Content uploaded by Kurtis Pei
Author content
All content in this area was uploaded by Kurtis Pei on May 13, 2014
Content may be subject to copyright.
RESEARCH ARTICLE
Genetic population structure of the masked palm civet Paguma
larvata, (Carnivora: Viverridae) in Japan, revealed from analysis
of newly identified compound microsatellites
Tomo Inoue •Yayoi Kaneko •Koji Yamazaki •Tomoko Anezaki •
Shuuji Yachimori •Keiji Ochiai •Liang-Kong Lin •Kurtis Jai-Chyi Pei •
Yen-Jean Chen •Shih-Wei Chang •Ryuichi Masuda
Received: 11 April 2011 / Accepted: 16 April 2012 / Published online: 4 May 2012
!Springer Science+Business Media B.V. 2012
Abstract The masked palm civet Paguma larvata (Car-
nivora: Viverridae) in Japan has been phylogeographically
considered an introduced species from Taiwan. To reveal
the population structures and relationships among the
P. larvata populations in Japan, seven compound micro-
satellite loci were isolated from the genome and genotyped
for 287 individuals collected from the field. STRUCTURE
analysis and factorial correspondence analysis of geno-
typing data revealed that animals from Japan were divided
into four genetic clusters. Geographic distribution of the
genetic clusters partly referred to sampling areas, indicat-
ing multiple introductions into distinct areas of Japan or
independent founding events leading to the generation of
different genetic clusters within introduced populations in
Japan. The large genetic differentiation of populations in
the Shikoku District from those in other areas within Japan
suggests that there were at least two introduction routes
into Japan, and a possibility that some founders from areas
other than Taiwan were also involved in the introduction
into Japan. The genetic variation within Japanese popula-
tions were not markedly reduced compared with that of
Taiwan. The results indicated that the Japanese populations
of P. larvata could have retained moderate genetic diver-
sity during founding events, because of multiple intro-
ductions, or a large number or high genetic diversity of
founders. Although some individuals in Japan showed a
sign of admixture between different clusters, there is no
evidence that such an admixture markedly increased the
genetic diversity within Japanese populations.
Keywords Compound microsatellite !Factorial
correspondence analysis !Founder effects !Introduced
species !Masked palm civet !Paguma larvata !
STRUCTURE analysis
T. Inoue !R. Masuda (&)
Department of Natural History Sciences, Graduate School of
Science, Hokkaido University, Sapporo 060-0810, Japan
e-mail: masudary@mail.sci.hokudai.ac.jp
Y. Kaneko
Tokyo University of Agriculture and Technology, Fuchu
183-8509, Japan
K. Yamazaki
Ibaraki Nature Museum, Bando 306-0622, Japan
T. Anezaki
Gunma Museum of Natural History, Tomioka 370-2345, Japan
S. Yachimori
Shikoku Institute of Natural History, Susaki 785-0023, Japan
K. Ochiai
Natural History Museum and Institute, Chiba 260-8682, Japan
L.-K. Lin
Department of Life Science, Tunghai University, Taichung 407,
Taiwan
K. J.-C. Pei
Institute of Wildlife Conservation, National Pingtung University
of Science and Technology, Pintung 91201, Taiwan
Y.-J. Chen
Department of Zoology, National Museum of Natural Science,
Taichung 404, Taiwan
S.-W. Chang
Division of Zoology, Endemic Species Research Institute,
Nantou 55244, Taiwan
123
Conserv Genet (2012) 13:1095–1107
DOI 10.1007/s10592-012-0357-7
Introduction
Since the beginning of human migration throughout the
world, many animal and plant species have been introduced
into their non-native ranges. Some of the introduced spe-
cies have successfully established new habitats and popu-
lations, resulting in the disturbance of native ecosystems.
To control such introduced species, information about their
population biology and genetics is important (Sakai et al.
2001). Population genetic data may predict invasiveness to
reduce the occurrence of new invasions or to improve the
efficiency of control efforts for conservation of the native
ecosystem (Sakai et al. 2001).
The masked palm civet Paguma larvata (Carnivora:
Viverridae) is the only viverrid species in Japan and is
considered an introduced species because of their discon-
tinuous distribution and lack of fossil records (Torii 2009).
P. larvata matures sexually at around two years old (Gao
et al. 1987; Torii 2009). This species is basically nocturnal
and arboreal, and they live in families comprising a mother
and her cubs (Torii 2009). Although their natural range is
western, southeastern and eastern parts of Asia (Torii
2009), in Japan this species was first reported in Shizuoka
Prefecture (in Chubu District: Fig. 1) in 1943 (Nawa 1965).
Since the first record in Japan, their range has become
wider, and currently they are found in most areas of central
and eastern Honshu Island and Shikoku Island (Fig. 1)
(Torii 2009). As their range has expanded, damage to crops
by P. larvata has also increased. Furthermore, their diet
overlaps with those of native carnivore species in Japan,
such as the raccoon dog (Nyctereutes procyonoides), bad-
ger (Meles anakuma) and Japanese marten (Martes mel-
ampus) (Matsuo et al. 2007; Matsuo and Ochiai 2009) and
competition for food between them occurs. It is also
reported that, in Chiba Prefecture (Kanto District: Fig. 1),
P. larvata eats the endangered Tokyo salamander (Hyno-
bius tokyoensis) (Matsuo et al. 2007).
The origins and introduction periods of Japanese P.
larvata have long been unclear (Kuroda 1955; Nakamura
1994; Torii 2009). Masuda et al. (2008,2010) analyzed the
phylogeography of the mitochondrial DNA (mtDNA)
cytochrome bgene of P. larvata in Japan, Southeast Asia
and Taiwan, and they revealed that the Japanese popula-
tions have some haplotypes common to those in Taiwan.
Taiwan has been thought to be one of the origins of Jap-
anese P. larvata without any scientific evidence (Furuya
1973; Miyashita 1977). Masuda et al. (2010) suggested the
introduction of at least three lineages of P. larvata into
Japan from Taiwan, although further genetic study is
necessary to clarify the introduction routes as well as the
expansion history after the introduction in Japan.
Meanwhile, Masuda et al. (2010) reported founder
effects in the Japanese populations of P. larvata: mtDNA
genetic diversity much lower than those of natural popu-
lations of Taiwan and Southeast Asia, and broad distribu-
tion patterns of particular mtDNA haplotypes. In general,
the genetic diversity of introduced populations is expected
to be lower than that of natural populations (Dlugosch and
Parker 2008) because of the small number of founders and
genetic drift.
On the other hand, multiple introductions may increase
genetic diversity in populations of introduced species
(Dlugosch and Parker 2008; Zalewski et al. 2010). Although
there is a possibility of multiple introductions in Japanese
P. larvata (Furuya 1973; Nakamura 1994; Harada and Torii
1993), Masuda et al. (2010) demonstrated low genetic
diversity in the Japanese populations of P. larvata as a sign of
founder effects, by analysis of mtDNA, which reflects only
the female’s migration history after introduction. Therefore,
as the next step, to further understand the current population
structure and introduction history of Japanese P. larvata,
population genetic studies using biparentally inherited genes
as genetic markers are necessary.
