J. Bot. 86: 887–889.

http://dx.doi.org/10.2307/2656709

Drummond, A.J., Ashton, B., Buxton, S., Cheung, M., Cooper, A.,

Duran, C., Field, M., Heled, J., Kearse, M., Markowitz , S.,

Moir, R., Stones-Havas, S., Sturrock, S., Thierer, T. & Wilson

A. 2005. Geneious Pro, version 6. Program distributed by Biomat-

ters. http://www.geneious.com/

Du Puy, D., Cribb, P.J., Bosser, J., Hermans, C. & Hermans, J.

1999. The orchids of Madagascar. Kew: Royal Botanic Gardens.

Garay, L.A. & Taylor, P. 1976. The genus Oeceoclades Lindl. Bot.

Mus. Leaf l. 24: 249–274.

Geerinck, D. 1987. Orchidaceae. Pp. 505–629 in: Troupin, G. (ed.),

Flore du Rwanda, vol. 4, Spermatophytes. Tervuren: Musée Royal

de l’Afrique Centrale.

Geer inck , D. 1992. Flore d’Afrique Centrale (Zaire – Rwanda –

Burundi): Spermatophytes; Orchidaceae (seconde partie). Meise:

Jardin Botanique National de Belgique.

Geerinck, D. 2005. La problématique taxonomique du complexe Eulo-

phia abyssinica Reichb. f., E. aurantiaca Rolfe, E. carsonii Rolfe,

E. euantha Sch ltr., E. subulata Rendle, E. thomsonii Rolfe, E. wel-

witschii (Reichb. f.) Rendle, E. zeyheri Hook. f. (Orchidaceae) en

Afrique centrale (Bur undi, Congo-Kinshasa, Rwanda) = The taxo-

nomic problem in the Eulophia abyssinica Reichb. f., E. aurantiaca

Rolfe, E. carsonii Rolfe, E. euantha Schltr., E. subulata Rendle,

E. thomsonii Rolfe, E. welwitschii (Reichb. f.) Rendle, E. zey-

heri Hook. f. complex (Orchidaceae) in Central Africa (Burundi,

Congo-Kinshasa, Rwanda)]. Taxonomania 16: 1–11.

Hall, A.V. 1963. Studies of the South African species of Eulophia R .Br.

ex. Lindl. (Orchidaceae). Ph.D. Dissertation, University of Cape

Town, South Africa.

Hall, A.V. 1965. Studies of the South African species of Eulophia.

J. S. African Bot. suppl. 5: 1–248.

Hermans, J., Hermans, C., Du Puy, D., Cribb, P.J. & Bosser, J. 2007.

Orchids of Madagascar, 2nd ed. Kew: Royal Botanic Gardens.

Humphreys, A.M. & Linder, H.P. 2009. Concept versus data in de-

limitation of plant genera. Ta xon 58: 1054–1072.

Kass, R .E. & Raftery, A.E. 1995. Bayes factors. J. Amer. Statist. Assoc.

90: 773–795.

http://dx.doi.org /10.1080/01621459.1995.10476572

Katoh, K., Misawa, K., Kuma, K.-I. & Miyata, T. 2002. MAFFT: A

novel method for rapid multiple sequence alignment based on fast

Fourier transform. Nucl. Acids Res. 30: 3059–3066.

http://dx.doi.org /10.1093/nar/g kf436

Kocyan, A., Qiu, Y.L., Endress, P.K. & Conti, E. 2004. A phylo-

genetic analysis of Apostasioideae (Orchidaceae) based on ITS,

trnL-F and matK sequences. Pl. Syst. Evol. 247: 203–213.

http://dx.doi.org /10.1007/s00606- 0 04-0133-3

Kores, P., Weston, P., Molvray, M. & Chase, M.W. 2000. Phyloge-

netic relationships within the Diurideae (Orchidaceae): Inference

from plastid matK DNA sequences. Pp. 449–456 in: Wilson, K.L.

& Morrison, D.A. (eds.), Monocots: Systematics and evolution.

Melbourne: CSIRO.

La Croix, I. & Cribb, P.J. 1998. Eulophia. Pp. 458–537 in: Pope, G.V.

(ed .), Flora Zambesiaca, vol. 11(2). Kew: Royal Botanic Gardens.

La Croix, I., La Croix, E.A. S. & La Croix, T.M. 1991. Orchids of

Malawi. Rotterdam: Balkema.

Linder, H.P. & Kurzweil, H. 1999. Orchids of southern Africa. Rot-

terdam: Balkema.

Lind le y, J. 1823. Eulophia guineensis. Sierra Leone Eulophia. Bot.

Reg. 8: t. 686.

Li nd le y, J. 1832. Angraecum eburneum. Ivory Angraceum. Edwa r d s’s

Bot. Reg. 18: t. 1522.

Lindley, J. 1833. The genera and species of orchidaceous plants. Lon-

don: Ridgway.

Maddison, D.R. & Maddison, W.P. 2000. MacClade 4: Analysis of

phylogeny and character evolution, version 4. Sunderland, Mas-

sachusetts: Sinauer.

Nylander, J.A.A. 2004. MrModeltest, version 2. Program distributed

by the author. Evolutionary Biology Centre, Uppsala University.

http://www.abc.se/~nylander/mrmodeltest2/mrmodeltest2.html

Ogura-Tsujita, Y. & Yukawa, T. 2008. High mycorrhizal specific-

ity in a widespread mycoheterotrophic plant, Eulophia zollingeri

(Orchidaceae). Amer. J. Bot. 95: 93–97.

http://dx.doi.org/10.3732/ajb.95.1.93

Perrier de la Bâthie, H. 19 41. Orchidées, vol. 2. 49

Famille in: Hum-

bert, H. (ed.), Flore de Madagascar. Tananarive: Imprimerie Of-

ficielle.

