Content uploaded by L. Miguel Martins
Author content
All content in this area was uploaded by L. Miguel Martins on Aug 29, 2014
Content may be subject to copyright.
Available via license: CC BY 3.0
Content may be subject to copyright.
Loss of PINK1 enhances neurodegeneration in a mouse model
of Parkinson’s disease triggered by mitochondrial stress
q
Nicoleta Moisoi
b
,
*
, Valentina Fedele
a
, Jennifer Edwards
a
, L. Miguel Martins
a
,
**
a
Cell Death Regulation Laboratory, MRC Toxicology Unit, Hodgkin Building, Lancaster Road, Leicester LE1 9HN, UK
b
Cell Physiology and Pharmacology Department, University of Leicester, Maurice Shock Building, University Road, Leicester LE1 9HN, UK
article info
Article history:
Received 14 July 2013
Received in revised form
12 September 2013
Accepted 7 October 2013
Keywords:
Mitochondria quality control
Neurodegeneration
Parkinson’s disease
abstract
Parkinson’s disease (PD) shows a complex etiology, where both genetic and environmental factors
contribute to initiation and advance of pathology. Mitochondrial dysfunction and mutation of genes
implicated in mitochondria quality control are recognized contributors to etiopathology and progression
of PD. Here we report the development and characterization of a genetic mouse model of PD with a
combined etiology comprising: 1) induction of mitochondrial stress achieved through the expression of a
mitochondrial matrix protein that accumulates in an unfolded state and 2) deletion of PINK1 gene. Using
this model we address the role of PINK1 in mitochondrial quality control and disease progression.
To induce mitochondrial stress specifically in catecholaminergic neurons we generated transgenic
animals where the conditional expression of mitochondrial unfolded ornithine transcarbamylase (dOTC)is
achieved under the tyrosine hydroxylase (Th) promoter. The mice were characterized in terms of survival,
growth and motor behaviour. The characterization was followed by analysis of cell death induced in
dopaminergic neurons and responsiveness to
L
-dopa. We demonstrate that accumulation of dOTC in
dopaminergic neurons causes neurodegeneration and motor behaviour impairment that illustrates a
parkinsonian phenotype. This associates with
L
-dopa responsiveness validating the model as a model of
PD. The combined transgenic model where dOTC is overexpressed in PINK1 KO background presents
increased neurodegeneration as compared to dOTC transgenic in wild-type background. Moreover, this
combined model does not show responsiveness to
L
-dopa. Our in vivo data show that loss of PINK1 ac-
celerates neurodegenerative phenotypes induced by mitochondrial stress triggered by the expression of
an unfolded protein in this organelle.
Ó2013 The Authors. Published by Elsevier Ltd. All rights reserved.
1. Introduction
Parkinson’s disease (PD) is the second most common neurode-
generative disorder, with a prevalence second only to that of Alz-
heimer’s disease. The primary hallmarks of the disease are
degeneration of multiple neuronal types including, most notably,
dopaminergic (DA) neurons in the Substantia Nigra of the midbrain
(Shulman et al., 2011), and formation of Lewy bodies, intra-
cytoplasmic inclusions that are mainly composed of fibrillar
a
-
synuclein. The, pathology of many non-dopaminergic neurons
including olfactory and brain stem neurons precedes that of DA
neurons (Braak et al., 2003). Patients with PD present characteristic
motor symptoms, such as resting tremor, slowness of movement,
rigidity, postural instability, and gait perturbation. PD patients also
present a combination of non-motor symptoms including psychi-
atric symptoms such as depression and anxiety, autonomic
dysfunction (involving cardiac and digestive systems), perturbed
sleep patterns, and musculoskeletal abnormalities (Simuni and
Sethi, 2008). PD has a complex multifactorial etiology where both
environmental and genetic factors appear to be important.
Mitochondrial dysfunction is at the core of several age related
neurodegenerative diseases including Parkinson’s disease (Lezi and
Swerdlow, 2012). Over the last years mutations found in familial or
sporadic cases of neurodegenerative disorders provided insights
into the mechanisms underlying neurodegeneration. That is also
the case for PD where a number of proteins have been found
mutated and their function has been directly or indirectly corre-
lated with mitochondria, oxidative stress and accumulation of
q
This is an open-access article distributed under the terms of the Creative
Commons Attribution License, which permits unrestricted use, distribution, and
reproduction in any medium, provided the original author and source are credited.
*Corresponding author.
** Corresponding author. Tel.: þ44 116 252 5533; fax: þ4 4 116 252 5616.
E-mail addresses: nm105@le.ac.uk (N. Moisoi), martins.lmiguel@gmail.com
(L.M. Martins).