In the present study, compound microsatellites were
newly isolated from the genome of P. larvata, using a
simplified method. Then, genotypes of the compound
microsatellite loci of P. larvata from Japan and Taiwan
were determined, and the detailed population structure,
genetic diversity and founder effects are discussed on the
basis of the genotyping data. Information on the genetic
structure in local areas can be applied to the management
Eurasian Continent
50°
45°
Kanto
District
Akita [3]
Tochigi [15]
Gunma [45]
40°
Chubu
District
Ibaraki [59]
Chiba [68]
Tokyo [9]
Saitama [1]Gifu-
Nagano [9]
35°
30°
Shikoku
District
Shizuoka [7]
Aichi [6]
Kochi [27]
Tokushima [15]
Ehime [6]
Pacific Ocean
25°
20°N
Taiwan [17]
120°E 125° 130° 135° 140° 145° 150°
0500 1000 km
Fig. 1 Sampling locations (dots) and the numbers of specimens of
P. larvata in Japan and Taiwan. The sampling locations in Japan,
referring to geographic populations, were grouped into three
geographic areas (Kanto, Chubu and Shikoku Districts), as shown
by circles. In Taiwan, animals were collected at eight locations
1096 Conserv Genet (2012) 13:1095–1107
123
strategy of introduced P. larvata populations in Japan and the
conservation of native populations in Taiwan. In addition,
the present (microsatellite) and previous (mtDNA) genetic
studies contribute to the identification of effective manage-
ment units and to detection of contact zones among popu-
lations in Japan.
Materials and methods
Samples and DNA extraction
Specimens of P. larvata were collected from roadkills and
ecological surveys at various locations in Japan (270
individuals from 13 locations) and Taiwan (17 individuals
from eight locations) (Fig. 1). Total DNA was extracted
from muscle tissues (about 3 9393 mm) or total bloods
(about 100 ll) using the DNeasy Blood & Tissue Kit
(Qiagen), eluted in 200 ll of TE buffer and stored at 4 "C
until use. Total DNA from hair samples (20–30 hairs per
animal) was extracted using the QIAamp DNA Micro Kit
(Qiagen), eluted in 100 ll of TE buffer and stored at 4 "C
until use.
Development of compound microsatellite markers
Compound microsatellite loci (Lian et al. 2006) were
newly isolated from the P. larvata genome using the in-
tercompound microsatellite (ICSSR) method (Wu et al.
2008; Nishida and Koike 2009). Using polymerase chain
reaction (PCR), the ICSSR regions were amplified directly
from extracted DNA of one Japanese P. larvata, with a
compound simple sequence repeat (SSR) primer,
(AC)
6
(AG)
5
or (TC)
6
(AC)
5
(Lian et al. 2006), or a mixture
of both primers (Nishida and Koike 2009). The PCR
amplifications were performed in 20 ll of the reaction
mixture: 2.0 ll of 109reaction buffer (Takara), 1.6 ll of
dNTP (2.5 mM), 0.4 ll of the single compound SSR pri-
mer (25 pmol/ll) or 0.4 ll of a mixture of both primers
(0.2 ll each), 0.1 ll of rTaq DNA polymerase (5 U/ll,
Takara) and 1.0 ll of the DNA extracts. After denaturing at
94 "C for 3 min, 40 cycles were performed using a thermal
cycler (TP600; Takara) with the following program:
denaturing at 94 "C for 1 min; annealing at 56–58.6 "C for
1 min; extension at 72 "C for 1 min; and the reaction
completion at 72 "C for 10 min. To check PCR amplifi-
cation, 9 ll of each product was electrophoresed on a 2 %
agarose gel, stained by ethidium bromide, and visualized
under an ultraviolet illuminator.
The PCR products showing multiple bands or smear were
cloned using the TA Cloning Kit (Invitrogen). Positive
colonies were selected and incubated in the liquid medium
(LB broth, Invitrogen) at 37 "C overnight. Plasmid DNA
was isolated with the QIAprep Miniprep Kit (Qiagen) and
sequenced using an automated sequencer (SQ5500; Hit-
achi). Because the cloned nucleotide sequences included
compound microsatellite sequences at both ends, site-spe-
cific primers were designed within the regions between the
two compound microsatellites.
To test the polymorphisms of compound microsatellite
loci identified in the present study, 20 individuals of
P. larvata from various locations in Japan were analyzed.
The PCR amplifications were performed in 10 ll of the
reaction mixture: 1.0 ll of 109reaction buffer (Takara),
0.8 ll of dNTP (2.5 mM), 0.1 ll of the compound SSR
primer labeled with Texas Red (5 pmol/ll), 0.1 ll of the
site-specific primer (5 pmol/ll), 0.1 ll of rTaq DNA
polymerase (5 U/ll, Takara) and 1.0 ll of the DNA
extract. After denaturing at 94 "C for 3 min, 35–45 cycles
were performed using a thermal cycler (TP600; Takara)
with the following program: denaturing at 94 "C for 1 min;
annealing at 55–57 "C for 1 min; extension at 72 "C for
1 min; and the reaction completion at 72 "C for 10 min.
The PCR products (2.5 ll) or 2.5 ll of the Fluorescent
Ladder CXR (Promega) for molecular size marker were
mixed with 2.5 ll of Bromophenol Blue Loading Solution
(Promega), heated at 95 "C for 2 min, and cooled down on
ice immediately. Mixtures of 2.5 ll were electrophoresed
using an automated sequencer (SQ5500, Hitachi). The
molecular sizes were determined by FRAGLYS version 3
(Hitachi). The newly isolated compound microsatellite
loci, which were polymorphic in the 20 individuals, were
PCR-amplified and genotyped for all 287 samples in the
same manner as above.
Data analysis
For all 287 samples, the observed (Ho), expected (He)
heterozygosities, deviations from Hardy–Weinberg equi-
librium and allele frequencies of each locus were calcu-
lated by ARLEQUIN 3.5.1.2 (Excoffier and Lischer 2010).
The samples were then divided into 14 geographic popu-
lations based on sampling locations (Fig. 1), and standard
genetic variations within each population were examined.
In addition to Ho and He, allelic richness (R) was calcu-
lated by FSTAT 2.9.3.2 (Goudet 2001). To evaluate
genetic differentiations between the geographic popula-
tions, pairwise Fst values and Nei’s standard genetic dis-
tances (Ds, Nei 1978) were calculated using ARLEQUIN
3.5.1.2 and SPAGeDi 1.3 (Hardy and Vekemans 2002),
respectively. Using the two values, neighbor-joining trees
(Saitou and Nei 1987) were constructed by MEGA4
(Tamura et al. 2007). GENETIX 4.05 (Belkhir et al. 1996–
2004) was also used to visualize the pattern of genetic
relationships among geographic populations by factorial
correspondence analysis (FCA) (Benzecri 1973). The
Conserv Genet (2012) 13:1095–1107 1097
123
above analyses of genetic variations and population dif-
ferentiations were performed in 12 populations, except for
individuals in Saitama and Akita Prefectures, Japan,
because of their small sample sizes (Fig. 1). Analysis by
BOTTLENECK 1.2.02 (Cornuet and Luikart 1996) was
performed in three geographic groups in Japan (Kanto,
Chubu and Shikoku Districts; Fig. 1) to detect evidence of
recent bottleneck effect as heterozygosity excess. In this
analysis, two-phase mutation model (TPM) with 95 %
stepwise mutation model (SMM) as mutation model of
microsatellites and Wilcoxon sign-rank test (Piry et al.
1999) were used.
