Content uploaded by Keith A Maggert
Author content
All content in this area was uploaded by Keith A Maggert on Mar 18, 2015
Content may be subject to copyright.
INVESTIGATION
Reduced rDNA Copy Number Does Not Affect
"Competitive"Chromosome Pairing in XYY Males of
Drosophila melanogaster
Keith A. Maggert
Department of Biology, Texas A&M University, College Station, Texas 77843-3258
ABSTRACT The ribosomal DNA (rDNA) arrays are causal agents in X-Y chromosome pairing in meiosis I of
Drosophila males. Despite broad variation in X-linked and Y-linked rDNA copy number, polymorphisms in
regulatory/spacer sequences between rRNA genes, and variance in copy number of interrupting R1 and R2
retrotransposable elements, there is little evidence that different rDNA arrays affect pairing efficacy. I
investigated whether induced rDNA copy number polymorphisms affect chromosome pairing in a “com-
petitive”situation in which complex pairing configurations were possible using males with XYY constitution.
Using a common normal Xchromosome, one of two different full-length Ychromosomes, and a third
chromosome from a series of otherwise-isogenic rDNA deletions, I detected no differences in X-Y or Y-Y
pairing or chromosome segregation frequencies that could not be attributed to random variation alone.
This work was performed in the context of an undergraduate teaching program at Texas A&M University,
and I discuss the pedagogical utility of this and other such experiments.
KEYWORDS
Drosophila
male meiotic/
meiosis pairing
aneuploidy
Ychromosome
ribosomal DNA
Sex chromosome pairing in the heterogametic Drosophila male is
mediated by the ribosomal DNA (rDNA) (McKee 1996, 2004),
an array of tandem repeated 35S pre-ribosomal RNA (rRNA) genes
(Ritossa and Spiegelman 1965; Wellauer and Dawid 1977; Long et al.
1981b). Specifically, in meiosis I sequence repeats in the 240-bp inter-
genic “nontranscribed spacer”assure pairing and disjunction between
the X-linked and Y-linked pre-rRNA transcription units (McKee and
Karpen 1990; McKee et al. 1992; Merrill et al. 1992; Ren et al. 1997;
McKee 2009). The causes and regulation of rDNA pairing remain areas
of investigation; however, it is established that the minimum number
of rDNA repeats to confer pairing between an Xand Yis quite small
(Appels and Hilliker 1982; McKee 1996).
The rDNA is highly polymorphic between populations, between
individuals within populations, between cells within individuals, and
between chromosomes within cells (Tartof 1973; Spear 1974; Long
and Dawid 1980; Terracol and Prud’homme 1986; Lyckegaard and
Clark 1989; Eickbush et al. 1997; Perez-Gonzalez and Eickbush 2002;
Cohen et al. 2003; Perez-Gonzalez et al. 2003; Averbeck and Eickbush
2005; Stage and Eickbush 2007; Greil and Ahmad 2012). The copy
number of rRNA cistrons is variable, ranging from tens to hundreds
per array in most wild and laboratory strains. The spacer sequences
between the transcription units are highly polymorphic, consisting of
variable repeats of core elements that are thought to direct transcrip-
tional enhancement, likely manifesting as varied levels of expression of
each copy (Long et al. 1981a; Averbeck and Eickbush 2005; Stage and
Eickbush 2007). The transcription units themselves may be interrup-
ted by the R1 and R2 retrotransposable elements, and the presence of
transcriptional and posttranscriptional regulatory mechanisms di-
rected to these retroelements adds to the complex genetics of the
rDNA (Perez-Gonzalez et al. 2003; Eickbush et al. 2008). The unusual
arrangement of the rDNA—tandem expressed genes that alone ac-
count for approximately 50% of all nuclear transcription (Warner
1999)—renders them inherently unstable and prone to damage and
loss (Peng and Karpen 2008, 2009; Guerrero and Maggert 2011).
Finally, at least in some cases, there are special mechanisms to amplify
or delete the rDNA genes in specific cells or at specific times of de-
velopment (Ritossa 1968; Tartof 1973; Endow 1980, 1982; Hawley and
Tartof 1985; Hawley and Marcus 1989). Consequently, the molecular-
genetics of the rDNA has been refractory to simple approaches aimed
at revealing cause–effect relationships. The location of the rDNA in
heterochromatin in Drosophila has aggravated the difficulty in per-
forming standard manipulative experiments by denying the use of
many standard molecular-genetic tools.
Copyright © 2014 Maggert
doi: 10.1534/g3.113.008730
Manuscript received October 1, 2013; accepted for publication January 13, 2014;
published Early Online January 21, 2014.
This is an open-access article distributed under the terms of the Creative
Commons Attribution Unported License (http://creativecommons.org/licenses/
by/3.0/), which permits unrestricted use, distribution, and reproduction in any
medium, provided the original work is properly cited.
Corresponding author: Department of Biology, Texas A&M University, College
Station, TX 77843-3258. E-mail: kmaggert@tamu.edu
Volume 4 | March 2014 | 497
The polymorphic rDNA array loci are located on the short arm of
the Ychromosome and in the centric heterochromatin of the Xchro-
mosome, and are genetically redundant because either males or
females can survive and accommodate all translational needs with
only one Y-linked or X-linked rDNA array. Of the 100–600 copies
found in natural and laboratory populations (Lyckegaard and Clark
1989), as few as 90 are sufficient for viability (although given the
exceedingly complex regulation, an exact number is difficult to de-
termine) (Terracol et al. 1990; Paredes and Maggert 2009a); the role of
supernumerary copies is unclear, although their existence is appar-
ently ubiquitous in eukaryotes (Long and Dawid 1980). Although
significant rDNA copy number variation is found at either X-linked
or Y-linked rDNA arrays, analyses of natural polymorphisms in rDNA
gene copy number have not detected any quantitative chromosome
segregation phenotype associated with rRNA gene copy number.
