Citharichthys darwini n. sp., a new endemic flatfish from the Galápagos Archipelago (Teleostei: Pleuronectiformes: Paralichthyidae)

Abstract

A new flatfish, Citharichthys darwini n. sp., is described from the shores of Isla Isabela on the western side of the Galápagos Archipelago. Our recent collection from Tagus Cove in 1998 is the first record of the species on Isla Isabela since a series of specimens were collected at Tagus Cove and nearby by the Allan Hancock Expedition in 1934. C. darwini is a dwarf species with adults maturing at around 30 mm SL and the largest collected less than 60 mm SL. The new species is distinguished from other eastern Pacific members of the Citharichthys/Etropus group by a narrow body (maximum body width 39–45% SL), medium-sized mouth (upper jaw 31–35% HL), low dorsal and anal fin-ray counts (D 70–75, A 51–58), relatively few slender gill rakers (4–7 upper, 8–10 lower), and non-deciduous scales. The barcode mtDNA COI sequence (used by the Barcode of Life project) for the new species falls within the broad Citharichthys/Etropus clade, but is more than 16% divergent from other Citharichthys in the BOLD barcode database (including most of the known species). The nearest-neighbor sequence in the phenetic tree for paralichthyid flatfishes is an Atlantic species, Citharichthys sp., from the U.S. Virgin Islands. The
species list of flounders and sanddabs (Paralichthyidae) for the Galápagos Islands is revised and expanded to six, including Syacium maculiferum, previously considered a Cocos Island endemic. C. darwini is apparently the only endemic flatfish (Paralichthyidae or Bothidae) in the Galápagos Archipelago. The new species is associated with the cooler water and coarse black volcanic sands of the recently emerged western islands in the chain.

Full text

Journal of the Ocean Science Foundation, vol. 6, no. 1, pp. 19-32, February 2013
Citharichthys darwini n. sp., a new endemic atsh from the Galápagos
Archipelago (Teleostei: Pleuronectiformes: Paralichthyidae)
BENJAMIN C. VICTOR
Ocean Science Foundation, 4051 Glenwood, Irvine, CA 92604 and Guy Harvey Research Institute, Nova South-
eastern University, 8000 North Ocean Drive, Dania Beach, FL 33004. E-mail: ben@coralreefsh.com
GERARD M. WELLINGTON
(retired), Department of Biology and Biochemistry, University of Houston, Houston, TX 77204
Abstract
A new atsh, Citharichthys darwini n. sp., is described from the shores of Isla Isabela on the western side of the
Galápagos Archipelago. Our recent collection from Tagus Cove in 1998 is the rst record of the species on Isla
Isabela since a series of specimens were collected at Tagus Cove and nearby by the Allan Hancock Expedition in
1934. C. darwini is a dwarf species with adults maturing at around 30 mm SL and the largest collected less than
60 mm SL. The new species is distinguished from other eastern Pacic members of the Citharichthys/Etropus
group by a narrow body (maximum body width 39–45% SL), medium-sized mouth (upper jaw 31–35% HL), low
dorsal and anal n-ray counts (D 70–75, A 51–58), relatively few slender gill rakers (4–7 upper, 8–10 lower),
and non-deciduous scales. The barcode mtDNA COI sequence (used by the Barcode of Life project) for the new
species falls within the broad Citharichthys/Etropus clade, but is more than 16% divergent from other Citharich-
thys in the BOLD barcode database (including most of the known species). The nearest-neighbor sequence in the
phenetic tree for paralichthyid atshes is an Atlantic species, Citharichthys sp., from the U.S. Virgin Islands. The
species list of ounders and sanddabs (Paralichthyidae) for the Galápagos Islands is revised and expanded to six,
including Syacium maculiferum, previously considered a Cocos Island endemic. C. darwini is apparently the only
endemic atsh (Paralichthyidae or Bothidae) in the Galápagos Archipelago. The new species is associated with
the cooler water and coarse black volcanic sands of the recently emerged western islands in the chain.
Key words: Galápagos, shes, atsh, sanddab, endemic, new species, Citharichthys darwini, Paralichthyidae,
barcode, DNA sequence, biogeography, species list, biodiversity.
Introduction
The taxonomy of tropical eastern Pacic ounders and sanddabs (Paralichthyidae) was stable for some time
after a series of expeditions in the late 1800s, most notably the Albatross surveys, which resulted in the description
of many of the atshes in the region (Gilbert 1890, Garman 1899). Those expeditions were followed by several
more collections early in the last century that mostly conrmed prior species accounts. In the past two decades,
however, a renewed interest in biodiversity has yielded four new species for the region (Murakami & Amaoka
1992, Hoshino & Amaoka 1999, van der Heiden & Mussot-Perez 1995, van der Heiden & Plascencia Gonzalez
2005), as well as the rediscovery of an old species (van der Heiden & Mitchell 1998).