To investigate the population structures of P. larvata
in the 287 samples from Japan and Taiwan, Bayesian
clustering method implemented in STRUCTURE 2.3
(Pritchard et al. 2000) was applied. In this analysis, the
admixture model and correlated allele frequencies model
were used. STRUCTURE 2.3 was run with five repetitions
of 10,000 iterations of Markov chain Monte Carlo, fol-
lowing a burn-in of 10,000 iterations at K=1–10.
Although analyses with more precise conditions (10 repe-
titions of 100,000 iterations of Markov chain Monte Carlo,
following a burn-in of 100,000 iterations at K=1–10)
were also performed, the results were almost the same as
that with the shorter run. To estimate the real number of the
subpopulation (K), the values of the log-likelihood ratio
[LnP(D)] and DK(Evanno et al. 2005) were calculated.
Because the value of DKusually detects the uppermost
hierarchical level of the genetic structure (Evanno et al.
2005), the samples were divided into two geographic
groups, and further analyses were performed at K=1–6 to
investigate the detailed genetic structures respectively,
after the first analysis. When individuals had qvalues
(estimated membership in clusters) of C0.7, they were
assumed to be members of that particular cluster.
General genetic information (Ho,He and R) on each
cluster inferred by STRUCTURE 2.3 was calculated in the
same manner as geographic populations, and indicators of
genetic differentiations (pairwise Fst and Ds) between the
clusters were also calculated.
Results
Genetic characteristics of compound microsatellite loci
In the development of compound microsatellite markers,
68 TA-clones were selected and sequenced. Of 40 site-
specific primers designed, 34 worked successfully for PCR.
Of the 34 loci, nine were polymorphic, of which seven
were usable as compound microsatellite markers. The
remaining two loci were not usable, because one of them
showed multiple ambiguous bands in electrophoresis and
the other indicated a deviation from Hardy–Weinberg
equilibrium. The successful seven loci were named
PLAMSA-1, PLAMSA-3, PLAMST-9, PLAMST-16,
PLAMST-18, PLAMST-20 and PLAMST-26, respectively
(Table 1). Two to twelve alleles were identified from the
seven loci, and the average number was 6. The observed
heterozygosity (Ho) ranged from 0.195 (PLAMST-18) to
0.581 (PLAMSA-1): 0.447 (0.137 SD) on average. The
expected (He) ranged from 0.193 (PLAMST-18) to 0.688
(PLAMST-26): 553 (0.177 SD) on average (Table 1).
The sequences of the seven loci were deposited
in DDBJ/EMBL/GenBank nucleotide databases with
the following accession numbers: AB619599–AB619605
(Table 1).
Genetic diversities and the relationships
among geographic populations
Table 2shows the average values of Ho,He and Rfor each
geographic population. The highest Ho value (0.548) was
obtained from the Gifu-Aichi population and the lowest
(0.274) was from the Tokyo population, both of which
were populations from Japan. The highest He value (0.590)
was from the Nagano population, whereas the lowest
(0.307) was from the Tokyo population. For average values
of allelic R, the highest value (3.423) was obtained from
the population native to Taiwan, whereas the lowest
(2.344) was from the Tokyo population. Allele distribu-
tions of each locus in geographic populations were shown
in Table 3. Of 42 alleles identified from all individuals
genotyped, 28 (66.7 %, 28/42 alleles) were shared by both
Japan and Taiwan. Four alleles were private to Taiwan, but
not to Japan, whereas 10 alleles were private to Japan, but
not to Taiwan (Table 3). Of the 10 alleles private to Japan,
one allele (#1 at PLAMST-20) was found only in the Kochi
population of Shikoku Island. The pairwise Fst and Nei’s
standard genetic distance (Ds) values among the popula-
tions showed that the Kochi, Ehime and Tokushima pop-
ulations, all of which are located in Shikoku District
(Fig. 1), were more highly differentiated from the other
populations (Table 4). In the neighbor-joining trees based
on pairwise Fst and Ds (Fig. 2), the Japanese populations
were classified into three groups: Kanto group (Tokyo,
Tochigi, Gunma, Ibaraki and Chiba), Chubu group (Nag-
ano, Shizuoka and Gifu-Aichi) and Shikoku group (Kochi,
Ehime and Tokushima), in concordance with geographic
distances among them (Fig. 1). The pairwise Fst values
were not significant (P[0.05) within Shikoku group,
Kanto group (between ‘‘Tochigi and Gunma’’ and ‘‘Tochigi
and Ibaraki’’) and Chubu group (between ‘‘Gifu-Aichi and
Nagano’’ and ‘‘Gifu-Aichi and Shizuoka’’) (Table 3). In
addition to the neighbor-joining trees (Fig. 2), FCA anal-
ysis showed that individuals in Japan were largely
1098 Conserv Genet (2012) 13:1095–1107
123
separated into three main groups (Kanto, Chubu and Shi-
koku groups), and overlaps of individuals between Kanto
and Chubu groups (Fig. 3). Individuals from Taiwan
were distributed between Kanto and Shikoku groups.
In BOTTLENECK analysis, significant heterozygosity
excesses were detected from Chubu District (P\0.005)
and Shikoku Districts (P\0.05).
Population structure analysis
The simulations in STRUCTURE 2.3 clarified the popu-
lation structures in Japan and Taiwan. The value of the log-
likelihood ratio [LnP(D)] was largest at K=4, although
DKwas highest at K=2. Whenever Kwas set to 2, 3 or 4,
most of the individuals from Shikoku District were
assigned to one common cluster, and the other individuals
from other areas were assigned to other clusters (Fig. 4).
Because DKoften detects the uppermost hierarchical level
of the genetic structure (Evanno et al. 2005), the result
(Fig. 4b) could reflect large genetic differences between
the populations in Shikoku District and those from other
areas, as demonstrated by Fst and Ds values (Fig. 2;
Table 4). When further analyses were performed, samples
were divided into two groups according to their sampling
locations, Shikoku District and other areas. In Shikoku
District, the value of log-likelihood ratio [LnP(D)] was
largest at K=1, and when Kwas larger than 1, most
individuals were assigned to each cluster with an equal
proportion of membership. In other areas, the value of the
log-likelihood ratio [LnP(D)] and DKwas largest at K=3;
therefore, K=4 was chosen as an appropriate number of
clusters for all samples (Fig. 4a). The characteristics of the
four genetic clusters are summarized in Table 5. These
clusters were partly in concordance with geographic pop-
ulations. Most individuals from Chubu District (Nagano,
Table 1 Genetic characteristics of seven compound microsatellite loci developed in the present study
Locus Primer sequence (50–30) Annealing
temperature
("C)
Number of
samples
genotyped
Allele size
range (bp)
Number
of alleles
Heterozygosities Accession no.