Contents lists available at ScienceDirect
Neuropharmacology
journal homepage: www.elsevier.com/locate/neuropharm
0028-3908/$ esee front matter Ó2013 The Authors. Published by Elsevier Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.neuropharm.2013.10.009
Neuropharmacology 77 (2014) 350e357
unfolded proteins (Kumar et al., 2012). The presence of protein
aggregates in neurodegeneration, including PD, has been well
documented. In PD, Lewy bodies are known to contain unfolded
proteins of mitochondrial origin, together with proteins that are
normally located in the cytosol or at neuronal synapses. Although
the accumulation of unfolded proteins in the mitochondria has
been debated (de Castro et al., 2010) there is now clear evidence
both from patient samples and animal models that in PD there is
accumulation of mitochondrial unfolded proteins correlated with
mitochondrial stress signalling (de Castro et al., 2012).
Cells have developed several defence mechanisms to cope with
mitochondrial damage (Tatsuta and Langer, 2008;Baker et al., 2011).
Molecular quality control represents the first step in the mito-
chondrial defence mechanisms. This implicates the up-regulation of
Fig. 1. pZ/EG dOTC-FLAG expression construct. (A) The Z/EG construct for the expression of dOTC-FLAG consists of strong chicken
b
-actin promoter, directing the expression of a
loxP-flanked (triangles)
b
geo (lacZ/neomycin-resistance) fusion gene and three SV40 polyadenylation sequences. Following that, there is the coding sequence of dOTC-FLAG, that
precedes an internal ribosomal entry site (IRES) and EGFP and a rabbit
b
globin polyadenylation sequence. In this configuration,
b
geo is expressed before Cre excision whereas dOTC-
FLAG and EGFP are expressed from a single mRNA after Cre excision. Indicated in the figure is the approximate position of oligonucleotide sequences used to detect the Cre-
mediated recombination by PCR analysis (P1, P2, P3). (B) PCR-analysis of Cre mediated recombination. The recombination in U2OS cells was achieved by overexpressing the Z/
EG dOTC-FLAG construct together with a plasmid expressing Cre recombinase under activation with tamoxifen. (C) Detection of EGFP in cells transfected with dOTC expression
plasmid following Cre-mediated recombination. Expression of dOTC at protein level following recombination is shown by immunostaining (red). (D) dOTC (green) colocalization
with mitochondria mtHsp70 (red) has been confirmed in U2OS cells transfected with dOTC in a vector for mammalian cells expression. (For interpretation of the references to
colour in this figure legend, the reader is referred to the web version of this article.).
N. Moisoi et al. / Neuropharmacology 77 (2014) 350e357 351
nuclear genes encoding for mitochondrial chaperones and proteases
to assist the removal of misfolded and non-assembled polypeptides.
This molecular quality control represents a form of mitochondrial
retrograde signalling known as the UPR
mt
(Haynes and Ron, 2010).
The second level of mitochondria quality control is achieved
through fusion and fission processes facilitated by the highly dy-
namic nature of mitochondria (Twig et al., 2008a,b). Damaged
mitochondria can fuse with healthy organelles to restore the level of
healthy components necessary for proper mitochondrial function.
When the damage is excessive, the first two levels of quality control
are overwhelmed mitochondria become depolarized and are tar-
geted for recycling through a specific form of autophagy, termed
mitophagy (Wang and Klionsky, 2011; Youle and Narendra, 2011).
Components of this quality control pathway such as PINK1 and
Parkin have already been found mutated in PD or associated with
increased susceptibility for PD like the mitochondrial protease
HTRA2 (reviewed in Rugarli and Langer, 2012).
The PINK1 gene encodes a highly conserved serineethreonine
kinase, mutations in which cause autosomal-recessive parkin-
sonism (Valente et al., 2004; Nuytemans et al., 2010). These mu-
tations compromise the kinase activity or interfere with protein
stability suggesting a loss-of-function mechanism in PD (Deas
et al., 2009; Kawajiri et al., 2011; Thomas and Cookson, 2009).
Further supporting this loss-of-function model, Drosophila pink1
mutants show reduced life span, and degeneration of flight mus-
cles and dopaminergic neurons (Clark et al., 2006; Park et al.,
2006).
Deletion of PINK1 in mice results in a subtle phenotype involving
decreased dopamine levels motor deficits in aged mice (Gispert
et al., 2009) and impaired synaptic plasticity (Kitada et al., 2007).
A conditional KO of PINK1 displays phenotypes reminiscent of early
PD, including impaired gait, olfaction and serotonergic innervation
(Glasl et al., 2012). Moreover, mitochondrial respiration is impaired
in the PINK1 KO mice (Gautier et al., 2008; Gispert et al., 2009).
A model that has now been established to study mitochondrial
stress response and quality control is through overexpression of
unfolded mitochondrial ornithine transcarbamylase (OTC). OTC is a
mitochondrial enzyme involved in urea metabolism, normally only
expressed in liver and small intestine and absent from transformed
cells. Previous studies have established that accumulation of this
protein in the mitochondrial matrix in an unfolded structure
induced a mitochondrial stress response UPR
mt
, characterized by
transcriptional up-regulation of mitochondrial chaperones and
proteases (Zhao et al., 2002; de Castro et al., 2012).
