Content uploaded by Kyle J. McCulloch
Author content
All content in this area was uploaded by Kyle J. McCulloch on Dec 06, 2023
Content may be subject to copyright.
Small molecule screen for compounds that affect vascular
development in the zebrafish retina
Satish S. Kitambi1,2,4, Kyle J. McCulloch, Randall T. Peterson3, and Jarema J. Malicki4,*
1 School of Life Sciences, Södertörns University College
2 Department of Biosciences and Nutrition, Karolinska Institutet
3 Cardiovascular Research Center, Massachusetts General Hospital
4 Department of Ophthalmology, Harvard Medical School/MEEI 243 Charles Street, Boston, MA
02114, USA
Abstract
Blood vessel formation in the vertebrate eye is a precisely regulated process. In the human retina,
both an excess and a deficiency of blood vessels may lead to a loss of vision. To gain insight into
the molecular basis of vessel formation in the vertebrate retina and to develop pharmacological means
of manipulating this process in a living organism, we further characterized the embryonic zebrafish
eye vasculature, and performed a small molecule screen for compounds that affect blood vessel
morphogenesis. The screening of approximately 2000 compounds revealed four small molecules that
at specific concentrations affect retinal vessel morphology but do not produce obvious changes in
trunk vessels, or in the neuronal architecture of the retina. Of these, two induce a pronounced
widening of vessel diameter without a substantial loss of vessel number, one compound produces a
loss of retinal blood vessels accompanied by a mild increase of their diameter, and finally one other
generates a severe loss of retinal vessels. This work demonstrates the utility of zebrafish as a screening
tool for small molecules that affect eye vasculature and presents several compounds of potential
therapeutic importance.
Keywords
Blood; Circulation; Intraocular; Hyaloid; Vasculature; Angiogenesis; Chemical; Disease
1. Introduction
The zebrafish has gained considerable importance as a model for the studies of vertebrate
development. The small size, rapid external embryogenesis, and the transparency of the embryo
during early stages of embryogenesis all benefit the efforts to use this organism in
developmental studies (Kimmel et al., 1995). Similarly, the identification of hundreds of
mutant strains facilitates the study of genetic process that regulate development (Amsterdam
et al., 2004; Driever et al., 1996; Haffter et al., 1996). More recently, the sequencing of the
genome and the availability of reverse genetic methods further strengthened the zebrafish
*corresponding author: Tel: +1 617 573 4372, Fax: +1 617 573 4290, email: jarema_malicki@meei.harvard.edu.
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers
we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting
proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could
affect the content, and all legal disclaimers that apply to the journal pertain.
NIH Public Access
Author Manuscript
Mech Dev. Author manuscript; available in PMC 2010 May 1.
Published in final edited form as:
Mech Dev. 2009 ; 126(5-6): 464–477. doi:10.1016/j.mod.2009.01.002.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
model (Nasevicius and Ekker, 2000; Wienholds et al., 2002). Importantly, the same
characteristics that make the zebrafish suitable for genetic experiments: small size, rapid
development, and transparency, make it also exceptionally useful for small molecule screens
(Peterson et al., 2000; Tran et al., 2007; Zon and Peterson, 2005). In these studies, small batches
of embryos are exposed to many thousands of different chemical compounds and analyzed for
developmental changes. Such an approach can be applied either to wild-type embryos or to
carriers of genetic defects that phenocopy human abnormalities. In the latter case, it can be a
powerful way to identify chemicals of potential therapeutic importance (North et al., 2007).
In the eyes of most vertebrates, an intricate network of blood vessels supplies oxygen and
nutrients to the retina. The importance of this system is underscored by the fact that retinal
vascularization defects are seen in many human diseases (Grunwald et al., 1998; Killingsworth
et al., 1990; Ross et al., 1998; Weber et al., 1994). The hyaloid, retinal, and choroidal
vasculatures are the three main blood supply systems in the eye of most mammals. The hyaloid
vasculature is the first to form and exists transiently only (Saint-Geniez and D’Amore, 2004).