a
Ho He
PLAMSA-1 F: (AC)
6
(AG)
5
R: AAGCCGTTCATGGCTGTTAA
57 284 223–239 5 0.581 0.672 AB619599
PLAMSA-5 F: (AC)
6
(AG)
5
R: TCCTGGAGCTTCTGTTCTAC
55 287 250–255 4 0.341 0.459 AB619600
PLAMST-9 F: (TC)
6
(AC)
5
R: GTGTAGATATGCCTGAAGTCA
55 286 226–241 4 0.448 0.581 AB619601
PLAMST-
16
F: (TC)
6
(AC)
5
R: CTGTTTGTTGTGTTAGAATTAC
55 286 167–200 12 0.490 0.616 AB619602
PLAMST-
18
F: (TC)
6
(AC)
5
R: CATTCATTAGCTCAACTGTGG
55 287 181–182 2 0.195 0.193 AB619603
PLAMST-
20
F: (TC)
6
(AC)
5
R: AAAGCAGGGCTCGTGCTCA
55 287 149–164 7 0.502 0.664 AB619604
PLAMST-
26
F: (TC)
6
(AC)
5
R: CATTGAGTCACCTGTGATCC
55 286 253–272 8 0.570 0.688 AB619605
Average 6 0.447 0.553
Standard
deviation
3.317 0.137 0.177
F, forward (compound microsatellite); R, reverse (site specific primer)
a
Sequences including the primers were deposited in DDBJ/EMBL/GenBank nucleotide databanks with those accession numbers
Table 2 Genetic characteristics within each geographic population
Geographic
population
Number of
samples
Average value of
allelic richness (R)
a
Heterozygosities
Ho He
Tokyo 9 2.344 0.274 0.307
Tochigi 15 2.658 0.352 0.432
Gunma 45 2.912 0.453 0.487
Ibaraki 59 2.855 0.488 0.507
Chiba 68 2.556 0.404 0.451
Nagano 9 3.307 0.524 0.590
Shizuoka 7 2.403 0.531 0.473
Gifu-Aichi 6 2.857 0.548 0.569
Kochi 27 2.907 0.529 0.533
Ehime 6 2.857 0.476 0.537
Tokushima 15 2.778 0.437 0.533
Taiwan 17 3.423 0.399 0.504
Ho, observed; He, expected
a
Based on the minimum sample size n=6
Conserv Genet (2012) 13:1095–1107 1099
123
Table 3 Distribution of microsatellite alleles among geographic populations of P. larvata
Group Population PLAMSA-1 PLAMSA-
5
PLAMST-
9
PLAMST-16 PLAMST-
18
PLAMST-
20
PLAMST-26 Total
Kanto Tokyo # 1, 3, 4 # 2, 3 # 1, 3 # 3, 8, 10 # 1 # 2, 4, 5 # 1, 3, 5, 7
Tochigi # 1, 3, 4 # 2, 4 # 1, 3 # 3, 8 # 1, 2 # 2, 3, 4, 5,
7
# 2, 3, 4, 5, 6,
7, 8
Gunma # 1, 3, 4, 5 # 2, 3 # 1, 3, 4 # 2, 3, 4, 8, 10, 12 # 1, 2 # 2, 3, 4, 5 # 1, 3, 4, 5, 6,
7, 8
Ibaraki # 1, 3, 4, 5 # 1, 2, 3, 4 # 1, 3 # 2, 3, 4, 6, 8 # 1, 2 # 2, 3, 4, 5,
7
# 3, 4, 5, 6, 7, 8
Chiba # 1, 3, 4 # 2, 3 # 1, 3 # 3, 4, 8 # 1, 2 # 2, 3, 4, 5,
7
# 3, 5, 6, 7, 8
Chubu Nagano # 3, 4, 5 # 1, 2, 3 # 1, 3 # 2, 3, 6, 8, 10, 11, 12 # 1, 2 # 2, 3, 4, 5 # 1, 3, 6, 7
Shizuoka # 3, 4 # 2, 3 # 1, 3 # 2, 3, 10 # 1, 2 # 2, 4, 5 # 1, 3, 5
Gifu-Aichi # 3, 4, 5 # 2, 3 # 1, 3 # 2, 3, 8, 10, 12 # 1, 2 # 2, 4 # 3, 4, 6, 7
Shikoku Kochi # 3, 4, 5 # 2, 4 # 1, 3 # 1, 3, 6, 8, 10, 11 # 1 # 1*, 2, 3, 5,
6
# 2, 3, 5, 7
Ehime # 3, 4, 5 # 2, 4 # 1, 2, 3 # 1, 3, 6, 8, 10 # 1 # 2, 3, 5 # 3, 5, 7
Tokushima # 3, 4, 5 # 2, 4 # 1, 2, 3 # 1, 3, 6, 8, 10, 11 # 1 # 2, 3, 5 # 2, 5, 7
Akita # 3 # 2 # 1, 3 # 3, 6, 8 # 1 # 5 # 4, 5, 7
Saitama # 4 # 2 # 1, 3 # 3, 10 # 1 # 2, 5 # 4, 7
Taiwan # 1, 2*, 3, 4,
5
# 1, 2, 4 # 1, 2, 3, 4 # 1, 3, 4, 5*, 6, 7*, 8,
9*, 10
# 1 # 2, 3, 5, 6 # 2, 3, 4, 5, 6, 7
Total no. of alleles 5 4 4 12 2 7 8 42
No. of alleles
common between
Japan and Taiwan
4 3 4 6 1 4 6 28
No. of alleles private
to Japan
0 1 0 3 1 3 2 10
No. of alleles private
to Taiwan
1003 000 4
Numbering of alleles was done independently at each locus. Asterisks indicate alleles private to the geographic populations
Table 4 Fst (lower matrix) and Ds (upper matrix) values among geographic populations
Tokyo Tochigi Gunma Ibaraki Chiba Nagano Shizuoka Gifu-Aichi Kochi Ehime Tokushima Taiwan
Kanto group
Tokyo 0.086 0.034 0.167 0.132 0.163 0.087 0.131 0.386 0.429 0.470 0.160
Tochigi 0.094 0.019 0.009 0.021 0.297 0.132 0.174 0.322 0.303 0.407 0.062
Gunma 0.035 0.020* 0.047 0.032 0.153 0.075 0.101 0.323 0.318 0.416 0.080
Ibaraki 0.135 0.008* 0.045 0.016 0.257 0.146 0.147 0.353 0.308 0.431 0.095
Chiba 0.122 0.024 0.037 0.021 0.244 0.140 0.161 0.362 0.295 0.443 0.088
Chubu group
Nagano 0.212 0.235 0.148 0.198 0.219 0.107 0.012 0.451 0.446 0.452 0.320
Shizuoka 0.191 0.195 0.117 0.182 0.189 0.103 0.014 0.502 0.467 0.580 0.185
Gifu-Aichi 0.196 0.178 0.111 0.144 0.174 0.010* 0.043* 0.419 0.295 0.390 0.248
Shikoku group
Kochi 0.283 0.240 0.227 0.231 0.250 0.252 0.288 0.246 0.020 0.015 0.198
Ehime 0.332 0.236 0.220 0.205 0.221 0.233 0.280 0.187 0.010* -0.005 0.232
Tokushima 0.321 0.268 0.255 0.246 0.275 0.252 0.320 0.241 0.012* -0.007* 0.295
Taiwan 0.159 0.067 0.069 0.085 0.090 0.204 0.179 0.170 0.159 0.168 0.198
* Not significant (P[0.05); the other values of Fst were all statistically significant (P\0.05)
1100 Conserv Genet (2012) 13:1095–1107
123
Shizuoka and Gifu-Aichi: Fig. 1) were assigned to cluster
3, and those from Shikoku District to cluster 4 (Fig. 4a;
Table 5). Individuals assigned to cluster 3 were also found
in Kanto District (Tokyo, Tochigi, Gunma, Ibaraki and
Chiba: Fig. 1); those from Kanto District were assigned to
any of clusters 1–3 (Fig. 4a; Table 5). Some individuals
from single sampling locations were assigned to different
genetic clusters (for instance, individuals from the Ibaraki
population were divided into three clusters: Fig. 4a;
Table 5). In addition, about 48 % (94/196) of individuals
in Kanto District were not assigned to any clusters with
qC0.7 (Fig. 4a; Table 5). A single cluster consisting of
only specimens from Taiwan was not formed, but indi-
viduals from Taiwan were assigned to any of three clusters
2–4, all of which were common to Japanese individuals
(Fig. 4a; Table 5).