Fig. 2. Expression of dOTC in Substantia Nigra. (A) The level of rat OTC mRNA in Substantia Nigra (SN) where the Cre recombination occurs under the tyrosine hydroxylase (Th)
promoter. We detected a significantly higher mRNA level in the SN of the double transgenic mice. Statistical significance was analysed with Student T-test (n¼3) between the
indicated groups. (B) EGFP fluorescence image was taken from brain slices (perfused and fixed in paraformaldehyde) with the same exposure for control and transgenic mice
expressing dOTC-EGFP. The imagescovered an area of the brain including most of the Substantia Nigra and Ventral Tegmental Area. (C) Expression of dOTC in dopaminergic neurons
confirmed using anti-GFP immunostaining (red) and by colocalization with tyrosine hydroxylase (green). (For interpretation of the references to colour in this figure legend, the
reader is referred to the web version of this article.).
N. Moisoi et al. / Neuropharmacology 77 (2014) 350e357352
Moreover we have recently reported the development of an
in vivo model for mitochondrial dysfunction as a consequence of
protein misfolding in Drosophila. In transgenic flies, the accumu-
lation of abnormally folded proteins resulted in mitochondrial
phenotypical alterations similar to those reported in Drosophila
models of PD (Clark et al., 2006; Park et al., 2006).
Here we present a mouse model that reproduces cardinal
features of the complex PD etiology. The model combines
mitochondrial stress achieved through the expression of dOTC in
the mitochondrial matrix together with impairment in the mito-
chondria quality control through genetic deletion of PINK1.
Using this model we show that the induction of mitochondrial
stress in dopaminergic neurons results in neurodegeneration
and motor impairment that is rescued by the administration of
L
-dopa. The process of neurodegeneration is accelerated by loss of
PINK1.
Fig. 3. Motor behaviour characterization. (A, B) Growth curves of double transgenic mice from two independent lines with single integration of the dOTC transgene do not show a sig-
nificantinfluence of the transgeneexpressionon this parameter.(C, D) Motor abilityassessed byrearing activity in ‘openfield system’is decreasedin both lines. Two-wayANOVA for age and
genotypeshow: panel C estatisticallysignificant differencesfor genotype (line 6-1C, p¼0.04, n¼3e5)and no statistical difference forage; panel D estatistically significantdifferences for
genotype(line 8-3A, p¼0.03, n¼3e5) and no statisticaldifference forage; (E) Motor behaviouranalysis of tripletransgenic overexpressingdOTC single integrationfrom line 6-1C in PINK1
KObackground shows a more pronounceddecrease of motor ability.Two-wayANOVA shows significantdifference with genotype,p¼0.05, n¼4e9, and not significantdifference with age.
N. Moisoi et al. / Neuropharmacology 77 (2014) 350e357 353
Fig. 4. Neurodegeneration in the dopaminergic pathway. The neuronal cell death was assayed by immunohistochemistry of tyrosine hydroxylase positive neurons in brains of the
indicated genotypes. Overexpression of dOTC induces cell death in the Substantia Nigra with a significant reduction in the dopaminergic neurons of 25% at one year of age (A, B)
(n¼3). In the PINK1 KO background this decrease is accentuated as shown by a more severe reduction in the number of Th positive neurons, to 40% (n¼3) (C) The level of
dopamine in Substantia Nigra was analysed by HPLC measurements in tissue of the indicated genotype. The dopamine content is reduced in the double transgenic in WT
N. Moisoi et al. / Neuropharmacology 77 (2014) 350e357354
2. Results
2.1. Generation of a system for the conditional expression of dOTC in
mice
In previous work we used dOTC to develop a model for mito-
chondrial stress in the fruit fly, Drosophila melanogaster (de Castro
et al., 2012). In order to extend these studies to a mammalian sys-
tem, we made use of a system for the in vivo delivery of dOTC in
mouse. To achieve this, we generated a dOTC-FLAG expression
construct for in vivo studies based on the system described by Novak
and colleagues (Novak et al., 2000)(Fig.1A). This system enables the
expression of dOTC by Cre mediated recombination. Additionally,
cells where Cre-mediated recombination has taken place lose
expression of a lacZ reporter transgene with concomitant activation
of enhanced-GFP (EGFP) expression. We first demonstrated the
efficient recombination of the transgene in U2OS cultured cells
transfected with the dOTC expression construct either in the pres-
ence or absence of a Cre recombinase expression vector. The
recombination at DNA level was confirmed by PCR (Fig. 1B), using
two sets of primers as indicated in Fig.1Aand B. Next, we transfected
cultured human cells with the transgene expression construct and
confirmed at protein level that co-expression of Cre recombinase
results in expression of dOTC with the EGFP reporter (Fig. 1C).
Additionally we have validated the localization of the dOTC to the
mitochondria by colocalization with mtHSP70 (Fig. 1D). We
demonstrated elsewhere that dOTC-FLAG overexpressed in vitro in
cell culture and in vivo in Drosophila accumulated in an unfolded
state in the mitochondria (de Castro et al., 2012) and its capability to
induce UPR
mt
in these systems (Zhao et al., 2002; de Castro et al.,
2012). Taken together this data validates our system for the
controlled delivery of dOTC in transgenic mouse models with the
purpose of inducing genetically a mitochondrial stress.