Hyaloid vessels enter the retina through the optic fissure and form a dense network around the
lens. Later during development, hyaloid vessels regress and are replaced by the retinal
vasculature (Saint-Geniez and D’Amore, 2004; Smith, 2004; Zhu et al., 1999). The genes
Wnt7b, Fz4, and Lrp5, have been shown to regulate this process in mice (Kato et al., 2002;
Lang and Bishop, 1993; Lobov et al., 2005; Xu et al., 2004). Failure of hyaloid regression in
the human eye (Smith, 2004; Zhu et al., 1999) leads to a pathological condition known as
persistent fetal vasculature (PFV) (Goldberg, 1997). The vasculature of the mature mammalian
eye consists of two separate blood vessel networks: the retinal and the choroidal vasculature.
The first of these is made up of two components: the superficial primary, and the deep secondary
vessel system (Kato et al., 2002; Lang and Bishop, 1993; Xu et al., 2004). The deeper plexus
originates from the primary one as vessels that penetrate into the layers of retinal neurons and
branch along the inner and outer surfaces of the inner nuclear layer (Kato et al., 2002; Lang
and Bishop, 1993; Xu et al., 2004). Finally, the choroidal circulation is closely associated with
the pigmented epithelium and in most mammals supplies oxygen and nutrients to the
photoreceptor cell layer. Defects in this set of vessels are associated with Age-Related Macular
Degeneration (AMD) (Grunwald et al., 1998).
Efforts to characterize the zebrafish retinal vasculature revealed that a network of vessels first
forms between the retina and the lens, similar to many other vertebrates (Alvarez et al.,
2007). In contrast to retinae of many mammals, however, it is thought that the embryonic
vasculature of the zebrafish eye does not degenerate and instead transitions into a mature
vascular network. Moreover, the retinal vasculature appears to be confined to the inner surface
of the retina, as deep vessels embedded into layers of retinal neurons have not been reported.
Several chemically-induced zebrafish mutants display retinal vessel defects, providing an
opportunity to study the genetic basis of vasculature formation (Alvarez et al., 2007). Here we
use two zebrafish transgenic lines; fli1:EGFP, and flk1:GFP (Choi et al., 2007; Lawson and
Weinstein, 2002), to further investigate the development of retinal vasculature, and to
demonstrate that zebrafish embryos can be effectively used in small molecule screens to
identify medically-relevant compounds affecting blood vessel development in the eye.
2. Results
2.1. Vasculature development in the wild-type retina
The zebrafish optic primordium evaginates from the forebrain region around the 6–7 somite
stage, takes up a wing-like shape by the 9-somite stage, and reorients its position to achieve a
vertical orientation by 12 somites (reviewed in Avanesov and Malicki, 2004). Following that,
the eye cup invaginates and the choroid fissure forms at the anterior rim of the eye by the 20
somite stage, or ca. 18 hours postfertilization (hpf). Throughout early embryogenesis, the eye
Kitambi et al. Page 2
Mech Dev. Author manuscript; available in PMC 2010 May 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
primordium consists of mitotically active cells. The first to become postmitotic are ganglion
cell progenitors, which exit the cell cycle at around 27 hpf, marking the onset of retinal
neurogenesis (Hu and Easter, 1999; Nawrocki, 1985). This is followed by the appearance of
interneurons and photoreceptor cells, resulting in a functional retina by ca. 3 dpf (Easter and
Nicola, 1996). It is not well understood how these events correlate with the appearance of the
retinal vasculature. Previous studies reported that blood vessels are present around the medial
side of the lens by 60 hpf, and gradually spread laterally to cover most of the lens surface
(Alvarez et al., 2007). To our knowledge, earlier events have not been, however, described so
far.