Discussion
Multiple introductions and range expansions indicated
by population structures of Japanese P. larvata
In the present study, P. larvata populations in Japan and
Taiwan were divided into four genetic clusters. The finding
of genetic clusters and alleles common between individuals
from both regions (Fig. 4a; Tables 3,5) supports the pre-
vious study of mtDNA (Masuda et al. 2010) reporting that
one of the origins of Japanese P. larvata was Taiwan.
Identification of 10 alleles private to Japan and four private
to Taiwan in the present study (Table 3), however, does not
neglect P. larvata’s immigration to Japan from other
countries, in addition to Taiwan. Masuda et al. (2010)
(a)
(b)
Chubu
group
Shikoku
group
Taiwan
Kochi
Nagano
Gifu-Aichi
Tokushima
Ehime
Gunma
Chiba Ibaraki
Tochigi
Shizuoka
0.02
Kanto
group
Tokyo
Taiwan
Gunma
Tokushima
Kochi
Ehime
Shikoku
group
Tochigi
Ibaraki
Chiba
Tokyo
Shizuoka
Gifu-Aichi
Kanto
group
0.05
Nagano Chubu
group
Fig. 2 Neighbor-joining relationships among geographic popula-
tions, constructed using values of pairwise Fst (a) and Ds (b).
Broken circles show districts (Fig. 1), in which geographic popula-
tions are located
Fig. 3 FCA of P. larvata in
Japan and Taiwan. Each
individual is represented by one
cube.Colors of the cubes show
geographic populations, to
which each individual belongs.
Clustering of individuals
corresponds with the geographic
populations
Conserv Genet (2012) 13:1095–1107 1101
123
actually reported three mtDNA haplotypes specific to
Japan, not yet found in Taiwan. Since the numbers of
samples and sampling locations from Taiwan in the present
study as well as Masuda et al. (2010) are not enough to
conclude whether Taiwan is only an origin, it is necessary
to further survey genotypes in the populations of Taiwan
and the rest of the natural range of this species.
Because P. larvata has been sporadically found in var-
ious areas of Japan, some researchers supposed that this
species was introduced into multiple locations within Japan
(Furuya 1973; Harada and Torii 1993; Nakamura 1994;
Masuda et al. 2008,2010). The present study revealed that
different genetic clusters are distributed in distinct areas of
Japan. For instance, cluster 3 is mainly distributed in
Chubu District (Nagano, Shizuoka and Gifu-Aichi: Fig. 1),
whereas cluster 4 is located in Shikoku District (Kochi,
Ehime and Tokushima: Fig. 1) (Fig. 4a; Table 5). This
result suggests that individuals from different lineages
were introduced into different areas in Japan, and supports
the previous inferences about multiple introductions.
(a)
K
= 4
Cluster 1 Cluster 2 Cluster 3 Cluster 4
(b)
K
= 3
(c)
K
= 2
Fig. 4 Population structures of
P. larvata in Japan and Taiwan
inferred by STRUCTURE
analysis. Each individual is
represented by one vertical thin
line partitioned into K colored
segments, and arranged
according to geographic
populations. The proportion of
each color in the line shows the
individual’s estimated
membership for each cluster.
The log-likelihood ratio
[LnP(D)] was largest at K=4
(a), and DKwas largest at
K=2(c). For a comparison,
the result at K=3(b) is also
shown
1102 Conserv Genet (2012) 13:1095–1107
123
Masuda et al. (2010) reported that P. larvata in Shikoku
District had a single mtDNA haplotype common to some
individuals in Chubu District, and proposed that animals
introduced into Chubu District brought the haplotype to
Shikoku District, or that animals were introduced inde-
pendently into Shikoku District from Taiwan. In the pres-
ent study, compared between Shikoku and Honshu Islands
(Table 3), four microsatellite alleles (allele #2 at locus
PLAMST-9; #1 at PLAMST-16; and #1 and #6 at
PLAMST-20) were private to Shikoku, but not to Honshu.
Conversely, 13 alleles (#1 at PLAMST-1; #1 and #3 at
PLAMST-5; #2, #4 and #12 at PLAMST-16; #2 at
PLAMST-18; #4 and #7 at PLAMST-20; #1, #4, #6 and #8
at PLAMST-26) were specific to Honshu, but not to Shi-
koku. Thus, the allele distribution is different between the
two main islands of Japan. The populations in Shikoku
District were largely genetically differentiated from other
Japanese populations (Fig. 2; Table 4); Therefore, the
present study supports the latter scenario for independent
introduction between Honshu and Shikoku Districts. In
addition, it may suggest that the founders were introduced
to Shikoku Island from areas other than Taiwan.
From their discontinuous distribution patterns, Suzuki
(1985) reported that Japanese P. larvata expanded from
four locations: Miyagi and Fukushima Prefectures (both
prefectures are located north of Kanto District), Shizuoka
Prefecture (Chubu District: Fig. 1) and Kochi Prefecture
(Shikoku District: Fig. 1). Suzuki (1985) suggested that P.
larvata in Miyagi and Fukushima Prefectures reached the
northern part of Kanto District (Gunma, Tochigi and Iba-
raki: Fig. 1), and that they expanded from Shizuoka Pre-
fecture to Nagano and Aichi in Chubu District (Fig. 1) and
western parts of Kanto District (including Tokyo and Sai-
tama: Fig. 1). This inference is almost consistent with the
distribution patterns of the four genetic clusters found by
STRUCTURE and FCA analyses in the present study. On
the other hand, P. larvata could have immigrated from
northern to southern regions within Ibaraki Prefecture, and
then expanded to adjacent Chiba Prefecture (both prefec-
tures are located in Kanto District: Fig. 1) (Ochiai 1998;
Table 5 Frequencies of individuals which were assigned to the four clusters grouped by STRUCTURE analysis
Geographic population Cluster 1 Cluster 2 Cluster 3 Cluster 4 Number not assigned (q\0.7) Total number
Kanto District
Tokyo 1 0 4 0 4 9
Tochigi 2 4 1 0 8 15
Gunma 2 7 16 0 20 45
Ibaraki 15 12 4 0 28 59
Chiba 29 4 1 0 34 68
Chubu District
Nagano 0 0 9 0 0 9
Shizuoka 0 0 6 0 1 7
Gifu-Aichi 0 0 6 0 0 6
Shikoku District
Kochi 0 0 0 27 0 27
Ehime 0 0 0 6 0 6
Tokushima 0 0 0 14 1 15
Taiwan
Taiwan 0 7 1 1 8 17
Other areas
Akita 0 1 0 0 2 3
Saitama 0 0 1 0 0 1
Total number 49 35 49 48 106 287
Ho 0.496 0.431 0.448 0.488
He 0.508 0.472 0.515 0.537
R2.770 4.130 4.054 3.375
Ho observed heterozygosity; He expected heterozygosity
R, average value of allelic richness over seven loci based on n=34 (because one individual had missing data, its data was eliminated for
calculation)
Conserv Genet (2012) 13:1095–1107 1103
123
Yoshitake 1998; Yamazaki et al. 2001). The lower values
of Fst and Ds showed that P. larvata in Ibaraki and Chiba
are closely genetically related (Fig. 2; Table 4), supporting
the previous inference (Ochiai 1998; Yoshitake 1998;
Yamazaki et al. 2001) about their range expansions in
Kanto District. These results suggest that P. larvata
introduced into multiple locations of Japan quickly
expanded their range toward adjacent areas.