Peter, C.I. & Johnson, S.D. 2006. Anther cap retention prevents self-

pollination by elaterid beetles in the South Af rican orchid Eulophia

foliosa. Ann. Bot. (Oxford) 97: 345–355.

http://dx.doi.org/10.1093/aob/mcj041

Peter, C.I. & Johnson, S.D. 2009a. Autonomous self-pollination and

pseudo-fruit set in South African species of Eulophia (Orch id-

aceae). S. African J. Bot. 75: 791–797.

http://dx.doi.org /10.1016/j.s ajb.20 09.07.007

Peter, C.I. & Johnson, S.D. 2009b. Reproductive biology of Acrolophia

cochlearis (Orchidaceae): Estimating rates of cross-pollination in

epidendroid orchids. Ann. Bot. (Oxford) 104: 573–581.

http://dx.doi.org/10.1093/aob/mcn218

Peter, C.I. & Johnson, S.D. 2009c. Pollination by flower chafer bee-

tles in Eulophia ensata and Eulophia welwitschii (Orchidaceae).

S. African J. Bot. 75: 762–770.

http://dx.doi.org /10.1016/j.s ajb.20 09.07.00 8

Peter, C.I. & Johnson, S.D.

2013

. Generalized food deception: Colour

signals and efficient pollen transfer in bee-pollinated species of

Eulophia (Orchidaceae). Bot. J. Linn. Soc. 171: 713–729.

ht t p://d x.doi .org/10 .1111/ b oj.12028

Poggio, L., Naranjo, C.A. & Jones, K. 1986. The chromosomes of

orchids IX. Eulophia. Kew Bull. 41: 45–49.

http://dx.doi.org /10.2307/4103025

Popescu, A.-A.A., Huber, K.T.K. & Paradis, E .E. 2012. ape 3.0: New

LITERATURE CITED

TAX ON

63 (1) • February 2014: 9–23Martos & al. • Phylogeny of Eulophiinae orchids

22 Version of Record (identical to print version).

tools for distance-based phylogenetics and evolutionary analysis

in R. Bioinformatics 28: 1536–1537.

http://dx.doi.org/10.1093/bioinformatics/bts184

Pridgeon, A.M., Cribb, P.J., Chase, M.W. & Rasmussen, F.N. (eds.)

2009. Genera orchidacearum, vol. 5, Epidendroideae, pt. 2. Ox-

ford: Oxford University Press.

Quattrocchi, U. 2000. CRC world dictionar y of plant names. Boca

Raton: CRC Press.

Reichenbach, H.G. 1878. Otia botanica hamburgensia, pt. 1. Hamburg:

Typis T.T. Meissneri.

Reichenbach, H.G. 1881. Otia botanica hamburgensia, pt. 2(1). Ham-

burg: Typis T.T. Meissneri.

Richard, A. 1850. Tentamen florae abyssinicae, vol. 2. Paris: Bertrand.

Rolfe, R.A. 1912. Acrolophia. Pp. 12–17 in: Thiselton-Dyer, W.T. (ed.),

Flora capensis, vol. 5(3). Ashford: Reeve & Co.

Ronquist, F., Huelsenbeck, J.P. & Teslenko, M. 2011. Draft MrBayes

version 3.2 manual: Tutorials and model summaries. http://

mrbayes.sourceforge.net/mb3.2_manual.pdf

Ronquist, F., Teslenko, M., Van der Mark, P., Ayres, D.L., Darling,

A., Höhna, S., Larget, B., Liu, L., Suchard, M.A. & Huelsen-

beck, J.P. 2012. MrBayes 3.2: Efficient Bayesian phylogenetic

inference and model choice across a large model space. Syst. Biol.

61: 539–542. http://dx.doi.org/10.1093/sysbio/sys029

Shaw, J., Lickey, E.B., Schilling, E.E. & Small, R.L. 2007. Compari-

son of whole chloroplast genome sequences to choose noncoding

regions for phylogenetic studies in angiosperms: The tortoise and

the hare III. Amer. J. Bot. 94: 275–288.

http://dx.doi.org/10.3732/ajb.94.3.275

Stewart, J., Linder, H.P., Schelpe, E.A. & Hall, A.V. 1982. Wild or-

chids of southern Africa. Johannesburg: Macmillan South Africa.

Summerhayes, V.S. 1936. African orchids: VIII. Bull. Misc. Inform.

Kew 1936: 221–36.

Summerhayes, V.S. 1957. The genus Eulophidium Pfitz. Bull. Jard.

Bot. Etat Bruxelles 27: 391– 403.

http://dx.doi.org/10.2307/3667072

Summerhayes, V.S. 1968. Eulophia. Pp. 243–250 in: Hutchinson, J.,

Dalziel, J.M. & Hepper, F.N. (eds.), Flora of west tropical Africa,

vol. 3(1). London: Crown Agents for Oversea Governments and

Administrations.

Summerhayes, V.S. & Hall, A.V. 1962. The type species and conser-

vation of the generic name Eulophia R.Br. ex Lindl. Taxo n 11:

201–203. http://dx.doi.org/10.2307/1217222

Sun, Y., Skinner, D.Z., Liang, G.H. & Hulbert, S.H. 1994. Phylo-

genetic analysis of Sorghum and related taxa using internal tran-

scribed spacers of nuclear ribosomal DNA. Theor. Appl. Genet.

89: 26–32. http://dx.doi.org/10.1007/BF00226978

Swofford, D.L. 2002. PAUP*: Phylogenetic analysis using parsimony

(*and other methods). Sunderland, Massachusetts: Sinauer.

