Content uploaded by Paul J. Brindley
Author content
All content in this area was uploaded by Paul J. Brindley on Mar 30, 2015
Content may be subject to copyright.
ORIGINAL PAPER
Approaches to genotyping individual miracidia
of Schistosoma japonicum
Ning Xiao & Justin V. Remais & Paul J. Brindley &
Dong-Chuan Qiu & Elizabeth J. Carlton & Rong-Zhi Li &
Yang Lei & David Blair
Received: 28 June 2013 /Accepted: 22 August 2013 /Published online: 8 September 2013
#
Springer-Verlag Berlin Heidelberg 2013
Abstract Molecular genetic tools are needed to address ques-
tions as to the source and dynamics of transmission of the human
blood fluke Schistosoma japonicum in regions where human
infections have reemerged, and to characterize infrapopulations
in individual hosts. The life stage that interests us as a target for
collecting genotypic data is the miracidium, a very small larval
stage that consequently yields very little DNA for analysis. Here,
we report the successful development of a multiplex format
permitting genotyping of 17 microsatellite loci in four sequential
multiplex reactions using a single miracidium held on a
Whatman Classic FTA indicating card. This approach was
successful after short storage periods, but after long storage
(>4 years), considerable difficulty was encountered in multiplex
genotyping, necessitating the use of whole genome amplification
(WGA) methods. WGA applied to cards stored for long periods
of time resulted in sufficient DNA for accurate and repeatable
genotyping. T rials and tests of these methods, as well as appli-
cation to some field-collected samples, are reported, along with
the discussion of the potential insights to be gained from such
techniques. These include recognitio n of sibships among mira-
cidia from a single host, and inference of the minimum number
of worm pairs that might be present in a host.
N. Xiao (*)
:
D.<C. Qiu
:
R.<Z. Li
:
Y. Lei
Institute of Parasitic Diseases, Sichuan Center for Disease Control
and Prevention, Chengdu, Sichuan 610041,
People’sRepublicofChina
e-mail: xiao.ning@yahoo.com
D.<C. Qiu
e-mail: qiudongchuan@yahoo.com.cn
R.<Z. Li
e-mail: liee4113@163.com
Y. Le i
e-mail: jysyck@sina.com
J. V. Remais
Department of Environmental Health, Rollins School of Public
Health, Emory University, 1518 Clifton Rd. NE, Atlanta,
GA 30322, USA
e-mail: justin.remais@emory.edu
P. J. Brindley
Department of Microbiology, Immunology and Tropical Medicine,
George Washington University Medical Center, 2300 Eye Street,
NW, Washington, DC 20037, USA
e-mail: pbrindley@gwu.edu
E. J. Carlton
Department of Environmental and Occupational Health, Colorado
School of Public Health, University of Colorado, Anschutz Medical
Campus, 13001 E. 17th Place, Aurora, CO 80045, USA
e-mail: elizabeth.carlton@ucdenver.edu
D. Blair
School of Marine and Tropical Biology, James Cook University,
Townsville, QLD 4811, Australia
e-mail: david.blair@jcu.edu.au
Present Address:
N. Xiao
National Institute of Parasitic Diseases, Chinese Center for Disease
Control and Prevention, WHO Collaborating Centre for Malaria,
Schistosomiasis and Filariasis, Key Laboratory of Parasite and Vector
Biology , Ministry of Health, Shanghai 200025, People’s Republic of
China
Parasitol Res (2013) 112:3991–3999
DOI 10.1007/s00436-013-3587-9
Introduction
Our interest is in tracing the movement of pathogens through
landscapes, identifying specific pathways of dispersal with
particular emphasis on the blood fluke, Schistosoma
japonicum,inChina(Remaisetal.2010;Remaisetal.
2011;Akullianetal.2012). After nearly 60 years of control
activities, Sichuan, a province in southwest China, had suc-
cessfully controlled schistosomiasis transmission to a low
level. However, reemergence of the disease has been docu-
mented in the province, highlighting the challenge of achiev-
ing local elimination and raising questions as to the pathways
by which the pathogen is returning to previously controlled
areas (Liang et al. 2006; Liu et al. 2010; Carlton et al. 2011).
Models suggest even modest parasite inputs may be sufficient
to reestablish the parasite life cycle and cause new human
schistosomiasis cases (Spear et al. 2011). What are the sources
of these inputs—are pathogens transported across water ways,
social networks, or by nonhuman definitive hosts such as
bovines? Moreover, are the human infections found in
postcontrol environments truly new infection s or residua l
infections that persisted due to lack of treatment or treatment
failure? Global initiatives to control sch istosomiasis have
made these questions relevant not just to Sichuan but also to
many areas where efforts are underway to greatly reduce
parasite populations (WHO 2012). Our ability to describe
the dynamics of schistosomiasis reemergence can assist con-
trol and surveillance programs as progress is made toward
elimination. We have pursued a population genetic approach
that exploits parasite microsatellites (Xiao et al. 2011)as
markers and as part of a multidisciplinary effort to characterize
the dynamics of schistosomiasis reemergence in Sichuan.