Occurrence of four different lineages in Japan
and Taiwan
The present study revealed that individuals from wide areas
of Taiwan (Fig. 1) were assigned to three genetic clusters
(clusters 2–4; Fig. 4a; Table 5). In addition, the Taiwan
population showed deviations from Hardy–Weinberg equi-
librium at two loci. These results indicate that there are
multiple lineages in the native populations of Taiwan, in
agreement with the previous study of mtDNA variations
(Masuda et al. 2010). Masuda et al. (2010) suggested that
populations in Taiwan were geographically separated by
high mountain ranges, resulting in uneven distribution pat-
terns of mtDNA haplotypes. Although specimens from
Taiwan in the present study included individuals from pop-
ulations separated by such high mountain ranges, they did
not form genetic clusters in concordance with the mtDNA
lineages reported by Masuda et al. (2010). Some individuals
having haplotypes from separate mtDNA lineages were
included in the single genetic clusters detected by the present
microsatellite analysis. Because alleles in microsatellite loci
are biparentally inherited, the genetic clusters shown by the
present study could reflect migration patterns within Taiwan,
different from those obtained by maternal mtDNA data.
Since there are few studies about the sexual differences of
home ranges or migration patterns of P. larvata, it is unclear
which behaviors affect the distribution differences of lin-
eages detected from maternal (mtDNA) and biparental
(microsatellites) genetic data. Further ecological studies of
this species may give more insight into the issue.
Alternatively, the four genetic clusters detected in the
present study could have been formed after their introduction
into Japan. Although the distribution patterns of mtDNA
haplotypes in Taiwan are separated by geographic barriers
such as high mountains, the differences between mtDNA
sequences were relatively small (Masuda et al. 2010). In
addition, Patou et al. (2009) suggested a lack of clear genetic
structures in native continental Chinese P. larvata popula-
tions. Thus, because P. larvata in natural ranges may not be
well genetically differentiated among populations, the four
genetic clusters detected in the Japanese populations could
have been structured from founder populations due to
genetic drift during their introduction, rather than originating
from natural lineages.
Contact and admixture between different genetic
lineages in Japan
The present study revealed four genetic clusters in Japa-
nese P. larvata. Most individuals from single sampling
locations in Chubu and Shikoku Districts were assigned to
single clusters, respectively, whereas individuals from
single sampling locations in Kanto District (Tokyo,
Tochigi, Gunma, Ibaraki and Chiba: Fig. 1) were divided
into three clusters (Fig. 4a; Table 5). This result suggests
that frequent contacts among sampling locations (geo-
graphic populations) in Kanto District could have occurred.
Although there were three clusters in Kanto District, about
48 % (94/196) of individuals from this district were not
assigned to any clusters with qC0.7 (Fig. 4a; Table 5).
Because those individuals had admixture characteristics of
different genetic clusters (for instance, some had almost
equal values of qto two or three clusters), it is also sug-
gested that an admixture of genetic clusters has occurred in
Kanto District.
On the other hand, although individuals assigned to
cluster 3 were found in all sampling locations in Kanto
District, it is notable that many individuals (20/26) in
cluster 3 were especially found in the Tokyo and Gunma
populations (Fig. 4a; Table 5) located in western Kanto
District, close to Chubu District (Fig. 1). In addition, FCA
analysis (Fig. 3) showed the closely relatedness between
Kanto and Chubu Districts, suggesting contacts of these
two lineages around Gunma Prefecture. Compared between
Kanto and Chubu Districts, seven alleles (#1 at PLAMST-
1; #4 at PLAMST-5; #4 at PLAMST-9; #4 at PLAMST-16;
#7 at PLANST-20; and #2 and #8 at PLAMST-26) were
private to Kanto, whereas only one allele (#11 at
PLAMST-16) was private to Chubu (Table 3). This indi-
cates that the two lineages have different origins and the
variation in Kanto is higher. The high frequency of cluster
3 in the Tokyo and Gunma populations, overlaps of indi-
viduals between Kanto and Chubu Districts, and still dif-
ferent distribution of private alleles suggest the ongoing
migration (and breeding) from Chubu District to Kanto
District or via the counter route. Although there are higher
mountain ranges, such as Mt. Fuji and the Kanto Mountain
Range including elevations of [2,000 m, which cannot be
habitats of P. larvata, they could have migrated through
valleys and low lands connecting Gunma Prefecture (Kanto
District) with Nagano Prefecture (Chubu District). Since
Chubu District is one of the earliest areas where the exis-
tence of P. larvata was reported (Nawa 1965), the former
migrating direction (from Chubu to Kanto) might be more
reasonable. Masuda et al. (2010) reported that mtDNA
haplotypes found in Chubu and Shikoku Districts were also
identified from individuals of the Gunma population, in
addition to other haplotypes found in Kanto District. In the
1104 Conserv Genet (2012) 13:1095–1107
123
present study, 36 % (16/45) of individuals from the Gunma
population were assigned to cluster 3 (Table 5). The data of
the present (microsatellites) and previous (mtDNA) studies
demonstrate that Gunma is a contact zone between the
populations from Kanto District and those from Chubu
District.
Genetic diversity of P. larvata in Japan, compared
with Taiwan
Because Masuda et al. (2010) reported a sign of founder
effects in the Japanese P. larvata population based on
mtDNA phylogeography, it was expected that they had
lower polymorphisms at microsatellite loci than those of
Taiwan. Despite this assumption, the heterozygosities in
some populations in Japan were higher than in Taiwan,
whereas those of other populations in Japan were lower
than those in Taiwan (Table 2). Average values of Ho
(0.450) and He (0.553) in all samples from Japan were
higher, compared with those (0.399 for Ho and 0.504 for
He) of Taiwan. Although this may be ascribed to the rel-
atively small sample size (17 individuals) of the Taiwan
population, if there are different genetic lineages in Taiwan
as detected by mtDNA (Masuda et al. 2010), the specimens
collected from wide areas of Taiwan should have showed
higher diversities of microsatellites, compared with a
population (such as the Shikoku population) consisting of
one single lineage. Alternatively, if there are no clear
genetic structures in Taiwan based on microsatellites, four
genetic clusters detected in the present study could have
been generated due to genetic drift during the introduction
of small founder populations into Japan, and a population
consisting of a single cluster (such as the Shikoku popu-
lation) should have showed lower genetic diversities than
native Taiwanese populations. However, the Shikoku
population, which consisted of single genetic lineages of
microsatellites (present study) and mtDNA (Masuda et al.