Szlachetko, D.L . & Kowalkowska, A. 2007. Contributions to the

ORCHID f lora of Guinea, West Africa. Polish Botanical Studies

25. Krakow: W. Szafer Institute of Botany, Polish Academy of

Sciences.

Szlachetko, D.L . & Olszewski, T. 1998. Eulophia. Pp. 602–663

in: Satabie, B. & Morat, P. (eds.), Flore du Cameroun, vol. 35.

Yaounde: Ministère de l’Enseignement Superieur de l’Informatique

et de la Recherche Scientifique.

Szlachetko, D.L., Sawicka, M. & Kras-Łapińska, M. 2004. Flore du

Gabon, vol. 37, Orchidaceae II. Paris: Muséum National d’Histoire

Naturelle.

Thomas, S.A. 1996. Eulophia pulchra. Orchidaceae. Curtis’s Bot. Mag.

13: 82–85. ht tp://d x.doi.or g /10.1111/j.1467-8748 .1996 .tb005 4 6.x

Thomas, S.A. 1998. A preliminary checklist of the genus Eulophia.

Lindleyana 13: 170 –202 .

Williamson, G. 1977. The orchids of south central Africa. London:

Dent & Sons.

WCSP 2013. World Checklist of Selected Plant Families. Facilitated

by the Royal Botanic Gardens, Kew. http://apps.kew.org/wcsp/

(accessed 10 Jan 2013).

Wu, F.-H., Chan, M.-T., Liao, D.-C., Hsu, C.-T., Lee, Y.-W., Daniell,

H., Duvall, M.R. & Lin, C.- S. 2010. Complete chloroplast genome

of Oncidium Gower Ramsey and evaluation of molecular markers

for identification and breeding in Oncidiinae. B. M. C. Pl. Biol.

10: 68. http://dx.doi.org/10.1186/1471-2229-10-68

Appendix 1.

Taxa included in this study.

Taxon name including authority: countr y, largest p olitical subdivision, locality, collection date, collector and collector numbe r (herbariu m acronym), GenBan k

accession numbers in the order ITS, rbcL, trnK-matK, rp l32-trn L, and trn Q-5′ r ps16 . A dash (–) denotes missing sequence; an asterisk (*) denotes species for

which taxonomic changes (transfer to the genera Orthochilus or Oeceoclades) are proposed.

Acrolophia bolusii Rolfe: South Africa, Western Cape, Groot Hagelkraal, 7 Nov 2001, Bytebier 2120 (BR, K, NBG, NY), KF318909, KF358051, KF358114,

KF363835, KF358146; South Africa, Western Cape, Houw Hoek, 14 Oct 2011, Staerker s.n. (NU [photographs]), KF318933, KF358055, KF358115, KF363899,

KF358193. Acrolophia capensis (P.J.Bergius) Fourc.: South Af rica, Eastern Cape, Joubertina, Oct 2011, Staerker s.n. (NU [phot ographs]), KF318958, KF358001,

KF358074, KF363914, KF358167. Acrolophia cochlearis (Lindl.) Schltr. & Bolus: South Africa, Eastern Cape, Langkloof Valley, Oct 2012, Thornton Smith

AC1 (NU), KF318947, KF358029, KF358059, KF363915, KF358212; South Africa, KwaZulu-Natal, Umtamvuna N.R., 28 Sep 2011, Staerker s.n. (NU [pho-

tograph s]), –, KF358000, K F358097, KF363880, KF358137. Acrolophia lamellata (Li ndl.) Pfitzer: South Africa, Western Cape, Groot Hagelk raal, 7 Nov 2001,

Bytebier 2125 (BR, K, NBG), KF318964, KF358002, KF358063, KF363896, KF358174. Acrolophia lunata (Schltr.) Schltr. & Bolus: South Africa, Easter n

Cape, Langkloof Valley, Oct 2011, Thornton Smith AL1 (NU ), KF318965, KF358006, KF358129, KF363871, KF358176. Acrolophia micrantha (Lindl.) Pfitzer:

South Africa, Western Cape, Betty’s Bay, 14 Oct 2011, Staerker s.n. (NU [photographs]), KF318913, KF358019, KF358111, KF363833, KF358173. Acrolophia

sp. aff . cochlearis: South Africa, Eastern Cap e, Langkloof Valley, Oct 2011, Thornton Smith A M1 (N U), KF318912, KF358003, KF358116, KF363840, KF358163.

Acrolophia ustulata (Bolus) Schltr. & Bolus: South Africa, Western Cape, Robinson Pass, 27 Nov 2012, Vl ok 2891 (NU), KF318963, KF358027, KF358121,

KF 363911, KF358152 . Ansellia africana Lindl.: South Afr ica, KwaZulu-Natal, U KZN Botanical Garden, 23 Sep 2011, Mar to s 748 ( NU), K F318915, KF358009,

KF358098, KF363854, KF358189. Eulophia aculeata (L.f.) Spreng.*: South Africa, East ern Cape, Grahamstown, Rabbit s Wood, 29 Nov 2001, Pet er 431 (NU),

KF318949, –, KF358077, KF363872, KF358147. Eulophia acutilabra Summerh., Tanzania, Ruvuma, Mkuju river project area, 4 Dec 2011, McClelan d 790

(BNRH), KF318954, KF358035, KF358103, KF363875, KF358150. Eulophia angolensis (Rchb.f.) Summerh.: South Africa, Mpumalanga, Witklipdam, 30

Dec 2002, Bytebier 2480 ( BR, K, N BG, NY), KF318932, KF358031, KF358075, KF363905, KF358139. Eulophia calanthoides Schltr.: South Af rica, KwaZulu-

