Content uploaded by José B Poveda
Author content
All content in this area was uploaded by José B Poveda on Dec 18, 2015
Content may be subject to copyright.
Downloaded from www.microbiologyresearch.org by
IP: 54.210.20.124
On: Fri, 18 Dec 2015 06:36:11
Resistance to ceftazidime in Escherichia coli
associated with AcrR, MarR and PBP3 mutations
and overexpression of sdiA
Marı´a M. Tavı´o,
1,2
Virginia D. Aquili,
1
Jordi Vila
3
and Jose
´B. Poveda
2
Correspondence
Marı´a M. Tavı´o
mtavio@dcc.ulpgc.es
Received 6 June 2013
Accepted 1 October 2013
1
Microbiologı´a, Departamento de Ciencias Clı´nicas, Facultad de Ciencias de la Salud,
Universidad de Las Palmas de Gran Canaria, Las Palmas de Gran Canaria, Spain
2
Unidad de Epidemiologı´a y Medicina Preventiva, Instituto Universitario de Sanidad Animal (IUSA),
Universidad de Las Palmas de Gran Canaria, Arucas, Spain
3
Departamento de Microbiologı´a, IDIBAPS, Facultad de Medicina, Universidad de Barcelona,
Barcelona, Spain
The mechanisms responsible for the increase in ceftazidime MIC in two Escherichia coli in vitro
selected mutants, Caz/20-1 and Caz/20-2, were studied. OmpF loss and overexpression of acrB,
acrD and acrF that were associated with acrR and marR mutations and sdiA overexpression,
together with mutations A233T and I332V in FtSI (PBP3) resulted in ceftazidime resistance in
Caz/20-2, multiplying by 128-fold the ceftazidime MIC in the parental clinical isolate PS/20.
Absence of detectable b-lactamase hydrolytic activity in the crude extract of Caz/20-2 was
observed, and coincided with Q191K and P209S mutations in AmpC and a nucleotide
substitution at ”28 in the ampC promoter, whereas b-lactamase hydrolytic activity in crude
extracts of PS/20 and Caz/20-1 strains was detected. Nevertheless, a fourfold increase in
ceftazidime MIC in Caz/20-1 compared with that in PS/20 was due to the increased transcript
level of acrB derived from acrR mutation. The two Caz mutants and PS/20 showed the same
mutations in AmpG and ParE.
INTRODUCTION
The emergence and spread of cefotaxime- and ceftazidime-
resistant strains among Escherichia coli isolates have been
frequently described in recent years, with most cases due
to some extended-spectrum b-lactamases (ESBLs) of the
CTX-M family, which display increased hydrolytic activ-
ities against ceftazidime, such as is the case for CTX-M-15
and CTX-M-32 (Oteo et al., 2006). In addition, mutations
have been described in AmpC b-lactamases that enhance
catalytic efficiency towards oxyimino-b-lactam substrates
(Ahmed & Shimamoto, 2008) or mutations and insertions
in the ampC promoter/attenuator region, especially those
located in the 235 and 210 boxes (Corvec et al., 2003),
which have resulted in AmpC chromosomal b-lactamase
overexpression. They have all been probed to increase the
resistance to cefoxitin and expanded-spectrum cephalo-
sporins (Jacoby, 2009; Tracz et al., 2007). Likewise, other
mechanisms of resistance such as increased expression of
efflux pumps frequently contribute to the acquisition of
resistance to ceftazidime and other antibiotics in E. coli
(Oteo et al., 2006; Jacoby, 2009). Moreover, the rate of
ceftazidime-resistant Enterobacteria has been significantly
correlated with daily doses of fluoroquinolones and
cephalosporins (Uchida et al., 2010). Other mechanisms
such as decreased permeability and ftsI (PBP3) mutations
can contribute to decreasing the susceptibility to ceftazi-
dime (Jacoby, 2009; Tavı
´oet al., 2010).
Otherwise, in vitro acquisition of multidrug resistance
phenotype by ceftazidime or fluoroquinolones in E. coli
has been previously associated with the quorum-sensing
regulator sdiA (Tavı
´oet al., 2010). SdiA can upregulate
efflux pump transporters such as AcrB and AcrF that
increase cefotaxime and ceftazidime MICs (Wei et al.,
2001a; Yang et al., 2003; Nishino et al., 2003). Despite the
meaning of SdiA in bacterial pathogenesis being known
(Lee et al., 2007), its significance in resistance to antibiotics
still requires clarification. This suppressor of division
inhibition (SdiA) regulates cell division in a cell density-
dependent (or quorum-sensing) manner (Wei et al., 2001b).
SdiA is homologous to the LuxR family of quorum-sensing
transcription factors, and its amplification has a global
impact on several functions in bacterial cells, including cell
Abbreviations: ESBL, extended-spectrum beta-lactamase; OD, optical
density; OMP, outer-membrane protein; PBP3, penicillin-binding protein
3; QRDR, quinolone resistance-determining region. RT-PCR, reverse
transcription of total RNA and PCR of cDNA.
One supplementary figure is available with the online version of this paper.
Journal of Medical Microbiology (2014), 63, 56–65 DOI 10.1099/jmm.0.063727-0
56 063727 G2014 SGM Printed in Great Britain
Downloaded from www.microbiologyresearch.org by
IP: 54.210.20.124
On: Fri, 18 Dec 2015 06:36:11
septation (ftsQAZ cell division genes) (Wei et al., 2001a). In
its turn, cell-wall turnover is part of the biochemical events
during cell growth and division. In the process of bacterial
cell-wall turnover, murein is degraded, resulting in anhydro-
muropeptides that are imported into the cytoplasm by
AmpG permease, and then muropeptides are broken down
to yield tetra- and tripeptides that can re-enter into de novo
peptidoglycan synthesis or be secreted into the growth
medium. An ATP-binding cassette transporter MppA/
OppBCDF (Park et al., 1998; Maqbool et al., 2011) recovers
these secreted tri- and tetrapeptides. It has also been
suggested that MppA could be involved in the quorum-
sensing response (Park et al., 1998).
Therefore, the aim of this study was to characterize
ceftazidime resistance determinants and a possible role of
sdiA and the genes of its regulon in mutants in vitro
selected with ceftazidime.
METHODS
Bacterial strains and drugs. The study was performed using one E.
coli clinical isolate, PS/20 strain, as the initial parental strain, and two
mutants derived from it through two different and consecutive
selective steps that resulted in E. coli mutants Caz/20-1 and Caz/20-2.
The parental strain PS/20, which had been isolated from a urine
sample from one inpatient at the Hospital Insular of Gran Canaria
(Spain), was susceptible to fluoroquinolones and ceftazidime.
E. coli AG100 induced by salicylate or paraquat was used as control
strain for the study of gene expression and cyclohexane tolerance. E.
coli KL-16 and JF703 (OmpF-deficient) were used in outer-membrane
protein (Omp) analysis, following a previous description (Tavı
´oet al.,
2010). Antimicrobial agents and other drugs used in this study were
from Sigma-Aldrich and other manufacturers, as previously described
(Tavı
´oet al., 2010).
Mutant selection. Spontaneous mutants were consecutively selected
on Mueller–Hinton agar plates containing ceftazidime at concentra-
tions 4- and 16-fold times the ceftazidime MIC in the PS/20 strain.
The most ceftazidime-resistant new stable mutants that were obtained
in each selection step were in turn the parental strains in the next
selection step (Tavı
´oet al., 2010).
Susceptibility tests and transfer of ceftazidime resistance.
MICs were determined following CLSI guidelines (CLSI, 2006) with
and without the active efflux inhibitor carbonyl cyanide m-
chlorophenylhydrazone (CCCP) at 50 mM, since PS/20 did not grow
well with CCCP concentrations higher than 50 mM, as previously
described (Tavı
´oet al., 2010). The susceptibility to 2,4-dinitrophenol
was also assessed following a previous description (Tavı
´oet al., 2010).