20
Of the 32 species of paralichthyid atshes in the eastern Pacic Ocean, about a third are temperate northern
species that extend south only to the Baja California peninsula and the adjacent Sea of Cortez and several more
are from cool subtropical waters south of Colombia or Ecuador (Hensley 1995, Robertson & Allen 2008). In gen-
eral, ounders and sanddabs are continental in distribution, paralleling the distribution of soft sediments. The off-
shore islands of the eastern Pacic have mostly hard substrate and are thus particularly depauperate in this family
of atshes, with records of only a few species, mostly wide-ranging and some collected only once or twice on
the offshore islands. Six species are now known for the Galápagos Islands (McCosker & Rosenblatt 2010 and
this study); three species occur on Cocos Island, including one originally described as an endemic (Bussing &
Lopez 2005, Garrison 2005); one or two reach the Islas Revillagigedos and Malpelo Island; and none have been
collected on Clipperton Atoll, the farthest offshore island in the region (Robertson & Allen 2008).
The largest genus in the family Paralichthyidae is Citharichthys, the sanddabs, with nine tropical eastern Pacic
species (now ten), ve of which are found only around the northern subtropics, in Baja California and the adja-
cent Mexican coastline (Robertson & Allen 2008, van der Heiden et al. 2009). Only C. gilberti and C. platophrys
are wide-ranging throughout the region, while Citharichthys mariajorisae van der Heiden & Mussot-Perez 1995
occurs from Southern Mexico to Panama and Citharichthys gnathus Hoshino & Amaoka 1999, described recently
as a Galápagos endemic, is also found in Colombia (van der Heiden et al. 2009).
On a National Geographic Society/National Public Radio-sponsored expedition in May 1998 to the Galápa-
gos Islands, we collected several small Citharichthys in 10–30 m depth while SCUBA diving at Tagus Cove on
the island of Isabela (Albemarle). The sequence of the mtDNA barcode gene, COI, was obtained for a specimen
as part of the campaign to barcode all shes by the Barcode of Life project, Fish-BOL (Ward et al. 2009). The
sequence proved to be in the Citharichthys clade, but not close to any of the several Pacic Citharichthys species
in the BOLD database (including the two widespread species C. gilberti and C. platophrys). The nearest-neighbor
sequence in the phenetic tree, still more than 17% divergent, was Citharichthys sp. from the Atlantic Ocean. The
new specimens did not t the description for the only known Citharichthys in the Galápagos Islands, C. gnathus,
found only on rare patches of deep mud substrate in the archipelago. A subsequent review of museum collection
records revealed that a series of small Citharichthys had been collected at Tagus Cove and nearby on Isla Isabela
during the Allan Hancock expedition on the Velero III in 1934. These old specimens and the new ones we recently
collected matched in morphology and meristics and represent a new species of Citharichthys, apparently endemic
to the Galápagos Archipelago.
Materials and Methods
Type specimens of the new species are deposited in the Marine Vertebrate Collection of the Scripps Institution
of Oceanography (SIO), the Los Angeles County Museum of Natural History (LACM), the California Academy
of Sciences Ichthyology Collection (CAS), and the Smithsonian Institution, National Museum of Natural His-
tory (USNM). The sh from 1998 were collected by hand and immediately preserved in 90% ethanol. Ethanol-
preserved specimens of other species in the Cyclopsetta group of the Paralichthyidae were collected for DNA se-
quencing from the Pacic Ocean in Baja California, Guanacaste in Costa Rica, and from larval samples collected
over the Galápagos hydrothermal vents south of Cocos Island in 1985 (Victor 1987). Comparison species from
the Atlantic were collected for this study in Panama, Belize, Quintana Roo (Mexico), and the U.S. Virgin Islands
(Appendix 1). Comparison sequences from the Barcode of Life Database (BOLD) were graciously provided by
Eduardo Balart of Centro de Investigaciones Biológicas del Noroeste, La Paz, Mexico; Andrew Bentley of the
Ichthyology Division, Biodiversity Institute, University of Kansas; Ralph Imondi of Coastal Marine Biolabs; Ja-
cob Lowenstein of the American Museum of Natural History; and Lourdes Vásquez Yeomans and Martha Valdez
of ECOSUR, Unidad Chetumal, in Quintana Roo, Mexico (Appendix 1).
DNA extractions were performed with the NucleoSpin96 (Machery-Nagel) kit according to manufacturer
specications under automation with a Biomek NX liquid-handling station (Beckman-Coulter) equipped with a
ltration manifold. A 652-bp segment was amplied from the 5′ region of the mitochondrial COI gene using a va-
riety of primers (Ivanova et al. 2007). PCR amplications were performed in 12.5 µl volume including 6.25 µl of
10% trehalose, 2 µl of ultra pure water, 1.25 µl of 10× PCR buffer (10mM KCl, 10mM (NH4)2SO4, 20mM Tris-

21
HCl (pH8.8), 2mM MgSO4, 0.1% Triton X-100), 0.625 µl of MgCl2 (50mM), 0.125 µl of each primer (0.01mM),
0.0625 µl of each dNTP (10mM), 0.0625 µl of Taq DNA polymerase (New England Biolabs), and 2 µl of template
DNA. The PCR conditions consisted of 94°C for 2 min., 35 cycles of 94°C for 30 sec., 52°C for 40 sec., and 72°C
for 1 min., with a nal extension at 72°C for 10 min. Specimen information and barcode sequence data from this
study were compiled using the Barcode of Life Data Systems (BOLD, www.barcodinglife.org; Ratnasingham &
Hebert 2007). The sequence data is publicly accessible on BOLD and GenBank. Sequence divergence was cal-
culated using BOLD with the Kimura 2-parameter (K2P) model generating a mid-point rooted neighbor-joining
(NJ) phenogram to provide a graphic representation of the species divergence.
Measurements follow van der Heiden et al. (2009), with the following clarications: length measurements
are taken from the tip of the upper jaw; all lengths are horizontal spans except the oblique measurements of the
upper jaw and n lengths; upper jaw length is the maximum from the uppermost tip of the eshy lip of the pre-
maxilla to the farthest point on the rear end of the maxilla; orbit lengths are measured from the bony rims since
the preservation of the eye is variable; snout length is the horizontal span before the anterior margin of the bony
orbit of the upper eye; interorbital width is the bony width; pored lateral line scale counts are from the scale just
above the end of the opercular opening to the last over the hypural plate, not counting additional pored scales on
the caudal n; dorsal and anal n-ray counts include each of the last rays counted individually; vertebral counts
include the urostylar centrum.
Citharichthys darwini, n. sp.
Figures 1–4.
Holotype. SIO 12-3075 (1) 33.3 mm SL, Ecuador, Galápagos Islands, Isla Isabela, Tagus Cove (-0.26°,
-91.37°), B. Victor, G. Wellington, & C. Caldow, May 28, 1998.
Paratypes. SIO 12-3076 (2) 33.4–39.1 mm SL, same as holotype; LACM 57426-1 (1) 32.7, same as holotype;
LACM 23671 (8) 33.4–42.4 mm SL, Ecuador, Galápagos Islands, Isla Isabela, Tagus Cove (-0.26°, -91.37°), Al-
lan Hancock Expedition, prob. Jan. 13–15, 1934 (in LACM catalog as Jan. 10, but the Expedition was in transit
and only arrived in Galápagos on Jan. 11 according to the Fraser (1943) itinerary); CAS 6895 (5) 20.8–49.3 mm
SL, Ecuador, Galápagos Islands, Isla Isabela, Tagus Cove (-0.26°, -91.37°), Allan Hancock Expedition, Jan. 15,
1934; CAS 6862 (8) 19.3–50.2 mm SL, Ecuador, Galápagos Islands, prob. Isla Isabela, Albemarle Point (0.15°,
-91.38°), Jan. 12, 1934 (in CAS catalog as “Charles Island, Jan. 12 1934”, but the expedition did not reach Charles
Island (Floreana) until Jan. 16, 1934 (Fraser 1943), on Jan. 12 the expedition was at Albemarle Pt. and the Field
Number in the catalog is, appropriately, HE 12-I-1934); USNM 101970 (4) 48.8–59.6 mm SL, Ecuador, Galápa-
Figure 1. Citharichthys darwini, holotype, 33.3 mm SL, male, SIO 12-3075.