Natal, Wahroonga Farm, 8 Feb 2001, Pete r 357 (NU), KF318896, –, KF358107, KF363844, KF358175. Eulophia callichroma Rchb.f.: South Africa, Mpuma-

langa, Songimvelo N.R., 22 Nov 2012, Staerker s.n. (NU), KF318903, KF358041, KF358058, KF363904, –. Eulophia chlorantha Schltr.*: Swaziland, Hhohho,

Mbabane, 4 Nov 2011, Staerker s.n. (NU), KF318939, KF358025, KF358124, KF363848, KF358140. Eulophia clitellifera (Rchb.f.) Bolus: South Africa,

KwaZulu-Natal, Pieter maritzburg, Wembley, 17 Nov 2000, Peter 296 ( NU), –, –, KF358056, KF363879, KF358184. Eulophia coeloglossa Schltr.: South Af rica,

KwaZulu-Natal, Umtamvuna N.R., 6 Dec 2012, Staerker s.n. (NU), KF318961, KF358016, KF358071, KF363873, KF358182. Eulophia cucullata (Afzel. ex

Sw.) Steud.: South Africa, KwaZulu-Natal, Mabibi N.R., 15 Nov 2001, Pete r 418 (NU), KF318946, KF358047, KF358106, KF363865, KF358145. Eulophia

ensata Lindl.*: South Africa, KwaZulu-Natal, T hornville, 30 Dec 2002, Peter 4035 (for m cream) (GRA), KF318956, KF358021, KF358117, KF363851, KF358136;

South Africa, KwaZulu-Natal, Amatigulu, 15 Dec 2001, Peter s.n. (for m cream) (GRA), KF318931, –, KF358073, KF363870, KF358172; South Africa,

Martos & al. • Phylogeny of Eulophiinae orchids

TAX ON

63 (1) • February 2014: 9–23

23Version of Record (identical to print version).

KwaZulu-Natal, Thornville, 30 Dec 2002, Peter 4033 (form yellow) (GRA), KF318957, –, KF358082, KF363887, KF358156. Eulophia flavopurpurea (Rchb.f.)

Rolfe, Cameroon, Littoral, Melon, 8 Mar 2007, Bytebier 2742 (YA, BR), KF318930, –, KF358069, KF363838, KF358181. Eulophia foliosa (Lindl.) Bolus*:

South Africa, Mpumalanga, Long Tom Pass, 31 Dec 2002, Bytebier 2484 (BR, K, NBG), –, –, K F358101, KF363858, KF358142; South Af rica, KwaZulu-Natal,

Himeville, 17 Dec 2000, Peter 33 8 (NU, NH), KF318920, KF358034, KF358113, KF363888, KF358179. Eulophia graminea Lindl.: Singapore, South Keppel,

Sentosa, 16 Nov 2011, Pet er 759 8 (GRA), KF318890, KF358040, KF358078, KF363897, –. Eulophia guineensis Lindl.: Kenya, Western, Kakamega Forest,

12 Feb 2009, Odhiambo 36 (EA), KF318960, KF358028, KF358080, KF363849, KF358209. Eulophia hereroensis Schltr.: South Africa, KwaZulu-Natal,

Ashburton, 4 Nov 2000, Peter 302 (NU), KF318940, –, KF358066, KF363906, KF358138. Eulophia hians Spreng. var. hians: South Africa, Mpumalanga,

Lydenburg, 26 Sep 2011, Staerker s.n. (NU ), KF318959, KF358052, KF358112, KF363913, KF358151; South Africa, Ea stern Cape, Port Elizabeth, Bridgemead,

1 Nov 2003, Pete r 5277 (GRA), KF318892, KF358024, KF358060, K F363831, KF358166; South Africa, KwaZulu-Nat al, Umtamvuna N.R., 9 Nov 2011, Grieve

476 (N U), KF318950, –, KF358096, K F363874, KF358190. Eulophia hians var. inaequalis (Schltr.) S. Thomas: South Africa, KwaZulu-Nat al, Pietermar itzburg,

Ukilinga Farm, 28 Aug 2012, Bytebier 3464 (NU), KF318942, KF358015, KF358104, KF363892, KF358154; South Africa, KwaZulu-Natal, Wagendrift Dam,

3 Oct 2002, Pe te r 3774 (GRA), KF318902, –, KF358100, KF363881, –. Eulophia hians var. nutans (Sond.) S. Thomas: Malawi, Northern Region, Nyika

Plateau, 4 Feb 2003, Pet er 4183 (GRA), KF318928, –, KF358135, KF363898, KF358171. Eulophia horsfallii (Bateman) Summerh.: South Africa, KwaZulu-

Natal, Pal m Beach, 14 Jan 2001, Peter 5496 (GR A), KF318922, –, –, KF363902, K F358160; Tanzania, Ruv uma, Mkuju r iver project area, 7 Dec 2011, McCleland

793 (BNRH), KF318926, KF358018, KF358109, KF363876, KF358191. Eulophia huttonii Rolfe*: South Africa, KwaZulu-Natal, Garden Castle, 1 Dec 2001,

Pete r 434 (NU ), KF318910, –, –, KF363912, –. Eulophia leontoglossa Rchb.f.*: South Africa, KwaZulu-Natal, Cobham, 6 Jan 2002, Pet er 448 (N U) , K F3189 41,

KF 357998, KF 358132, KF 363882 , KF358198. Eulophia litoralis Schltr.*: South Afr ica, Weste rn Cape, Jonkershoek, 9 Dec 2009, Bytebier 3163 (NU) , K F3189 01,

KF358043, KF358085, KF363863, KF358194. Eulophia livingstoneana (Rchb.f.) Summerh., Tanzania, Ruvuma, Mkuju river project area, 4 Dec 2011,