A previously described double-disc synergy test with clavulanic acid
was used to identify possible ESBL production in parental strain and
Caz/20 mutants (Corvec et al., 2007). Likewise, the CLSI confirmatory
test for ESBL production and a boronic acid disc test with or without
clavulanic acid were performed as previously described (Song et al.,
2007), with a ¢3 mm increase in the inhibition zone diameter of
either the cefotaxime/boronic acid disc or the ceftazidime/boronic
acid disc in the presence of clavulanic acid considered indicative of an
ESBL producer (Song et al., 2007).
Likewise, the possible transfer of ceftazidime resistance by conjuga-
tion was studied, using methods described previously (Tavı
´oet al.,
2010).
Analysis of outer-membrane proteins (OMPs). The study of
OMPs was performed as previously described (Tavı
´oet al., 2010). OMPs
were obtained from the pellet after Sarkosyl treatment and separated in
an 11 % polyacrylamide gel with 6 M urea to achieve a better separation
of the major OMPs as previously described (Tavı
´oet al.,2010).Gelswere
stained using the Imperial Protein Stain kit (Pierce).
b-lactamase hydrolytic activity. b-lactamase activity in sonicated
extracts of parental strain and Caz/20 mutants was assayed using
100 mM benzylpenicillin and 100 mM cefaloridine in 0.05 M phos-
phate buffer (pH 7) at 25 uC, following previous reports (Tavı
´oet al.,
2010). In this regard, ceftazidime is generally a poor substrate for
AmpC cephalosporinases compared with cefaloridine (Queenan et al.,
2007), which, unlike ceftazidime, is frequently used for the
determination of hydrolytic activities of chromosomal AmpC b-
lactamases (Doi et al., 2004). The activity was expressed as units per
milligram of protein, where 1 U represents 1 mmol of substrate
hydrolysed min
21
per ml of extract.
Organic solvent tolerance. Tolerance to cyclohexane was measured
by a liquid-medium assay, as previously described (Tavı
´oet al., 2010).
Cyclohexane tolerance values are reported as the mean determina-
tions from at least three independent measures of optical density
(OD) at 660 nm at 3 and 6 h after the addition of cyclohexane. The
rate of turbidity (OD at 660 nm) increase of bacterial culture was
determined by the formula: Increase in turbidity5OD at 3 and 6 h
after cyclohexane addition/OD immediately before cyclohexane
addition. The standard deviations for these values were all ,10 %.
A total increase in turbidity of approximately two to threefold in the
first 3–6 h after cyclohexane addition was considered significant
following previous descriptions (Asako et al., 1997; Tavı
´oet al., 2010).
E. coli AG100 induced by salicylate 5 mM was used as a positive
control for tolC overexpression due to its effect inducing increased
cyclohexane tolerance. Salicylate 5 mM is a good inducer of marRAB
regulon expression and, hence, tolC expression (White et al., 1997;
Pomposiello et al., 2001; Tavı
´oet al., 2010) and cyclohexane tolerance
in E. coli is TolC dependent (Aono et al., 1998). Cyclohexane
tolerance is associated with overexpression of tolC, but it also depends
on the concomitant overexpression of two-component efflux pumps
exporting organic solvents, such as AcrAB and AcrEF (Aono et al.,
1998; Kobayashi et al., 2001).
Analysis of DNA sequences of the acrR,marR,soxR,ftsI,
ampG, and ampC genes, ampC promoter-attenuator region
and QRDRs of the gyrA,gyrB,parC, and parE genes. The
acquisition of possible mutations in the ftsI,ampG,acrR,marR and
soxR genes and the QRDR of the gyrA,gyrB,parC and parE genes of
PS/20 and the two Caz mutants studied through DNA sequencing of
their PCR products were amplified according to GenBank sequence
accession no. U00096 and sequenced.
Likewise, the ampC and ampC promoter/attenuator regions were
amplified in the above three strains according to GenBank sequence
accession no. J01611 and sequenced, following previous descriptions
(Corvec et al., 2007; Yang et al., 2003).
Reverse transcription of total RNA and PCR of cDNA (RT-PCR).
Overnight cultures of the studied strains and AG100 inoculated in
Luria–Bertani medium were used for extraction of total RNA,
following previous descriptions (Sa
´nchez-Ce
´spedes & Vila, 2007;
Tavı
´oet al., 2010). Transcript levels of the acrB,acrD,acrF,tolC,
marA,ftsI,mppA and sdiA genes were studied by reverse transcription
of total RNA and PCR of cDNA (RT-PCR), using the method and
primers previously described (Tavı
´oet al., 2010) with the follow-
ing bp for the amplified fragments: acrB-336, tolC-398, marA-390,
ftsI,acrR,marR,sdiA genes in ceftazidime resistance
http://jmm.sgmjournals.org 57
Downloaded from www.microbiologyresearch.org by
IP: 54.210.20.124
On: Fri, 18 Dec 2015 06:36:11
ftsI-380 and sdiA-417. The primers utilized for the amplification of
acrF (amplified fragment of 431 bp), acrD (amplified fragment of
380 bp) and mppA (amplified fragment of 554 bp) from cDNA are
listed in Table 1. All primers were designed according to GenBank
sequence accession no. U00096, as previously reported (Tavı
´oet al.,
2010). The data obtained for gene targets were normalized against the
reference gene gapA following previous descriptions (Kern et al.,
2000; Tavı
´oet al., 2010). The expression level of each of the above-
mentioned genes in Caz/20-2, PS/20 and AG100 strains was assessed,
although only acrB and sdiA were analysed in the case of Caz/20-1
since marR mutations were not identified in it. The transcript level of
soxS was not studied in any of the cases since no mutation other than
silent nucleotide substitutions were found in soxR in PS/20, Caz/20-1
and Caz/20-2 strains. Induction of acrB,tolC and marA genes by
salicylate 5 mM and acrB by paraquat 0.2 mM were used as positive
controls.
At least three different extracts of total RNA were obtained from each
studied strain, and RT-PCR was done in triplicate for every RNA
extract obtained from each strain and for the different analysed genes.
The resulting PCR products (cDNA amplified by each primer pair
tested) were separated in 12 % polyacrylamide slab gels and detected
using a DNA silver staining kit (Amersham Biosciences), as previously
described (Tavı
´oet al., 2010). Gel results were analysed using ImageJ
analysis software for the measurements of density and pixels of bands
to obtain a more accurate measurement of band densities. The
accepted standard deviation for these densitometric values for each
gene and strain was always ,5%.
Changes ¢1.3-fold in the gene expression levels were considered
significant, as previously described (Tavı
´oet al., 2010).
RESULTS AND DISCUSSION
Different mechanisms have been described as responsible
for the acquisition of resistance to ceftazidime in E. coli,in
many cases associated with the presence of ESBLs or AmpC
b-lactamase hyperproduction concomitantly with active
efflux and/or decreased permeability (Martı
´nez-Martı
´nez
et al., 2000; Oteo et al., 2006; Jacoby, 2009; Oteo et al.,
2010). Spontaneous mutants with less susceptibility to
ceftazidime were selected from the parental strain PS/20
after two consecutive selective steps with selection
frequencies of 10
28
in the first selective step (Caz/20-1
strain) and 10
27
in the second selective step (Caz/20-2
strain) when it was used as a concentration 16-fold higher
than the MIC of ceftazidime in PS/20. Caz/20-2 exhibited a
multidrug resistance phenotype (Tables 2 and 3), including
a 128-fold increase in ceftazidime MIC (64 mgml
21
)
compared to that in the parental strain PS/20. The
mechanisms involved in the ceftazidime resistance pheno-
type of Caz20-2 were assessed and compared with those in
Caz/20-1 mutant, which was its parental mutant.