2010), respectively, indicated higher heterozygosities than
those in Taiwan (Table 2). On the other hand, the allelic
richness of the Japanese populations was slightly lower
than the Taiwanese (Table 2). It is reported that allelic
richness is more sensitive to founder effects than hetero-
zygosity values (Dlugosch and Parker 2008). Furthermore,
BOTTLENECK analysis in the present study showed sig-
nificant heterozygosity excess in populations from Chubu
and Shikoku District, suggesting that these populations
could have experienced bottleneck recently. Considering
these results, it is possible that the Japanese populations
still retain the genetic diversity throughout introduction.
Thulin et al. (2006) investigated microsatellite diversities
in native and introduced populations of the small Indian
mongoose (Herpestes auropunctatus), and reported that the
Jamaica population originating from the native population
had moderate genetic diversity, whereas some populations
originating from the Jamaica population lost diversity.
Although the genetic diversity of introduced populations is
expected to be lower than that of natural populations
(Dlugosch and Parker 2008), in some case, the degree of
reduction of diversity by single founding events from
natural populations may not be so large. Furuya (1973)
reported that distributions of P. larvata in Shizuoka Pre-
fecture (Chubu District: Fig. 1) were discontinuous, and
suggested multiple introductions into different locations
within Shizuoka. Due to such multiple introductions, if
animals from the same lineage independently immigrated
into geographically close areas, they might continue to
retain some original genetic diversity. Alternatively, the
number of founders in the introductions of P. larvata into
each area of Japan may not have been so small. Nawa
(1965) reported that a considerable number of animals
were farmed in Shizuoka Prefecture before World War II.
Extensive introduction into some areas of Japan in the past
might have resulted in maintaining moderate genetic
diversities of current animal populations. Shimatani et al.
(2010) investigated introduced American mink (Neovison
vison) populations in Nagano Prefecture in Chubu District,
and reported that some microsatellite loci showed low
genetic variations probably resulting from the low genetic
diversity of founder individuals from farms, compared with
other native and introduced animal populations. In P.
larvata populations introduced into Japan, relatively higher
genetic diversities of founders could have brought the
present moderate variations.
Although the present study suggested admixtures among
different genetic clusters in Kanto District, genetic diver-
sity seen in this district was not so high compared with
other areas (Table 2). The multiple introduction and
admixture of populations originating from different sources
sometimes increased the genetic diversity of introduced
populations (Dlugosch and Parker 2008; Zalewski et al.
2010), but such cases are rare (Dlugosch and Parker 2008).
It is likely that the admixture between different genetic
clusters found in Kanto District has not increased the
genetic diversity of the introduced P. larvata populations.
Implications for management of Japanese P. larvata
Because of agricultural damage, it is considered that
effective reduction of the number of P. larvata in Japan is
important (Furuya 2009). In addition, they may have
competed with native species for foods (Matsuo et al. 2007;
Matsuo and Ochiai 2009). Management of their population
size is needed to protect crops and native ecosystems.
The present study revealed that most individuals from
different districts were assigned to distinct genetic clusters
(Fig. 4a; Table 5). This result indicates that animals from
Conserv Genet (2012) 13:1095–1107 1105
123
each of the three districts (Kanto, Chubu and Shikoku
Districts: Fig. 1) may be treated as independent manage-
ment units. Although higher mountains are located between
Kanto and Chubu Districts, some valleys and low lands
may be their migration routes, promoting gene flow, which
was detected in the present study. This indicates that even
if the population size of P. larvata is successfully reduced
in one district, migrants from an other district may supply
individuals for reduced populations. In addition, although
the present study showed that admixtures between different
genetic clusters did not increase genetic diversity in
introduced populations, in the future, the continuous
admixture may increase the genetic diversity of P. larvata
in Japan. For effective management of populations in
Kanto and Chubu Districts, the separation of migration
routes between them could be important. Because the
present microsatellite and previous mtDNA (Masuda et al.
2010) studies revealed that the contact zone between lin-
eages from two districts is around Gunma, eradication
efforts in this area may help to manage population sizes in
Kanto and Chubu Districts.
On the other hand, the present study indicated that most
individuals from Shikoku District were included in a single
genetic cluster (Fig. 4; Table 5). No signs of genetic con-
tact or migrants between populations in Shikoku District
and the other districts show that P. larvata in Shikoku
District have not met any other populations since their
introduction. Since Shikoku District consists of one island
and is geographically separated from other areas by the sea
(Fig. 1), there are no factors to increase the genetic varia-
tions by additional founders within the island; therefore,
concentrated trapping could reduce the population size in
Shikoku District more effectively, rather than Kanto and
Chubu Districts.
Efficiency of microsatellite marker development using
the ICSSR method
Although microsatellite markers are highly useful tools for
many kinds of population genetics studies, their develop-
ment is sometimes hard work (Lian et al. 2006). The
ICSSR method (Wu et al. 2008; Nishida and Koike 2009)
is an easy method for developing microsatellite markers. In
this method, to detect microsatellite loci in genome, only
three steps (PCR, cloning and sequencing) are needed. In
the present study, the ICSSR method was applied to marker
development from mammal species for the first time.
Consequently, nine of 40 designed primer sets (22.5 %)
were polymorphic and seven were able to be used as
actually usable markers. Chen et al. (2008) isolated
microsatellite loci from the P. larvata genome by con-
structing a dinucleotide-enriched library (Kandpal et al.
1994; Karp et al. 1998), and reported that six of 38 loci
containing simple repeat motifs (about 15.8 %) were
polymorphic. Thus, there are no large differences in effi-
ciency between the present study and Chen et al. (2008).
The method used in the present study is more simplified for
the isolation of effective markers, and shows high potential
for wide application to the development of genetic markers
for population genetics studies of even introduced animals.
Acknowledgments We thank Ryosuke Kishimoto (Nagano Envi-
ronmental Conservation Research Institute), Ayao Kanesawa (Ibaraki
Nature Museum), Terutake Hayashi (Tochigi Prefectural Museum),
Akihiro Koizumi (Iida City Museum), Midori Ogura (Karasu-gawa
Keikoku Ryokuchi of Nagano Prefecture), Megumi Matsushita (Ni-
hondaira Zoo), Tsunenori Tsujimoto (Morioka Zoological Park),
Mamoru Komatsu and Katsumi Chiba (Akita Omoriyama Zoo) for
supplying specimens. We are also grateful to Chizuko Nishida
(Hokkaido University), Shin Nishida (Kyushu University), Tatsuo
Oshida (Obihiro University of Veterinary Medicine and Agriculture)
and Yu-Cheng Chang (Tunghai University) for helpful suggestions
and support. This study was supported in part by a grant from the
Yuasa International Foundation to R. M.
References
Belkhir K, Borsa P, Chikhi L, Raufaste N, Bonhomme F (1996–2004)
GENETIX 4.05, logiciel sous Windows TM pour la ge
´ne
´tique
des populations. Laboratoire Ge
´nome, populations, interactions.
CNRS UMR 5000, Universite
´de Montpellier II, Montpellier
(France)
Benzecri JP (1973) L’analyse des Donnees: T.2, L’analyse des
correspondences. Dunoud, Paris
Chen JP, Andersen DH, Veron G, Randi E, Zhang SY (2008)
Isolation and characterization of polymorphic microsatellite
markers for the masked palm civet (Paguma larvata). Biochem
Genet 46:392–397
Cornuet JM, Luikart G (1996) Description and power analysis of two
tests for detecting recent population bottlenecks from allele
frequency data. Genetics 144:2001–2014
Dlugosch KM, Parker IM (2008) Founding events in species
invasions: genetic variation, adaptive evolution, and the role of
multiple introductions. Mol Ecol 17:431–449
Evanno G, Regnaut S, Goudet J (2005) Detecting the number of
clusters of individuals using the software STRUCTURE: a
simulation study. Mol Ecol 14:2611–2620
Excoffier L, Lischer HEL (2010) Arlequin suite ver 3.5: A new series
of programs to perform population genetics analyses under
Linux and Windows. Mol Ecol Resour 10:564–567
Furuya Y (1973) On Paguma larvata in Shizuoka Prefecture 1.