Lyckegaard and Clark (1989) showed that Ychromosomes isolated
from wild caught flies varied in rDNA copy number. They quantified
the rDNA copy number on those chromosomes and correlated aneu-
ploidy (loss and nondisjunction) with rDNA copy number, reasoning
that rDNA copy number polymorphism, specifically low copy num-
ber, might result in chromosome pairing defects and loss or nondis-
junction. They found no significant correlation between X,-.Y
disjunction in male meiosis and rDNA copy number (Clark 1987;
Lyckegaard and Clark 1989). This is consistent with observations that
very few rDNA copies—an order of magnitude fewer than found on
natural Y chromosomes—are sufficient to assure pairing and disjunc-
tion (Appels and Hilliker 1982; McKee 1996, 1998). These real data
are supported by my anecdote, years of using a Y-linked rDNA de-
letion series has never expressed an obviously high rate of nondis-
junction (which would be readily apparent because of genetic markers
on the Ychromosomes). However, in most experiments, and in my
own observations using Ychromosomes with polymorphisms in
rDNA copy number, Ypairing was not challenged by other pairing
partners that could compete for the X-linked rDNA pairing sites. In
that regard, it remains possible that faithful X-Y pairing is potentially
reinforced by other pairing systems that act on Xand Yafter the
homologous autosomes pair: even an unpopular boy may find a dance
partner provided he is the last one available on the dance floor. Thus,
it is conceivable that rDNA copy number polymorphisms confer
a slight (or regulated) advantage that altered pairing arrangements
would only be appreciable or detectable in “sensitized”situations,
for instance, in a laboratory assay when multiple competing chromo-
some and pairing configurations are possible. Alternatively, the mul-
tiplicity of pairing sites in natural rDNA arrays may allow trivalent
arrangements (Cooper 1964), obviating models of competition. Re-
gardless, with three chromosomes moving to two poles, preferential
co-orientation and segregation in XYY aneuploid males may reveal
subtle quantitative effects of rDNA intergenic spacer sequences as
pairing sites. Such hypothetical effects might have consequence in wild
populations because male meiotic nondisjunction leads to XYY and
X0 males, and to XXY females, and might have repercussions in
altering in sex ratio, inheritance of B or other supernumerary chro-
mosomes, inheritance of heterochromatic sequence, and inheritance
of Y-linked genes. Although XYY males and XXY females are not
common in natural populations, they are not overly rare: the seminal
study by Calvin Bridges showed that approximately 1 in 1000 males
are XYY as a consequence of meiotic nondisjunction in females (from
XX eggs fertilized by Y-bearing sperm, and the subsequent XY-bearing
eggs fertilized again by Y-bearing sperm) (Bridges 1916a, 1916b).
Bridges tested the pairing efficacy of chromosomes in XYY males
and reasoned that both Ychromosomes were equally likely to pair
with the X; however, he did not use individually marked chromo-
somes or chromosomes with rDNA copy number polymorphisms,
and therefore he could determine a rate, but not whether rDNA copy
number was salient.
Work by Grell (1958) and Lyttle (1981) both showed that different
Ychromosomes differed in their pairing and disjunction in meiosis of
XYY males; however, in both cases the data supported biases in prog-
eny classes to be a result of postmeiotic embryonic inviability and not
because of preference during pairing or segregation during meiosis.
Neither set of work could ascribe any differences specifically to rDNA
copy number. Few rDNA copies are sufficient to assure complete
disjunction (Appels and Hilliker 1982), and even a single supernu-
merary copy is sufficient to alter segregation patterns based on rDNA-
mediated pairing (Karpen et al. 1988; McKee and Karpen 1990;
McKee 1996). My laboratory created and characterized a series of
rDNA deficiencies from a common ancestor Y(Paredes and Maggert
2009a), allowing me to now test whether rDNA copy number re-
duction affected pairing of Xand Ychromosomes in male meiosis of
XYY aneuploids. I considered the Ychromosomes of this study to be
isogenic at all loci except the rDNA based on fertility and cytology.
After an initial period of rDNA magnification (Paredes and Maggert
2009a), the copy number has been robustly measured for years (J.
Aldrich and K. Maggert, data not shown). I do not know the abso-
lute number of rDNA genes on any of these chromosomes. Instead,
I rely on fraction relative to amplification of a dispersed multicopy
tRNA gene; however, the relative rDNA copy number that corre-
sponds to the bobbed-lethal and wild-type-bobbed transitions of the
deletion series is consistent with the wild-type Y,10B (see below)
having approximately 300 total rDNA cistrons (Paredes and Maggert
2009a).
IusedthisrDNA deletion series to test pairing between an Xchro-
mosome, one of two “wild-type”(full-length) Ychromosomes, and the Y
bearing a shortened rDNA array. Males of genotype X,rDNA
wild-type
/Y,
rDNA
wild-type
/Y,rDNA
Deficiency
were outcrossed and all progeny were
scored so that the chromosome composition of the sperm could be
inferred, as could the frequencies of different pairing arrangements in
meiosis I. I show that pairing and segregation in males with three sex
chromosomes are unperturbed by rDNA copy number polymorphisms
on one Y, because the proportions of all resulting phenotypic classes
were statistically indistinguishable regardless of the identity of the wild-
type Ychromosome or the rDNA copy number on the supernumerary Y
chromosome. This finding establishes that even when challenging the
pairing of natural Xand Ychromosomes, a third chromosome with copy
number polymorphisms of the rDNA on the Ychromosome is unlikely
to quantitatively affect pairing or segregation.
MATERIALS AND METHODS
Drosophila husbandry
Drosophila cultures were kept on molasses-yeast-cornmeal food at 25°
and 80% relative humidity. Crosses were performed with 3–5females
and 2–3 males per vial and cultured for 5 days before transferring or
dumping; offspring were counted on days 14 and 18 after vials were
set. Genotypes are described in Results, but published references are Y,
B(Maggert and Golic 2005), Y,ROMA (Maggert and Golic 2002), and
Y,10B, and derivatives (Paredes and Maggert 2009a, 2009b).
Chromosome nomenclature
“X”is X,y
1
w
67c23
.“Y,B
S
”is B
S
Y.“Y,ROMA”is Y,P{y
+mDintz
w
BR.E.BR
=
SUPor-P}ROMA. These three are considered “wild-type”chromo-
somes in terms of rDNA. The chromosomes with manipulated rDNA
498 | K. A. Maggert
copy number are derived from y
+
Y,rDNA
+
P{FRT(RS3).y}10B,which
is referred to as Y,rDNA
wt-10B
; by nature of it being the progenitor, it
contains 100% rDNA by definition. Deficiency chromosomes are re-
ferred to as “Y,rDNA
Df
”(generally) or “Y,rDNA
Phenotype-Number
”
(when denoting a specific chromosome; bb =bobbed and l=lethal
when the Yis made the sole source of rDNA).
DNA extractions and real-time PCR
DNA was extracted in a solution containing 100 mM Tris pH 8.0, 50
mM EDTA, and 1% SDS (added fresh). Flies were macerated using
a Kontes pestle, proteinase K was added to 0.5 mg/mL, and the sample
was incubated at 65°for 1 hr. Samples were then organic extracted
four times with Tris-buffer phenol, phenol-chloroform-isoamyl alco-
hol (25:24:1), chloroform, and, finally, ethyl ether. DNA was ethanol-
precipitated and resuspended in distilled water and normalized
to 1 ng/mL. Real-time PCR was performed as described (Paredes
and Maggert 2009a); primers were AGCCTGAGAAACGGCTACCA
and AGCTGGGAGTGGGTAATTTACG for the 18S rRNA and
CTAGCTCAGTCGGTAGAGCATGA and CCAACGTGGGGCTC
GAAC for tRNA
K-CTT
. Samples were run in triplicate (or more) for
each sample of DNA, and DNA from females of genotype C(1)DX,
y
1
f
1
bb
0
/y
+
Y,rDNA
+
P{FRT(RS3).y}10B) was run on every separate
PCR reaction plate to normalize between experiments.
Statistical analyses
Regression functions and coefficients in Figure 3 were calculated using
the CORREL, SLOPE, and INTERCEPT functions of Apple Numbers
version 2.3. Data in Table 3 and Figure 4 were analyzed using Bayesian
inference of 0.975 confidence intervals for the difference of means;
exclusion of 0% from that interval was taken as a significant de-
viation between samples. Statements of lack of significant difference
in sex ratios, differences between pooled and vial-separated progeny
classes for each chromosome set, and rDNA copy number were all
inferred the same way.