The expression of b-lactamases different to chromosomal
AmpC was ruled out since the double-disc synergy test
between each tested cephalosporin and clavulanic acid did
not detect synergy in the parental strain and the two
mutants. Likewise, the increases in the inhibition zone
diameters of cefotaxime (30 mg) and ceftazidime (30 mg) in
the presence of clavulanic acid were all ,5 mm in the three
studied strains, and in turn, the increases in the inhibition
zone diameters of either the cefotaxime/boronic acid or
ceftazidime/boronic acid discs in the presence of clavulanic
acid were all ,3 mm. Furthermore, resistance to ceftazi-
dime was not transferred by conjugation assays to E. coli
K12 C600. Resistance to oxyimino-cephalosporins, cefta-
zidime and cefotaxime, concomitant with susceptibility to
both cefepime and imipenem, which are two compounds
highly stable to AmpC b-lactamases from E. coli, has been
associated with the hyperproduction of chromosomal
AmpC b-lactamase and loss of OmpF porin (Martı
´nez-
Martı
´nez et al., 2000). The Caz/20-2 mutant indeed showed
a resistance profile to b-lactams compatible with that des-
cribed in E. coli hyperproducing chromosomal b-lactamase
Table 1. Oligonucleotides used for RT-PCR and DNA sequence determination
Gene Forward primer 5§–3§Reverse primer 5§–3§
Primer pairs for RT-PCR
acrD GGTGCTGGCAATCCTGTTG TGGTCAGAATGTTGGTATCGC
acrF ATCGAACAGAATATGAACG TTCAACTGGTTAATCACATC
mppA CATTGTCGCCATTTGCATGG CAGACGAACGCGCTGATC
Primer pairs for sequencing
ampC-prt GATCGTTCTGCCGCTGTG GGGCAGCAAATGTGGAGCAA
ampC GGCCGTTTTGTATGGAAAC
GAGTTTGCATCGCCTGC
GTGTAGATGACAGCAAGG
GAAGCCGTCTGGTTTGAG
ampG CGCGCGTTAATTTCTGCCC
GATGTGCTTCCGGCAGAAG
GGTTACTGGCTGCTGTC
CGGAAACAGCATCCCTAATC
GCCCATGCTGTAGAGATGC
GCCGTAATAATTACGGCG
ftsI CTTGAAGAGAATGCGCTCG
GAAGGCGCTGGCTAACGC
GTAACCGTACCATCACCG
CGGTGAACGTGTCTTCCC
GTTAATGCGGGCTGAAAG
CAACGCGGTCATTACCACC
GGTAGCGCCACGCTTTC
CAGCCACACGGCTGTCG
marR AGCTAGCCTTGCATCGCA TACGGCAGGACTTTCTTAAGCA
soxR GGGACATAAATCTGCCTC GGAAACCCTCCTGTGTAC
M. M. Tavı´o and others
58 Journal of Medical Microbiology 63
Downloaded from www.microbiologyresearch.org by
IP: 54.210.20.124
On: Fri, 18 Dec 2015 06:36:11
by Martı
´nez-Martı
´nez et al. (2000). Nevertheless, no b-
lactamase hydrolytic activity against benzylpenicillin and
cefaloridine was detected in the mutant Caz/20-2, whereas
low b-lactamase hydrolytic activities were observed in PS20
and Caz/20-1, 0.65 and 0.074 U mg
21
of the total protein in
the PS/20 strain and 0.67 and 0.076 U mg
21
of the total
protein in Caz/20-1 against 100 mM benzylpenicillin and
100 mM cefaloridine, respectively. Furthermore, there were
no changes in the nucleotide sequence of the ampC
attenuator in Caz/20-1, Caz/20-1 and PS20 strains with
respect to wild-type sequence accession no. J01611 previously
described (Jaurin et al., 1982), coinciding with a previous
report on non-hyperproducing AmpC E. coli strains
(Ferna
´ndez-Cuenca et al., 2005). Increased transcription of
ampC has been more frequently associated with transversions
between 235 and 210 boxes such as those at 242 and 232
positions (Caroff et al., 2000) or with CAAtransversionat
211 (Tracz et al., 2005), CAT transversions at 21, +58
(Yu et al., 2009) and 288 (Corvec et al., 2003) and AAG
transversion at 282 (Yu et al., 2009), also with insertions in
the spacer region within 235 and 210 boxes (Tracz et al.,
2005; Tracz et al., 2007; Peter-Getzlaff et al.,2011).
Nevertheless, GAAtransversionatthe228 position within
the 235 and 210 boxes, as previously reported in clinical
isolates, was not associated with AmpC hyperproduction
(Peter-Getzlaff et al., 2011). The same substitution, a GAA
transversion at the 228 position located in the spacer region
between 235 and 210 boxes, was identified in the Caz/20-2
mutant, and also a CAT transversion at the 273 position in
the PS/20 and the two Caz mutants (Table 3), but neither of
the two above nucleotide transversions was associated with
any AmpC hyperproducing phenotype.
Regarding putative inactivating mutations in AmpC, which
could explain the decreased hydrolytic activity of Caz/20-2
crude extract on b-lactams, active site Ser64, as well as
Lys67 (Beadle & Shoichet, 2002), Tyr150, Asn152, Lys315
and Ala318 residues, but not Glu272 and His314, have
been previously proposed to be important in the catalytic
mechanism of class C b-lactamases found in Entero-
bacteriaceae and Pseudomonas spp. (Dubus et al., 1996;
Jacoby, 2009). It has been previously described that
substitutions of catalytic residues Ser64, Lys67, Tyr150,
Asn152 and Lys315 decreased the activity of the enzyme by
10
3
-to10
5
-fold compared to AmpC wild-type (Beadle &
Shoichet, 2002); nevertheless, residues Gln191 and Pro209,
in which mutations were identified in Caz/20-2 mutant
(Table 3), have not been described as being among those
involved in the catalytic function of AmpC b-lactamases. It
must not be overlooked that some mutations modifying
the length and charge of the side chain of a certain residue
can create electrostatic interactions that slow or decrease
the catalytic activity of the AmpC b-lactamase, such as
previously described for Ser289 residue (Tre
´panier et al.,
1999), which is not essential in the binding or hydrolytic
mechanism of class C b-lactamase from Enterobacter
Table 2. Antimicrobial agent MICs and the effect of 50 mM
carbonyl cyanide m-chlorophenylhydrazone on the susceptibil-
ity of Caz/20-2 mutant and its parental strain
MIC (mgml
”1
)
Drug PS/20 PS/20 +CCCP Caz/20-2 Caz/20-2
+CCCP
NAL 32 16 1024 256
CEF 8 8 32 8
FOX 1 0.5 8 2
CTX 0.25 0.25 1 0.25
CPO 1 1 8 4
FEP 0.12 0.12 2 0.5
ATM 0.25 0.25 4 0.25
IMP 0.25 0.25 0.5 0.25
CHL 0.5 0.25 32 8
TET 32 16 128 16
DNP 0.12 ND 0.06 ND
MYT-C 2 2 4 4
+CCCP, Antibiotic MIC in the presence of 50 mM carbonyl cyanide
m-chlorophenylhydrazone; ATM, aztreonam; CEF, cefalotin; DNP,
2,4-dinitrophenol; FEP, cefepime; CTX, cefotaxime; FOX, cefoxitin;
CPO, cefpirome; CHL, chloramphenicol; IMP, imipenem; NAL,
nalidixic acid; TET, tetracycline; MYT-C, mitomycin-C.
Table 3. Ceftazidime and norfloxacin MICs (mgml
”1
), the effect of 50 mM carbonyl cyanide m-chlorophenylhydrazone on the
susceptibility of Caz/20-2 mutant and its parental strain, and nucleotide substitutions and mutations in PS/20 and Caz/20 mutants
Strains MIC (mgml
”1
) Mutations
CAZ/+I NOR/+I FtsI AmpC ampC-pr AcrR MarR ParE
PS/20 0.5/0.5 0.5/0.25 ––273 CAT––K443T
N446K
Caz/20-1 2/1 2/0.5 ––273 CAT Q27H –K443T
N446K
Caz/20-2 64/8 4/1 A233T
I332V
Q191K
P209S
273 CAT
228 GAA
Q27H c.102_103insT K443T
N446K
CAZ, Ceftazidime; NOR, norfloxacin; +I, antibiotic MIC in the presence of 50 mM carbonyl cyanide m-chlorophenylhydrazone.