The ideal parasite stage to genotype is the adult, the stage-
causing disease in mammals. Adult schistosomes are large
enough to yield sufficient DNA for many analyses. However,
this stage occurs in the circulatory system of the human host
and is therefore not available for analysis. Eggs passed from
the human host, and especially the miracidial stage emerging
from the egg, are the immediate products of adult worms,
carrying schistosome genetic material into the environment.
Miracidia are therefore suitable for landscape genetic studies
(Steinauer et al. 2010), which we intend to use for understand-
ing transmission dynamics. Genetic data from miracidia can
also be used to explore sexual interactions between schisto-
somes within an infrapopulation (Beltran and Boissier 2009)
and, by extension, can provide a means of estimating numbers
and persistence through time of reproducing worm pairs in
that infrapopulation.
Many efforts have been made to genotype miracidia. Given
their tiny size (Eklu-Natey et al. 1985), some workers have
opted to passage harvested miracidia through to adults in
laboratory hosts in order to o btain enough DNA for
genotyping (Stohler et al. 2004; Thiele et al. 2008; Stothard
et al. 2009). This has ethical implications, is expensive, time-
consuming, and subject to genetic bottlenecking (Stohler et al.
2004; Gower et al. 2007). An alternative is to genotype
directly from miracidia themselves. Freshly hatched miracidia
can be held briefly in water before being taken directly to the
genotyping stage if laboratory facilities are immediately avail-
able (Beltran et al. 2008; Steinauer et al. 2008; Valentim et al.
2009). However, some sort of storage method is generally
required since most samples are field-collected. Whatman
FTA indicating cards have been used by a number of groups.
A miracidium (or other larval stage) can be added directly to
the card in a small amount of water or saline, and the card
dried and used later as a source of DNA (Rudge et al. 2008;
Standley et al. 2010; Gower et al. 2007, 2011
). Alternatively,
preservation in RNA later appears to have been successful, but
only one example of this approach has been publish ed
(Webster 2009). Similarly, preservation of miracidia in ethanol
seemstohavebeenreportedonlyonce(VandenBroeketal.
2011) and was said to be the most cost-effective method. This
last study found relatively high levels of failure and
genotyping errors when FTA Classic cards were used for
storage of miracidia, a finding at odds with other studies.
Workers reporting on genotyping of miracidia have always
cited the small quantity of DNA available as a major consid-
eration in their planning. Some have PCR-amplified only a
single locus for each miracidium (Shrivastava et al. 2005),
while others have multiplexed several loci within a single
reaction per miracidium, and these studies have all used
FTA cards (Rudge et al. 2008; Gower et al. 2007, 2011). A
few studies, extracting DNA from freshly hatched miracidia in
water or saline, have reported successful amplification of up to
21 loci in four reactions (Steinauer et al. 2008; Valentim et al.
2009).
Given the small amount of genetic material in a single
miracidium, it is surprising that the use of whole genome
amplification (WGA) methods has not been more widespread.
WGA provides a means of near-uniform amplification of any
genome from very small starting quantities (Dean et al. 2002).
Low uptake of this approach for schistosomes has likely been
due to concerns about bias that might be introduced during the
WGA process and also cost factors. Valentim et al. (2009)
appear to be the only study to have used WGA to generate
sufficient schistosome DNA for genotyping (Valentim et al.
2009). They genotyped 28 F1 miracidia from a known paren-
tal cross at 56 loci, apparently locus-by-locus, and found an
error rate of only 0.45 %.
After reviewing published options, we decided to use the
Whatman FTA Classic indicating cards to immobilize and
preserve miracidia obtained from human and animal feces in
the field. Initially preferring not to use WGA methods because
of the concerns about uniformity of amplification across the
genome and cost, we tested the possibility of using a single-
FTA disk for several sequential PCRs. We were able to do this
3992 Parasitol Res (2013) 112:3991–3999
successfully with miracidia, which had been held on FTA
cards for 11 months (see below). However, we later encoun-
tered difficulties when using miracidial DNA on the disks as
template for multiplex genotyping reactions, especially after
long storage (>4 years). This was assumed to be due to the
small amount of DNA available in a single miracidium and the
effect that even slight degradation over time might have on
success of the amplification. Consequently, we moved to the
use of whole genome amplification (WGA) methods to in-
crease the yield of DNA. Here, we describe the materials and
methods used to successfully genotype S. japonicum miracid-
ia directly sampled from human and animal stool using WGA
and a multiplexing procedure.
Methods
Field collection and preservation of miracidia
A field survey of human schistosomiasis was initiated in 2007
in 53 villages in three counties of Sichuan Province, China
where schistosomiasis had reemerged following reduction of
human S. japonicum infection prevalence below 1 % (Liu
et al. 2010; Carlton et al. 2011). Residents were asked to
submit fecal samples on three consecutive days which were
examined using the Kato-Katz method and the miracidia
hatching tests. Add itionally, stool samples were collected
from bovines in the study villages over three consecutive days
and examined using the miracidia hatching tests. Each hatch-
ing test was conducted according to national standards de-
scribed in detail elsewhere (Chinese MoH 2001). Due to the
May 2008 8.0 magnitude earthquake which severely impacted
one of the three counties surveyed, follow-up infection sur-
veys were conducted in 2008 and 2010 in the 36 study villages
in two other counties (Carlton et al. 2013).