Statistical power (required N for specified P-value to discriminate
differences in progeny classes) was calculated using the t distribution
(and alpha = 0.05) using the average, SD, and N values from the data
in Table 2.
RESULTS AND DISCUSSION
Chromosome stocks used to test pairing and
segregation are themselves without obvious
nondisjunctional phenotypes
Males were generated with chromosome compositions X/B
S
Y/Y,
rDNA
Deficiency
or X/Y,ROMA/Y,rDNA
Deficiency
. Because single males
were used to initiate all crosses in this set of experiments, the Ys were
effectively isogenized; therefore, any polymorphisms that arose in
the fly stocks since their establishment were removed for this set of
experiments.
The Xwas isogenized in the laboratory and, as of 2005, the spon-
taneous nondisjunction rate in females was 0.06% (5 exceptional prog-
eny of 8220 total progeny; C. Alfonso-Parra, unpublished data). This
is consistent with the primary nondisjunction values of Bridges
(1916a, 1916b), indicating that, at a minimum, there were no strong
modifiers of female meiotic pairing in the genetic background. The
“wild-type”Ychromosomes are from unrelated sources; Y,B
S
and Y,
ROMA were obtained from Kent Golic in 2001. The former is the
original B
S
Y(Brosseau and Lindsley 1958), and the latter bears a var-
iegating SUPorP P-element in cytological band h12 (Maggert and
Golic 2002). Both are otherwise wild-type and cannot be separated
by less than 100 years of independent variation (Y,B
S
was originally
from y
+
Y, which was generated in 1948; Y,ROMA was derived from
an unmarked Yin approximately 2000). Stocks of both of these chro-
mosomes showed normal meiotic nondisjunction (Table 1). The pre-
ponderance of X0 progeny from Y,ROMA crosses highlights that I
could not discriminate chromosome loss from meiotic nondisjunction
using this class of progeny. Nonetheless, the rates of sex chromosome
aneuploids in offspring should not unduly affect the analysis of sex
chromosome pairing and segregation.
The data for spontaneous loss and nondisjunction of these
chromosomes were collected from the same genetic background as
the Xabove, further reinforcing the lack of high levels of meiotic
nondisjunction in these flies. The progenitor Ychromosome with no
rDNA deletion (chromosome Y,rDNA
wt-10B
) and the most extreme
deletion recovered (Y,rDNA
l-473
) were tested for spontaneous loss or
nondisjunction in the same way (Table 1); levels of neither XXY
females nor X0 males were elevated, and the sex ratios were statis-
tically indistinguishable from random (50%) in every case. Each
chromosome of the rDNA deletion series is reported as a fraction
of the initial amount of rDNA before deletion (Tables 2 and 4)
because I could not determine cardinal copy number (Paredes and
Maggert 2009a).
Polymorphisms in rDNA copy number do not affect
pairing or segregation in males
Analysis of progeny from XYY males is a complex but sensitive assay
for the role of chromosome pairing because progeny will usually be
derived from X-bearing eggs fertilized by X,Y,XY,orYY sperm,
which are each derived from different pairing configurations (Figure
1). I considered three pairing configurations, which I termed L, M,
and N for ease of discussion. L pairing is between the Xand the first
(wild-type) Ychromosome (henceforth described as “1,”Y,Bor Y,
ROMA), with the second Ychromosome (Ychromosome with the
nTable 1 Frequency of exceptional progeny from crosses between X,y
1
w
67c23
virgin females and males of genotype X,y
1
w
67c23
/Yof
the indicated identity
Y Chromosome Female Male % Female % Aneuploid
y w B, y
+
w
+
,y
+
y w B, y
+
w
+
,y
+
B2228 9 10 1944 53.4 0.5
ROMA 942 0 4 1005 48.3 0.2
10B 3035 17 18 3020 50.1 0.6
473 969 3 13 958 50.0 0.8
Normal female progeny are expected to be yellow-bodied and white-eyed (“yw”), and normal male progeny are expected to be Bar (“B,”for the Y,B
S
chromosome),
yellow
+
white
+
(“y
+
w
+
,”for the Y,ROMA chromosome) or yellow
+
(“y
+
,”for the Y,rDNA
wt-10B
and Y,rDNA
l-473
chromosomes). Primary exceptions (consequences of
nondisjunction in meiosis of either males or females) are expected to be Bar, yellow
+
white
+
,oryellow
+
females and yellow white males. % Aneuploid was calculated
from the sum of female and male exceptions; the latter class also includes chromosome loss events.
Volume 4 March 2014 | Meiotic Pairing and rDNA Copy Number | 499
rDNA deletion under evaluation, henceforth described as “2”) segre-
gating randomly. M is pairing between Xand 2,with1segregating
randomly. N is pairing between the Ychromosomes, with the X
segregating randomly. The “2+1”arrangements shown here represent
an extreme case wherein two chromosomes show 100% pairing and
disjunction (“2”), whereas the third chromosome (“+1”) moves ran-
domly, as first envisioned by Bridges (1916a). Even if XYY aneuploid
males do not exhibit 2+1 pairing, it is useful to model biases in pairing,
co-orientation, segregation, and recovery of sex chromosomes that vary
in rDNA copy number.
Identical sperm karyotypes can arise from two of the pairing
configurations (e.g.,12 sperm from L or M pairing, X1 sperm from
M or N pairing), so determination of whether rDNA copy number
affects X-Y or Y-Y pairing requires evaluation of all six classes of
progeny. The null hypothesis of random pairing and segregation
predicts equal proportion of all progeny classes, whereas extreme
bias (e.g., exclusively L pairing) results in the absence of two classes.
Deviations in progeny classes may arise through other means
but are expected to be inconsequential. Only very rarely would
progeny be absent because of lethality, for instance, meiosis I or
meiosis II nondisjunction in females producing nullo-Xeggs fertilized
by Yor YY sperm, or diplo-Xeggs fertilized by Xor XY sperm.
These are expected to be a negligible minority of events (Table 1)
and rely on female nondisjunction unaffected by differences in
segregation in males, and thus are consistent across these experi-
ments that manipulate sex chromosome ploidy in males. Similarly,
chromosome loss (from nondisjunction or centromere/kinetochore
dysfunction) could be readily detected by the use of marked Y
chromosomes.