22
gos Islands, Isla Isabela, Tagus Cove (-0.26°, -91.37°), Allan Hancock Expedition, Jan. 15, 1934; USNM 101896
(2) 43.6–45.5 mm SL, Ecuador, Galápagos Islands, Isla Isabela, Tagus Cove (-0.26°, -91.37°), Allan Hancock
Expedition, Dec. 10, 1934.
Diagnosis. A small narrow-bodied species of Citharichthys, sharing the characters for the genus, i.e. a mostly
straight lateral line, apparently uniserial and even-sized teeth, relatively long thin gill rakers without serrations,
urogenital papilla on the blind side, asymmetric pelvic n placement with ocular-side n-base along ventral mid-
line (i.e. the Cyclopsetta group sensu Hensley and Ahlstrom 1984), and a medium-sized mouth with upper-jaw
length greater than 30% HL (vs. less in Etropus). Citharichthys darwini is distinguished from congeners by low
n-ray counts, D 70–75 A 51–58; low numbers of slender gill rakers, 4–7+8–10 (usually 6+9 or 6+10); a narrow
body, maximum body width in adults 39–45% SL; low numbers of pored lateral line scales, 41–42; 10+25 verte-
brae; and rmly attached (non-deciduous) scales.
Description. (range listed for variously included paratypes, depending on condition, with holotype in paren-
theses) Body at and left-sided, elongate and oval, upper-body prole low, i.e. outline mostly symmetrical around
lateral midline, maximum body width slightly forward of midbody, more than twice into SL, 37–45 (40)% SL
(45% only in largest paratype, 42% maximum in types from 30 to 42 mm SL and 37% in 21.7 mm SL); lateral
line mostly straight along the lateral midline but with a gradual slight curve above pectoral n; caudal peduncle
width 11–12 (11)% SL, caudal peduncle length (dorsal) 3–4 (4)% SL.
Head relatively small 24–29 (27)% SL; dorsal head prole mostly smooth with only slight notch in front
of upper eye; dorsal head prole low, sloping gradually, maximum head depth (measured at the rear end of the
operculum) 31–37 (37)% SL; eyes large with prominent rounded corneal tab over pupil (pupillary operculum),
lower eye slightly forward of upper eye; upper orbit length 31–35 (34)% HL; interorbital space very narrow 2–3
(3)% HL; interorbital ridge moderately developed; snout short 13–18 (18)% HL; lower free preopercular margin
straight, almost parallel to body axis, corner of preopercle smoothly curved, forming about right angle and corner
well behind vertical at rear margin of eyes; no eshy tabs or tentacles along preopercular or opercular margins on
either ocular or blind side. Mouth medium; jaws mostly straight and parallel to head outline, no angle formed in
maxillary or mandibular outline, only a slight indentation in the anterior cranial margin overlying upper jaw; rear
end of maxilla extending to vertical through anterior quarter of orbit and below horizontal through lower edge of
eye, length of upper jaw 31–35 (34)% HL; small bump below mandibular symphysis. Teeth caniniform to trian-
gular, apparently uniserial (without dissection), small but stout, uniformly sized, movable (bend inward), extend
full length of jaw on blind side, sometimes less than half length along ocular-side jaws.
Dorsal-n rays 70–75, mode 72 (72); anal-n rays 51–58, mode 56 (56); pectoral-n rays on ocular side
10–11 (11), on blind side 8–9 (8); ocular-side pectoral n 15–19 (15)% SL; blind-side pectoral n 12–14 (14)%
SL; pelvic-n insertion asymmetrical with blind-side n attached along ventral midline in advance of insertion of
ocular-side n, pelvic ns with 6 rays each (6), ocular-side pelvic n 10–11 (11)% SL; blind-side n 12–14 (12)%
SL; caudal n truncate, caudal-n length 10–11% SL; 17 caudal-n rays, rare 16. Vertebrae 10+25 (6 specimens).
Figure 2. Citharichthys darwini, paratype, USNM 101896, radiograph courtesy Sandra Raredon, USNM.

23
Figure 3. Citharichthys darwini, holotype, 33.3 mm SL, male, SIO 12-3075.
Scales medium-sized, extending over entire body and head except snout, becoming distinctly smaller over
pterygiophore zone near body edges (Fig. 3), moderately ctenoid to a few cycloid on ocular side, no secondary
scales (but largest paratype has occasional small secondary scale apparent around lateral line on posterior body),
cycloid on blind side; lines of small strongly ctenoid scales along lower portions of dorsal, anal, and caudal-n
rays, all scales rmly attached (no loss of scales on any types from 1998 collection); pored lateral-line scales on
body 41–42 (39), plus up to 6 pored scales along the middle caudal-n ray (scales intact for accurate counts pri-
marily from 1998 specimens; pored series begins above end of opercular opening, with scale after pore in black
spot, up to end of hypural plate, followed by several pored scales along caudal-n rays not included in lateral-line
counts). Urogenital papilla on blind side near anal n origin, simple papilla on females, cone with accessory aps
in a eur-de-lis form in males.

24
Gill rakers on rst arch medium-length and slender, without
serrations, longest about half pupil diameter; upper limb 4–7,
mode 6; lower limb (including rudiments and corner) 8–10, mode
10 (rare 8); total 12–17, mode 15 (Fig. 4).
Color in alcohol. Live colors not documented. Specimens
placed directly into ethanol retain their marking pattern; the
specimens from 1934 are variably marked, some similar to newer
specimens (CAS 6895), some retaining mostly white markings
(CAS 6862), and the remainder uniformly museum-brown with
few remaining markings. For the newer specimens, the pattern on
the ocular side of the body is mottled brown and pale, the outer
edges of the scales within the brown patches are clearly outlined
with dark pigment. There are a series of about 8 white or light
spots about the size of the pupil arrayed along the body adjacent
to the dorsal midline and about 6 near the ventral midline, as
well as iridescent white patches on the rear interorbital and on
the body facing and below the pectoral n. The darkest patches
amongst the mottling are along the lateral line, usually a patch
just behind the mid-body followed by a light area and then one
or two more dark patches before a dark patch on the base of the
caudal n (the sh in the 1934 collection from Albermarle Point
(CAS 6862) have more intense white markings and reduced dark
markings and likely reect the patterning of individuals found on
white or mixed sands, although preservation artifact cannot be
excluded). The ocular-side pectoral n has dark patterning (not bands) including dark patches at the distal end of
the upper (longest) n rays and at the base of the three lower n rays. The blind side is mostly uniformly light,
except for some brown patterning on the underside of the jaws, the edge of the snout, a few patches along the
body near the edges, and sometimes the urogenital papilla. Several small round deep internal melanophores are
sometimes visible from the blind side in the body musculature near the base of the pterygiophores along the dorsal
and anal ns and in a row or streak along the posterior midline of the underside.
Barcode DNA sequence. A 652-nucleotide sequence of the section of the mitochondrial COI gene used for
barcoding by the BOLD informatics database (Ratnasingham & Hebert 2007) was obtained for the holotype
(Genbank accession number JX516097). Following the database management recommendation of the BOLD the
sequence of the holotype is presented here as well:
CCTGTATCTAGTATTCGGTGCCTGAGCCGGTATAGTTGGAACGGCATTAAGCCTTCTCATCCGAGCC-
GAACTTAGTCAACCTGGAGCCCTTCTAGGAGACGACCAAATTTACAATGTAATCGTTACCGCA-
CATGCATTCGTAATGATTTTCTTTATAGTAATGCCCATTATGATTGGGGGCTTTGGAAACTGATTA-
ATTCCCCTTATGATCGGAGCCCCTGATATAGCTTTTCCACGAATAAATAATATGAGTTTCTGAC-
TACTGCCTCCTTCTTTCCTTCTCCTTTTAGCATCTTCGGGTGTCGAAGCAGGGGCAGGAACAG-
GCTGAACAGTTTATCCCCCACTAGCAGGAAATCTTGCCCACGCAGGAGCATCCGTAGACCTAAC-
GATCTTCTCCCTTCATCTTGCAGGTATTTCCTCTATTTTAGGAGCAATCAACTTTATTACAACCATTAT-
TAATATGAAGCCAAACTCCGTCACAATGTACCAAATCCCTCTTTTCGTATGAGCTGTCCTTATTACT-
GCAGTACTACTCCTCCTCTCTCTACCAGTACTTGCTGCAGGTATCACCATGCTACTAACAGACC-
GAAACCTAAATACAACTTTCTTTGACCCGGCAGGGGGAGGAGATCCTATTCTATATCAACACCTG
Etymology. The new species is named for Charles Darwin, who spent an “overpoweringly hot” October 1,
1835 exploring Tagus Cove and hiking into the Beagle Crater just south of the bay (quote from The Voyage of the
Figure 4. Citharichthys darwini, slender gill rakers on rst arch.