McClel and 792 (BNRH), KF318943, –, KF358057, KF363846, KF358161. Eulophia longisepala Rendle, Tanzania, Ruvu ma, Mkuju river project area, 29 Nov

2011, Mc Cle la nd 78 8 (BNRH), KF318918, KF358010, KF358086, KF363843, KF358188. Eulophia macowanii Rolfe: South Africa, Eastern Cape, Umtata,

UNI TRA campus, 28 Nov 2001, Peter 429 (N U), KF318904, –, K F358120, KF363842, KF358144. Eulophia mechowii (Rchb.f.) T. Durand & Schinz*: Angola,

Huila, Upper Zootechnica, 16 Jan 2009, Be l lst e d t 1197 (NU), KF318914, KF358013, KF358102, KF363868, KF358157. Eulophia meleagris Rchb.f.: South

Africa, Mpumalanga, Dullstroom, 20 Feb 2012, Ma rtos 797 (NU), KF318936, KF357999, KF358083, KF363859, KF358162. Eulophia milnei Rchb.f.*: South

Africa, KwaZulu-Natal, Umtamvuna N.R., 6 Dec 2012, Staerker s.n. (NU), KF318923, KF358049, –, KF363860, KF358195. Eulophia odontoglossa Rchb.f.*:

Tanzania, Njombe, Njombe, 19 Feb 2003, Bytebier 2551 (EA), KF318951, KF358044, KF358105, KF363841, KF358158; Tanzania, Njombe, Njombe, 19 Feb

2003, Bytebier 2546 (BR, DSM, EA, K, NY), KF318935, KF358038, KF358089, KF363855, KF358200. Eulophia ovalis var. bainesii (Rolfe) P.J.Cribb & La

Croix, Malawi, Northern Region, Nyika Plateau, 4 Feb 2003, Pete r 4182 (GRA), KF318905, KF358020, KF358064, KF363909, KF358153. Eulophia ovalis

Lindl. var. ovalis: South Africa , Mpumalanga, Agnes Mine, 29 Dec 2002, Bytebier 2476 (BR, K, N BG), KF318908, KF357997, KF358125, KF363857, KF358164;

South Africa, KwaZulu-Natal, Wahroonga Farm, 8 Feb 2001, Pete r 358 (GRA, NU), KF318929, –, KF358087, KF363853, KF358186. Eulophia parvif lora

(Lindl.) A.V.Hall: South Africa, KwaZulu-Natal, Vernon Crookes NR, 16 Jul 2011, Martos 738 (form long spur) (NU), KF318966, KF358046, KF358070,

KF363886, KF358168; South Africa , KwaZulu-Natal, Harburg Eag le View, 17 Dec 2011, Johnson s.n. (form long spur) (N U), –, KF358017, KF358062, KF363866,

KF358185; South Africa, Eastern Cape, Port Elizabeth, Skoenmaakerskop, 14 Nov 2006, Peter 5959f (form Port Elizabeth) (GRA), KF318895, KF358030,

KF358065, KF363890, KF358202; South Africa, Eastern Cape, Grahamstown, Dassie K rantz, 8 Nov 2006, Pet er 5943 (form short spur) (GRA), KF318893, –,

KF358122, KF363850, KF358159. Eulophia parvilabris Lindl.: South Africa, KwaZulu-Natal, Springside N.R., 28 Jan 2001, Peter s.n. (GRA), KF318927, –,

KF358130, KF363878, KF358178. Eulophia petersii (Rchb.f.) Rchb.f.: South Africa, Mpumalanga, Lowveld Botanical Gardens, Nelspruit, 6 Dec 2000, Pe ter

s.n. (GRA), KF318906, –, KF358128, KF363895, KF358143; Kenya, Nyanza, Mfangano Island, 7 Aug 2000, Ki rik a 528 (E A), K F318897, KF 358012, K F358067,

KF363837, KF358155. Eulophia platypetala Lindl.: South Africa, Western Cape, 30 Apr 2005, Pete r 5635 (GRA), –, KF358004, KF358088, KF363877,

KF358197. Eulophia pulchra (Thouars) Lindl.*: Reunion, Saint Philippe, Basse Vallée, 8 Feb 2011, Mar tos 732 (REU), KF318919, KF358022, KF358081,

KF363847, KF358165; Tanzania, Iringa, Udzungwa Mountain NP, 8 Nov 1997, Luke 5010 (EA, K), KF318911, KF358042, KF358079, KF363891, KF358170;

Reunion, Entre-Deux, Bayon ne Dimitile, 21 Jan 2011, Pailler s.n. (REU), KF318938, KF358053, KF358090, KF363862, KF358180. Eulophia ruwenzoriensis

Rendle*: Tanzania, Mbeya, Kitulo Plateau, 13 Mar 2005, Van der Niet 407 ( NU), KF318894, KF358032, KF358072, KF363883, KF358211. Eulophia ? schnel-

liae L.Bolus: South Africa, KwaZulu-Natal, Port Edwards, 27 Feb 2011, Church s.n. (N U), KF318891, KF358045, KF358126, KF363864, KF358187. Eulophia

schweinfurthii Kraenzl.: South Africa, KwaZulu-Natal, Port Edwards, 27 Feb 2011, Church s.n . (NU), KF318924, –, KF358133, KF363834, –. Eulophia

speciosa (R.Br.) Bolus: South Africa, KwaZulu-Natal, St Lucia, 12 Nov 2011, Mar to s 763 (NU), KF318967, KF358023, KF358123, KF363884, KF358183.