All progeny classes are unambiguously identifiable because the
marker genes affect different aspects of development (eye color, eye
shape, bristle color, body and wing color). X1 and X12 progeny, when
the Ywas Y,ROMA, could be discriminated because the yellow
+
gene
in P{y
+mDintz
w
BR.E.BR
=SUPor-P}ROMA is a partial gene, lacking the
bristle enhancer element (Roseman et al. 1995), and is subject to
position effect variegation (Roseman et al. 1995; Maggert and Golic
2002), whereas the yellow
+
gene on the rDNA deficiency series
founder chromosome, y
+
Y,rDNA
Deficiency
P{FRT(RS3).y}10B, is from
a transposition between the Xand Y(Maggert and Golic 2005), and
thus is fully wild-type in expression. The Ychromosome in the stock
from which the XX virgins were collected was unmarked, so that any
nonvirgins involved in the cross would produce fertile XY yellow
nTable 2 Frequency of each class of progeny from XYY males
Y chromosome rDNA N N Average SD % % Pairing: L, M Pairing: M, N Pairing: L, N
1 2 Size Vials Flies Flies/Vial Flies/Vial Female Aneuploid X 12 X1 2 X2 1
B 10B Sum (total) 100% 32 3360 105 44 49.2 41.8 15.8% 8.4% 16.8% 23.4% 16.5% 19.1%
Average (vials) 49.3 42.8 15.2% 8.7% 17.8% 22.4% 16.2% 19.6%
SD (vials) 6.3 10.3 7.9% 4.9% 6.8% 8.8% 6.0% 7.7%
B 465 Sum (total) 83% 5 522 131 12 51.4 39.5 20.4% 8.5% 14.7% 28.0% 16.3% 12.1%
Average (vials) 50.7 39.8 20.0% 9.1% 14.3% 27.8% 16.4% 12.5%
SD (vials) 8.2 18.0 15.2% 4.8% 8.3% 9.8% 6.0% 6.6%
B 183 Sum (total) 76% 4 626 125 37 50.6 42.9 16.3% 8.6% 14.9% 21.1% 19.3% 19.7%
Average (vials) 50.5 43.2 16.0% 8.7% 15.0% 21.1% 19.5% 19.8%
SD (vials) 4.7 7.1 5.1% 3.1% 5.0% 3.9% 2.4% 2.9%
B 484 Sum (total) 55% 5 847 169 58 53.5 46.9 14.8% 8.1% 17.2% 18.4% 21.5% 20.0%
Average (vials) 54.3 46.9 15.9% 8.5% 17.0% 18.0% 21.4% 19.2%
SD (vials) 5.5 2.4 7.3% 1.7% 3.1% 2.1% 2.0% 5.0%
B 503 Sum (total) 52% 15 1219 81 31 52.1 41.5 19.0% 8.4% 14.4% 17.6% 18.6% 21.8%
Average (vials) 52.4 43.2 18.1% 8.9% 15.7% 17.5% 18.6% 21.3%
SD (vials) 4.8 8.7 7.0% 3.6% 6.7% 5.0% 5.6% 5.9%
B 473 Sum (total) 46% 25 2738 110 53 49.7 40.8 16.7% 7.8% 16.7% 24.4% 16.3% 18.0%
Average (vials) 49.4 40.7 16.7% 8.0% 16.0% 24.2% 16.6% 18.4%
SD (vials) 5.7 10.5 10.1% 3.5% 5.6% 6.1% 5.1% 6.7%
ROMA 10B Sum (total) 100% 9 1349 150 78 50.9 47.1 12.9% 9.0% 22.4% 22.4% 15.6% 17.6%
Average (vials) 52.0 48.3 12.4% 8.7% 25.1% 22.2% 14.5% 17.1%
SD (vials) 5.0 9.6 5.6% 3.0% 7.4% 2.0% 5.1% 5.6%
ROMA 465 Sum (total) 83% 5 978 196 76 48.1 44.6 12.0% 8.5% 18.8% 23.8% 17.3% 19.6%
average (vials) 47.2 44.0 11.9% 8.7% 18.5% 24.1% 16.8% 20.0%
SD (vials) 3.8 4.5 0.7% 1.7% 2.5% 2.4% 2.7% 2.4%
ROMA 183 Sum (total) 76% 5 950 190 36 49.2 45.3 14.5% 10.6% 18.2% 23.4% 16.4% 16.8%
Average (vials) 48.7 45.2 14.2% 10.7% 18.3% 23.4% 16.2% 17.3%
SD (vials) 4.8 2.7 3.3% 1.6% 1.4% 3.4% 1.8% 4.9%
ROMA 484 Sum (total) 55% 5 1026 205 68 44.0 44.3 10.6% 11.0% 18.3% 25.6% 15.0% 19.4%
Average (vials) 43.7 44.1 10.6% 11.0% 18.1% 25.6% 15.0% 19.7%
SD (vials) 2.6 1.5 0.7% 1.7% 1.5% 2.1% 0.8% 1.7%
ROMA 473 Sum (total) 46% 10 1404 140 63 48.0 46.9 11.8% 10.6% 19.9% 23.7% 16.3% 17.7%
Average (vials) 47.7 47.6 11.2% 11.1% 20.0% 24.1% 16.6% 17.1%
SD (vials) 3.3 3.4 2.5% 2.5% 3.5% 4.0% 2.4% 2.8%
"Size"indicates rDNA copy number, relative to Y,rDNA
wt-10B
, which is defined as 100% (Table 4). Number of replicate vials and total flies are indicated [N (vials) and N
(flies)], as are the average number of flies per vial (average) and SD of flies per vial. Sex ratio (% female) and fraction of sex chromosome aneuploids (% Aneuploid is
a sum of XXY females and XYY males) are shown, as are progeny of each chromosome constitution. Pairing (L, M, N) refer to Figure 1A and indicated gamete types (X,
12,X1,2,X2,1) refer to sperm karyotypes. Rows indicate values for all flies pooled into a single sum [sum(total)] and values for each separate vial averaged with SD
[average(vial) and SD(vials)]. Pooled data are not outside the confidence interval derived from individual vials in any case. Data are shown graphically in Figure 2.
500 | K. A. Maggert
white male progeny and would be readily detectable; none were
observed.
To obviate the possibility of genomic imprinting affecting rDNA
activity and chromosome segregation, I created males with X12 con-
stitution by crossing XX1 females to males bearing the rDNA deletion
series. Males (X12) were then crossed to XX females, creating X12
male progeny with a matroclinous Xand two patroclinous Ychro-
mosomes. Individuals were outcrossed to XX virgins and the progeny
were scored on days 14 and 18. Each parental vial was transferred
once or twice, creating two or three vials of progeny from the same
parents. The data for the progeny are shown in Table 2 and are
graphically represented in Figure 2.
The Tables report differences in offspring, which are indirectly
results of differences in pairing. Three salient questions arise. First, do
deficiencies of the rDNA, the known pairing centers of the Xand Yin
male meiosis I, affect chromosome pairing and segregation? Second,
do Y,Bar and Y,ROMA chromosomes differ in their interactions with
the rDNA deletion series? Third, are offspring recovered in expected
(i.e., Mendelian) frequencies? The answers to the first two questions,
at least within the analytical limits of these statistics, are “no,”obvi-
ating any further analysis. The answer to the third question is “no,”
although the subviability I saw was consistent regardless of the Y
chromosome constitution and is consistent with previously described
proportions in similar experiments (Grell 1958; Lyttle 1981).
My results indicate that while differences exist in the frequencies of
each of the six progeny classes, rDNA copy number had no bearing on
the frequencies of each class. By extension, rDNA copy number had
no role in efficacy of meiotic pairing, segregation, centromere func-
tion, or viability.