Geographical distribution. J Mamm Soc Jpn 5:199–205 (in
Japanese)
Furuya M (2009) The masked palm civet and raccoon, their
interesting behaviors and smart ways to prevent them. Rural
Culture Associate Japan, Tokyo (in Japanese)
Gao Y, Wang S, Zhang M, Ye Z, Zhou J, Ma Y, Li G, Wu J, Zheng Y,
Guo F, Xu L, Peng H, Wang Y, Sheng H, Li C, Fu Y (1987)
Fauna Sinica. Mammalia, vol 8: Carnivora. Science Press,
Beijing (in Chinese)
Goudet J (2001) FSTAT, a program to estimate and test gene
diversities and fixation indices (version2.9.3). http://www.unil.
ch/izea/softwares/fstat.html. Updated from Goudet (1995)
1106 Conserv Genet (2012) 13:1095–1107
123
Harada M, Torii H (1993) Karyological study of the masked palm
civet Paguma larvata in Japan (Viverridae). J Mamm Soc Jpn
18:39–42
Hardy OJ, Vekemans X (2002) SPAGeDi: a versatile computer
program to analyse spatial genetic structure at the individual or
population levels. Mol Ecol Notes 2:618–620
Kandpal RP, Kandpal G, Weissman SM (1994) Construction of
libraries enriched for sequence repeats and jumping clones, and
hybridization selection for region-specific markers. Proc Natl
Acad Sci USA 91:88–92
Karp A, Isaac PG, Ingram DS (1998) Molecular tools for screening
biodiversity. Champman & Hall, London
Kuroda N (1955) The present status of the introduced mammals in
Japan. J Mamm Soc Jpn 1:13–18
Lian C, Wadud MA, Geng Q, Shimatani K, Hogetsu T (2006) An
improved technique for isolating codominant compound micro-
satellite markers. J Plant Res 119:415–417
Masuda R, Kaneko Y, Siriaroonrat B, Subramaniam V, Hamachi M
(2008) Genetic variations of the masked palm civet Paguma
larvata, inferred from mitochondrial cytochrome bsequences.
Mamm Study 33:19–24
Masuda R, Lin L, Pei KJ, Chen Y, Chang S, Kaneko Y, Yamazaki K,
Anezaki T, Yachimori S, Oshida T (2010) Origins and founder
effect on the Japanese masked palm civet Paguma larvata
(Viverridae, Carnivora), revealed from a comparison with its
molecular phylogeography in Taiwan. Zool Sci 27:499–505
Matsuo R, Ochiai K (2009) Dietary overlap among two introduced
and one native sympatric carnivore species, the raccoon, the
masked palm civet, and the raccoon dog, in Chiba Prefecture,
Japan. Mamm Study 34:187–194
Matsuo R, Kaneshiro Y, Ochiai K (2007) Comparative analyses on
food habits of five carnivore species in the Chiba Prefecture,
Japan. Bull Biol Soc Chiba 57:73–80 (in Japanese with English
abstract)
Miyashita K (1977) Ecology of introduced animals. Kodansha, Tokyo
(in Japanese)
Nakamura K (1994) Story on introduced animals. Gihodo, Tokyo (in
Japanese)
Nawa A (1965) Notes on Paguma larvata in Shizuoka Prefecture.
J Mamm Soc Jpn 2:99–105 (in Japanese)
Nei M (1978) Estimation of average heterozygosity and genetic
distance for small number of individuals. Genetics 89:583–590
Nishida S, Koike K (2009) Isolation and characterization of
compound microsatellite loci in the tri-spine horseshoe crab
(Tachypleus tridentatus). Conserv Genet Resour 2:31–33
Ochiai K (1998) Distribution and invading process of the masked
palm civet, Paguma larvata, in Chiba prefecture, central Japan.
J Nat Hist Mus Inst Chiba 5:51–54 (in Japanese with English
abstract)
Patou ML, Chen J, Cosson L, Andersen DH, Cruaud C, Couloux A,
Randi E, Zhang S, Veron G (2009) Low genetic diversity in the
masked palm civet Paguma larvata (Viverridae). J Zool
278:218–230
Piry S, Luikart G, Cornuet JM (1999) Computer note. BOTTLE-
NECK: a computer program for detecting recent reductions in
the effective size using allele frequency data. J Hered
90:502–503
Pritchard JK, Stephens M, Donnelly P (2000) Inference of population
structure using multilocus genotype data. Genetics 155:945–959
Saitou N, Nei M (1987) The neighbor-joining method: a new method
for reconstructing phylogenetic trees. Mol Biol Evol 4:406–425
Sakai AK, Allendorf FW, Holt JS, Lodge DM, Molofsky J, With KA,
Baughmen S, Cabin RJ, Choen JE, Ellstrand NC, McCauley DE,
O’Neil P, Parker IM, Thompson JN, Weller SG (2001) The
population biology of invasive species. Annu Rev Ecol Syst
32:305–332
Shimatani Y, Fukue Y, Kishimoto R, Masuda R (2010) Genetic
variation and population structure of the feral American mink
(Neovison vison) in Nagano, Japan, revealed by microsatellite
analysis. Mamm Study 35:1–7
Suzuki K (1985) Notes on Paguma larvata in Saitama Prefecture. Nat
Anim 15(1):30–33 (in Japanese)
Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: Molecular
Evolutionary Genetics Analysis (MEGA) Software Version 4.0.
Mol Biol Evol 24:1596–1599
Thulin GC, Simberloff D, Barun A, Mccracken G, Pascal M, Islam
MA (2006) Genetic divergence in the small Indian mongoose
(Herpestes auropunctatus), a widely distributed invasive species.
Mol Ecol 15:3947–3956
Torii H (2009) Paguma larvata (Smith, 1827). In: Ohdachi SD,
Ishibashi Y, Iwasa MA, Saitoh T (eds) The wild mammals of
Japan. Kyoto, Shoukadoh, pp 267–268
Wu B, Shiokawa A, Matsushita N, Hogetsu T (2008) Isolation of
compound microsatellite loci in the herbaceous perennial
Cirsium purpuratum (Maxim.) Matsum. Mol Ecol Resour
8:814–817
Yamazaki K, Koyanagi K, Tsuji A (2001) List of mammals found in
Ibaraki prefecture, central part of Japan. Bull Ibaraki Nat Mus
4:103–108 (in Japanese with English abstract)
Yoshitake W (1998) Miscellaneous notes of animals in Ibaraki
Prefecture: Requiem for roadkilled animals. Ibaraki Seibutsu
18:33–57 (in Japanese)
Zalewski A, Michalska-Parda A, Bartoszewicz M, Kozakiewicz M,
Brzezinski M (2010) Multiple introductions determine the
genetic structure of an invasive species population: American
mink Neovison vison in Poland. Biol Conserv 143:1355–1363
Conserv Genet (2012) 13:1095–1107 1107
123