Eulophia stachyodes Rchb.f.: Kenya, Western, Kakamega Forest, 19 Feb 2009, Odhiambo 213 (EA), KF318953, KF358050, KF358094, KF363839, KF358199.

Eulophia streptopetala var. stenophylla (Summerh.) P.J.Cribb: Kenya, Nairobi, Nairobi Arboretum, 16 Mar 1995, Bytebier 494 (EA), KF318925, KF357996,

KF358093, KF363869, KF358201. Eulophia streptopetala Lindl. var. streptopetala: South Africa, Eastern Cape, Port Alfred, 21 Oct 2006, Peter 5933 (GR A),

KF318921, –, KF358134, KF363889, KF358192; D.R. Congo, Orientale, Mongbwalu, 21 Jan 2011, Bytebier 3239 (BR, EA, EPU, NU), KF318934, KF358048,

KF358110, KF363901, KF358207; Kenya, Central, Lake Ol Bolossat, 27 Ju n 2007, Odhiambo 34 (EA), KF318898, KF358011, KF358131, KF363903, KF358208.

Eulophia stricta Rolfe: Kenya, Coast, Kinango Kwale, 15 Dec 2007, Odhiambo 84 (EA), KF318955, –, KF358127, KF363908, –. Eulophia tabularis (L.f.)

Bolus*: South Africa, Wester n Cape, Table Mountain, 10 Dec 2010, Staerker s.n. (GRA), KF318907, KF358014, KF358092, KF363894, KF358169. Eulophia

tenella Rchb.f.: South Africa, Eastern Cape, Grahamstown, 16 Jan 2002, Pe ter 455 (NU), KF318900, KF358007, KF358119, KF363910, KF358196. Eulophia

tuberculata Bolus: South Africa, Eastern Cape, Grahamstown, Ecca Pass Wild Flower Reserve, 22 Dec 2006, Pet er 59 61 (GRA), KF318945, KF358037,

KF358076, KF363856, KF358210. Eulophia vinosa McMurtry & G.McDonald*: South Africa, KwaZulu-Natal, Balgowan, 19 Sep 2001, Peter s.n. (GRA),

KF318952, –, –, KF363852, –. Eulophia welwitschii (Rchb.f.) Rolfe*: South Africa, KwaZulu-Natal, Far Away Farm, 6 Jan 2010, Bytebier 3167 (BR, NU), –,

–, KF358095, KF363832, KF358141. Eulophia zeyheriana Sond.: South Africa, KwaZulu-Natal, Cobham, 6 Jan 2002, Peter 447 (NU), KF318948, KF358026,

KF358091, KF363916, KF358148. Oeceoclades bernetii J.-B.Castillon: Reunion, Saint Denis, Ilet à Guillaume, 12 Mar 1992, Jubault s.n. (REU), KF318937,

KF358039, KF358068, KF363836, KF358206; Reunion, Saint Joseph, Plaine des Grègues, 4 Apr 2010, Pailler s.n. (REU), –, –, –, KF363893, –. Oeceoclades

maculata (Lind l.) Lindl.: Kenya, Weste rn, Kakamega Forest, 7 Oct 20 09, Odhiambo 10 (EA), KF318917, KF358036, KF358084, KF363845, KF358177; Reunion,

Saint Pierre, Piton Monvert, Mar 2011, Pailler s.n. (REU), KF318968, KF358008, KF358118, KF363867, KF358204. Oeceoclades saundersiana (Rchb.f.)

Garay & P.Taylor: Kenya, Coast, Mwache, 26 Nov 1997, PCP 2 (EA), KF318916, KF358033, KF358108, KF363907, KF358203; Kenya, Western, Kakamega

Forest, 19 Feb 2009, Odhiambo 212 (EA), KF318962, KF358005, KF358061, KF363900, KF358205. Oeceoclades sp.: Madagascar, Southern, –, –, Peter 5497

(GRA), KF318944, –, –, KF363861, –. Oeceoclades ugandae (Rolfe) Garay & P.Taylor: Kenya, Western, Kakamega Forest, 7 Oct 2009, Odhiambo 4 (EA),

KF318899, KF358054, KF358099, KF363885, KF358149.

Appendix 1.

Continued.

Expansion of the orchid genus Eulophia (Eulophiinae; Epidendroideae) to include Acrolophia, Cymbidiella, Eulophiella, Geodorum, Oeceoclades and Paralophia.

Article

Mar 2021

Eulophia (Eulophiinae; Epidendroideae) has been found in molecular phylogenetic studies to be non-monophyletic. Here, we propose to combine it with Acrolophia, Cymbidiella, Eulophiella, Geodorum, Oeceoclades and Paralophia and discuss the characters that have been used previously to discriminate among these genera, demonstrating that none of them is without exceptions. Given the incongruence found in the molecular phylogenetic studies between plastid and nuclear results, a broader circumscription of Eulophia is more likely to be stable. In total, 35 new combinations/names are required for the expansion of Eulophia to include these other genera.

Eulophia myanmarica (Orchidaceae), a new species from Myanmar and notes on Geodorum densiflorum

Article

May 2022

Eulophia myanmarica, a species new to science is herein described from Monywa District, Sagaing Region, Myanmar. The species superficially resembles E. andamanensis but differs significantly in having 5-veined petals and sepals, narrowly oblong dorsal sepal with acute, slightly cucullate apex, obliquely narrowly oblong-elliptic lateral sepals and obliquely triangular sidelobes of the labellum. Detailed morphological description, a colour plate, notes on phenology, distribution, and a provisional conservation assessment are provided below. With this discovery, Myanmar now holds a total number of 19 Eulophia species. Additionally, after merging the genus Geodorum under Eulophia, a new name is needed for Geodorum densiflorum, for which taxonomic notes have been provided.