25
Beagle). Furthermore, the description serves as a somewhat belated recognition of the 150th anniversary of the
publication of The Origin of Species in London in October 1860, mitigated to some small degree by the knowl-
edge that the dilatory nature of the endeavor would not be particularly foreign to Darwin’s sensibilities. The com-
mon name of Darwin’s Sanddab is proposed.
Comparisons. The combination of low dorsal and anal n-ray counts and low numbers of gill rakers distin-
guishes C. darwini from virtually all other Citharichthys species. The only eastern Pacic congener with n-ray
counts almost as low is C. gordae, which broadly overlaps the count for C. darwini (i.e. C. gordae mode of D
75 (72–79) and A 58 (53–62)), however the dorsal-n count is generally higher and it has many more gill rakers
(6–10 + 16–19) (van der Heiden et al. 2009). Most eastern Pacic Citharichthys have more gill rakers than C.
darwini, only C. stigmaeus and C. platophrys share the 10 or fewer on the lower limb of the rst arch. According
to van der Heiden et al. (2009), some congeners, including C. fragilis, C. gordae, and C. mariajorisae, have de-
ciduous or partially deciduous scales vs. rmly attached in C. darwini. In addition, C. mariajorisae has a notably
wider body, with the maximum body width greater than 50% SL (van der Heiden & Mussot-Perez 1995).
Among Pacic congeners, C. darwini is closest in appearance and morphology to C. platophrys, which shares
the low gill-raker count. In the key for eastern Pacic Citharichthys by van der Heiden (2009), C. darwini would
key out to the line describing C. platophrys. There is a small overlap in dorsal and anal n-ray counts; the low-
est end of the range for C. platophrys (D 73–84, A 57–65; van der Heiden et al. 2009) coincides with the upper
limit for C. darwini. Nevertheless, the DNA barcode sequences for the two species are 16.1% divergent and the
lineages are about as distant from each other as they are from other congeners from both sides of the isthmus
of Panama. Meristics clearly distinguish C. darwini from the known species of Citharichthys from the Atlantic
Ocean. Hoshino et al. (2004) collated the counts for the genus from the Western Atlantic and, although several
species share the low n-ray counts of C. darwini, only C. minutus also has as few gill rakers; it can be distin-
guished from C. darwini by having many fewer lateral-line scales (34–36), as well as differing by 18.2% in the
barcode DNA sequence.
The genus Etropus is very close to Citharichthys and the separation has been questioned for some time
(Parr 1931, Leslie & Stewart 1986). Indeed, the barcode DNA sequences of some Etropus species fall within
the Citharichthys clade (see below), although a phylogenetic study with more species and multiple genes is
needed. C. darwini, like most Citharichthys, is separated
from Etropus by a larger mouth; species of Etropus are
characterized by a small mouth with the upper jaw length
less than 30% HL and often the anterior cranial margin
overlying the short upper jaw notably indented. Neverthe-
less, some species assigned to Citharichthys have small
mouths, such as C. arctifrons (Parr 1931) and C. minu-
tus (Cervigon 1996). Etropus species generally share low
gill-raker counts with C. darwini although the gill rakers
are described as stout or broad-based.
Among the eastern Pacic Etropus, both E. ciadi,
with D 66–79 (mode 73) and A 52–62 (mode 57), and
E. delsmani pacicus, with D 71–77 (mode 75) and A
53–62 (mode 58), overlap the n-ray counts for C. dar-
wini (van der Heiden & Plascencia Gonzalez 2005 and
Nielsen 1963, respectively). E. delsmani pacicus dif-
fers in the generic character of a smaller mouth (24–30%
HL; Nielsen 1963), along with a pronounced indentation
in the anterior cranial margin overlying the short upper
jaw (Fig. 5). The dorsal prole rises more sharply and the
operculum is expanded to cover more of the cheek than
Figure 5 (right). Etropus delsmani pacicus, USNM 383307,
Coiba, Panama. Photograph courtesy Sandra Raredon, USNM

26
the preoperculum, resulting in a distinctly wider head. These morphological differences can be quantied as fol-
lows (E. delsmani pacicus vs. C. darwini respectively): rst, the upper jaw length is less than the orbit diameter
and much less than the horizontal span from the corner of the preoperculum to the edge of the operculum vs. equal
or greater; and second, the body width at the end of the head is 39–43% SL (vs. 31–37%)(Fig. 6). In addition, E.
delsmani pacicus is slightly wider (on my measure from photographs of 4 types and a new specimen, USNM
383307) with a maximum body width from 43–46% SL (vs. 39–42% SL in the same size range), has fewer gill
rakers (6–8 lower limb vs. 8–10), and does not have the sharp change in scale size near the body edges. They also
appear to have deciduous scales and are found in deeper (45m) mud sediments along the coast of South America
(Nielsen 1963). E. ciadi can be quickly distinguished by a wider body (>50% SL) and obviously deciduous scales
(van der Heiden & Plascencia Gonzalez 2005).
DNA analysis. Most of the New World species comprising the Cyclopsetta group of paralichthyids have now
been sequenced by various contributors to the Barcode of Life project. Almost all of the Citharichthys species
are included, although a few lineages have only tentative specic identications. In the neighbor-joining phenetic
tree (generated by BOLD) of Citharichthys and Etropus (with Syacium and Cyclopsetta as outgroups), the near-
est neighbor to C. darwini (i.e. sharing the same clade) is a juvenile Citharichthys sp. collected in the U.S. Virgin
Islands, in the Atlantic (Fig. 7). There is, nevertheless, a large 17.8% sequence difference between the two species.
Neighbor-joining trees as generated in BOLD are based on a clustering model (Ratnasingham & Hebert 2007) in
which the nearest neighbor is not always the closest sequence in a simple similarity measure (as in the BLAST
similarity model used by GenBank) or a probability-based model (such as the Hidden Markov model used in
BOLD in the ID engine for shes). Two sequences can have the same percent similarity in the sequence to a test
sequence but may or may not cluster on the same branch of the tree assembled with a neighbor-joining model. In
this case, C. platophrys is marginally more similar based on the simple similarity percentage, but is not as close
as the USVI Citharichthys sp. in the phenetic tree.
Discussion. There are notably few museum records of paralichthyids from the Galápagos Islands and almost
all are small specimens with tentative identications. Upon review, it appears that many are C. darwini collected
during the Allan Hancock Expedition of 1934 and subsequently divided up among the USNM, SIO, and CAS
collections. The several additional museum specimens are small and often in poor condition; given the difculty
in distinguishing even genera in juvenile paralichthyid shes, no rm identication can be made for them in the
absence of DNA sequencing (not feasible in formalin-preserved specimens).
Previous surveys and listings of the shes of the Galápagos Islands have not reported the Allan Hancock Ex-
pedition’s collections of Citharichthys on Isla Isabela. Grove and Lavenberg (1997) list only three paralichthyid
Figure 6. Etropus delsmani pacicus holotype, ZMUC P-853137, Islas Perlas, Panama. Photograph courtesy Marcus Krag,
Natural History Museum of Denmark.