2.2. In vivo expression of dOTC in dopaminergic neurons
We first obtained transgenic mice containing the dOTC expres-
sion system. After Southern Blot analysis to confirm the successful
integration of the gene, two transgenic lines containing a single
integration (6-1C, 8-3A) were used for further characterization.
In order to induce mitochondrial stress in catecholaminergic
neurons we crossed dOTC mice with a line that expresses the Cre
recombinase under the control of the tyrosine hydroxylase pro-
moter (Th-Cre line) (Savitt et al., 2005).
We then demonstrated, that dOTC is expressed in the tissue of
interest. We measured the mRNA levels for the dOTC transgene in
the Substantia Nigra (SN) where the Cre recombination occurs
under the tyrosine hydroxylase promoter, detecting a significantly
higher mRNA level in the double transgenic mice (Fig. 2A).
Additionally, we confirmed the correct expression of the trans-
gene by measuring the fluorescence of the EGFP reporter that is co-
expressed with dOTC (Fig. 2B). In order to increase the GFP signal
and to verify the selective expression in dopaminergic neurons, we
used anti-GFP staining (red) and colocalization with tyrosine hy-
droxylase stain (green) (Fig. 2C).
2.3. PINK1 loss of function enhances the degenerative phenotype
induced by mitochondrial stress
To determine the consequences of enhanced stress caused by
the expression of a mitochondrial protein in a misfolded state, the
dOTC-expressing mice were characterized for both growth and
motor behaviour. We did not observe any growth defects in dOTC
expressing mice (Fig. 3A and B). However, in both lines there is a
significant decrease in motor abilities as measured by reduced
rearing movements (Fig. 3C and D).
One of the single integration lines (6-1C) has been used to study
the effect of PINK1 loss of function on the phenotype induced by the
expression of dOTC (Fig. 3E). Due to the low probability to obtain all
the desired genotypes in the same colony, the mice were bred on
two different colonies: dOTC were crossed with Th-Cre onwild type
PINK1 background and on PINK1 KO background. Therefore the
comparisons were made between dOTCþ/Thþversus control/WT,
dOTCþ/Thþ/PINK1 KO versus control/PINK1 KO.
The motor ability analysis in the PINK1 KO background shows a
decrease in the rearing activity for the triple transgenic line as
compared to PINK1 KO. This appears to be accelerated as compared
to the decrease in rearing activity induced by dOTC in the WT
background. In the WT background the reduction in the rearing
activity shows at one year of age while in the PINK1 KO background
it diminishes from six months.
We then characterized the transgenic mice from one of the lines
(6-1C) for cell death and dopamine content in the Substantia Nigra.
The tyrosine hydroxylase (Th) positive cell counts show 25%
decrease in neuronal population in dOTCþ/Thþat one year of age
(Fig. 4A and B). Similarly with the motor dysfunction trait, loss of
PINK1 function accelerates this phenotype. Thus, in PINK1 KO
background overexpression of dOTC induces a cell loss of about 40%
in SN (Fig. 4A and B). We have then measured the level of dopamine
in the Substantia Nigra by HPLC. PINK1 KO mice are known to
present a reduction in dopamine levels that becomes significant
from 18 months of age in spite of no dopaminergic cell loss being
detected (Gispert et al., 2009). In our experimental set-up the PINK1
KO strain versus WT presented a reduction in the dopamine levels
reported to the mass of tissue at 12 months of age, but this was not
significant to 95% with a p>0.05 in the Student T-test. Due to the
breeding protocol in two separated colonies (WT respectively
PINK1 KO background) we have presented the data comparing the
dOTCþ/Thþtransgenics to littermates control within the individual
colonies. The dOTC overexpressed in WT background demonstrates
a significant decrease in the dopamine levels versus control.
Interestingly in the PINK1 KO background overexpression of dOTC
does not induce a further reduction in the dopamine levels (Fig. 4C).
In order to assess whether the parkinsonian phenotype we have
achieved in this transgenic mice is dependent on
L
-dopa, we per-
formed a pharmacological rescue experiment analysing the motor
behaviour after
L
-dopa injection. Injection of
L
-dopa induced an
increase in the rearing movement in 50% of controls and in 60% of
double transgenics (Fig. 4D). The increase in motor ability is sig-
nificant suggesting that motor dysfunction caused by mitochon-
drial stress is rescued by
L
-dopa. Most strikingly the injection of
L
-
dopa in the PINK1 KO background does not improve the motor
behaviour in any of the mice assessed (Fig. 4E). This suggests that
the dopaminergic signalling is impaired in the transgenic mice
presenting both dOTC induced mitochondrial stress and PINK1 loss
of function.