During each survey, miracidia were harvested from posi-
tive hatching test flasks for use in experiments to optimize
preservation and DNA extraction techniques. Miracidia ob-
served on the water surface of the incubation flask during the
hatch test were isolated individually using a hematocrit tube or
a Pasteur pipette drawn to a narrow bore in a flame. After three
washes with autoclaved deionized water, one miracidium
together with 2–5 μl water were loaded onto the FTA indicat-
ing card, producing a 2–3 mm diameter white circle contrast-
ing with the FTA card background color. After being dried at
room temperature for at least 1 h, the cards were stored in a
desiccator in a cool and dry environment for up to 5 years.
Isolation of genomic DNA from adult worms
The Sichuan Center for Disease Control and Prevention
(SCDC) maintains S. japonicum in the laboratory using cer-
cariae from infected snails sourced from Hubei and Anhui
Provinces and passed through rabbit hosts. For this study,
existing samples were obtained from SCDC of adult schisto-
somes that were derived from a single passage of cercariae
through a definitive host as described elsewhere (Xiao et al.
2011). DNA from these was used for the development of
multiplex genotyping reactions, as controls in various exper-
iments and for testing repeatability of WGA methods.
Genomic DNA was extracted from individual male or fe-
male worms by incubation in hot sodium hydroxide (20 μl)
with pH adjustment using a Tris-EDTA buffer solution (20 μl;
HotSHOT) (Truett et al. 2000). The lysates were diluted in 1:8
and 1 μl of each used as templates for PCR directly.
Use of DNA from miracidia on disks and repetitive use
of disks
When needed, the white disk indicating the location of a
miracidium was excised from the Whatman card using a 2-
mm Harris Uni-Core punch (available from Whatman) and
washed following the recommended protocol (Whatman Inc.,
NJ, USA). As DNA remains bound to the disk, the disk itself
was used as a template for either direct PCR or whole genome
amplification.
Statements in the literature suggest that each disk can only
be used in a single reaction (Gower et al. 2007). We tested this
assertion using miracidia held on the FTA cards for periods of
up to 11 months. Each disk was first used in a PCR with a pair
of primers, forward 5′-GGTACCGGTGGATCACTCGGCTC
GTG-3′, reverse 5′-GGGATCCTGG TTAGTTTCTTT T
CCTCCGC-3′ (3S/ A28) (Bowl es et al. 1993
; Blair et al.
1997) designed to amplify about 500 bp of a repetitive region
in the schistosome genome, specifically a portion of the 5.8S
ribosomal RNA gene, the complete internal transcribed spacer
2(ITS2)andthe5′ end of the 28S ribosomal RNA gene. The
purpose of t his w as to confirm that miracidial DNA was
present before using disks in subsequent reactions. PCR
conditions were as follows: denaturation for 5 min at
94 °C followed by 25 cycles of 30 s at 94 °C, 30 s at
55 °C, and 30 s at 72 °C, with a final extension at
72 °C for 5 min. Subsequently, the disk was used as
substrate in a series of PCRs, each using primers
designed to amplify a different microsatellite locus
(Xiao et al. 2011). After each PCR, the disk was
washed following the Whatman protocol mentioned
above. Thermal cycling was performed under the fol-
lowing conditions: 10 min at 94 °C, 30 cycles of 30 s
at 94 °C, 30 s at 55 °C, and 60 s at 72 °C, with a final
10 min extension at 72 °C. Five microliters of PCR product
were run on a 1.5 % agarose gel. Tris–EDTA (TE) buffer
solution was used as “template” in negative controls. A 100-
bp DNA ladder (GENEray
TM
Biotechnology, Shanghai, Chi-
na) was used to provide size markers.
Parasitol Res (2013) 112:3991–3999 3993
Final multiplex format used and PCR conditions
Multiplex Manager (http://www.multiplexmanager.com/)
(Holleley and Geerts 2009) was used to design a multiplex
format for genotyping of 17 loci. The final design contained
four groups (Table 1). We found it necessary to modify the
grouping of loci several times to arrive empirically at a set that
worked most reliably. For some loci, the primers from Xiao
et al. (2011) were not used, and new primers were designed,
usually to generate shorter amplicons for more efficient
multiplexing (Table 1). To save costs of dye-labeling each
primer pair separately, labeled tails were used (Schuelke
2000). In this approach, each forward primer is present in
limited amounts and has a 20-bp “tail” at its 5′ end corre-
sponding to a 20-bp labeled oligonucleotide which then “takes
over” as the forward primer, incorporating the label into the
PCR products. To permit multiplexing, we used three different
tails, each with a separate dye label (Table 2) (Real et al.
2009). A fourth dye, NED, gave poor results, as not only it
did display low signal of its incorporated PCR products but it
also interfered with signal from other dyes, so we did not use
it. Within a single multiplex, loci could be distinguished by a
combination of “tail” used and expected amplicon sizes.
The multiplex PCR thermocycler conditions are as follows:
94 °C for 5 min, then 35 cycles at 94 °C (30 s), 57 °C (90 s),
72 °C (60 s), and a final extension at 60 °C for 30 min.