To determine the onset of blood vessel formation during early eye morphogenesis, we used
two transgenic lines that express fluorescent reporter proteins in the vascular system: the
fli1:EGFP line that carries the EGFP gene driven by the fli1 promoter (Lawson and Weinstein,
2002), and the flk1:GFP line, expressing GFP under the control of the flk1 regulatory sequences
(Choi et al., 2007). The fli1 gene encodes an ETS family transcription factor expressed in the
ventral mesoderm by 12 hpf, and subsequently detected in all the endothelial vessels (Melet et
al., 1996; Meyer et al., 1993; Thompson et al., 1998). The zebrafish flk1 is a homologue of the
mammalian VEGF receptor, KDR, belongs to the family of receptor tyrosine kinases, and is
also expressed at early stages of blood vessel formation (Choi et al., 2007; Thompson et al.,
1998). The two transgenic lines display similar, if not identical, GFP expression patterns in the
retina. We first investigated fli1:EGFP expression at 18 hpf and found that as previously
reported it is present in cranial and trunk blood vessels. We did not, however, detect GFP signal
in the zebrafish eye at this stage (Fig. 1A), indicating that the vasculature is most likely absent.
By 24 hpf, however, fli1:EGFP-positive cells are seen in the choroid fissure area and behind
the lens (Fig. 1B). This expression pattern suggests that the fli1:EGFP cells may enter the retina
through choroid fissure. By 28 hpf, the GFP-positive cells appear to extend inward from the
choroid fissure and occupy an area behind the lens (Fig. 1C). These cells most likely form the
first rudiment of the retinal vasculature, hereafter referred to as the intraocular vasculature. At
about the same time, a group of GFP-positive cells appears on the retinal surface directly
opposite to the choroid fissure region, in the so-called posterior groove region (red arrow in
Fig. 1C). These cells are likely to contribute to the surface vasculature that is described below.
By 48 hpf, a network of vessels surrounds the medial side of the zebrafish lens (Fig. 1D, E).
During the next 24 hours, this network expands towards lens equator, where it merges into a
single intraocular ring vessel that runs around the lens (red arrowheads in Fig. 1D, E, G, H, J,
K and Fig. 2D, F). During the same period, a vessel system forms on the external surface of
the developing zebrafish eye. It includes three radial vessels, here designated as the nasal, the
dorsal, and the ventral radial vessel (red arrows in Fig. 1F), which merge into another ring
vessel around the lens circumference, in this case on the surface of the eye. The intraocular
and surface vessel systems connect through a single duct that extends from the ventral region
of the intraocular vasculature and connects to the surface ring vessel in the vicinity of its
junction with the ventral radial vessel (asterisk in Fig 1D, G, H, I and in Fig. 2B, C).
Between 48 and 144 hpf, intraocular vessels undergo remodeling so that their trajectories
become less convoluted (Fig. 1D–K and Fig. 2D, F). At 144 hpf, the arrangement of vessels
around the lens resembles fingers holding a tennis ball (Fig. 1K). A similar radial configuration
of intraocular vessels is seen at 30 dpf (Fig. 1N), and becomes even more obvious in adult
individuals (Alvarez et al., 2007). Although we did not follow this segment of vasculature in
detail, we note that choroidal vessels form a dense polygonal network enveloping the outer
surface of the eye by 9 dpf (Fig. 1M and Fig. 2E).
Blood circulation in the retina is clearly visible by 72 hpf both in the surface (yellow arrows
in Fig. 1F, movie 1) and in the intraocular vessels (movie 2). In the intraocular vasculature
Kitambi et al. Page 3
Mech Dev. Author manuscript; available in PMC 2010 May 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
system, blood is supplied by a single duct that runs along the optic nerve (white arrows in Fig.
1I, K), flows around the lens and then is directed through the connecting vessel into the surface
vasculature (Fig. 1G). In the surface vasculature, blood enters through the nasal vessel and
leaves the eye through the ventral and dorsal vessels (Fig. 1F, yellow arrows).