ftsI,acrR,marR,sdiA genes in ceftazidime resistance
http://jmm.sgmjournals.org 59
Downloaded from www.microbiologyresearch.org by
IP: 54.210.20.124
On: Fri, 18 Dec 2015 06:36:11
cloacae P99. However, when (Tre
´panier et al., 1999)
substituted it by Lys or Arg (polar and positively charged
residues), it resulted in decreased catalytic activity
(Tre
´panier et al., 1999). Indeed, substitution of a residue
with a small side chain such as serine for a larger amino
acid or positively charged could fundamentally change the
protein activity (Betts & Russell, 2003). Mutations in
AmpC of Caz/20-2 strain were in the amino acids
(positions 191 and 209) that are between the catalytic
residues Asn152 and Lys315. The amino acid Gln (at
position 191), which is a polar or hydrophilic amino acid
with a neutral side-chain charge such as Ser (Betts &
Russell, 2003), was substituted by a polar and positively
charged amino acid Lys (Gln191Lys), whereas Pro (at
position 209), which is a small with an aliphatic-side chain
was substituted by serine (Pro209Ser) (Table 3), which is
also a small amino acid but which is polar (Betts & Russell,
2003). Furthermore, Gln191Lys and Pro209Ser mutations
were located within the V-loop, which lies from residues
178 to 226, and surrounds the active site of cephalospor-
inases R1 (Nordmann & Mammeri, 2007). Whatever the
explanation of the relationship between the above muta-
tions in AmpC and activity, it must not be overlooked that
the simultaneous appearance of the mutations Gln191Lys
and Pro209Ser in AmpC of Caz/20-2 was associated with a
significant decrease of b-lactamase hydrolytic activity
compared with that in PS/20 and Caz/20-1, which did
not carry any mutation in AmpC. Nevertheless, the
purification of AmpC enzymes of the studied strains and
kinetic analysis is necessary as described in Beadle &
Shoichet (2002) and Doi et al. (2004) to determine if the
difference in protein residues of AmpC b-lactamase in the
case of Caz/20-2 strain could confer a lower hydrolysis
ability against ceftazidime, which is far from the objective
of the present study: the characterization of resistance to
ceftazidime.
Therefore, since b-lactamase hydrolytic activity was not the
cause of the resistance to ceftazidime in Caz/20-2, other
possible mechanisms were evaluated, such as PBP3
mutations, increased expression of efflux pumps and
decreased cell-wall permeability.
Penicillin-binding protein 3 (PBP3; also called FtsI) is a
transpeptidase that catalyses cross-linking of the peptido-
glycan cell wall in the division septum of E. coli
(Georgopapadakou, 1993). The catalytic domain of PBP
binds b-lactam antibiotics, which mimics a transpeptidase
substrate and serves as a suicide inhibitor by forming a
long-lived covalent adduct with the catalytic serine (Wissel
& Weiss, 2004). Mutations in PBP3 have been previously
described to increase b-lactam resistance in Gram-negative
microorganisms such as Haemophilus influenzae,Acineto-
bacter baumanii and P. aeruginosa (Barbosa et al., 2011;
Cayo
ˆet al., 2011; Moya
´et al., 2012). Furthermore,
ceftazidime, cefpirome and aztreonam preferentially inhibit
PBP3 (FtsI) (Curtis et al., 1979; Maejima et al., 1991).
Thus, the two mutations in PBP3, Ile332Val and
Ala233Thr, which were only identified in Caz/20-2 mutant
(Table 3) and not in PS/20 and Caz/20-1 strains, could
decrease the affinity of the protein by ceftazidime
increasing its MIC. The mutation Ile332Val was within
the catalytic penicillin-binding module Asp237-Val577
(Piette et al., 2004), a highly conserved domain within
the transpeptidase superfamily. Interestingly, Ile332Val was
near to the previously described PBP3 active site Gly306-
Ser-Thr-Val-Lys-Pro311 (Keck et al., 1985). Furthermore,
it was previously proposed that activity of the transpepti-
dase module of PBP3 is regulated by the interaction of its
N-terminal non-catalytic module with other cell division
proteins, and, in fact, catalytic activity of PBP3 is
stimulated by interaction(s) with other division proteins
(Eberhardt et al., 2003). Perhaps the mutation Ala233Thr
in PBP3 of Caz/20-2 mutant, which is located within the
N-terminal non-catalytic module Arg71-Ile236, could
abrogate or make more difficult the interaction with the
transpeptidase module and/or with other division proteins,
as has been previously demonstrated for mutations within
the non-catalytic module of PBP3 (Piette et al., 2004);
along this line, the mutated residue Ala233Thr is within the
highly conserved motif Asn231-Leu-Ala-Leu-Ser-Ile-Asp-
Glu-Arg-Leu-Gln241 in n-PBP module (Nguyen-Diste
`che
et al., 1998) in PBP3 of E. coli and other Enterobacteria
and P. aeruginosa. Further studies investigating possible
differences in the affinity of Caz/20-2 mutant’s PBP3 by
ceftazidime and other b-lactams, derived from the muta-
tions Ile332Val within the catalytic penicillin-binding
module and Ala233Thr within the N-terminal non-
catalytic module Arg71-Ile236 are in progress. Likewise,
there was no significant difference between the level of
expression of ftsI in Caz/20-2 and PS/20 (Table 4, Fig. S1,
available in JMM Online).
The condition of AcrD as an aztreonam transporter, and
those of AcrB or AcrF as ceftazidime and cefotaxime
Table 4. The fold increase of the expression levels in the
studied genes in E. coli PS/20 and Caz/20-2 compared with
those in E. coli AG100 strain
Genes Expression ratio over AG100*
PS/20 Caz/20-2 AG100SADAG100PQd
acrB 0.9 17.8 3.6 2.7
acrD 1.01 15.3 ND ND
acrF 2.1 6.1 ND ND
tolC 0.9 6.9 7.7 ND
marA 1.02 4.3 4.9 ND
sdiA 4.5 65.6 ND ND
ftsI 0.8 0.99 ND ND
mppA 2.9 9.9 ND ND
*The level of expression of genes in the AG100 strain non-induced
with salicylate or paraquat was taken as 100.
DAG100 induced with 5 mM salicylate.
dAG100 induced with 0.2 mM paraquat.
M. M. Tavı´o and others
60 Journal of Medical Microbiology 63
Downloaded from www.microbiologyresearch.org by
IP: 54.210.20.124
On: Fri, 18 Dec 2015 06:36:11
transporters have been previously described (Nishino et al.,
2003), and expression of the above efflux pump transport-
ers and possible regulatory genes was analysed. The efflux
pump transporters AcrB, AcrD, and AcrF resulted
significantly overexpressed in Caz/20-2 the same that
SdiA (Table 4, Fig. S1). In turn, the increase in
mitomycin-C MIC in Caz/20-2, which was not reversed
by CCCP (Table 2), was consistent with increased
transcript levels of sdiA as previously described (Tavı
´o
et al., 2010). Previous publications found 5.18- to 10.56-
fold induction of sdiA expression associated with a 4.9- to
13.93-fold increase in the acrF transcript level (Domka
et al., 2006). In other reports, the concurrent over-
expression of ramA and marA resulted in 6.6- and 15.1-
fold increased transcript levels of acrF and acrB, respec-
tively, whereas a 149.1-fold increase in the transcript level
of soxS alone only resulted in a 2.5-fold increase of acrF
and 5.5-fold for acrB in Salmonella Typhimurium (Zheng
et al., 2009). In the present study, increased transcript levels
of both sdiA (65.6-fold) and marA (4.3-fold) in Caz/20-2
were associated with a 6.1-fold increase of acrF expression
(transporter of the two-component efflux pump AcrEF)
together with acrD (single-component efflux pump) and
acrB overexpression (Table 4, Fig. S1). It has previously
been demonstrated that when efflux pumps of different
structural types combined in the same cell, the observed
antibiotic resistance was much higher than that conferred
by each of the pumps expressed singly, although simultan-
eous expression of two multi-component efflux pumps also
had an additive effect on antibiotic resistance (Lee et al.,
2000). Likewise, it was previously demonstrated that the
effect on antibiotic resistance conferred by a multi-
component pump was dependent on its level of expression
(Lee et al., 2000). Thus, in the present study, an increase of
19.8-fold of acrB, in addition to a 2.9-fold increase in acrF
in Caz/20-2 with respect to the expression level of both
genes in the parental strain, could multiply the effect of
PBP3 mutations reducing the susceptibility to ceftazidime
in the Caz/20-2 mutant. In turn, the overexpression of
AcrD, AcrB and AcrF transporters could also contribute to
increasing the 16-fold aztreonam MIC and fourfold
cefotaxime MIC in Caz/20-2. The increased transcript level
of acrB in the Caz/20-2 strain was striking, 17.8-fold more
than that in AG100 (Table 4, Fig. S1), particularly when
compared with previous descriptions in which only
frameshift mutation in marR (Keeney et al., 2008) or only
acrR mutation (Watanabe & Doukyu, 2012) was detected.