All data were checked by the eye. All loci have trimer
repeats, making recognition of out-of-phase alleles relatively
easy. Individuals exhibiting any such alleles were re-
genotyped at the offending loci as often as necessary to
resolve the point (a very few apparently real phase shifts were
found).
Whole genome amplification
Wholegenomeamplification (WGA) was done using
the GenomiPhi V2 amplification kit (GE Healthcare
Bio-Sciences,USA)(Kumaretal.2008). Individual
disks punched from a Whatman card and processed as
above were placed singly in tubes along with the re-
agents for WGA. The protocol recommended by the
manufacturer was followed with slight modification. A
disk was rinsed five times (5 min each time). The first
three washes used 200 μl of the FTA Purification Re-
agent and the last two used TE buffer. The disk was
then dried for 1 h at room temperature. Nine microliters
of the GenomiPhi sample buffer were subsequently
added to each tube for incubation at 95 °C for 3 min.
Then the tube was cooled to 4 °C on ice and centri-
fuged briefly. A prepared mixture of 9 μlofthe
GenomiPhi Reaction Buffer and 1 μloftheEnzyme
Mix was added into the tube for incubation at 30 °C for
90 min. Finally, the tube w as held at 65 °C for 10 min
to inactivate the enzyme. Subsequently, aliquots of
0.5 μl of reaction product were used in each of the
four multiplex PCR reactions as out lined in the p revious
section.
In some cases, the white circle on the card, within which a
miracidium was located, was too large to be completely ex-
cised with the 2 mm punch. Instead, as many punches as
required to excise the entire circle were taken and combined
in a tube for the WGA reaction. As many as six disks were
added to a reaction with generally good results (data not
shown).
We evaluated the effects of m ultiple displ acement
amplification on the repeatability of subsequent
genotyping. To do this, we first multiplex-genotyped
DNAs (1:8 diluted) extracted from two adult worms
raised in the laboratory. Then, we used a small aliquot
(1 μl of a 1:1,000 dilution) of DNA from each adult
worm, added to an FTA card, as the substrate for
genotyping directly (without WGA). Additionally,
DNA, diluted as above, from each adult worm on an
FTA card was used in a WGA reaction and the resulting
products multiplex-genotyped.
To further understand the potential error after WGA pro-
cessing, additional tests were carried out using five randomly
selected loci. Each of three miracidial DNAs on FTA cards
(and after WGA) was used as a template at least twice for PCR
and genotyping of each locus using tailed primers. Further, the
forward primer for each of the five loci was directly labeled
with dye and genotyping results compared with those
obtained using the multiple-tailing method. Finally, represen-
tative amplicons were sequenced to check for sequence fidel-
ity relative to the original genomic sequence.
Application to field-collected material
Genotyping of miracidia collected is ongoing, and full results
will be published elsewhere in due course. Data from two
human cases are presented here as examples. We need to stress
that the statistical analytical issues surrounding genotypic data
from miracidia are not under discussion here. These issues
have been reviewed elsewhere (Steinauer et al. 2010). We
only wish to present some data to demonstrate the utility of
the method. The two cases, both farmers aged 50–60 years,
were found to be infected during each of the three infection
surveys. From the first individual (“A”), 15 miracidia collect-
ed in 2007, 15 in 2008, and 8 in 2010 (total 38) were geno-
typed following WGA of miracidia on the FTA disks. From
the second individual (“B”), the corresponding numbers ge-
notyped are 15, 10, and 4 from the 2007, 2008, and 2010
infection surveys, respectively. Data wer e analyzed using
GenAlEx v6.x (Peakall and Smouse 2006) and Colony v2.0
(Jones and Wang 2010).
3994 Parasitol Res (2013) 112:3991–3999
Ethics statement
TheresearchwasapprovedbytheSichuanInstitutional
Review Board and the University of California, Berke-
ley, Committee for the Protection of Human Subjects.
Participants prov ided written informed consent before
participating in this study. All children provided assent,
and their parents or guardians provided written informed
permission for them to participate in this study. After
each i nfection survey, infected individuals were notified
and provided praziquantel tablets (40 mg per kilogram
of body weight) by the county Anti-Schistosomiasis
Control Station, with instructions for taking these as a
single dose to clear the i nfection. Because bovine stool
samples were collected after they were excreted, the
Animal Care and Use Committee at t he University of
California, Berkeley determined the protocol was ex-
empt from review. All bovines tested positive for schis-
tosomiasis were provided t reatment with praziquantel by
the county veterinary station.