2.2. Small molecule screen
Previous pharmacological screens in zebrafish identified small molecules affecting
development, regeneration, and metabolism (Mathew et al., 2007; Peterson and Fishman,
2004; Peterson et al., 2004; Yu et al., 2008). This approach has not been used, however, to
screen for compounds affecting the retina. To develop standard assay conditions for a small
molecule screen on the zebrafish retina, we used the fli1:EGFP transgenic line to identify
compounds affecting the zebrafish retinal vasculature. Around 2000 small molecules from The
Spectrum library (Microsource Discovery Systems Inc.) were used to treat embryos at the
pectoral fin stage. Embryos were screened for changes in the appearance of retinal blood vessels
at several stages, ranging from 3 to 6 dpf. At the concentration tested, 20 compounds resulted
in embryonic lethality, 41 caused a loss of EGFP expression but did not affect blood flow, and
10 compounds induced an abnormal morphology in the retinal vasculature. Following a
rescreen of these 10 compounds, 5 were found to result in reproducible phenotypes largely
specific to the retina, ranging from a widening and fusion of vessels to a nearly complete loss
of retinal vasculature (Fig. 3). To determine whether these defects are related to changes in the
neural retina, we analyzed the architecture of retinae treated with these compounds on
histological sections. One of the 5 compounds produced a severe disorganization of the retina
at all concentrations tested, another one produced changes at higher concentrations only, and
the remaining 3 did not affect the organization of the retinal layering at all concentrations
analyzed (Fig. 4C). For all 5 compounds, following exposure at ca. 2.5 hpf, we identified a
range of concentrations that cause vasculature defects in the retina but not in the trunk (Fig. 3,
Table 1), indicating a degree of specificity.
The 5 compounds that reproducibly affect the retinal vasculature are: enalapril maleate,
pyrogallin, albendazole, mebendazole and zearalenone (Fig. 3). Enalapril maleate and
zearalenone produce an increase in the diameter of early ocular vessels, but do not obviously
reduce the number of vessels (Fig. 4A). Pyrogallin also causes an increase in the diameter of
vessels but in addition it produces a reduction of blood vessel number by ca. 50%. Finally,
albendazole and mebendazole dramatically reduce the number of vessels by over 80%. Both
compounds occasionally also produce an increase in the diameter of the few vessels that remain
intact in the treated retinae (Fig. 4A). Intraocular blood flow stops following exposure to
albendazole and mebendazole, while blood flow in the trunk and tail is not affected.
To determine whether eye-specific effects of the above 5 compounds are due to the fact that
trunk vessels are more mature and hence more stable at the pectoral fin stage (2.5 dpf), we used
these compounds to treated embryos from the 20-somite stage to ca. 2.5 dpf, a developmental
period characterized by a rapid expansion of the intersegmental vasculature (Isogai et al.,
2003). This is hereafter referred to as the early treatment, while compound addition at 2.5 dpf
is referred to as the late treatment. The effect on trunk intersegmental vessels varies depending
on the compound used. Enalapril maleate, zearalenone, and pyrogallin do not produce defects
in the trunk vasculature at concentrations that cause retina-specific changes following the late
treatment (Table 1). Albendazole and mebendazole are more toxic following the early
treatment, compared to the late treatment. We did, however, identify one concentration of
albendazole that does not produce changes in the trunk vasculature following an early
treatment, although it affects eye vasculature following the late one. Finally, mebendazole
produces at least a partial vessel loss at all concentrations tested. These results indicate that in
general the early trunk vasculature is more sensitive to pharmacological treatment. In the case
Kitambi et al. Page 4
Mech Dev. Author manuscript; available in PMC 2010 May 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
of one compound, mebendazole, its strong effect on the eye but not the trunk vasculature
following the late treatment may be due to a relative immaturity of eye vessels at this stage.
Alternatively, retinal blood vessel defect may be secondary to a general loss of neuronal
architecture in the eye.
Enalapril maleate is an angiotensin converting enzyme (ACE) inhibitor, which prevents the
synthesis of angiotensin II (Davies et al., 1984; Patchett et al., 1980). This compound is used
to treat high blood pressure, heart and renal abnormalities (Bicket, 2002). Enalapril acts on
blood vessels and relaxes them, thereby reducing blood pressure (Bicket, 2002). In zebrafish,
this compound is toxic at higher concentrations and causes embryonic lethality (Table 1). At
lower concentrations, it causes a widening of intraocular blood vessels (Fig. 3, 4 and Table 1),
while vessel thickness in the trunk does not display this effect even following an early treatment
at the 20-somite stage. To test whether enalapril maleate activity in zebrafish is mediated via
the inhibition of ACE, we performed morpholino knockdown of the ACE gene. This
experiment did not result in any obvious changes of blood vessel morphology in the eye,
possibly due to an incomplete inhibition of the ACE expression (Fig. S1). Alternatively,
enalapril maleate acts through an ACE-independent mechanism in retinal vasculature.