Eulophia dabia - A Lesser Known Critically Endangered Terrestrial Orchid

Article

Full-text available

Feb 2022

Giriraj Singh Panwar

Eulophia dabia (D.Don) Hochr is an endemic and critically endangered, species of the family Orchidaceae. It prefers to grow on sandy soil near water embankments. The tubers of this species are highly medicinal and used by the local healer for the treatment of various ailments. The present paper provides insight of its medicinal utility and their mode of propagation.

EXPLOSIVE RANGE EXPANSION OF EULOPHIA GRAMINEA (ORCHIDACEAE) IN PUERTO RICO AND THE WEST INDIES

Article

Full-text available

Oct 2021

Eulophia graminea Lindley (Orchidaceae), a native orchid of tropical and subtropical Asia, was first reported in the Western Hemisphere from populations in Miami, Florida, U.S.A. where it spread rapidly through the southern part of the state. Here we report the first record of this species for Puerto Rico and also sightings in the Bahamas and Cuba, reflecting the rapid spread seen in southern Florida (U.S.A).

A morphometric and molecular phylogenetic analysis of the African orchid genus Stenoglottis (Orchidaceae: Orchidoideae)

Article

Jun 2020

Stenoglottis is a small genus of forest orchids endemic to continental Africa. Nine taxa have so far been described, but species boundaries in the genus are problematic and several of these taxa are not widely accepted. In this study, taxon boundaries were investigated by means of a combination of morphometric and phylogenetic analyses, with the aim of resolving species-level relationships and identifying practical diagnostic characters. Sequence variation was low, particularly in plastid DNA (atpI-atpH), and Bayesian inference and maximum likelihood analyses of nuclear markers (ITS and ETS) did not resolve all of the putative taxa. Multivariate morphometrics (PCA, PCoA, cluster analysis) likewise did not support the recognition of all described Stenoglottis taxa, but they reliably distinguished some taxa that DNA data did not. Combined morphological and phylogenetic evidence supports the delimitation of five species and two varieties, for which characteristics of floral spurs, labella, leaves, bracts and auricles provide reliable diagnostic traits. These findings will form the basis of a taxonomic revision in which the proposed changes will be formalized.

Plants of Tribe Cymbidieae

Chapter

Dec 2023

Eulophia edwardii (Orchidaceae), a new species from the Pondoland Centre of Endemism in South Africa

Article

Full-text available

Sep 2023

Benny Bytebier

Background and aims – Despite the fact that the orchid flora of South Africa is well documented, new species are still being discovered. The identity of an Eulophia subpopulation from near Port Edward in KwaZulu-Natal has been ambiguous. Some thought that it belongs to Eulophia schnelliae , currently considered a synonym of Eulophia macowanii , whereas others were of the opinion that it was potentially a new species. Both hypotheses are investigated here. Material and methods – Plants were studied in the field and herbarium specimens, including types, were consulted. The relevant published literature was revised. Key results – Eulophia schnelliae is confirmed as a synonym of Eulophia macowanii . The Port Edward subpopulation does not match any known Eulophia taxon and is newly described as Eulophia edwardii , endemic to the Pondoland Centre of Endemism. It is only known from one subpopulation of about 200 individuals, which is threatened by urban development. It is, therefore, assessed as Critically Endangered according to Criterion B2ab(i,ii,iii). Conclusion – The newly described species increases the number of Eulophia species in South Africa to 29 and the number of endemic Eulophia species to 10. This discovery underlines the need for continued botanical inventories and protection of sensitive grasslands.

Temperature conditions optimization for storing tropical orchid seeds on the example of Eulophia streptopetala and Stanhopea tigrina

Article

Full-text available

Dec 2022

The paper presents the results of the study of temperature regime optimization for storing seeds of tropical orchids on the example of Eulophia streptopetala Lindley and Stanhopea tigrina Batem ex Lindl. Mature seeds were frozen at temperatures of 18C, 40C or 80C for a period of 1, 3, 6 or 12 months, the storage temperature was +4C. Before and after freezing, the viability of seeds was determined by visual and tetrazole methods. After defrosting, the seeds were sown and the plants grown from them were cultivated on a nutrient asymmetric medium, then the dynamics of plant development was recorded, the content of photosynthesis pigments (chlorophyll and carotenoids) was quantified. The analysis of the data obtained showed that the viability of seeds significantly decreases after storage, including in conditions of low temperatures. At the same time, in experimental groups of plants, the terms of early ontogenetic states were shortened, and the growth rate of protocorms increased. Freezing of seeds caused further restructuring of the photosynthetic apparatus. The optimal temperatures for storing seeds of the species Eulophia streptopetala were +4C, and for Stanhopea tigrina 80C and 40C.

A revision of Orchidaceae from the Kimberley region of Western Australia with new species of tropical Calochilus and Dipodium

Article

Full-text available

Aug 2022

Orchidaceae occurring in the Kimberley region of Western Australia are revised. Calochilus barbarossa R.L.Barrett, M.D.Barrett & K.W.Dixon, Calochilus kimberleyensis R.L.Barrett, M.D.Barrett & M.A.Clem., Dipodium ammolithum M.D.Barrett, R.L.Barrett & K.W.Dixon and Dipodium basalticum M.D.Barrett, R.L.Barrett & K.W.Dixon are described and illustrated as new species from the Kimberley, one also occurring in the Northern Territory. The genera Empusa Lindl., Habenaria Willd. s. str., Phoringopsis D.L.Jones & M.A.Clem., Spiranthes Rich. and Zeuxine L. have been added to the Western Australian flora since publication of the Flora of the Kimberley Region. The taxonomic status of a number of tropical Australian Orchidaceae is discussed with recommendations for future research. Descriptions and illustrations are provided for twenty orchid species recorded in the Kimberley Region (one without a verified voucher). Keys are presented to all Kimberley orchid species.