27
Figure 7. The neighbor-joining tree based on the COI mtDNA sequences of New World Citharichthys, Etropus, Cyclop-
setta, and Syacium (the Cyclopsetta group of paralichthyid atshes), following the Kimura two-parameter model (K2P)
generated by BOLD (Barcode of Life Database). The scale bar at left represents a 2% sequence difference. Collection loca-
tions for specimens are indicated and C. darwini is highlighted with an asterisk. GenBank accession numbers and collection
data corresponding to the sequences in the tree are listed in Appendix 1.
C. arenaceus Atlantic Panama
C. arenaceus Atlantic Panama
C. gilberti El Salvador
C. gilberti El Salvador
C. spilopterus Atlantic Panama
C. spilopterus Atlantic Panama
C. spilopterus Atlantic Panama
C. fragilis Baja California
C. fragilis Baja California
C. sordidus California
C. sordidus California
C. sordidus California
C. xanthostigma California
C. xanthostigma California
C. cornutus Texas
C. darwini n. sp. Galápagos Islands
Citharichthys sp. a US Virgin Islands
Citharichthys sp. a US Virgin Islands
C. platophrys Galápagos Rift vent
C. platophrys Galápagos Rift vent
C. platophrys Galápagos Rift vent
C. dinoceros? Atlantic Mexico
C. gymnorhinus? Belize
C. minutus Atlantic Panama
C. minutus Atlantic Panama
C. stigmaeus Puget Sound, WA
C. stigmaeus Puget Sound, WA
C. arctifrons Virginia
Etropus microstomus Virginia
C. macrops Atlantic Mexico
Cyclopsetta panamensis Galápagos Rift vent
Cyclopsetta chittendeni Texas
Cyclopsetta querna Pacic Costa Rica
Syacium gunteri Atlantic Panama
Syacium micrurum Belize
Syacium maculiferum Galápagos Rift vent
Syacium papillosum Belize
Syacium papillosum Atlantic Mexico
Syacium papillosum Belize
*
0.02

28
species (before the recognition of C. gnathus in 1999), including Paralichthys woolmani, Syacium ovale, and C.
gilberti. The latter two are misidentied. The S. ovale record cited (LACM 44012) is Syacium latifrons by exami-
nation (see illustration by Richard Feeney, p. 860 in Grove and Lavenberg (1997)); i.e. the large male specimen
has widely-separated eyes, D-87, A-70, and 8 lower-limb gill rakers, diagnostic for S. latifrons according to Mu-
rakami and Amaoka (1992) and van der Heiden and Mitchell (1998). The C. gilberti listing was decided by Grove
and Lavenberg (1997) by process of elimination from the only two known tropical species at the time, based
solely on a set of Citharichthys larvae collected off the Galápagos Islands by the Eastropac surveys in 1966 (Ahl-
strom 1972). Those larvae were early stage and could not be identied to species (William Watson and Andrew
Thompson, pers. comm.), but were noted in Grove and Lavenberg (1997) to have two extended dorsal n spines
compared to the three diagnostic for C. platophrys, and were assigned to C. gilberti based on that exclusion. They
likely represent C. darwini or C. gnathus, the two species now known from the Galápagos Archipelago.
More recently, McCosker and Rosenblatt (2010) list four paralichthyid species for the Galápagos Islands, re-
taining P. woolmani and S. ovale and adding a widespread eastern Pacic ounder, Hippoglossina bollmani, and
the newly recognized C. gnathus. Interestingly, all 19 of the H. bollmani records from the Archipelago (USNM
362263) were collected on the same day at the same trawl station (Anton Bruun Survey 791C, Sep. 21, 1966) as
the type specimens (and only known collection) of C. gnathus in the Galápagos Islands (USNM 337310–337311;
Hoshino & Amaoka 1999). That particular location has been recorded in Fraser (1943, p. 290) as one of the rare
deep mud bottoms present in the Galápagos Islands: i.e. “mud and shell, between Daphne and Seymour at 55
fathoms”. The location of that trawl is listed as 95 m depth and from 0° 36’ S to 0° 27’ S in Hoshino and Amaoka
(1999); however, with those coordinates the trawl starts on land on Isla Santa Cruz- the corrected coordinates
should be 0° 26’ S to 0° 27’ S. Clearly, mud-associated continental species can be found when suitable habitat
is available on the offshore islands. Another specimen of possible H. bollmani was collected by John McCosker
on the Johnson Sea Link in 1995 at 300m off Isla Floreana (the coordinates in the CAS catalog for CAS 86410
indicate Devil’s Crown on Floreana; not “off Isla Espanola” as listed), but its taxonomic status remains uncertain
(McCosker & Rosenblatt 2010). In the most recent online checklist for Galápagos shes, Tirado et al. (2013) list
only C. gnathus, H. bollmani, and P. woolmani (and S. ovale under Bothidae).
Another small atsh specimen (CAS 2984) not reviewed for prior species lists was collected in the Galápa-
gos Islands by the Templeton Crocker Expedition (TCE 3723= CAS 2984–3085) on June 4, 1932, and it possesses
serrated wide-based gill rakers consistent with Syacium. The 80.2 mm SL specimen has large eyes with the lower
eye in advance of the upper, narrowing the identication to the widespread S. latifrons vs. S. maculiferum, the
latter described as a Cocos Island endemic (Murakami & Amaoka 1992, van der Heiden & Mitchell 1998). The
n-ray count of D-86 and A-68 falls in the overlapping range between S. latifrons and S. maculiferum. The front-
half body outline is distinctly more curved ventrally than dorsally (i.e. a low dorsal prole), a characteristic of S.
maculiferum. In addition, the specimen has 9 lower-limb gill rakers on the rst arch on both sides, a diagnostic
feature for separating the two species (van der Heiden & Mitchell 1998). It is not surprising that S. maculiferum
can reach the Galápagos Islands, since Cocos Island is the nearest offshore island in the region and I have col-
lected numerous early-stage S. maculiferum larvae, identied by n-ray counts and DNA barcoding, from the
ocean over the Galápagos hydrothermal vents, located about 500 km south of Cocos Island and 350 km east of the
Galápagos Archipelago (unpublished data; Victor 1987).
A review of museum records also revealed a set of late-stage Citharichthys/Etropus larvae collected off the
southern Galápagos Islands by A. Ebeling on Nov. 28, 1955 (ET-H-60) about 80 km SSW of the island of Floreana
(SIO-55-258). The larvae are in relatively good condition and are clearly paralichthyid larvae (Moser & Sumida
1996, Lyczkowski-Shultz & Bond 2006). They do not belong to the Syacium/Cyclopsetta group since they are
missing the diagnostic horn-like cranial spines and ornate spikes at the corner of the preoperculum. They have the
characters of the Citharichthys/Etropus group, i.e. limited body pigmentation with melanophores over the hindgut
and cleithral symphysis, a melanophore streak along the posterior notochord, widely spaced melanophore streaks
along the base of the dorsal and anal n pterygiophores (spreading distally), a streak along a posterior myoseptum,
small spines in irregular rows on the preoperculum, as well as some elongation of the rst few dorsal-n rays.
The 1955 larvae do not match the known larvae of any of the northern species described in Moser and Sumida
(1996) or the descriptions of the tropical species C. platophrys or C. gilberti (Moser & Sumida 1996, Beltrán-