Table 1 Primers used for genotyping at 17 microsatellite loci. Their
distribution into four multiplex groups is indicated, along with the labeled
tail (Real et al. 2009)used.The5′ tail sequence for each forward primer is
not shown (see Table 2). Where primer sequences have been altered from
those reported in (Xiao et al. 2011), this is indicated by the word
“redesigned”
Locus Primers (without tails) Multiplex group Length range
a
Tail used Notes
Sj4 F: ACAAGCTCCAATCGTCTCTGA G2 193–258 T1
R: GAATACTGCCGCCCTTGTAA
Sj8 F: ATGCACGTAAAGAAAAGGGTAAA G1 194–287 T4
R: TGATCTCCTACTGCGTTTCTGA
Sj18 F: TCCTTTATCTGGGCTGTGGA G3 261–298 T2
R: TTTCAGCAGGATAACATGACG
Sj22 F: CAAAGCCTAAACGTCATAGACAG G3 105–167 T2
R: CAACCACCGATAAGTAGAGTGGA
Sj23 F: GTACGATATGAGGGAAAGTTCA G4 192–253 T2
R: CTCTCCTTCAGACGAATTGAG
Sj28 F: TAACGCCTTTTCCCACATTC G3 232–269 T1
R: ATAACCACGATGGGAACCAA
Sj32 F: TGTCACCGAGTCTTCATTAGC G3 142–193 T4
R: ACAGTCAGTAGACCTGGATAAAC
Sj34 F: GGCGACCATACATAAGGAGAAT G1 265–314 T2 Redesigned
R: GCAAAGGCGTTACCTTCGTCT Redesigned
Sj37 F: TCCTTGACACGAGGTACATGT G4 149–223 T4
R: ATTACGTAACAGAAGGCTGGA
Sj39 F: GACGACTGTTAAGTCCATCTGA G3 316–344 T4
R: ATAACCAATCTCCACGAAAGC
Sj41 F: ACTGTACCATTGACACCTTGA G4 281–310 T2
R: GGACAACCATCAAAATCAAC
Sj42 F: GCTGCAGCTTCTGTGTAGTAA G2 199–234 T4
R: GTCTTGCTCAGATCAGTTCGT
Sj45 F: ATAACACCGAATCTGTTCAGC G2 150–244 T2
R: TAATCCGGTCAGGATGTATGT
Sj48 F: TTGTTGGGTAGTGATGGTAGG G1 246–273 T1
R: TAGTTCATTCCACCTCTTGGA
Sj58 F: CCTCTCAACGTATCAAACTTC G1 138–198 T2 Redesigned
R: CTAATAAAGTCGTCAAGGAGCA
Sj60 F: CGATTCATTCATAGCCTGACT G2 134–165 T1
R: GAATCCCATCACAGATTAACG
Sj63a F: CCGCCACTACCACTAACCTC G4 100–156 T1 Redesigned
R: GGAACCAAATGACGTATCTAAAGC Redesigned
a
Length range, excluding tails, from[Xiao et al. 2011] and as modified subsequently
Parasitol Res (2013) 112:3991–3999 3995
Results and discussion
Collection and preservation of miracidia
Miracidia (a total of 4199) were obtained from 365 human and
38 bovine schistosomiasis cases during the surveys in 2007,
2008, and 2010 and stored on the Whatman Classic FTA
indicating cards. The number of miracidia collected per case
ranged from 1 to 72 (median, 7).
Repetitive use of disks
Amplification of the ITS2 and portions of the flanking nuclear
5.8S and 28S rRNAs was routinely done prior to WGA.
Presence of a clear band of the expected length of around
500 bp was proof that the disk punch held DNA from a
miracidium (Fig. 1a).
Having demonstrated that a miracidium was present on a
disk, one preliminary experiment (two replicates) was to use
the same disk in a series of single-plex PCRs, using a different
primer pair each time. Bands of the expected sizes were
evidence of successful amplification. Results of this for one
replicate are in Fig. 1b–f. This single disk was reused 11 times,
yielding a band in each case, although the last two loci
amplified were visible only as very faint bands.
Whole genome amplification
Although multiplexing worked well with DNA from adult
worms and using miracidia recently preserved on FTA cards,
poor results (failure to amplify loci and appearance of spurious
bands) after long storage (>4 years) of miracidia on the FTA
cards led us to use WGA methods to increase the amount of
template. The results indicated that WGA amplification of
genomic DNA from a miracidium on a disk could yield as
much as 1 mg/μl of DNA for subsequent work.
Repeated testing and quality control steps in WGA con-
vinced us that error rates are low. We used two approaches to
satisfy ourselves of this. One was to test the repeatability of
multiplex genotyping (17 loci) from the lysates of two differ-
ent adult worms, each treated in three different ways prior to
genotyping: (a) direct use of lysate for genotyping, (b) use of
lysate added to FTA disks without WGA prior to genotyping,
and (c) use of lysate added to FTA disks followed by WGA
and genotyping. With a single exception, allele sizes were
identical across the three treatments. The exception was a
single base-pair insertion in the region flanking the microsat-
ellite repeats at only one locus after WGA, a result confirmed
by sequencing.
The second approach was to test stability and repeatability
on PCR and genotyping of five randomly selected loci. The
results were completely consistent across methods, providing
evidence to confirm the stability and repeatability of the loci
used for population genetic analysis.
Application to field-collected material
The method was applied to field-collected samples, and after
repeating any PCR where the results were questionable, only
five loci (out of a total of 646) could not be scored for the 38
miracidia from subject A. This equates to a failure rate of
0.8 %. The failure rate for individual B was 3.4 %.
Assignment tests in GenAlEx assigned all miracidia from
Atothathost.OnemiracidiumfromBwasassignedtoA.