Data are separately reported as a single pool of all flies collected
from all vials [“sum (total)”] and as averages of individual vials [“av-
erage (vials)”and “SD (vials)”]. Comparisons of the former data with
the latter show remarkable concordance, indicating that fluctuations
in proportions of offspring classes seen in the individual vials were
caused by random chance, as further explained below.
Regression statistics were computed to determine if small effects
could be divined (Figure 3). rDNA copy number was used as abscissa,
and the ordinal values were from Table 2. In every case, both wild-
type Y,Bar and Y,ROMA chromosomes, and every rDNA deletion
chromosome, the slope was near zero, although the regression coef-
ficients (R
2
) were widely disparate (from 0 to 0.64). Low R
2
values
indicate none of the observed trend could be attributed to rDNA copy
number variation, and high R
2
values ironically indicate a very high
proportion of the trend could be attributed to a function with negli-
gible input of rDNA copy number (because the slopes of the lines are
all near zero).
The nonuniform frequencies of different progeny classes suggest
that some pairing configurations may be preferred; however, it is not
possible to determine if a particular pairing configuration is favored.
The increased frequency of yellow white female offspring suggests
that the Ys pair more frequently with each other than either does
with the X. The corresponding classes of offspring (XYY males) are
nTable 3 Frequency of each class of progeny from vials separated by individual or by time
Y Chromosome X 12 X1 2 X2 1
1 2 Average SD Average SD Average SD Average SD Average SD Average SD
ROMA 10B
123 0.123 0.020 0.092 0.028 0.225 0.003 0.203 0.040 0.182 0.010 0.223 0.020
10.145 0.058 0.070 0.016 0.230 0.026 0.126 0.210 0.183 0.033 0.231 0.105
20.119 0.012 0.128 0.039 0.226 0.042 0.149 0.112 0.166 0.058 0.205 0.056
30.114 0.037 0.088 0.049 0.227 0.073 0.183 0.087 0.189 0.012 0.226 0.044
0.1 0.103 0.019 0.065 0.026 0.256 0.051 0.147 0.116 0.218 0.015 0.205 0.058
0.2 0.140 0.062 0.105 0.028 0.202 0.035 0.150 0.126 0.159 0.034 0.213 0.063
0.3 0.135 0.018 0.116 0.056 0.225 0.043 0.155 0.179 0.161 0.016 0.245 0.090
ROMA 473
123 0.117 0.017 0.187 0.016 0.150 0.024 0.191 0.036 0.249 0.048 0.105 0.013
10.140 0.048 0.164 0.064 0.158 0.010 0.236 0.042 0.188 0.059 0.113 0.044
20.110 0.061 0.192 0.090 0.122 0.053 0.182 0.023 0.281 0.065 0.113 0.034
30.112 0.059 0.190 0.050 0.169 0.056 0.157 0.026 0.282 0.078 0.089 0.022
0.1 0.127 0.045 0.167 0.045 0.187 0.042 0.174 0.049 0.241 0.049 0.104 0.033
0.2 0.095 0.046 0.216 0.068 0.137 0.029 0.194 0.007 0.246 0.070 0.112 0.019
0.3 0.141 0.066 0.162 0.077 0.126 0.046 0.208 0.068 0.265 0.121 0.098 0.050
Two chromosome combinations were tested, X/Y,ROMA,Y,rDNA
wt-10B
, and X/Y,ROMA/Y,rDNA
l-473
. Each of three replicate vials (“1,”“2,”and “3”) from each
genotype were transferred twice, establishing three temporal replicates (“0.1,”“0.2,”and “0.3”) from each. For example, 1.1, 1.2, and 1.3 were established by the
same individuals, each offset by 5 days, whereas 1.1, 2.1, and 3.1 were all set on the same day with a separate set of parents. Progeny were scored independently and
all nine of a genotype were considered as a set (“123”) or analyzed as progeny of parents or as progeny from a set time. In only one case do 0.975 confidence intervals
of every pairwise comparison exceed 0 (bold), showing that within Bayesian limits there is no difference between progeny frequencies from any two vials, indicating
that the variance seen is not attributable to differences in heritable or temporal factors.
nTable 4 Copy numbers of rDNA arrays on chromosomes in this
study
Y Chromosome N Average SEM
B 11 112.3% 2.4%
ROMA 11 83.1% 1.7%
10B Not applicable 100.0% By definition
465 11 83.4% 1.5%
183 11 76.2% 2.2%
484 5 55.3% 4.2%
503 8 52.0% 5.8%
473 5 46.0% 11.3%
Real-time PCR was performed on progeny after the completion of the crosses
show in Table 2 and Figure 2. All data are relative to Y,rDNA
wt-10B
. N is number
of replicated real-time PCR reactions from a common pool of DNA purified from
40 sibling flies. All reactions were performed with reference (Y,rDNA
wt-10B
)
reactions included, so SEMs of the reference were pooled into the Y,ROMA,
Y,B,orY,rDNA
Df
data (Sokal and Rohlf 1995).
Volume 4 March 2014 | Meiotic Pairing and rDNA Copy Number | 501
underrepresented, perhaps because of previously described subviabil-
ity of XYY aneuploid males.
Meiotic drive of the sex chromosomes in male meiosis is an ideal
way for a population to produce biased sex ratios in a population, and
the particularities of sex determination in Drosophila (sex is deter-
mined by Xdose rather than Ypresence, and supernumerary Ychro-
mosomes seem to have no phenotypic consequence in females) make
control of X-Y pairing an appealing possibility for meiotic drive.
However, the sex ratio in all of my experiments was the same and
independent of Ychromosome constitution, strongly arguing against
meiotic drive in X12 males affecting either sex ratio in offspring or the
overrepresentation of specific chromosomes.
Gynandromorphs or somatic mosaics attributable to Ychromo-
some loss were not seen in any of the experiments, arguing against
pronounced mitotic instability or loss after fertilization. Concordantly,
no flies were seen that could be interpreted as ultra-Bar or as two
copies of Y,ROMA. Admittedly, the Bar and white
+
markers could
only be scored in the eyes, and the yellow
+
of Y,ROMA could only be
scored in the absence of the rDNA deficiency chromosomes. Because
of the sectors of nuclei giving rise to epidermal anlagen in early
embryogenesis, it is unlikely that any mitotic instabilities exist within
the first three or four zygotic divisions.
Random fluctuation and the limits of statistical power
The variance in Table 2 shows the SD, treating each vial as an inde-
pendent subpopulation. Its high value indicates that variation between
vials is broad, either as a consequence of meaningful differences in
individuals or because of a large natural fluctuation in progeny types
and phenotypic classes. If the latter is true, then a larger sample size
would refine the SD, but not reduce it; therefore, it will do nothing to
increase the likelihood of avoiding a type 2 error (inappropriate accep-
tance of a false null hypothesis). The correspondence between individual
vials and grouped populations for each cross type, the consistency
across all experiments, and isogeny between replicate vials all suggest
that the differences in offspring classes are attributable to stochastic
probability, arising from either pairing or other sources.