29
Leon & Herrera 2000), in particular not sharing the obvious tail bar of those species. Larvae of some Atlantic
species of Citharichthys also have a single streak at that location, as do larvae of Etropus crossotus, the only
eastern Pacic member of Etropus with described larvae (Moser & Sumida 1996, Beltrán-Leon & Herrera 2000,
Lyczkowski-Shultz & Bond 2006). However, the Galápagos larvae differ in several ways from the described lar-
vae of E. crossotus: they are more deep-bodied, are missing the melanophore at the pectoral axil, have only two
widely separated pigment patches, about 20 rays apart, along the base of the anal-n pterygiophores (vs. rows of
melanophores along the bases of the anal-n pterygiophores as well as along the insertion line of the rays), and
have melanophores in a vertical collection over the hindgut (vs. horizontal along the ventral abdominal margin).
The larvae from 1955 have a n-ray count of D-87 and A-67, higher than that of most of the species in the group
and excluding many, especially C. darwini, nevertheless the count does overlap the uppermost range for several
species: i.e. E. crossotus, C. gnathus, C. mariajorisae, the southernmost-populations of C. gilberti, and slightly
exceeds the range reported for Etropus peruvianus (van der Heiden & Mussot-Perez 1995, Hoshino & Amaoka
1999, van der Heiden & Plascencia Gonzalez 2005). Since C. gilberti larvae are reported to have a prominent
tail bar, these larvae are not likely to be C. gilberti. Without fully matching n-ray counts and given that several
regional species are without larval descriptions, their species identity remains unknown and C. gnathus cannot be
excluded.
There are now six species of paralichthyid atshes conrmed from the Galápagos Islands, yet only one, P.
woolmani, is routinely encountered in surveys. C. gnathus and H. bollmani are found only on the scarce deep
mud substrate in the Archipelago, S. latifrons and S. maculiferum are apparently rare with a single record each,
and the new species, C. darwini, is documented only on Isla Isabela. This curious distribution for the new species
may be related to the distinctive oceanographic conditions that develop on the western edge of the Galápagos Ar-
chipelago. The islands of Fernandina and Isabela are directly over the Galápagos hotspot and both have recently
active volcanoes and are exceptionally dry. In addition, extensive local upwelling of colder deep water occurs
seasonally in the area. This unusual combination of colder water and particularly light erosion sedimentation
due to low precipitation and rocky shores (Edgar et al. 2004) creates a distinctive habitat. Tagus Cove itself is a
breached tuff cone and is characterized by coarse black sands (Glynn & Wellington 1983). Areas of upwelling and
cool water elsewhere in the eastern Pacic are typically near continental shores with a heavy sedimentation load
and, concomitantly, a much ner substrate.
Other Material Examined. USNM 43424, Paralichthyidae, (1) Ecuador, Galápagos Islands, off Gardner
(-1.35°, -89.65°), Albatross, trawl, 37m, Apr. 7, 1888 (catalogued as C. gilberti); USNM 362518/9, Paralichthy-
idae, (5) Ecuador, Galápagos Islands, Isla Santiago, west side (-0.20°, -90.85°), trawl 794E, 34m, Dec. 10, 1934
(catalogued as Syacium sp., but n-ray counts are below the range for Syacium spp.); LACM 44012, Syacium
latifrons (1) 202 mm SL, Ecuador, Galápagos Islands, Isla Isabela, Tagus Cove; CAS 2984, Syacium maculiferum
(1) 80.2 mm SL, Ecuador, Galápagos Islands, Isla Santiago, James Bay; SIO 55-258, Paralichthyidae (4 larvae)
9.5–10.5 mm SL, Ecuador, Galápagos Islands, 80 km. SSW of Floreana.
Acknowledgments
I am truly indebted to Gerard M. Wellington for his contributions as a friend, colleague, and collaborator
over the decades. He is a coauthor on this paper, but due to his failing health was not able to participate beyond
the initial collections. He helped pioneer the plan for the Parque Nacional Galápagos as a member of the Peace
Corps in the 1970s and always considered that one of his most important accomplishments. Eliecer Cruz, Ro-
drigo Bustamante, Fernando Rivera, and Robert Bensted-Smith of the Galápagos National Park Service and the
Charles Darwin Research Station graciously granted permissions and facilitated the project. I would like to thank
Chris Caldow for his assistance and camaraderie in the Galápagos and elsewhere over the years. The National
Geographic Society sponsored the expedition and both Alex Chadwick of National Public Radio and the late Pe-
ter Benchley were instrumental in arranging the program as well as making enormously amusing shipmates. H.J.
Walker and Philip Hastings at the Scripps Institution of Oceanography Marine Vertebrate Collection, as well as
Richard Feeney of the Los Angeles County Museum of Natural History, were exceptionally helpful. Fiddie An-
germeyer and the crew of the Samba provided exceptional service in the Archipelago. Mahmood Shivji and Ross