Zearalenone, a mycotoxin, also causes an increase of intraocular vessel diameter. Zearalenone
and its derivatives display estrogenic activity as they bind to estrogen receptors (Zinedine et
al., 2007). In zebrafish, exposure to zearalenone increases vessel diameter in the intraocular
vasculature (Table 1). The trunk vasculature remains, however, unaffected following
treatments both at 20 somites and at 2.5 dpf (Fig. 3, 4, Table 1, and data not shown). Exposure
to higher doses of zearalenone is toxic to embryos (Table 1). Staining with an antibody to
phosphorylated histone H3, an indicator of cell proliferation (Pujic and Malicki, 2001), does
not reveal obvious changes in cell proliferation patterns, suggesting that other mechanisms are
responsible for the change in blood vessel diameter (data not shown).
In contrast to the two compounds discussed above, pyrogallin, promotes loss of about half of
retinal blood vessels (Fig. 3, 4A). Vessels that persist frequently cluster together (Fig. 3). Again
in the case of this compound, higher doses are toxic to embryos (Table 1). At lower doses, only
intraocular vessels seem to be altered as trunk vessel diameter remains normal following
chemical treatment at 2.5 dpf (Fig. 3, 4B). A treatment at the 20 somite stage causes either an
absence or a delay of trunk vessel formation at higher concentrations of the chemical. The
lowest concentration that produces eye vasculature defects (Table 1), does not, however, affect
the trunk vasculature even following the early treatment. Fusion of vessels is sometimes
produced by enalapril maleate, but this phenotype appears to be more frequent in pyrogallin
treated retinae.
Finally, albendazole and mebendazole are structurally–related, broad spectrum antihelminthic
compounds and have been shown to inhibit fumarate reductase, a helminth-specific enzyme
(Barrowman et al., 1984; Morgan et al., 1993; Venkatesan, 1998). They have been shown to
bind to colchicine sensitive sites of tubulin and inhibit its assembly into microtubules (Morgan
et al., 1993). Both albendazole and mebendazole block the uptake of glucose in nematodes
(Venkatesan, 1998). At the dose of 0.12× albendazole is inactive (data not shown), but at twice
this concentration it causes blood vessel defects in the retina but not in the trunk (Table 1). At
this concentration, trunk vasculature defects are not observed even following a treatment at 20
somites. Following albendazole treatment, ocular blood vessels collapse, their tissue forms
disorderly lumps, and in some cases it is absent altogether (Fig. 3, 4 and Table 1). Mebendazole
induces similar phenotypic changes: it causes a drastic reduction or the absence of the
vasculature in the retina (Fig. 3, 4). As stated above, however, mebendazole adversely affects
the organization of retinal layers, and thus it is possible that the vasculature defect that it induces
is secondary. Mebendazole treatment at 2.5 dpf produces a vessel loss in the eye but not in the
Kitambi et al. Page 5
Mech Dev. Author manuscript; available in PMC 2010 May 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
trunk at two concentrations tested (Table 1). Both of these concentrations, however, disrupt
the trunk vasculature when applied at the 20 somite stage. In contrast to the other three
compounds, albendazole and mebendazole predominantly produce a loss of vessels. In some
cases vessels appear entirely absent, although in most retinae, GFP-positive strands and clusters
of cells persist, most likely a remnant of vasculature. Given its retinal and trunk vasculature
phenotypes, mebendazole is the least specific and appears to display toxicity in many tissues.
Albendazole and mebendazole produce similar phenotypic changes in the zebrafish embryo
and are structurally related. Both are very potent at inducing blood vessel loss. The toxicity of
mebendazole is a serious disadvantage as it reduces the therapeutic potential of this compound.