To address this assertion I separated data for individual crosses of
Y,ROMA and Y,rDNA
wt-10B
and of Y,ROMA and Y,rDNA
l-473
into
datasets corresponding to three replicate vials sired by separate indi-
viduals (vials “1,”“2,”and “3”) and all offspring sired by different
fathers laid in the first, second, or third increments of 5 days (vials
“0.1,”“0.2,”and “0.3”). These six separate populations were then
compared to the collection of all nine vials (vial “123”), and the data
for average and SD are shown in Table 3 and are shown graphically in
Figure 4. Averages and SDs of individual parallel vials were not dif-
ferent from the same vial during three successive time periods, nor
were they different from the assumption that all vials were indepen-
dent, indicating that the entirety of the variance I detected in frequen-
cies of offspring is random. The one exception (the first and third
transfer vials of the X2 class from the Y,ROMA/Y,rDNA
wt-10B
cross)
was significantly different (alpha = 0.025), but the lack of a correspond-
ing difference in any other case suggests that this is not meaningful.
Figure 1 (A) Sex chromosomes used in this study. The
Xchromosome is mutant for yellow and white but has
normal structure, including euchromatic arm (thin bar),
pericentric heterochromatin (thick bar), the rDNA locus
(gray), and a centromere (circle). In each cross there is
a normal Y(“type 1”), either marked with Bar or a P-
element containing yellow
+
and white
+
genes. The sec-
ond type of Y(“type 2”) is marked with a yellow
+
gene
and has a deletion of part of the rDNA array. (B) Sex
chromosome aneuploid males (XYY, here the Ychromo-
somes are referred to by their types and are called “1”
and “2“) can pair in three configurations. I denote “L”
pairing to be between Xand 1, which assures disjunc-
tion of those two chromosomes, whereas 2segregates
at random, generating one of four possible sperm sex
chromosome karyotypes: X,1&2,X&2,or1.“L”pairing
and the other two pairing configurations (“M”and “N”)
collectively produce six types of sperm (X,1,2,X1,X2,
and 12). Fertilization of an X-bearing egg will produce
one of six types of zygote, and each can be separately
identified based on dominant Y-linked marker genes. In
the hypothetical case in which there is no preferred
pairing between chromosomes (L=M=N”), the zygote
genotypes will be equally frequent. In an extreme hy-
pothetical case (“L=1.0”when “L”is the sole pairing
type because 2never pairs because of the defect in
rDNA-mediated pairing), two progeny classes will be
absent.
502 | K. A. Maggert
It is most clear from this analysis that complementary phenotypic
classes are independent. For example, L pairing produces X,12,X2,
and 1gametes, thus Xand 12 are complementary products, as are X2
and 1. If pairing was not dominated by randomness, then I expected
complementary classes to co-vary; they did not, indicating that vari-
ation is random and under-representation is postmeiotic.
To determine the limits of my ability to resolve small effects on
chromosome pairing and segregation by scoring final phenotypic
classes, I calculated the required sample size for X/Y,B/Y,rDNA
wt-10B
(which has the largest sample size) to resolve small differences in
phenotypic class frequency. Assuming the measured sampling average
was a true population distribution (m), I calculated the N required to
statistically distinguish each class from the cognate X/Y,B/Y,rDNA
l-473
(the smallest rDNA array; hence, the one I expected would have the
greatest impact on nondisjunction), with alpha = 0.05 and degrees of
freedom set arbitrarily large (degrees of freedom = 1000). Using
a normal t-distribution and hypothesis testing, I calculated that I
would need a sample size of N = 275 vials to resolve the difference in
frequencies of the X-bearing sperm phenotypic class, 266 for 12,90
for X1, 139 for 2, 1374 for X2, and 286 for 1. Note that these are the
sample sizes required to establish a statistically significant difference
in mean frequencies but, as noted above, no analysis can establish
Figure 2 Graphical representation of segregation frequencies from Table 2, including pooled average (black) and averaged vials (white) with 0.67
confidence interval (based on average 61 SD) for each phenotypic class shown in gray. Graph column on the left shows progeny types separated
for intragenotype comparison; graph column in the middle shows progeny types separated for intergenotype comparison. Graph column on the
right shows averaged vial with 0.67 confidence intervals (61 SD) for sex ratio and aneuploidy frequency. Sex ratio is normal, but subviability of
aneuploid classes is evident for some crosses.
Volume 4 March 2014 | Meiotic Pairing and rDNA Copy Number | 503
any consequence to differences in pairing effectiveness this small
because random fluctuation is an order of magnitude greater than
these differences in mean pairing frequency.
Confirmation of rDNA copy number
At the conclusion of scoring, individual males bearing sole copies of
the Y,B,Y,ROMA,andY,rDNA
Deficiency
series were outcrossed to
virgin females of genotype C(1)DX,y
1
f
1
bb
0
/Y,B
S
, which possess no
rDNA on their compound X-chromosomes. Female progeny were of
genotype C(1)DX/Y, where the Yin question was isolated after the
completion of the pairing/segregation assays. This had the benefitof
assuring that any contaminating chromosomes that were inadver-
tently included in the experiments would be readily identifiable. For
those chromosomes that do not contain sufficient rDNA for pupation
and adult viability (i.e.,Y,rDNA
l-473
,Y,rDNA
l-503
,andY,rDNA
l-484
),
progeny were collected as larvae, along with Y,rDNA
wt-10B
larvae for
comparison.
DNA was extracted from progeny and used for quantitative real-
time PCR as described. PCR reactions from crosses were performed to
give quantification of rDNA copy number with pooled SEM. Data are
presented in Table 4 and show rDNA copy number as a percentage
of Y,rDNA
wt-10B
, which my laboratory has used as our wild-type
Figure 3 Monotonic regression
for both Y#1 chromosomes as
a function of Y#2 rDNA copy num-
ber. Formulae and R
2
are shown
for each phenotypic class. Data
arefromTable4(forrDNA copy
number) and Table 2 (for class
frequency).
504 | K. A. Maggert
standard in previous studies (Paredes and Maggert 2009b). All data
are normalized to the tRNA
K-CTT
gene as the internal standard. In no
case did the rDNA copy number change significantly from the original
published value.
A note on the intersection of research and pedagogy
This work was initiated in the context of the first semester of the
Capstone Research Program in Biology, a 1-hr class that met once per
week during the spring semester of 2012 at Texas A&M University.
The Capstone is a four-semester progression in the Department of
Biology that targets sophomore biology majors to engage in active
research, learn how biologists think, design experiments, perform
trouble-shooting, collect data, assess its quality, analyze findings,
and communicate the results to others. The first semester is specif-
ically intended to foment interest in research, provide a modicum of
exposure to the laboratory or field, and develop basic practical ex-
perience in designing and interpreting experiments. Semesters two
and three provide a hybrid informatics-based course/laboratory re-
search experience (which can be substituted by laboratory or field-
work with a specific professor), and semester four teaches research
communication.