3. Discussion
Sporadic PD appears to have a complex multifactorial etiology
with variable contributions from environmental factors and genetic
susceptibility.
background, versus control. Overexpression of dOTC in PINK1 KO background does not decrease the dopamine level as compared to PINK1 KO control. (D) Pharmacological rescue of
behavioural deficit with L-dopa shows increased activity in a population of mice from double transgenics in both control and dOTC overexpressing mice. The data presented here are
from responsive mice (n¼4WT,n¼3PINK1 KO). (E) For triple transgenic mice with dOTC expressed in PINK1 KO background there is no response reflected in rearing activity
changes following L-dopa treatment. (n¼8 for each WT and PINK1 KO). The analysis was performed with Student T-test between the indicated groups.
N. Moisoi et al. / Neuropharmacology 77 (2014) 350e357 355
It is now recognized that Parkinson’s disease is a multisystem
neurodegenerative disorder that affects multiple areas of the brain
(Braak et al., 2003) with motor symptoms appearing when greater
than 50% of the dopamine neurons in the Substantia Nigra are lost.
Modelling prodromal symptomatology of PD appears possible using
transgenic mice with loss of function in PINK1,PARKIN,DJ-1 genes or
gain of function in LRKK2, and
a
-synuclein [reviewed in Smith et al.
(2012)], genes found mutated in PD. The early symptomatology from
these models offers the possibility of targeting dysfunctional path-
ways, prior to severe neuronal loss when drug treatments appear to
improve symptoms but not to target the disease progression.
Mutations in PINK1 serineethreonine kinase are the second
most common cause of autosomal recessive parkinsonism after
mutations in the PARKIN gene (Valente et al., 2004). About 30
pathogenic mutations have been associated with the disease
[reviewed in Nuytemans et al. (2010)]. Deletion of PINK1 in mice
does not result in an overt phenotype. The mice display only subtle
deficits, which differ slightly between different loss-of-function
models, but converge to give a whole picture of a prodromal
model of PD. Thus the phenotype present only minor decrease in
total dopamine levels in very old mice (Gispert et al., 2009),
impaired synaptic plasticity in the striatum but no loss of dopa-
minergic neurons in Substantia Nigra (Kitada et al., 2007) respec-
tively a minor loss of dopamine cells in a more recent conditional
model of PINK1 loss-of-function (Glasl et al., 2012). Mitochondrial
respiration is impaired in the striatum of PINK1 KO and respiration
deficits can be induced in the cortex by cellular stress (Gautier et al.,
2008). The mobilization of reserve pool synaptic vesicles at the
neuromuscular junction of pink1 deficient flies is impaired during
rapid stimulation due to synaptic ATP depletion, indicating that
synaptic activity cannot be maintained under increased energy
demand in pink1 deficient neurons (Morais, 2009).
There is strong published data from in vitro and Drosophila
models linking PINK1 to mitochondrial function and mitochondrial
quality control together with Parkin (reviewed in Pilsl and
Winklhofer, 2012). However, the role of the PINK1/Parkin pathway
in vivo needs to be studied further particularly due to the fact that
recent work from Larsson and colleagues could not demonstrate an
in vivo role for Parkin in mitochondrial quality control in a mouse
model of Parkinsonism based on dopaminergic neuron-specific loss
of the mitochondrial transcription factor A (TFAM) (Van Laar et al.,
2011; Sterky et al., 2011).
The data presented here demonstrates for the first time in an
in vivo model that PINK1 loss of function is capable to accelerate
neurodegenerative phenotypes induced by mitochondrial stress.
We made use of a model of mitochondrial stress induction through
the expression of a protein in the mitochondrial matrix that has
been previously characterized both in vitro and in vivo (Zhao et al.,
2002; de Castro et al., 2012). Our data indicates that the accumu-
lation of a misfolded protein in the dopaminergic neurons is
capable of inducing neurodegeneration and motor behaviour
impairment that illustrates a parkinsonian phenotype. This asso-
ciates with
L
-dopa responsiveness validating the model as a model
of Parkinsonism. We hypothesise further that increased expression
of dOTC would be able to accelerate the parkinsonian phenotype
that we have obtained here and would produce a model that can be
used in pharmacological studies for Parkinson’s treatments.
Our results show that PINK1 loss of function accelerates the
motor deficit and the dopaminergic degeneration induced by
overexpression of dOTC in the mitochondria. First, the motor
behaviour impairment although mild, as expected from a pro-
dromal model of PD, appears faster in the PINK1 KO background
than in the WT. PINK1 KO mice did not present a loss of dopami-
nergic neurons up to one year of age, similarly with the pheno-
types reported in the literature and reviewed here. However, the
PINK1 loss of function appears to accentuate the loss of dopami-
nergic neurons determined by the dOTC induced mitochondrial
stress. Interestingly, overexpression of dOTC in the PINK1 KO
background does not decrease the dopamine levels as compared to
the PINK1 KO control. These results suggest that loss of dopamine
production might occur in the same neuronal population or
through the same mechanistic pathway for both PINK1 loss of
function and dOTC expression.
Most strikingly, the loss of PINK1 compromised the rescue of the
motor deficit induced by dOTC mitochondrial stress with
L
-dopa.