Nevertheless, the high expression level of acrB gene in Caz/
20-2 is similar to that described in Salmonella typhimurium
strains in which simultaneous increased expression of
ramA and marA was found, 69.1- and 1.9-fold, respectively
(Zheng et al., 2009). Likewise, E. coli strains with double
mutation in acrR and marR exhibited a higher expression
level of AcrB but not TolC, compared with those strains
with mutations in only one of the genes, acrR or marR
(Watanabe & Doukyu, 2012). In the present study, a
mutation in acrR (Gln27His) due to the substitution
CAGACAT was found in Caz/20-2 strain concomitantly
with the frameshift mutation in marR that was due to
c.102_103insT (Table 3) within the nucleotide sequence of
marR. This insertion in marR sequence resulted in
Pro35ASer and generated changes in the following
residues, including those lying inside the putative DNA-
binding domain of MarR within the region spanning
amino acids 61–121, following the description of the DNA-
binding domain of MarR by Alekshun et al. (2001). The
simultaneous presence of the above two mutations in Caz/
20-2 strain (Table 3) explains the higher increase of acrB
expression compared to that in Caz/20-1, which carried the
same mutation Gln27His in acrR, although without any
marR mutation. The above mutation in acrR was just
adjacent to the residue Gly28 (G28) in which mutations are
described connected to norfloxacin, chloramphenicol and
tetracycline resistance (Oteo et al., 2006). Therefore, the
moderate increase of acrB expression observed in Caz/20-1,
which was 3.6-fold lower than that in Caz/20-2 and 4.3-
fold higher than the acrB transcript level in PS/20 (Table 4,
Fig. S1), was probably responsible for the increase of
ceftazidime MIC in Caz/20-1, 2 mgml
21
, only fourfold
higher than that in PS/20, 0.5 mgml
21
. Otherwise, sdiA
expression level in the mutant Caz/20-1 did not show a
significant difference with respect to that found in PS/20
(4.9-fold increase with respect to that in AG100) (data not
shown in Fig. S1).
Likewise, the role of increased active efflux in Caz/20-2
multidrug resistance phenotype was also demonstrated by
the increased susceptibility (twofold to 16-fold) not only
to ceftazidime but also to quinolones, chloramphenicol,
tetracycline and all the tested b-lactams induced by
the efflux pump inhibitor CCCP (Tables 2 and 3).
Furthermore, increases in turbidity of 3.7- to 4.3-fold at
3 and 6 h after cyclohexane addition were found in Caz/20-
2, which meant a 1.9- to 2.8-fold increase in the cyclo-
hexane tolerance with respect to that detected in PS/20 and
in the wild-type AG100. The range of increases in turbidity
in Caz/20-1 mutant was 2.5- to 2.8-fold, which only meant
a 1.6- to 1.8-fold increase with respect to the PS/20 and
AG100 strains. Increased cyclohexane tolerance in Caz/20-2
was consistent with tolC overexpression (Table 4, Fig. S1)
and this resembled previously reported findings (Tavı
´o
et al., 2010). A previous report has demonstrated the
synergistic effect of double mutations of marR and acrR
improving the solvent tolerance to cyclohexane, compared
with that in strains with mutations in only one of the above
genes (Watanabe & Doukyu, 2012). The gene acrB, which
encodes the transporter of the two-component efflux
pump AcrAB, is overexpressed when mutations abrogate
the AcrR repressor function on acrAB operon (Webber &
Piddock, 2001). Likewise, both tolC and acrB are over-
expressed when marR mutations are carried by E. coli
strains (Wang et al., 2001; Tavı
´oet al., 2010; Watanabe &
Doukyu, 2012) since MarR is a repressor of marRAB
operon and therefore also a repressor of marA expression
(Alekshun & Levy, 1999). The analysis of OMPs revealed
the loss of OmpF only in Caz/20-2 strain, but not in PS/20
ftsI,acrR,marR,sdiA genes in ceftazidime resistance
http://jmm.sgmjournals.org 61
Downloaded from www.microbiologyresearch.org by
IP: 54.210.20.124
On: Fri, 18 Dec 2015 06:36:11
and Caz/20-1, which was concomitant with an increased
level of OmpC and the loss of a band migrating between
OmpC and OmpF (Fig. 1). The loss of OmpF in Caz/20-2
mutant coincided with the above-mentioned frameshift
mutation found in marR (Table 3). The truncated MarR
protein probably lost its repressive function on marRAB
operon, and this resulted in a marA transcript level in Caz/
20-2 mutant 4.3- and 4.2-fold higher than those in AG100
and PS/20, respectively, within the range of previously
described marA increased expression in marR mutants
(Linde et al., 2000). In turn, the increased MarA level in
Caz/20-2 mutant contributed to tolC and acrB over-
expression, and was responsible for OmpF loss due to the
elevation of micF RNA synthesis and the consequent
destabilization of the ompF mRNA, a known effect of MarA
overexpression (Aono et al., 1998; Pomposiello et al.,
2001). Curiously, the induction of Caz/20-2 with NaCl
resulted in increased expression of OmpF and decrease of
OmpC (Fig. 1), which means that synthesis of OmpF in
Caz/20-2 mutant could be upregulated by NaCl indepen-
dently of the presence of marR mutations and MarA
overexpression. Likewise, Caz/20-2 was twofold more
susceptible to 2,4-dinitrophenol than either PS/20 or
AG100 (Table 2); this finding coincides with a previous
description in other in vitro selected mutants (Tavı
´oet al.,
2010), as well as with data obtained in AG100 lon mutant
by Nicoloff et al. (2006). Then it is possible to suggest a
reduced Lon protease activity that, in addition to the marA
gene upregulation due to marR mutation, perhaps could
also contribute to increase the level of MarA in the
cytoplasm of Caz/20-2 strain by slowing the degradation
rate of MarA, since Lon protease degrades MarA and other
cellular proteins (Griffith et al., 2004).
Otherwise, no mutations other than silent nucleotide
substitutions were found in soxR gene in PS/20, Caz/20-1
and Caz/20-2 strains according to GenBank sequence
accession no. U00096.
We previously described the overexpression of sdiA upon
in vitro-selection of ceftazidime-resistant E. coli mutants
(Tavı
´oet al., 2010). In the present study, the transcript
level of the mppA gene showed a significant increase of
3.4- and 9.9-fold in Caz/20-2 compared with its transcript
level in PS/20 and AG100 strains, respectively (Table 4, Fig.
S1), and the same was observed for transcript levels of sdiA,
a 14.5-fold increase compared with that of PS/20 and a
65.6-fold increase with respect to AG100 (Table 4, Fig. S1);
therefore, it is possible that mppA might be upregulated by
sdiA. SdiA indeed accelerates cell division in E. coli (Wei
et al., 2001ab), which results in an increased usage of
peptides derived from murein turnover or recycling (Park
et al., 1998) including those secreted by bacteria into the
growth medium that are poor AmpG substrates (Cheng &
Park, 2002; Maqbool et al., 2011). Therefore, one could
hypothesize that mppA being part of sdiA regulon might be
overexpressed when sdiA accelerates cell division to
improve the uptake of such murein-derived peptides that
cannot be efficiently recovered by AmpG. Likewise, it was
previously proposed that MppA would serve some purpose
other than recycling, perhaps acting also as a periplasmic
binding protein that could mediate signal transduction in
the quorum-sensing response (Park et al., 1998). The
results in the present study seem to indicate that there was
no relationship or dependence between either ampG and
mppA expression or ampG and sdiA expression. In this
regard, despite PS/20, Caz/20-1 and Caz/20-2 strains
showing the same amino acid sequences in AmpG,
including three mutations Ala420Glu, Val436Ile and
Thr491Met, differences in the transcript levels of mppA
and sdiA were observed between PS/20 and Caz/20-2
mutant (Table 4, Fig. S1).