In the semester one class, pilot crosses using Y,rDNA
wt-10B
,Y,
rDNA
l-473
,andY,B
S
were set up and scored by the students, and the
class analyzed the data as a group. The initial findings from that class
were expanded later by me, but the essence of the experiment, in-
cluding the salient acceptance of the null hypotheses discussed above,
was performed by the students. This involved allowing small groups
(3–4 students) to come into the laboratory to collect virgin flies,
establish crosses, transfer vials, score phenotypes (e.g., body color
and sex), and count progeny. In the process of the experiment, the
class had the opportunity to read selected research articles (Bridges
1916a; McKee 1996; Hempel 1966; Paredes and Maggert 2009a), dis-
cuss chromosome pairing and nondisjunction in general terms, create
models and hypotheses for reasons why rDNA copy number might
affect pairing, work through predictions for different efficiencies
and establish alternative hypotheses, design and perform the crosses,
analyze the vast amount of numerical data, decide on the best
approaches (e.g., pooling the data into one experiment or treat each
vial individually), evaluate the strength of the data, and ultimately
arrive at a conclusion.
For example, as a class we discussed every pairing configuration
(L, M, and N), the meiotic segregation products, and sex determina-
tion by chromosome counting. This allowed the students to assure
themselves that the sex ratio was expected to be 1:1 even in aneuploid
crosses. It assured them that each of the six phenotypic classes could
arise from multiple pairing configurations, and that every chromo-
some was equally likely to be present. These observations initiated
discussion of expectations if L, M, and N were not equally likely, and
under what conditions biases in phenotypic classes would be found.
The concrete connection between the theoretical discussion of
pairing, seeing the XYY fathers, scoring the progeny to see the phe-
notypes, knowing exactly which flies had which chromosomes just
by looking at them, and comparing expectations we had all agreed
on with the actual data they collected were astoundingly effective. It
was a significant advantage for students who were enrolled in Cell
and Molecular Biology or in Genetics classes, because they could
apply their classroom knowledge to living organisms. Even though
the involvement in setting and counting the crosses was limited
(approximately 15 min per student), every student reported feeling
involved and having a vested interest in the discussions of chromo-
some segregation, the data collection, and even discussions of the
benefits of Bayesian inference. Specifically, problems that arose dur-
ing the experiment were easily used to launch discussions that they
otherwise would not likely be exposed to in a normal science
curriculum.
After the data were collected, the class observed (sometimes quite
significant) deviation from 1:1 male:female ratios in individual vials.
This fact gave the class a concrete example of variation with which
they could easily associate because they had collected the data. It was
an opportunity to discuss SD, probabilities of binomial distributions,
simple statistics (e.g., Student t-test, Bayesian confidence intervals,
alpha vs. beta, and type I and II errors), and the propriety of pooling
vials vs. averaging individual vials. I had more than one group count
the same vials without their knowledge, which revealed experimenter
error, allowing further discussion contrasting SEM with SD, and the
intuitive logic of how to pool error into SE of the difference. Many (if
Figure 4 Graphical representa-
tion of segregation frequencies
from Table 3. The 0.67 confi-
dence intervals are shown in gray.
Volume 4 March 2014 | Meiotic Pairing and rDNA Copy Number | 505
not all) of these points are known to geneticists and are often high-
lighted in crosses or homework in sophomore-level genetics labora-
tories. The difference here was two-fold. First, the students were
particularly engaged because this was “real”research in that it inves-
tigated a question that nobody had asked before. Thus, the result was
not known beforehand. The realization that they were the first people
in the history of humanity to see these data was a significant motiva-
tion. Second, the outcome was collaborative between all the students
of the class, which fostered joint feelings of competition and caution.
The value was profound, as exit interviews, course evaluations, and
personal comments even more than 1 yr later have highlighted.
It was a boon to involve undergraduate students in this ex-
periment, although it was difficult to align the joint considerations
of low-cost, explicable biological phenomenon, accessible data
collection, and synchronization of the organism’s life cycle with
the weekly class session. Still, the ability to perform investigative
science (as opposed to laboratory demonstration, however involved
the students may be) was a positive outcome well worth the effort.
ACKNOWLEDGMENTS
This work was completed in two phases. The first was performed by
21 undergraduate students as part of the Capstone Research Program
in Biology class in the Department of Biology at Texas A&M Univer-
sity during the spring 2012 semester. That class comprised J. Anderson,
J.Antony,K.Balding,E.Bruton,V.Cardenas,N.Charolia,P.Hoffmann,
A. Jones, K. Jones, S. Mash, S. McCawley, A. Moehlman, T. Oliver, R.
Pacilio, S. Patel, M. Patrick, J. Peters, L. Rubenstein, M. Schmuck, V.
Sonthalia, and V. Staniszewski. The second was an expansive follow-up
performed by myself with assistance by V. Cardenas.
LITERATURE CITED
Appels, R., and A. J. Hilliker, 1982 The cytogenetic boundaries of the rDNA
region within heterochromatin in the X chromosome of Drosophila
melanogaster and their relation to male meiotic pairing sites. Genet. Res.
39: 149–156.
Averbeck, K. T., and T. H. Eickbush, 2005 Monitoring the mode and tempo
of concerted evolution in the Drosophila melanogaster rDNA locus. Ge-
netics 171: 1837–1846.
Bridges, C. B., 1916a Non-disjunction as proof of the chromosome theory
of heredity. Genetics 1: 1–52.
Bridges, C. B., 1916b Non-disjunction as proof of the chromosome theory
of heredity (concluded). Genetics 1: 107–163.
Brosseau, G. E., and D. L. Lindsley, 1958 A dominantly marked Y chro-
mosome: YB. [S] Drosoph. Inf. Serv. 32: 116.
Clark, A. G., 1987 Natural selection and Y-linked polymorphism. Genetics
115: 569–577.
Cohen, S., K. Yacobi, and D. Segal, 2003 Extrachromosomal circular DNA
of tandemly repeated genomic sequences in Drosophila. Genome Res. 13:
1133–1145.
Cooper, K. W., 1964 Meiotic conjunctive elements not involving Chias-
mata. Proc. Natl. Acad. Sci. USA 52: 1248–1255.
Eickbush, T. H., W. D. Burke, D. G. Eickbush, and W. C. Lathe, 3rd,
1997 Evolution of R1 and R2 in the rDNA units of the genus
Drosophila. Genetica 100: 49–61.
Eickbush, D. G., J. Ye, X. Zhang, W. D. Burke, and T. H. Eickbush,
2008 Epigenetic regulation of retrotransposons within the nucleolus of
Drosophila. Mol. Cell. Biol. 28: 6452–6461.
Endow, S. A., 1980 On ribosomal gene compensation in Drosophila. Cell
22: 149–155.
Endow, S. A., 1982 Molecular characterization of ribosomal genes on
the Ybb- chromosome of Drosophila melanogaster. Genetics 102:
91–99.
Greil, F., and K. Ahmad, 2012 Nucleolar dominance of the Y chromosome
in Drosophila melanogaster. Genetics191: 119–128.
Grell, R. F., 1958 Preferential segregation of the sex chromosome in XYY
males of Drosophila melanogaster. Abstracts of the X International
Congress of Genetics, Montreal, 1958: 105.
Guerrero, P. A., and K. A. Maggert, 2011 The CCCTC-binding factor
(CTCF) of Drosophila contributes to the regulation of the ribosomal
DNA and nucleolar stability. PLoS ONE 6: e16401.