30
Robertson made the expeditions to other collecting locations possible and the cooperation of Richard Nemeth and
the MacLean Marine Science Center at the University of the Virgin Islands is greatly appreciated. Comparison
specimens and sequences were contributed by Eduardo Balart, Andrew Bentley, Lucia Campos, Ralph Imondi,
Jacob Lowenstein, Cormac Nolan, Martha Valdez, and Lourdes Vásquez-Yeomans. Photographs and radiographs
were generously provided by Sandra Raredon, Division of Fishes, Smithsonian Institution and Marcus Krag of the
Natural History Museum of Denmark. Also appreciated are the comments of Sergei Evseenko, Kouichi Hoshino,
H.G. Moser, Dirk Steinke, Andrew Thompson, A. van der Heiden, and William Watson. George Walsh and Walsh
Paper Distribution, Inc. of Westminster, CA kindly sponsored preparation and publication of the project. The
DNA barcoding was performed at the Biodiversity Institute of Ontario with the support of Bob Hanner and the
team at BOLD. DNA barcoding was supported by the International Barcode of Life Project (iBOL.org) with
funding from the Government of Canada via the Canadian Centre for DNA Barcoding as well as from the Ontario
Genomics Institute (2008-OGI-ICI-03), Genome Canada, the Ontario Ministry of Economic Development and
Innovation, and the Natural Sciences and Engineering Research Council of Canada.
References
Beltrán-Leon, B. S. & Herrera, R. R. (2000) Estadios tempranos de Peces del Pacico Colombiano. Instituto
Nacional de Pesca y Acuicultura (INPA). Buenaventura, Colombia, 727 pp.
Bussing, W. A. & Lopez, M. I. (2005) Fishes of Cocos Island and reef shes of the Pacic coast of lower Central
America. Revista de Biologia Tropical, 53, 1–192.
Cervigón, F. (1996) Los peces marinos de Venezuela vol. 4. Fundación Cientíca, Los Roques, Venezuela, 255 pp.
Edgar, G.J., Banks, S., Farina, J.M., Calvopina, M. & Martinez, C. (2004) Regional biogeography of shallow
reef sh and macro-invertebrate communities in the Galápagos archipelago. Journal of Biogeography, 31,
1107–1124.
Fraser, C. M. (1943) General account of the scientic work of the Velero III in the eastern Pacic, 1931–1941,
Part III: A ten-year list of the Velero III collecting stations. Allan Hancock Pacic Expeditions, 1 (3), 259–424.
Garman, S. (1899) Reports on an exploration off the west coasts of Mexico, Central and South America, and off
the Galápagos Islands in charge of Alexander Agassiz, by the U.S. Fish Commission Steamer ‘Albatross’ dur-
ing 1891, Lieut. Commander Z. L. Tanner, U.S.A. commanding. XXVI. The Fishes. Memoirs of the Museum
of Comparative Zoology, 24, 1–431.
Garrison, G. (2005) Peces de la Isla del Coco / Isla del Coco Fishes. 2nd Ed. Instituto Nacional de Biodiversidad,
Santo Domingo de Heredia, Costa Rica, 430 pp.
Gilbert, C. H. (1890) Scientic results of explorations by the U.S. Fish Commission Steamer Albatross. XII. A
preliminary report on the shes collected by the Steamer Albatross on the Pacic coast of North America dur-
ing the year 1889, with descriptions of twelve new genera and ninety-two new species. Proceedings of the
United States National Museum, 13, 49–126.
Glynn, P.W. & Wellington, G.M. (1983) Corals and coral reefs of the Galápagos Islands. University of California
Press, Berkeley, California, 332 pp.
Grove, J.S. & Lavenberg, R.J. (1997) The Fishes of the Galápagos Islands. Stanford University Press, Stanford,
California, 863 pp.
Hensley, D. A. (1995) Paralichthyidae Lenguados. In: Fischer, W., Krupp, F., Schneider, W., Sommer, C., Car-
penter, K. E. & Niem, V. H. (Eds.), Guía FAO para la Identicación de Especies para los Fines de la Pesca.
Pacíco Centro-oriental. Vol. 3. Vertebrados. Parte 2. FAO, Rome, pp. 1349–1380.
Hensley, D. A. & Ahlstrom, E. H. (1984) Pleuronectiformes: relationships. In: Moser, H.G., Richards, W.J., Co-
hen, D.M., Fahay, M.P., Kendall, A.W. & Richardson, S.L. (Eds.), Ontogeny and Systematics of Fishes. Allen
Press, Lawrence, Kansas, pp. 670–687.
Hoshino, K. & Amaoka, K. (1999) Citharichthys gnathus, a new species of paralichthyid ounder (Teleostei:

31
Pleuronectiformes) from the Galápagos Islands, eastern Pacic Ocean. Ichthyological Research, 46, 371–375.
Hoshino, K., Munroe, T. A. & Buth, D.G. (2004) Neoetropus macrops Hildebrand and Schroeder, 1928: A re-
versed specimen and a junior synonym of Citharichthys arctifrons Goode, 1880 (Teleostei; Pleuronectiformes;
Paralichthyidae). Copeia, 2004, 583–591.
Ivanova, N.V., Zemlak, T.S., Hanner, R.H. & Hebert, P.D.N. (2007) Universal primer cocktails for sh DNA bar-
coding. Molecular Ecology Notes, 7, 544–548.
Tirado, N., Ruiz, D., Chiriboga, A., & Banks, S. (2013). CDF Checklist of Galapagos Fish - FCD Lista de especies
de Peces de Galápagos. In: Bungartz, F., Herrera, H., Jaramillo, P., Tirado, N., Jiménez-Uzcátegui, G., Ruiz,
D., Guézou, A. & Ziemmeck, F. (Eds.). Charles Darwin Foundation Galapagos Species Checklist - Lista de
Especies de Galápagos de la Fundación Charles Darwin. Charles Darwin Foundation / Fundación Charles
Darwin, Puerto Ayora, Galapagos: http://checklists.datazone.darwinfoundation.org/vertebrates/pisces/ (ac-
cessed 17 Jan. 2013).
Leslie, A.J. & Stewart, D.J. (1986) Systematics and Distributional Ecology of Etropus (Pisces, Bothidae) on the
Atlantic Coast of the United States with Description of a New Species. Copeia, 1986, 140–156.
Lyczkowski-Shultz, J. & Bond, P.J. (2006) Paralichthyidae: Sand ounders. In: Richards, W. J. (Ed.), Early stages
of Atlantic shes: an identication guide for western central North Atlantic. CRC Press, Taylor & Francis
Group, Boca Raton, Florida, pp. 2291–2325.
McCosker, J.E. & Rosenblatt, R.H. (2010) The shes of the Galápagos Archipelago: an update. Proceedings of
the California Academy of Sciences (Series 4), 61 (II), 167–195.
Moser, H. G. & Sumida, B.Y. (1996) Paralichthyidae. In: Moser, H.G (Ed.), The early stages of shes in the Cali-
fornia Current region, California Cooperative Oceanic Fisheries Investigations (CALCOFI) Atlas No. 33.
Allen Press, Lawrence, Kansas, pp. 1325–1356.
Murakami, T. & Amaoka, K. (1992) Review of the genus Syacium (Paralichthyidae) with the description of a new
species from Ecuador and Columbia. Bulletin of the Faculty of Fisheries Hokkaido University, 43, 61–95.
Nielsen, J. G. (1963) Notes on some Heterosomata (Pisces) from N-W South America with the description of
a new genus and species and a new subspecies of Paralichthinae. Videnskabelige Meddelelser Fra Dansk
Naturhistorisk Forening, 125, 377–400.
Parr, A. E. (1931) A practical revision of the western Atlantic species of the genus Citharichthys (including Etro-
pus) with observations on the Pacic Citharichthys crossotus and C. spilopterus. Bulletin of the Bingham
Oceanographic Collection, 41, 1–24.
Ratnasingham, S. & Hebert, P.D.N. (2007) BOLD: The Barcode of Life Data System (www.barcodinglife.org).
Molecular Ecology Notes, 7(3), 355–364.
Robertson, D.R. & Allen, G.R. (2008) Shoreshes of the Tropical Eastern Pacic online information system.
Version 1.0 (2008). Smithsonian Tropical Research Institute, Balboa, Panamá. Available from http://www.
neotropicalshes.org/sftep, www.stri.org/sftep (accessed September 30, 2012).
van der Heiden, A. M. & Mitchell, R. (1998) Rediscovery and Description of the Flounder Syacium maculiferum
(Garman, 1899): An Endemic Species of Cocos Island, Costa Rica (Pleuronectiformes: Paralichthyidae). Co-
peia, 1998, 753–758.
van der Heiden, A. M. & Mussot-Perez, S. (1995) Citharichthys mariajorisae, a new atsh from the shallow
coastal waters of the eastern tropical Pacic (Pleuronectiformes: Paralichthyidae). Copeia, 1995, 439–446.
van der Heiden, A.M. & Plascencia Gonzalez, H.G. (2005) Etropus ciadi, a new endemic atsh from the Gulf of
California, Mexico (Pleuronectiformes: Paralichthyidae). Copeia, 2005, 470–478.
van der Heiden, A.M., Aguilar-Zarate, G. & Plascencia Gonzalez, H.G. (2009) On the Eastern Pacic Species
of the Paralichthyid Flatsh Genus Citharichthys: Redescription of C. fragilis, Comments on the Taxonomic
Status of C. gordae, and a Key to the Species. Copeia, 2009, 807–815.