In the present work the frequent appearance of multiple
mutations during in vitro-selection with ceftazidime was
striking and it could be due to the inhibition of PBP3 by
ceftazidime and its previously described relationship with
the production of mutator phenotypes (Pe
´rez-Capilla et al.,
2005; Bla
´zquez et al., 2006). It has been previously
demonstrated that the PBP3 inhibition results in the
arrest of cell-wall synthesis, which, in turn, induces the
transcription of SOS genes and error-prone DNA-poly-
merase, which results in mutator phenotypes that are
overexpressed (Pe
´rez-Capilla et al., 2005; Bla
´zquez et al.,
2006).
The acquisition of possible mutations in QRDR of gyrA,
gyrB,parC and parE genes responsible for the increase in
quinolone MICs in Caz/20-2 with respect to those in PS/20
was also analysed. No mutations other than silent
nucleotide substitutions were found in the amplified
fragments of the gyrA,gyrB and parC genes in PS/20,
Caz/20-1 and Caz/20-2. Nevertheless, two mutations at
12
66 kDa
45 kDa
29 kDa
34 567 8
C
F
A
Fig. 1. Outer-membrane protein extracts separated in a 6 M urea
11 % polyacrylamide gel and stained with Imperial Protein Stain:
size markers, lane 1; PS/20, lane 2; Caz/20-1, lane 3; Caz/20-2,
lane 4; Caz/20-2 grown with NaCl 1.35 %, lane 5; KL16, lane 6;
JF703, lane 7; size markers, lane 8. Size markers from top to
bottom (the thickest bands) correspond to: albumin, bovine serum
(66 kDa); ovalbumin, chicken egg (45 kDa); carbonic anhydrase,
bovine erythrocytes (29 kDa). The position (height) of OmpC,
OmpF and OmpA in the gel are indicated as C, F and A.
M. M. Tavı´o and others
62 Journal of Medical Microbiology 63
Downloaded from www.microbiologyresearch.org by
IP: 54.210.20.124
On: Fri, 18 Dec 2015 06:36:11
codons 443 and 446 were identified in the amplified
fragment of the ParE subunit (covering codons 365 to 525)
from PS/20 and both Caz mutants. They consisted of an
AAC transversion in the codon AAG together with a CAA
transversion in the codon AAC, which resulted in Lys-
443AThr and Asn-446 ALys substitutions, respectively
(Table 3) located outside but adjacent to QRDR of ParE
Asp420 to Lys441, which could result in increases in
nalidixic acid and norfloxacin MICs in Caz/20-2 (Tables 2
and 3) when their effect was multiplied by OmpF loss and
increased active efflux. Along this line, an eightfold increase
in norfloxacin MIC, such as that seen in Ca/20-2 mutant,
was in the range of a previous description where an increase
of 10-fold maximum was the contribution of active efflux to
quinolone MICs (Yang et al., 2003). Furthermore, other
mutations different to the above ones have been also
described outside the ParE QRDR associated with norflox-
acin MICs between 0.047 and 1.5 mgml
21
(Ruiz et al., 1997;
Komp Lindgren et al., 2005; Morgan-Linnell et al., 2009).
In conclusion, a single mutation in acrR and related acrB
overexpression resulted in only a fourfold increase in
ceftazidime MIC in Caz/20-1. Nevertheless, mutations
found in ftsI (PBP3) in both the catalytic penicillin-binding
and N-terminal non-catalytic modules together with OmpF
loss and increased expression (6.1- to 17.8-fold) of one
mono-component and two-component efflux pumps were
in a coordinated way responsible for a 128-fold increase in
ceftazidime MIC in Caz/20-2 mutant in absence of ESBLs
and a high-level production of AmpC beta-lactamase.
ACKNOWLEDGEMENTS
We employed the services of Genetics and Molecular Diagnosis
Service at the University of Las Palmas de Gran Canaria for DNA
sequencing. This work was supported by the Canary Foundation for
Research and Health (40/2009-FUNCIS). The work of V. D. A. was
supported by a grant awarded by the Carolina Foundation (Spanish
Agency for International Cooperation).
REFERENCES
Ahmed, A. M. & Shimamoto, T. (2008). Emergence of a cefepime- and
cefpirome-resistant Citrobacter freundii clinical isolate harbouring a
novel chromosomally encoded AmpC beta-lactamase, CMY-37. Int J
Antimicrob Agents 32, 256–261.
Alekshun, M. N. & Levy, S. B. (1999). Characterization of MarR
superrepressor mutants. J Bacteriol 181, 3303–3306.
Alekshun, M. N., Levy, S. B., Mealy, T. R., Seaton, B. A. & Head, J. F.
(2001). The crystal structure of MarR, a regulator of multiple
antibiotic resistance, at 2.3 A resolution. Nat Struct Biol 8, 710–714.
Aono, R., Tsukagoshi, N. & Yamamoto, M. (1998). Involvement of
outer membrane protein TolC, a possible member of the mar-sox
regulon, in maintenance and improvement of organic solvent
tolerance of Escherichia coli K-12. J Bacteriol 180, 938–944.
Asako, H., Nakajima, H., Kobayashi, K., Kobayashi, M. & Aono, R.
(1997). Organic solvent tolerance and antibiotic resistance increased
by overexpression of marA in Escherichia coli. Appl Environ Microbiol
63, 1428–1433.
Barbosa, A. R., Giufre
`, M., Cerquetti, M. & Bajanca-Lavado, M. P.
(2011). Polymorphism in ftsI gene and b-lactam susceptibility in
Portuguese Haemophilus influenzae strains: clonal dissemination of b-
lactamase-positive isolates with decreased susceptibility to amoxicil-
lin/clavulanic acid. J Antimicrob Chemother 66, 788–796.
Beadle, B. M. & Shoichet, B. K. (2002). Structural bases of stability-
function tradeoffs in enzymes. J Mol Biol 321, 285–296.
Betts, M. J. & Russell, R. (2003). Amino acid properties and
consequences of substitutions. In Bioinformatics for Geneticists, pp.
289–316. Edited by M. R. Barnes & I. C. Gray. Chichester: John Wiley
& Sons, Ltd.
Bla
´zquez, J., Go
´mez-Go
´mez, J. M., Oliver, A., Juan, C., Kapur, V. &
Martı
´n, S. (2006). PBP3 inhibition elicits adaptive responses in
Pseudomonas aeruginosa. Mol Microbiol 62, 84–99.
Caroff, N., Espaze, E., Gautreau, D., Richet, H. & Reynaud, A. (2000).
Analysis of the effects of -42 and -32 ampC promoter mutations in
clinical isolates of Escherichia coli hyperproducing ampC. J Antimicrob
Chemother 45, 783–788.
Cayo
ˆ, R., Rodrı
´guez, M. C., Espinal, P., Ferna
´ndez-Cuenca, F.,
Ocampo-Sosa, A. A., Pascual, A., Ayala, J. A., Vila, J. & Martı
´nez-
Martı
´nez, L. (2011). Analysis of genes encoding penicillin-binding
proteins in clinical isolates of Acinetobacter baumannii. Antimicrob
Agents Chemother 55, 5907–5913.
Cheng, Q. & Park, J. T. (2002). Substrate specificity of the AmpG
permease required for recycling of cell wall anhydro-muropeptides.
J Bacteriol 184, 6434–6436.
CLSI (2006). Methods for Dilution Antimicrobial Susceptibility Tests for
Bacteria that Grow Aerobically; Approved Standard M7–A7, 7th edn.
Wayne, PA: Clinical and Laboratory Standards Institute.
Corvec, S., Caroff, N., Espaze, E., Marraillac, J., Drugeon, H. &
Reynaud, A. (2003). Comparison of two RT-PCR methods for
quantifying ampC specific transcripts in Escherichia coli strains. FEMS
Microbiol Lett 228, 187–191.