Previous published data mention that PINK1 loss of function results
in impaired dopaminergic signalling manifested in low dopamine
release from nigrostriatal terminals and consequent reduction in
activation of specific postsynaptic receptors. This is accompanied by
defects in corticostriatal electrophysiological properties (Kitada et al.,
2007). The fact that
L
-dopa injection does not appear to improve the
motor deficit caused by mitochondrial stress in PINK1 KO back-
ground supports the hypothesis that the model presented here
demonstrates a deficit in transmission of dopaminergic signalling.
In spite of the mild phenotypes that PINK1 KO mice show, this
model has established itself as a useful prodromal model of PD
(Smith et al., 2012). Here we make use of it to demonstrate that
PINK1 loss of function contributes to parkinsonian neuro-
degeneration. Moreover the combination of mitochondrial stress
and PINK1 loss of function demonstrates for the first time that PD
has a multifactorial etiology where genetic and environmental
factors might synergize to increase neurodegeneration.
4. Materials and methods
4.1. Expression of dOTC
The deletion mutant dOTC (30-114) fused to a carboxy-terminal FLAG tag
sequence was clonedinto the conditional Z/EG expression vector (Novaket al., 200 0).
Recombination was assayed using a PCR strategy with primers P1 (5
0
-
TCTGCTAACCATGTTCATGCC-3
0
), P2 (5
0
-ATGTGCTGCAAGGCGATTAAG-3
0
) and P3 (5
0
-
TCTGACAGTCCGTTGACAATTG-3
0
). The recombination was tested in U2OS cells by
transfection (with Effectene) of the Z/EG dOTC-FLAG expression vector together with
the Cre expression vector pCAGGS_Cre-ER (a gift from Prof. Catrin Pritchard, Uni-
versity of Leicester). Expression of Cre was induced 24 h after transfection by addi-
tion of 4-hydroxy-tamoxifen(1 mM) for 48 h. The cells were than fixed and extracted
with 3% PFA in microtubule stabilizing buffer (Moisoi et al., 2002) and processed for
immunofluorescence with the antibody against OTC (Sigma). For colocalization of
dOTC with the mitochondria, dOTC was overexpressed in U2OS using a mammalian
expression vector, pcDNA3-dOTC, and the cells were fixed and processed for
immunofluorescence with the indicated antibodies (OTC respectively mtHSP70).
4.2. Animal husbandry
Animal husbandry and experimental procedures were performed in full
compliance with the United Kingdom Animal (Scientific Procedures) Act 1986.
The dOTC lines have been produced and characterized for the integration of the
gene by GENEOWAY, Lyon, France. The mice used in these experiments have been
backcrossed 5e6 times to a C57/B6 background.
The PINK1 KO mice have been obtained from LEXICON GENETICS and have been
described previously (Wood-Kaczmar et al., 2008). They were fully backcrossed on
C57/B6 background (more than ten times).
The Th-Cre line was from Jackson’s laboratory and they are bred on a C57/B6
background.
In order to obtain the desired genotypes the mice were bred on two different
colonies: dOTC were crossed with Th-Cre on wild type PINK1 background and on
PINK1 KO background. For the experiments presented here we used males.
4.3. Mice genotyping
The genotyping of dOTC mice was performed within the EGFP locus with
the primers: oIMR0042(CTAGGCCACAGAATTGAAAGATCT), oIMR0043(GTAGGTG-
GAAATTCTAGCATCATCC), oIMR0872(AAGTTCATCTGCACCACCG), oIM1416(A-
GATGGTGCG). The top band at 324 bp is a positive control band and the bottom band
at 173 bp represents the EGFP locus genotype.
The ThCre mice were genotyped using the primers:
Th-Cre(þ) (AAATGTTGCTGGATAGTTTTTACTGC)
Th-Cre() (GGAAGGTGTCCAATTTACTGACCGTA)
N. Moisoi et al. / Neuropharmacology 77 (2014) 350e357356
This genotyping protocol provides a single band for the mutant locus at 300 bp.
The PINK1 KO genotype was performed using the primers:
EB0088-26 (CTGCCCTCAGGGTCTCTAATGC),
EB0088-27 (GGAAGGAGGCCATGGAAATTGT),
Neo3a (GCAGCGCATCGCCTTCTATC)
The top band at 296 bp genotypes the wt locus, the bottom band at 193 bp
genotypes the mutant locus.
4.4. Behavioural testing
Locomotor activity was assessed using a computer-controlled photocell-based
system (Linton Instruments, UK) as described previously (Moisoi et al., 2009). The
activity has been recorded every 10min over 1 h and the result is given as average of
the 6 measurements. The parameter reported is ‘Rearing activity’calculated as
number of rearings in active time.
4.5. Pharmacological rescue
Transgenic mice and control littermates were injected intraperitoneal with sa-
line control (0.9% NaCl) or methyl levodopa hydrochloride 25 mg/kg with benser-
azide 6.5 mg/kg (Sigma) in saline solution. Behavioural testing was performed
40 min after the injection.