Between populations of free-living animals, such a result
might imply absence of gene flow. However, between schis-
tosome infrapopulations, this result might be due to the pres-
ence of sibling miracidia within each host or inbreeding within
each host (Steinauer et al. 2010). Full exploration of these
possibilities is beyond the scope of this paper. However, we
did examine the possibility of siblings being present within
either host, using the program Colony v2.0. There was sup-
port, with probabilities >0.9 in most cases, for siblings among
miracidia collected in the same year. For individual A, two
pairs of miracidia collected in 2007 were likely full sibs (i.e.,
two sibships, each with two members). For 2008, there were
three likely pairs of siblings. In 2010, one sibship with three
members and one with two were likely present. Host B, for
whom fewer miracidia were genotyped, had two pairs of sibs
in 2007 and one in 2008.
This suggests that individual Awas infected with at least 13
reproducing adult worm pairs in 2007 and 12 in 2008 and,
more generally, demonstrates the use of multilocus
genotyping to infer at least the minimum worm burden. The
number of reproducing adult worm pairs has important impli-
cations for morbidity, as pathology is generally proportional to
egg exposure. Furthermore, worm burden is a key variable of
interest when studying transmission dynamics and is particu-
larly essential when characterizing dynamics at low transmis-
sion levels. To date, inference about the number of reproduc-
ing adult worm pairs has largely been based on repeated,
quantitative egg counts from the Kato-Katz thick smear meth-
od (Hubbard et al. 2002). However, the Kato-Katz method
performs poorly at low infection inte nsities. In our study
region, where infection intensities are low, we found that
many infected individuals tested positive for S. japonicum
using the miracidia hatching test, but negative using the Kato-
Tabl e 2 Sequences of the three tailing oligonucleotides used (Real et al.
2009) and the dye with which each was labeled
Name Sequence 5′–3′ Label
T1 CTCTTCGCTATTACGCCAGC FAM
T2 GCTGCAAGGCGATTAAGTTG VIC
T4 TAGAGTCGACCTGCAGGCAT PET
3996 Parasitol Res (2013) 112:3991–3999
Katz method, likely due to the very different amounts of stool
used in the two tests (41.7 mg per slide for the Kato-Katz test
vs. 30 g used for the hatching test) (Carlton et al. 2013). In
fact, individual A had no detectable S. japonicum eggs upon
Kato-Katz examination in 2007, and individual B had no
detectable S. japonicum eggs in 2010. Identifying parasite
siblings within a host using multilocus genotypes offers a
new technique for estimating worm burdens, one that may
be particularly useful in low-transmission environments.
Interestingly, strong support was given for several pairs of
miracidia being siblings, despite being collected in different
years. There were two such pairs in A and five in B. Such a
result might indicate that the parental worm pairs had persisted
between years. We have previously found that some individ-
uals are repeatedly infected with S. japonicum, a phenomenon
not fully explained by host exposure (Carlton et al. 2013).
However, to date we have been unable to determine whether
infections detected in the same host over time represent new
infections, suggesting differential host susceptibility, or
whether such infections are, in fact residual infections, as adult
worms are known to be able to survive for 4.5 years (Li and
Guan 2010). This longitudinal sibship analysis suggests some
adult worm pairs may have persisted in the two case individ-
uals over time, despite provision of treatment. While it is
unclear whether the adult worms survived due to noncompli-
ance with treatment regimens or the occasional failure of
praziquantel to kill adult worms (Seto et al. 2011a, b), the
finding demonstrates that S. japonicum infections may persist
in some individuals despite targeted treatment campaigns. Our
multilocus genotypic method therefore provides a much
needed means of distinguishing new from residual infections,
a phenomenon that we will investigate further with a larger
sample size.
We have demonstrated that it is possible to reuse FTA disks
carrying Schistosoma japonicum miracidia as template in
several sequential PCRs. However, genotyping is easier using
a multiplex PCR format following WGA of miracidial DNA.
These methods provide an array of potential applications—
from analyzing parasite dispersal and connectivity over land-
scapes to characterizing within-host parasite populations over
time (Seto et al. 2011a, b). Our future work will utilize these
methods with the long-term goal of generating knowledge to
halt schistosomiasis transmission in reemerging endemic foci
in Sichuan Province.
Acknowledgments The authors wish to thank Kang Jun-xing, former
General Director of the Sichuan Center for Disease Control and Preven-
tion (Chengdu, People’s Republic of China) for his continued support and
collaboration. The authors also wish to acknowledge Zhong Bo, Lu Ding,
Ye Hong, Cui Lina, Chen Lin, Zhang Yi, and Meng Xian-hong of the
Institute of Parasitic Diseases, Sichuan Center for Disease Control and
Prevention for their support and assistance with the work described
herein. We also thank county Anti-Schistosomiasis Control Station
leaders and staff from the two counties included in this study for their
hard work and hospitality during the fieldwork of sample collection
conducted in 2007, 2008, and 2010. This work was supported in part
by the NIH/NSF Ecology of Infectious Disease Program (grant no.
0622743), by the National Institute for Allergy and Infectious Disease
(grant no. K01AI091864 and R01AI068854), and by the Emory Global
Health Institute. The funders had no role in study design, data collection
and analysis, decision to publish, or preparation of the manuscript.
Conflict of interests No author has any competing interests to declare.