Corvec, S., Prodhomme, A., Giraudeau, C., Dauvergne, S., Reynaud,
A. & Caroff, N. (2007). Most Escherichia coli strains overproducing
chromosomal AmpC b-lactamase belong to phylogenetic group A.
J Antimicrob Chemother 60, 872–876.
Curtis, N. A. C., Orr, D., Ross, G. W. & Boulton, M. G. (1979).
Competition of b-lactam antibiotics for the penicillin-binding
proteins of Pseudomonas aeruginosa, Enterobacter cloacae, Klebsiella
aerogenes, Proteus rettgeri, and Escherichia coli: comparison with
antibacterial activity and effects upon bacterial morphology.
Antimicrob Agents Chemother 16, 325–328.
Doi, Y., Wachino, J., Ishiguro, M., Kurokawa, H., Yamane, K., Shibata,
N., Shibayama, K., Yokoyama, K., Kato, H. & other authors (2004).
Inhibitor-sensitive AmpC b-lactamase variant produced by an
Escherichia coli clinical isolate resistant to oxyiminocephalosporins
and cephamycins. Antimicrob Agents Chemother 48, 2652–2658.
Domka, J., Lee, J. & Wood, T. K. (2006). YliH (BssR) and YceP (BssS)
regulate Escherichia coli K-12 biofilm formation by influencing cell
signaling. Appl Environ Microbiol 72, 2449–2459.
Dubus, A., Ledent, P., Lamotte-Brasseur, J. & Fre
`re, J. M. (1996). The
roles of residues Tyr150, Glu272, and His314 in class C b-lactamases.
Proteins 25, 473–485.
Eberhardt, C., Kuerschner, L. & Weiss, D. S. (2003). Probing the
catalytic activity of a cell division-specific transpeptidase in vivo with
b-lactams. J Bacteriol 185, 3726–3734.
Ferna
´ndez-Cuenca, F., Pascual, A. & Martı
´nez-Martı
´nez, L. (2005).
Hyperproduction of AmpC b-lactamase in a clinical isolate of
Escherichia coli associated with a 30 bp deletion in the attenuator
region of ampC. J Antimicrob Chemother 56, 251–252.
ftsI,acrR,marR,sdiA genes in ceftazidime resistance
http://jmm.sgmjournals.org 63
Downloaded from www.microbiologyresearch.org by
IP: 54.210.20.124
On: Fri, 18 Dec 2015 06:36:11
Georgopapadakou, N. H. (1993). Penicillin-binding proteins and
bacterial resistance to b-lactams. Antimicrob Agents Chemother 37,
2045–2053.
Griffith, K. L., Shah, I. M. & Wolf, R. E., Jr (2004). Proteolytic
degradation of Escherichia coli transcription activators SoxS and
MarA as the mechanism for reversing the induction of the superoxide
(SoxRS) and multiple antibiotic resistance (Mar) regulons. Mol
Microbiol 51, 1801–1816.
Jacoby, G. A. (2009). AmpC b-lactamases. Clin Microbiol Rev 22, 161–
182.
Jaurin, B., Grundstro
¨m, T. & Normark, S. (1982). Sequence elements
determining ampC promoter strength in E. coli. EMBO J 1, 875–881.
Keck, W., Glauner, B., Schwarz, U., Broome-Smith, J. K. & Spratt,
B. G. (1985). Sequences of the active-site peptides of three of the high-
Mr penicillin-binding proteins of Escherichia coli K-12. Proc Natl Acad
Sci U S A 82, 1999–2003.
Keeney, D., Ruzin, A., McAleese, F., Murphy, E. & Bradford, P. A.
(2008). MarA-mediated overexpression of the AcrAB efflux pump
results in decreased susceptibility to tigecycline in Escherichia coli.
J Antimicrob Chemother 61, 46–53.
Kern, W. V., Oethinger, M., Jellen-Ritter, A. S. & Levy, S. B. (2000).
Non-target gene mutations in the development of fluoroquinolone
resistance in Escherichia coli. Antimicrob Agents Chemother 44, 814–
820.
Kobayashi, K., Tsukagoshi, N. & Aono, R. (2001). Suppression of
hypersensitivity of Escherichia coli acrB mutant to organic solvents by
integrational activation of the acrEF operon with the IS1 or IS2
element. J Bacteriol 183, 2646–2653.
Komp Lindgren, P., Marcusson, L. L., Sandvang, D., Frimodt-Møller,
N. & Hughes, D. (2005). Biological cost of single and multiple
norfloxacin resistance mutations in Escherichia coli implicated in
urinary tract infections. Antimicrob Agents Chemother 49, 2343–2351.
Lee, A., Mao, W., Warren, M. S., Mistry, A., Hoshino, K., Okumura, R.,
Ishida, H. & Lomovskaya, O. (2000). Interplay between efflux pumps
may provide either additive or multiplicative effects on drug
resistance. J Bacteriol 182, 3142–3150.
Lee, J., Jayaraman, A. & Wood, T. K. (2007). Indole is an inter-species
biofilm signal mediated by SdiA. BMC Microbiol 7, 42.
Linde, H. J., Notka, F., Metz, M., Kochanowski, B., Heisig, P. & Lehn,
N. (2000). In vivo increase in resistance to ciprofloxacin in Escherichia
coli associated with deletion of the C-terminal part of MarR.
Antimicrob Agents Chemother 44, 1865–1868.
Maejima, T., Inoue, M. & Mitsuhashi, S. (1991). In vitro antibacterial
activity of KP-736, a new cephem antibiotic. Antimicrob Agents
Chemother 35, 104–110.
Maqbool, A., Levdikov, V. M., Blagova, E. V., Herve
´, M., Horler,
R. S. P., Wilkinson, A. J. & Thomas, G. H. (2011). Compensating
stereochemical changes allow murein tripeptide to be accommodated
in a conventional peptide-binding protein. J Biol Chem 286, 31512–
31521.
Martı
´nez-Martı
´nez, L., Conejo, M. C., Pascual, A., Herna
´ndez-Alle
´s,
S., Ramı
´rez de Arellano-Ramos, E., Benedı
´, J. & Perea, J. (2000).
Activities of imipenem and cephalosporins against clonally related
strains of Escherichia coli hyperproducing chromosomal b-lactamase
and showing altered porin profiles. Antimicrob Agents Chemother 44,
2534–2536.
Morgan-Linnell, S. K., Becnel Boyd, L., Steffen, D. & Zechiedrich, L.
(2009). Mechanisms accounting for fluoroquinolone resistance in
Escherichia coli clinical isolates. Antimicrob Agents Chemother 53, 235–
241.
Moya
´, B., Beceiro, A., Cabot, G., Juan, C., Zamorano, L., Alberti,
S. & Oliver, A. (2012). Pan-b-lactam resistance development in
Pseudomonas aeruginosa clinical strains: molecular mechanisms,
penicillin-binding protein profiles, and binding affinities. Antimicrob
Agents Chemother 56, 4771–4778.
Nguyen-Diste
`che, M., Fraipont, C., Buddelmeijer, N. & Nanninga, N.
(1998). The structure and function of Escherichia coli penicillin-
binding protein 3. Cell Mol Life Sci 54, 309–316.
Nicoloff, H., Perreten, V., McMurry, L. M. & Levy, S. B. (2006). Role for
tandem duplication and lon protease in AcrAB-TolC- dependent
multiple antibiotic resistance (Mar) in an Escherichia coli mutant
without mutations in marRAB or acrRAB. J Bacteriol 188, 4413–4423.
Nishino, K., Yamada, J., Hirakawa, H., Hirata, T. & Yamaguchi, A.
(2003). Roles of TolC-dependent multidrug transporters of Escherichia
coli in resistance to beta-lactams. Antimicrob Agents Chemother 47,
3030–3033.
Nordmann, P. & Mammeri, H. (2007). Extended-spectrum cephalos-
porinases: structure, detection and epidemiology. Future Microbiol 2,
297–307.