4.6. Histology, immunohistochemistry and immunofluorescence of brain tissues
In order to confirm the protein overexpression the brains of 2 months old mice
were perfused and fixed in 4% paraformaldehyde. Coronal sections were cut at 10
m
m
thickness. For GFP signal, images were taken at the same exposure for both control
and transgenic mice. In order to check the localization of the GFP signal in the
dopaminergic neurons, the sections were processed for immunofluorescence using
an anti-GFP (Roche) and anti-tyrosine hydroxylase antibodies.
For tyrosine hydroxylase staining, and dopaminergic cell counts, brains were
harvested from one-year mice old and processed as described previously (Moisoi
et al., 2009). Dopaminergic neurons were visualized by immunostaining with
anti-tyrosine hydroxylase antibody using the DAKO duet system (DAKO K0492)
with 3,3, diaminobenzidine (DAB) as the chromagen according to the manufac-
turer’s instruction. The immunostained sections were counterstained with
hematoxilin.
4.7. Neuronal quantitation
Counts of dopaminergic neurons(tyrosine hydroxylase positive)were performed
in the area of Substantia Nigra and Ventral Tegmental Area. Whole brain coronal
sections were reconstituted from digital images acquired with a 10objective using
the Photomerge tool in Adobe Photoshop CS3. Counts of tyrosine hydroxylase cells
were performed using stereologic methods as described (Shin et al., 2011).
4.8. HPLC measurement of dopamine
For sample preparation, Substantia Nigra of one-year old males with the indi-
cated genotypes was dissected and quickly frozen in liquid nitrogen. The tissue was
weighed and homogenized in 200
m
l chilled 0.01 M perchloric acid using a motor-
ized, hand-held tissue homogenizer. The chilled homogenates were filtered through
a low-binding Durapore (0.22
m
m) PVDF membrane using Ultrafree-MC centrifugal
devices. The dopamine measurement was performed immediately after the sample
preparation. Supernatant fluid was eluted at a flow rate of 50
m
l/min through a
150 1.0 mm C18 column (ALF-115, ANTEC). As recommended by the manufacturer
instructions the mobile phase contained: 50 mM phosphoric acid, 50 mM citric acid,
8 mM NaCl, 0.1 mM EDTA, 10% methanol, 350 mg/l OSA (pH 3.2). Analysis was
performed using an Alexys LC-EC system equipped with a DECADE II electro-
chemical detector (ANTEC). The level of dopamine was reported to the mass of tissue
and the values are presented as ratio to control.
4.9. Quantitative real-time RT-PCR
Quantitative RT-PCR was performed on an Mx4000 (Stratagene) real-time
cycler using the QuantiTect SYBR Green RT-PCR system (QIAGEN). Primers for rat
OTC were obtained from QIAGEN (QuantiTect Primer Assays). The relative tran-
script levels of the target genes were normalized against mouse GAPDH mRNA
levels. Quantification was performed using the comparative Ct method (Schmittgen
and Livak, 2008).
4.10. Statistical analysis
Data are presented as mean values, and error bars indicate SD. Inferential sta-
tisticalanalysis wasperformed usingthe Prism and StatMate software packages (www.
graphpad.com). The significance level is indicated as * for p0.05 and NS for p>0.05.
References
Baker, M.J., et al., 2011. Quality control of mitochondrial proteostasis. Cold Spring
Harb. Perspect. Biol. http://dx.doi.org/10.1101/cshperspect.a007559.
Braak, H., et al., 2003. Staging of brain pathology related to sporadic Parkinson’s
disease. Neurobiol. Aging 24, 197e211.
Clark, I.E., et al., 2006. Drosophila pink1 is required for mitochondrial function and
interacts genetically with parkin. Nature 441, 1162e1166.
de Castro, I.P., et al., 2010 Apr 19. Mitochondrial quality control and neurological
disease: an emerging connection. Expert Rev. Mol. Med. 12. http://dx.doi.org/
10.1017/S1462399410001456 e12.
de Castro, I.P., et al., 2012. Genetic analysis of mitochondrial protein misfolding in
Drosophila melanogaster. Cell Death Differ. 19, 1308e1316.
Deas, E., et al., 2009. PINK1 function in health and disease. EMBO Mol. Med. 1, 152e165.
Gautier, C.A., et al., 2008. Loss of PINK1 causes mitochondrial functional defects and
increased sensitivity to oxidative stress. PNAS 105, 11364e11369.
Gispert, S., et al., 2009. Parkinson phenotype in aged PINK1-deficient mice is
accompanied by progressive mitochondrial dysfunction in absence of neuro-
degeneration. PLoS One 4 e5777.
Glasl, L., et al., 2012. Pink1-deficiency in mice impairs gait olfaction and seroto-
nergic innervation of the olfactory bulb. Exp. Neurol. 235, 214e227.
Haynes, C.M., Ron, D., 2010. The mitochondrial UPR-protecting organelle protein
homeostasis. J. Cell Sci. 123, 3849e3855.