32
Victor, B.C. (1987) Growth, dispersal, and identication of planktonic labrid and pomacentrid reef-sh larvae in
the eastern Pacic Ocean. Marine Biology, 95, 145–52.
Ward, R.D., Hanner, R. & Hebert, P.D. (2009) The campaign to DNA barcode all shes, FISH-BOL. Journal of
Fish Biology, 74, 329–356.
Genus species Collection site Voucher GenBank # Collector
Citharichthys arctifrons USA, off Virginia KU 27142 JX516098 K. Moots, KUI Tissue
Citharichthys arenaceus Panama, Portobelo n7529af1244 HQ987852 B. Victor
Citharichthys arenaceus Panama, Portobelo n762bc130 JX516095 B. Victor
Citharichthys cornutus USA, off Texas KU 30202 KC170026 K. McNyset, KUI Tissue
Citharichthys darwini Isabela, Galápagos SIO 12-3075 JX516097 B. Victor/G. Wellington
Citharichthys dinoceros? Quintana Roo, Mexico ECO-CHLP3862 HM389452 L. Vásquez Yeomans
Citharichthys fragilis Baja California, Mexico CBN 5221 JN312654 E. Balart, CIBNOR
Citharichthys fragilis Baja California, Mexico CBN 5221 JN312655 E. Balart, CIBNOR
Citharichthys gilberti El Salvador KU 40295 KC170027 A. Bentley, KUI Tissue
Citharichthys gilberti El Salvador KU 40286 KC170028 A. Bentley, KUI Tissue
Citharichthys gymnorhinus? Belize ECO-CHLP4278 HM390025 L. Vásquez Yeomans
Citharichthys macrops Quintana Roo, Mexico ECO-CHLP5266 JN313699 L. Vásquez Yeomans
Citharichthys minutus Panama, Portobelo n7528ac140 JX516092 B. Victor
Citharichthys minutus Panama, Portobelo n7528ac200 JX516100 B. Victor
Citharichthys platophrys Galápagos Rift vents gv85310cp122 JX516093 B. Victor
Citharichthys platophrys Galápagos Rift vents gv85310cp79 JX516099 B. Victor
Citharichthys platophrys Galápagos Rift vents gv85310cp90 JX516089 B. Victor
Citharichthys sordidus San Diego, CA SIO 02-19 GU440282 P. Hastings, H.J. Walker
Citharichthys sordidus Ventura, CA CMB VH-11 JQ672526 R. Imondi
Citharichthys sordidus Ventura, CA CMB VH-11 JQ694029 R. Imondi
Citharichthys sp. a St. Thomas, USVI st80628cu122 HQ987850 B. Victor
Citharichthys sp. a St. Thomas, USVI st954p115 HQ987846 B. Victor
Citharichthys spilopterus Panama, Portobelo n7529af150 HQ987853 B. Victor
Citharichthys spilopterus Panama, Portobelo n762cc110 JX887474 B. Victor
Citharichthys spilopterus Panama, Portobelo n7528bc137 JX887473 B. Victor
Citharichthys stigmaeus Puget Sound, WA UW 48811 JQ354050 W. Pallson
Citharichthys stigmaeus Puget Sound, WA UW 48784 JQ354051 W. Pallson
Citharichthys xanthostigma San Diego, CA UW 119902 JQ354052 NMFS
Citharichthys xanthostigma San Diego, CA SIO 02-19 GU440283 P. Hastings, H.J. Walker
Cyclopsetta chittendeni USA, off Texas KU 30228 JX516094 K. McNyset, KUI Tissue
Cyclopsetta panamensis Galápagos Rift vents gv85310cp90 JX887475 B. Victor
Cyclopsetta querna Costa Rica JHLOW00205 JX887476 J. Lowenstein
Etropus microstomus USA, off Virginia KU 27165 JX516090 K. Moots, KUI Tissue
Syacium gunteri Panama, Portobelo n761f190 JX887477 B. Victor
Syacium maculiferum Galápagos Rift vents gv85310sm60 JX887478 B. Victor
Syacium micrurum Belize cn10f133 HQ987876 B. Victor
Syacium papillosum Belize cn11sy64 JX887479 B. Victor
Syacium papillosum Belize ECO-CHLP3755 GU224775 L. Vásquez Yeomans
Syacium papillosum Quintana Roo, Mexico ECO-CHLP4304 HM390055 L. Vásquez Yeomans
Appendix 1. Specimen data and GenBank accession numbers for the mtDNA COI sequences used in the phenogram in Fig.
7 (alphabetical order).