Oteo, J., Navarro, C., Cercenado, E., Delgado-Iribarren, A., Wilhelmi,
I., Orden, B., Garcı
´a, C., Miguelan
˜ez, S., Pe
´rez-Va
´zquez, M. & other
authors (2006). Spread of Escherichia coli strains with high-level
cefotaxime and ceftazidime resistance between the community, long-
term care facilities, and hospital institutions. J Clin Microbiol 44,
2359–2366.
Oteo, J., Cercenado, E., Cuevas, O., Bautista, V., Delgado-Iribarren, A.,
Orden, B., Pe
´rez-Va
´zquez, M., Garcı
´a-Cobos, S. & Campos, J. (2010).
AmpC beta-lactamases in Escherichia coli: emergence of CMY-2-
producing virulent phylogroup D isolates belonging mainly to STs 57,
115, 354, 393, and 420, and phylogroup B2 isolates belonging to the
international clone O25b-ST131. Diagn Microbiol Infect Dis 67, 270–276.
Park, J. T., Raychaudhuri, D., Li, H., Normark, S. & Mengin-Lecreulx,
D. (1998). MppA, a periplasmic binding protein essential for import
of the bacterial cell wall peptide L-alanyl-c-D-glutamyl-meso-
diaminopimelate. J Bacteriol 180, 1215–1223.
Pe
´rez-Capilla, T., Baquero, M. R., Go
´mez-Go
´mez, J. M., Ionel, A.,
Martı
´n, S. & Bla
´zquez, J. (2005). SOS-independent induction of dinB
transcription by beta-lactam-mediated inhibition of cell wall synthesis
in Escherichia coli.J Bacteriol 187, 1515–1518.
Peter-Getzlaff, S., Polsfuss, S., Poledica, M., Hombach, M., Giger, J.,
Bo
¨ttger, E. C., Zbinden, R. & Bloemberg, G. V. (2011). Detection of
AmpC beta-lactamase in Escherichia coli: comparison of three phenotypic
confirmation assays and genetic analysis. JClinMicrobiol49, 2924–2932.
Piette, A., Fraipont, C., Den Blaauwen, T., Aarsman, M. E. G.,
Pastoret, S. & Nguyen-Diste
`che, M. (2004). Structural determinants
required to target penicillin-binding protein 3 to the septum of
Escherichia coli. J Bacteriol 186, 6110–6117.
Pomposiello, P. J., Bennik, M. H. J. & Demple, B. (2001). Genome-
wide transcriptional profiling of the Escherichia coli responses to
superoxide stress and sodium salicylate. J Bacteriol 183, 3890–3902.
Queenan, A. M., Shang, W., Kania, M., Page, M. G. P. & Bush, K.
(2007). Interactions of ceftobiprole with b-lactamases from molecular
classes A to D. Antimicrob Agents Chemother 51, 3089–3095.
Ruiz, J., Casellas, S., Jime
´nez de Anta, M. T. & Vila, J. (1997). The
region of the parE gene, homologous to the quinolone-resistant
determining region of the gyrB gene, is not linked with the acquisi-
tion of quinolone resistance in Escherichia coli clinical isolates.
J Antimicrob Chemother 39, 839–840.
Sa
´nchez-Ce
´spedes, J. & Vila, J. (2007). Partial characterisation of the
acrAB locus in two Citrobacter freundii clinical isolates. Int J
Antimicrob Agents 30, 259–263.
Song, W., Bae, I. K., Lee, Y.-N., Lee, C. H., Lee, S. H. & Jeong, S. H.
(2007). Detection of extended-spectrum beta-lactamases by using
boronic acid as an AmpC beta-lactamase inhibitor in clinical isolates
M. M. Tavı´o and others
64 Journal of Medical Microbiology 63
Downloaded from www.microbiologyresearch.org by
IP: 54.210.20.124
On: Fri, 18 Dec 2015 06:36:11
of Klebsiella spp. and Escherichia coli.J Clin Microbiol 45, 1180–
1184.
Tavı
´o, M. M., Aquili, V. D., Poveda, J. B., Antunes, N. T., Sa
´nchez-
Ce
´spedes, J. & Vila, J. (2010). Quorum-sensing regulator sdiA and
marA overexpression is involved in in vitro-selected multidrug
resistance of Escherichia coli. J Antimicrob Chemother 65, 1178–
1186.
Tracz, D. M., Boyd, D. A., Bryden, L., Hizon, R., Giercke, S., Van
Caeseele, P. & Mulvey, M. R. (2005). Increase in ampC promoter
strength due to mutations and deletion of the attenuator in a clinical
isolate of cefoxitin-resistant Escherichia coli as determined by RT-
PCR. J Antimicrob Chemother 55, 768–772.
Tracz, D. M., Boyd, D. A., Hizon, R., Bryce, E., McGeer, A., Ofner-
Agostini, M., Simor, A. E., Paton, S., Mulvey, M. R. & Canadian
Nosocomial Infection Surveillance Program (2007). ampC gene
expression in promoter mutants of cefoxitin-resistant Escherichia coli
clinical isolates. FEMS Microbiol Lett 270, 265–271.
Tre
´panier, S., Knox, J. R., Clairoux, N., Sanschagrin, F., Levesque,
R. C. & Huletsky, A. (1999). Structure-function studies of Ser-289 in
the class C b-lactamase from Enterobacter cloacae P99. Antimicrob
Agents Chemother 43, 543–548.
Uchida, Y., Mochimaru, T., Morokuma, Y., Kiyosuke, M., Fujise, M.,
Eto, F., Harada, Y., Kadowaki, M., Shimono, N. & Kang, D. (2010).
Geographic distribution of fluoroquinolone-resistant Escherichia coli
strains in Asia. Int J Antimicrob Agents 35, 387–391.
Wang, H., Dzink-Fox, J. L., Chen, M. & Levy, S. B. (2001). Genetic
characterization of highly fluoroquinolone-resistant clinical Escherichia
coli strains from China: role of acrR mutations. Antimicrob Agents
Chemother 45, 1515–1521.
Watanabe, R. & Doukyu, N. (2012). Contributions of mutations in
acrR and marR genes to organic solvent tolerance in Escherichia coli.
AMB Express 2, 58.
Webber, M. A. & Piddock, L. J. V. (2001). Absence of mutations in
marRAB or soxRS in acrB-overexpressing fluoroquinolone-resistant
clinical and veterinary isolates of Escherichia coli. Antimicrob Agents
Chemother 45, 1550–1552.
Wei, Y., Lee, J. M., Smulski, D. R. & LaRossa, R. A. (2001a). Global
impact of sdiA amplification revealed by comprehensive gene
expression profiling of Escherichia coli. J Bacteriol 183, 2265–2272.
Wei, Y., Vollmer, A. C. & LaRossa, R. A. (2001b). In vivo titration of
mitomycin C action by four Escherichia coli genomic regions on
multicopy plasmids. J Bacteriol 183, 2259–2264.
White, D. G., Goldman, J. D., Demple, B. & Levy, S. B. (1997). Role of
the acrAB locus in organic solvent tolerance mediated by expression
of marA, soxS,orrobA in Escherichia coli. J Bacteriol 179, 6122–6126.
Wissel, M. C. & Weiss, D. S. (2004). Genetic analysis of the cell division
protein FtsI (PBP3): amino acid substitutions that impair septal
localization of FtsI and recruitment of FtsN. J Bacteriol 186, 490–502.
Yang, S., Clayton, S. R. & Zechiedrich, E. L. (2003). Relative
contributions of the AcrAB, MdfA and NorE efflux pumps to quinolone
resistance in Escherichia coli. J Antimicrob Chemother 51,545–556.
Yu, W., Bing, L. & Zhenhua, L. (2009). AmpC promoter and
attenuator mutations affect function of three Escherichia coli strains.
Curr Microbiol 59, 244–247.
Zheng, J., Cui, S. & Meng, J. (2008). Effect of transcriptional activators
RamA and SoxS on expression of multidrug efflux pumps AcrAB
and AcrEF in fluoroquinolone-resistant Salmonella Typhimurium.
J Antimicrob Chemother 63, 95–102.
ftsI,acrR,marR,sdiA genes in ceftazidime resistance
http://jmm.sgmjournals.org 65