Kawajiri, S., et al., 2011. Genetic mutations and functions of PINK1. Trends Phar-
macol. Sci. 32, 573e580.
Kitada, T., et al., 2007. Impaired dopamine release and synaptic plasticity in the
striatum of PINK1-deficient mice. PNAS 104, 11441e11 4 4 6.
Kumar, K.R., et al., 2012. Genetics of Parkinson disease and other movement dis-
orders. Curr. Opin. Neurol. 25, 466e474.
Lezi, E., Swerdlow, R.H., 2012. Mitochondria in neurodegeneration. Adv. Exp. Med.
Biol. 942, 269e286.
Moisoi, N., et al., 2002. Calmodulin-containing substructures of the centrosomal
matrix released by microtubule perturbation. J. Cell Sci. 115, 2367e2379.
Moisoi, N., et al., 2009. Mitochondrial dysfunction triggered by loss of HtrA2 results
in the activation of a brain-specific transcriptional stress response. Cell Death
Differ. 16, 449e464.
Morais, V.A., 2009. Parkinson’s disease mutations in PINK1 result in decreased
complex 1 activity and deficient synaptic function. EMBO Mol. Med. 1, 99e111.
Novak, A., et al., 2000. Z/EG, a double reporter mouse line that expresses enhanced
green fluorescent protein upon Cre-mediated excision. Genesis 28, 147e155.
Nuytemans, K., et al., 2010. Genetic etiology of Parkinson disease associated with
mutations in the SNCA, PARK2, PINK1, PARK7, and LRRK2 genes: a mutation
update. Hum. Mutat. 31, 763e780.
Park, J., et al., 2006. Mitochondrial dysfunction in Drosophila PINK1 mutants is
complemented by parkin. Nature 4 41, 1157e1161.
Pilsl, A., Winklhofer, K.F., 2012. Parkin, PINK1 and mitochondrial integrity: emerging
concepts of mitochondrial dysfunction in Parkinson’s disease. Acta Neuro-
pathol. 123, 173e188.
Rugarli, E.I., Langer, T., 2012. Mitochondrial quality control: a matter of life and
death for neurons. EMBO J. 31, 1336e1349.
Savitt, J.M., et al., 2005. Bcl-x is required for proper development of the mouse
substantia nigra. J. Neurosci. 25, 6721e6728.
Schmittgen, T.D., Livak, K.J., 2008. Analysing real time PCR data by the comparative
C(T) method. Nat. Protoc. 3, 1101e1108 .
Shin, J.H., et al., 2011. PARIS (ZNF746) repression of PGC-1a contributes to neuro-
degeneration in Parkinson’s disease. Cell 144, 689e702.
Shulman, et al., 2011. Parkinson’s disease: genetics and pathogenesis. Annu. Rev.
Pathol. 6, 193e222.
Simuni, Sethi, 2008 Dec. Non motor manifestations of Parkinson’s disease. Ann.
Neurol. 64 (Suppl. 2), S65eS80.
Smith, G.A., et al., 2012. The search for the genetic mouse models of prodromal
Parkinson’s disease. Exp. Neurol. 237, 267e273.
Sterky, F.H., et al., 2011. Impaired mitochondrial transport and Parkin-independent
degeneration of respiratory chain-deficient dopamine neurons in vivo. PNAS
108, 12937e12942.
Tatsuta, T., Langer, T., 2008. Quality control of mitochondria: protection against
neurodegeneration and aging. EMBO J. 27, 306e314.
Thomas, K.J., Cookson, M.R., 2009. The role of PTEN-induced kinase 1 in mito-
chondrial dysfunction and dynamics. Int. J. Biochem. Cell Biol. 41, 2025e2035.
Twig, G., et al., 2008a. Fission and selective fusion govern mitochondrial segregation
and elimination by autophagy. EMBO J. 27, 433e446.
Twig, G., et al., 2008b. Mitochondrial fusion, fission and autophagy as a quality
control axis: the bioenergetic view. Biochim. Biophys. Acta 1777, 1092e1097.
Valente, E.M., et al., 20 04. Hereditary early-onset Parkinson’s disease caused by
mutations in PINK1. Science 304, 1158e116 0.
Van Laar, V.S., et al., 2011. Bioenergetics of neurons inhibit the translocation response of
Parkin following rapidmitochondrialdepolarization.Hum. Mol.Genet. 20,927e940.
Wang,K., Klionsky, D.J., 2011. Mitochondria removalby autophagy. Autophagy 7,297e300.
Wood-Kaczmar, A., et al., 2008 Jun 18. PINK1 is necessary for long-term survival and
mitochondrial function in human dopaminergic neurons. PLoS One 3 (6) e2455.
Youle, R.J., Narendra, D.P., 2011. Mechanisms of mitophagy. Nat. Rev. Mol. Cell. Biol.
12, 9e14.
Zhao, Q., et al., 2002. A mitochondrial specific stress response in mammalian cells.
EMBO J. 21, 4411e4419.
N. Moisoi et al. / Neuropharmacology 77 (2014) 350e357 357