Fig. 1 Demonstration of repetitive use for PCR of punched the Whatman
FTA card disks holding a single miracidium stored for 11 months. a–f
Images of 1.5 % agarose gels on which 5-μl PCR product was run after
each successive PCR using a different primer pair. An arrow shows the
location of the faint band in F. Image a shows the results (for two disks)
amplified using primers 3S/A28 that span the nuclear ribosomal ITS2
region. Remaining images (b –f ) sh ow results of reuse of the disk
represented in the right-hand lane of a up to 11 times, each time using
primers for a different locus. Note that one primer pair (for locus Sj25)
used in this test was not used in the final multiplex format, so is not listed
in Table 1. One hundred base pairs DNA ladder was used as molecular
size marker. The blank lane to the right of the molecular size marker is the
negative control in each case
Parasitol Res (2013) 112:3991–3999 3997
References
Akullian A, Lu D, McDowell J, Davis G, Spear R, Remais J (2012)
Modeling the combined influence of host dispersal and waterborne
fate and transport on pathogen spread in complex landscapes. Water
Qual Expo Health 4:159–168
Beltran S, Boissier J (2009) Are schistosomes socially and genetically
monogamous? Parasitol Res 104(2):481–483
Beltran S, Galinier R, Allienne JF, Boissier J (2008) Cheap, rapid and
efficient DNA extraction method to perform multilocus microsatel-
lite genotyping on al l Schistosoma mansoni stages. Mem Inst
Oswaldo Cruz 103:501–503
Blair D, Agatsuma T, Watanobe T (1997) Molecular evidence for the
synonymy of three species of Paragonimus, P. ohirai Miyazaki,
1939, P. iloktsuenensis Chen, 1940 and P. sadoensis Miyazaki et al.
1968. J Helminthology 71:305–310
Bowles J, Hope M, Tiu WU, Liu XS, McManus DP (1993) Nuclear and
mitochondrial genetic markers highly conserved between chinese
and philippine Schistosoma japonicum. Acta Tropica 55:217–229
Bureau of Disease Control and Prevention, Chinese MOH (2001) Hand-
book of schistosomiasis control. Shanghai Science & Technology
Press, Shanghai, In Chinese
Carlton EJ, Bates MN, Zhong B, Seto EYW, Spear RC (2011) Evaluation
of mammalian and intermediate host surveillance methods for
detecting schistosomiasis re-emergence in Southwest China.
PLoSNegl Trop Dis 5(3):e987. doi:10.1371/journal.pntd.0000987
Carlton EJ, Hubbard A, Wang S, Spear RC (2013) Repeated Schistosoma
japonicum infection following treatment in two cohorts: evidence
for host susceptibility to helminthiasis? Plos Negl Trop Dis 7:e2098
Dean FB, Hosono S, Fang LH, Wu XH, Faruqi AF, Bray-Ward P, Sun ZY,
Zong QL, Du YF, Du J, Driscoll M, Song WM, Kingsmore SF,
Egholm M, Lasken RS (2002) Comprehensive human genome
amplification using multiple displacement amplification. Proc Natl
Acad Sci U S A 99:5261–5266
Eklu-Natey DT, Wuest J, Swiderski Z, Striebel HP, Huggel H (1985)
Comparative scanning electron-microscope (SEM) study of mira-
cidia of four human schistosome species. Int J Parasitol 15:33–42
Gower CM, Shrivastava J, Lamberton PHL, Tollinson D, Webster BL,
Emery A, Kabatereine NB, Webster JP (2007) Development and
application of an ethically and epidemiologically advantageous
assay for the multi-locus microsatellite analysis of Schistosoma
mansoni. Parasitology 134:523–536
Gower CM, Gabrielli AF, Sacko M, Dembele R, Golan R, Emery AM,
Rollinson D, Webster JP (2011) Population genetics of Schistosoma
haematobium: development of novel microsatellite markers and
their application to schistosomiasis control in Mali. Parasitology
138:978–994
Holleley CE, Geerts PG (2009) Multiplex Manager 1.0: a cross-platform
computer program that plans and optimizes multiplex PCR.
BioTechniques 46:511–517
Hubbard A, Liang S, Maszle D, Qiu D, Gu X, Spear RC (2002) Estimat-
ing the distribution of worm burden and egg excretion of
Schistosoma japonicum by risk group in Sichuan province, China.
Parasitology 125:221–231
Jones OR, Wang J (2010) COLONY: a program for parentage and sibship
inference from multilocus genotype data. Mol Ecol Resour 10:551–
555
Kumar G, Garnova E, Reagin M, Vidali A (2008) Improved multiple
displacement a mplific ation w ith phi29 DNA polymerase for
genotyping of single human cells. Biotechniques 44:879–890
Li YL, Guan XH (2010) Human Parasitology, 7th edn. People’
sHealth
Press, Beijing, p 111, In Chinese
Liang S, Yang C, Zhong B, Qiu D (2006) Re-emerging schistosomiasis in
hilly and mountainous areas of Sichuan, China. Bull World Health
Organ 84:139–144
Liu Y, Luan RS, Zhong B, Zheng W, Zou J, Qiu DC (2010) Determinants
of re-emerging of schistosomiasis epidemic in areas with transmis-
sion once controlled in Sichuan Province. J Prev Med Inf 3:165–
169, In Chinese, English abstract
Peakall R, Smouse PE (2006) GENALEX 6: genetic analysis in Excel.