Lista comentada de Orchidaceae en Uruguay y su Distribución en Ambientes y Eco-regiones

Article

Full-text available

Dec 2020

From an economic and taxonomic point of view, Orchidaceae is one of the most studied botanical families. In Uruguay it is poorly represented and known, and descriptive data are fragmented and scattered. In the present work the information on the species of this family is updated based on herbaria records, previous publications and field trips made in the country during 2018–2019. A list of Orchidaceae from Uruguay is presented with 59 species belonging to18 genera. Four species were found endemic to the country, while 22 species are endemic to the Southern Cone region. The Gondwanic Sedimentary Basin was the ecoregion with the highest species diversity (51%) and the richest departments were Cerro Largo (25 spp.) and Maldonado (25 spp.). The Highland Forest and Riparian Forest environments presented highest diversity. The most representative genera were Habenaria (12 spp.), Cyclopogon (8 spp.), and Brachystele (6 spp.). The species with the widest distribution were Habenaria gourlieana, H. parviflora, and Cyclopogon elatus, which were found in all ecoregions and in 15 out of 19 departments of the country.

Concept versus data in delimitation of plant genera

Article

Full-text available

Nov 2009

As a consequence of there being several ways in which observed patterns of variation in nature can be conveyed in a generic classification, long recognised genera have changed in size over time. The generic rank has its origins in folk taxonomy, where genera were homogenous units of relatively few kinds. In the era of Bentham there was a widespread preference for large genera, many of which were split during the 20th century. In a survey of contemporary (1998–2007) generic delimitation practice we found a significant dichotomy between studies that incorporate molecular data and those that rely exclusively on morphological data. The former lead to delimitation of larger genera whereas the latter in general do not. This finding spurred a broader investigation into what drives changes in overall generic sizes, new data sources or new concepts? Two new data types have been introduced during the course of history: detailed morphology (anatomy, cytology) and chemical data (amino acid and DNA sequence data). Conceptual development has seen several turns: from language and communication, through memory and stability, to evolution and monophyly. We argue that conceptual change has a greater impact than changes in data do, since new data must be interpreted and translated into a classification and since conceptual changes may spur a search for new kinds of data. We conclude that the current trend toward recognising larger genera is a result of a return to study on a broad scale, rather than of incorporation of molecular data.

MrModeltest V2. Program Distributed by the Author

Article

Full-text available

Jan 2004

Johan Nylander

The Chromosomes of Orchids IX. Eulophia

Article

Full-text available

Jan 1986

The chromosome numbers of three named species of Eulophia are given. Meiosis studies reveal chromosome associations (multivalents and secondarily associated bivalents). The analysis of chromosome pairing suggests a basic number x = 7 for these species. E. stenophylla and one cytotype of E. streptopetala are probably hexaploids (2n = 42) and E. paivaeana subsp. borealis and the other cytotype of E. streptopetala dodecaploids (2n = 84).

The Genus Oeceoclades Lindl

Article

Jun 1976

Wild Orchids of Southern Africa

Article

Jan 1985

Contributions to the orchid flora of Guinea, west Africa

Article

Nov 2007

Materials to the flora of Orchidaceae in Guinea, West Africa, are presented. Based on examination of 1258 herbarium specimens, 54 genera and 153 species are reported from this country. Descriptions, ecological requirements, distribution, citations of studied materials, illustrations and distribution maps for most of the species are provided. Keys to determinations of genera and species are included.

Phylogenetic relationships within the Diurideae (Orchidaceae); inferences from plastid matK DNA sequences

Chapter

Jan 2000

Katoh K, Misawa K, Kuma KI, Miyata T.. MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res 30: 3059-3066

Article

Jul 2002
NUCLEIC ACIDS RES

Kazutaka Katoh

A multiple sequence alignment program, MAFFT, has been developed. The CPU time is drastically reduced as compared with existing methods. MAFFT includes two novel techniques. (i) Homo logous regions are rapidly identified by the fast Fourier transform (FFT), in which an amino acid sequence is converted to a sequence composed of volume and polarity values of each amino acid residue. (ii) We propose a simplified scoring system that performs well for reducing CPU time and increasing the accuracy of alignments even for sequences having large insertions or extensions as well as distantly related sequences of similar length. Two different heuristics, the progressive method (FFT‐NS‐2) and the iterative refinement method (FFT‐NS‐i), are implemented in MAFFT. The performances of FFT‐NS‐2 and FFT‐NS‐i were compared with other methods by computer simulations and benchmark tests; the CPU time of FFT‐NS‐2 is drastically reduced as compared with CLUSTALW with comparable accuracy. FFT‐NS‐i is over 100 times faster than T‐COFFEE, when the number of input sequences exceeds 60, without sacrificing the accuracy.

The Type Species and Conservation of the Generic Name Eulophia R.Br. ex Lindl.

Article

Jul 1962

New Orchids from South Central Africa

Article

Jan 1977

P. J. Cribb

31 new taxa of Orchidaceae from South Central Africa are described, including 3 new genera and 25 new species.

A molecular phylogeny reveals paraphyly of the large genus Eulophia (Orchidaceae): A case for the reinstatement of Orthochilus</I

Abstract and Figures

Recommended publications

Systematics of Yoania prainii (Orchidaceae: Calypsoinae)

Phylogenetic position of the crustose Stereocaulon species

Molecular phylogenetics and new (infra)generic classification to alleviate polyphyly in tribe Hydran...

Vegetative anatomy and systematics of subtribe Dendrobiinae (Orchidaceae)