Hawley, R. S., and K. D. Tartof, 1985 A two-stage model for the control of
rDNA magnification. Genetics 109: 691–700.
Hawley, R. S., and C. H. Marcus, 1989 Recombinational controls of rDNA
redundancy in Drosophila. Annu. Rev. Genet. 23: 87–120.
Hempel, C. G., 1966 Philosophy of Natural Science,. Prentice-Hall, Inc.,
Englewood Cliffs, New Jersey.
Karpen, G. H., J. E. Schaefer, and C. D. Laird, 1988 A Drosophila rRNA
gene located in euchromatin is active in transcription and nucleolus
formation. Genes Dev. 2: 1745–1763.
Long, E. O., and I. B. Dawid, 1980 Repeated genes in eukaryotes. Annu.
Rev. Biochem. 49: 727–764.
Long, E. O., M. L. Rebbert, and I. B. Dawid, 1981a Nucleotide sequence of
the initiation site for ribosomal RNA transcription in Drosophila mela-
nogaster: comparison of genes with and without insertions. Proc. Natl.
Acad. Sci. USA 78: 1513–1517.
Long, E. O., M. L. Rebbert, and I. B. Dawid, 1981b Structure and expression
of ribosomal RNA genes of Drosophila melanogaster interrupted by type-
2 insertions. Cold Spring Harb. Symp. Quant. Biol. 45(Pt 2): 667–672.
Lyckegaard, E. M., and A. G. Clark, 1989 Ribosomal DNA and Stellate gene
copy number variation on the Y chromosome of Drosophila mela-
nogaster. Proc. Natl. Acad. Sci. USA 86: 1944–1948.
Lyttle, T. W., 1981 Segregation in XYY males and XXY females of D.
melanogaster. Drosoph. Inf. Serv. 56: 87–90.
Maggert, K. A., and K. G. Golic, 2002 The Y chromosome of Drosophila
melanogaster exhibits chromosome-wide imprinting. Genetics 162: 1245–
1258.
Maggert, K. A., and K. G. Golic, 2005 Highly efficient sex chromosome
interchanges produced by I–CreI expression in Drosophila. Genetics 171:
1103–1114.
McKee, B. D., 1996 The license to pair: identification of meiotic pairing
sites in Drosophila. Chromosoma 105: 135–141.
McKee, B. D., 1998 Pairing sites and the role of chromosome pairing in
meiosis and spermatogenesis in male Drosophila. Curr. Top. Dev. Biol.
37: 77–115.
McKee, B. D., 2004 Homologous pairing and chromosome dynamics in
meiosis and mitosis. Biochim. Biophys. Acta 1677: 165–180.
McKee, B. D., 2009 Homolog pairing and segregation in Drosophila mei-
osis. Genome Dyn. 5: 56–68.
McKee, B. D., and G. H. Karpen, 1990 Drosophila ribosomal RNA genes
function as an X-Y pairing site during male meiosis. Cell 61: 61–72.
McKee, B. D., L. Habera, and J. A. Vrana, 1992 Evidence that intergenic
spacer repeats of Drosophila melanogaster rRNA genes function as X-Y
pairing sites in male meiosis, and a general model for achiasmatic pairing.
Genetics 132: 529–544.
Merrill, C. J., D. Chakravarti, L. Habera, S. Das, L. Eisenhour et al.,
1992 Promoter-containing ribosomal DNA fragments function as X-Y
meiotic pairing sites in D. melanogaster males. Dev. Genet. 13: 468–484.
Paredes, S., and K. A. Maggert, 2009a Expression of I–CreI endonuclease
generates deletions within the rDNA of Drosophila. Genetics 181: 1661–
1671.
Paredes, S., and K. A. Maggert, 2009b Ribosomal DNA contributes to
global chromatin regulation. Proc. Natl. Acad. Sci. USA 106: 17829–
17834.
Peng, J. C., and G. H. Karpen, 2008 Epigenetic regulation of heterochro-
matic DNA stability. Curr. Opin. Genet. Dev. 18: 204–211.
Peng, J. C., and G. H. Karpen, 2009 Heterochromatic genome stability
requires regulators of histone H3 K9 methylation. PLoS Genet. 5:
e1000435.
Perez-Gonzalez, C. E., and T. H. Eickbush, 2002 Rates of R1 and R2 ret-
rotransposition and elimination from the rDNA locus of Drosophila
melanogaster. Genetics 162: 799–811.
506 | K. A. Maggert
Perez-Gonzalez, C. E., W. D. Burke, and T. H. Eickbush, 2003 R1 and R2
retrotransposition and deletion in the rDNA loci on the X and Y chro-
mosomes of Drosophila melanogaster. Genetics 165: 675–685.
Ren, X., L. Eisenhour,C. Hong, Y. Lee, and B. D. McKee, 1997 Roles of rDNA
spacer and transcription unit-sequences in X-Y meiotic chromosome
pairing in Drosophila melanogaster males. Chromosoma 106: 29–36.
Ritossa, F. M., 1968 Unstable redundancy of genes for ribosomal RNA.
Proc. Natl. Acad. Sci. USA 60: 509–516.
Ritossa, F. M., and S. Spiegelman, 1965 Localization of DNA complemen-
tary to ribosomal RNA in the nucleolus organizer region of Drosophila
melanogaster. Proc. Natl. Acad. Sci. USA 53: 737–745.
Roseman, R. R., E. A. Johnson, C. K. Rodesch, M. Bjerke, R. N. Nagoshi et al.,
1995 A P element containing suppressor of hairy-wing binding regions
has novel properties for mutagenesis in Drosophila melanogaster. Ge-
netics 141: 1061–1074.
Sokal, R. R., and F. J. Rohlf, 1995 Biometry: the principles and practice of
statistics in biological research, W.H. Freeman, New York.
Spear, B. B., 1974 The genes for ribosomal RNA in diploid and polytene
chromosomes of Drosophila melanogaster. Chromosoma 48: 159–179.
Stage, D. E., and T. H. Eickbush, 2007 Sequence variation within the rRNA
gene loci of 12 Drosophila species. Genome Res. 17: 1888–1897.
Tartof, K. D., 1973 Regulation of ribosomal RNA gene multiplicity in
Drosophila melanogaster. Genetics 73: 57–71.
Terracol, R., and N. Prud’homme, 1986 Differential elimination of rDNA
genes in bobbed mutants of Drosophila melanogaster. Mol. Cell. Biol. 6:
1023–1031.
Terracol, R., and Y. Iturbide, and N. Prud’Homme, 1990 Partial reversion
at the bobbed locus of Drosophila melanogaster. Biol. Cell 68: 65–71.
Warner, J. R., 1999 The economics of ribosome biosynthesis in yeast.
Trends Biochem. Sci. 24: 437–440.
Wellauer, P. K., and I. B. Dawid, 1977 The structural organization of ri-
bosomal DNA in Drosophila melanogaster. Cell 10: 193–212.
Communicating editor: M. C. Zetka
Volume 4 March 2014 | Meiotic Pairing and rDNA Copy Number | 507