Population genetic software for teaching and research. Mol Ecol
Notes 6:288–295
Real KM, Schmidt DJ, Hughes JM (2009) Mogurnda adspersa micro-
satellite markers: multiplexing and multi-tailed primers tagging.
Conserv Genet Resour 1:411–414
Remais J, Akullian A, Lu D, Seto E (2010) Analytical methods for
quantifying environmental connectivity for the control and surveil-
lance of infectious disease spread. J Royal Soc Interface 7(49):
1181–1193
Remais J, Xiao N, Akullian A, Qiu D, Blair D (2011) Genetic assignment
methods for gaining insight into the management of infectious
disease by understanding vector, host and pathogen movement.
PLoS Pathog 7(4):e1002013
Rudge JW, Carabin H, Balolong E, Tallo V, Shrivastava J, Lu DB,
Basañez MG, Olveda R, McGarvey ST, Webster JP (2008) Popula-
tion genetics of Schistosoma japonicum within the Philippines sug-
gest high levels of transmission between humans and dogs. PLoS
Negl Trop Dis 2:e340. doi:10.1371/journal.pntd.0000340
Schuelke M (2000) An economic method for the fluorescent labeling of
PCR fragments. Nat Biotechnol 18:233–234
Seto E, Remais J, Carlton E, Wang S, Liang S, Brindley P, Qiu D, Spear R
(2011a) Towards sustainable and comprehensive control of schisto-
somiasis in China: lessons from Sichuan. PLoS Negl Trop Dis
5(10):e1372
Seto EYW, Wong BK, Lu D, Zhong B (2011b) Human schistosomiasis
resistance to Praziquantel in China: should we be worried? Am J
Trop Med Hyg 85:74–82
Shrivastava J, Gower CM, Balolong E, Wang TP, Qian BZ, Webster JP
(2005) Population genetics of multi-host parasites—the case for mo-
lecular epidemiological studies of Schistosoma japonicum using lar-
val stages from naturally infected hosts. Parasitology 131:617–626
Spear RC, Seto EY, Carlton EJ, Liang S, Remais JV, Zhong B, Qiu D
(2011) The challenge of effective surveillance in moving from low
transmission to elimination of schistosomiasis in China. Int J
Parasitol 41:1243–1247
Standley CJ, Kabatereine NB, Lange CN, Lwambo NJS, Stothard JR
(2010) Molecular epidemiology and phylogeography of Schistosoma
mansoni around Lake V ictoria. Parasitology 137:1937–1949
Steinauer ML, Agola LE, Mwangi IN, Mkoji GM, Loker ES (2008)
Molecular epidemiology of Schistosoma mansoni: a robust, high-
throughput method to assess multiple microsatellite markers from
individual miracidia. Infect Genet Evol 8:68–73
Steinauer ML, Blouin MS, Criscione CD (2010) Applying evolutionary
genetics to schistosome epidemiology . Infect Genet Evol 10:433–443
Stohler RA, Curtis J, Minchella DJA (2004) A comparison of microsat-
ellite polymorphism and heterozygosity among field and laboratory
populations of Schistosoma mansoni. Int J Parasitol 34(5):595–601
Stothard JR, Webster BL, Weber T, Nyakaana S, Webster JP, Kazibwe F,
Kabatereine NB, Rollinson D (2009) Molecular epidemiology of
Schistosoma mansoni in Uganda: DNA barcoding reveals substan-
tial genetic diversity within Lake Albert and Lake Victoria popula-
tions. Parasitology 136:1813–1824
Thiele EA, Sorensen RE, Gazzinelli A, Minchella DJ (2008) Schistosome
genetic diversity and population structuring in a Brazilian village.
Int J Parasitol 38:389–399
Truett E, Mynatt LR, Truett AA, Walker AJ, Warman LM (2000) Prep-
aration of PCR-quality mouse genom ic DNA with hot sodium
hydroxide and Tris (HotSHOT). BioTechniques 29:52–54
Valentim CL, LoVerde PT, Anderson TJ, Criscione CD (2009) Efficient
genotyping of Schistosoma mansoni miracidia following whole
genome amplification. Mol Biochem Parasitol 166:81–84
3998 Parasitol Res (2013) 112:3991–3999
Van den Broek F, Geldof S, Polman K, Volckaert FAM, Huyse T (2011)
Optimal sample storage and extraction procotols for reliabl e
multilocus genotyping of the human parasite Schistosoma mansoni.
Infect Genet Evol 11:1413–1418
Webster BL (2009) Isolation and preservation of schistosome eggs and
larvae in RNAlater (R) facilitates genetic profiling of individuals.
Parasites Vectors 2:6
WHO (2012) Accelerating work to overcome the global impact of
neglected tropical diseases—a roadmap for implementation.
WHO, Geneva, www.who.int/neglected_diseases/NTD_
RoadMap_2012_Fullversion.pdf
Xiao N, Remais J, Brindley P, Qiu D, Spear RC, Lei Y, Blair D (2011)
Polymorphic microsatellites in the human bloodfluke, Schistosoma
japonicum, identified using a genomic resource. Parasites Vectors 4:13
Parasitol Res (2013) 112:3991–3999 3999