In an effort to separate toxicity from the ability to induce vessel loss, we searched for additional
structurally related compounds. Chemicals that share structural similarity with these two
compounds were identified in the small molecule database available on-line at
www.hit2lead.com. This database contains of a collection of around 700,000 small molecules
distributed commercially and used for biological screening. Searching of this database resulted
in the identification of 8 compounds, 5 of which were tested on zebrafish embryos. The five
compounds are: methyl{5-chloro-6-[(1-chloro-2-naphthyl)oxy]-1H-benzimidazol-2-yl}
carbamate (MCBC), methyl[5-(2-thienylcarbonyl)-1H-benzimidazol-2-yl]carbamate
(MBC), methyl{6-chloro-5-[(4-chloro-1-naphthyl)oxy]-1H-benzimidazol-2-yl}carbamate
(MCNBC), butyl 2-({2-[(methoxycarbonyl)amino]-1H-benzimidazol-5-yl}carbonyl)
benzoate (BBC), and ethyl 1H-benzimidazol-2-ylcarbamate (EBC) (Fig. 5). For simplicity,
we will refer to these chemicals using abbreviations provided in parentheses above. Four out
of the 5 compounds produce phenotypes that at least at some concentrations are specific to the
intraocular vasculature following the late treatment (Table 2). Similar to albendazole and
mebendazole, these chemicals produce a reduction in the number of intraocular blood vessels.
The strength of phenotypic changes induced by these compounds at the highest specific
concentration tested is quantitated in Fig 5: while MCNBC and EBC produce the complete
absence of retinal vessels, MCBC and BBC treatment results only a partial vessel loss (Fig. 5,
Table 2). The fifth compound, MBC, appears to be extremely potent, and even at very high
dilutions causes a complete vessel loss in the eye. MBC lacks specificity, however, as even at
the lowest effective concentration it affects both eye and trunk vessels. It is lethal to the embryo
at nearly all concentrations that produce eye vasculature defects (Table 2). At the dilution of
0.05× (data not shown), MBC does not produce any obvious phenotypic changes. These 5
compounds display varying impact on the organization of retinal neurons (Fig. 5 and Table 2).
MBC causes a severe disorganization of retinal architecture at all effective concentrations (Fig.
5), indicating a lack of specificity, MCNBC and EBC cause a partial disruption of retinal layers,
and, finally, BBC and MCBC do not affect the retinal architecture in any obvious way.
3. Discussion
One attractive feature of the zebrafish retina is its potential use as a model of events that occur
in human eye development. It is thus important to determine whether zebrafish vasculature is
morphologically related to the human one. Indeed, our studies indicate that some
morphological and developmental characteristics of zebrafish retinal vasculature are similar
to those in primates. Others, however, differ. The arrangement of early retinal vessels in
zebrafish, for example, is similar to that of the hyaloid vasculature of the human embryo, where
it has been compared to strings of an open parachute (Mutlu and Leopold, 1964; Zhu et al.,
1999). A major difference between the zebrafish and primates, on the other hand, is a complete
regression of the hyaloid vasculature by the time of birth in the latter group of animals
(Fruttiger, 2002: Dorrell, 2002). The transition from embryonic to mature vasculature in
zebrafish is much less dramatic, and involves a gradual change in the adhesive properties of
blood vessels, which at the onset of their development adhere to the lens (Fig. 1D–L and Fig.
2 A–D, F–G) and by 30 dpf are associated with the inner surface of the retina (Alvarez et al.,
Kitambi et al. Page 6
Mech Dev. Author manuscript; available in PMC 2010 May 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
2007, and Fig. 1N). Another obvious difference between zebrafish and mammals is the absence
of the secondary vessel plexus, which penetrates neuronal formations of primate retinae
(Provis, 2001). One has to note, however, that the pattern of blood vessels varies greatly even
among mammals: while primates feature retinae entirely covered by a network of blood vessels,
marsupial retinae are avascular (Wise et al., 1971).
Angiogenesis in the retina is a very carefully regulated process. Both an overproduction of
blood vessels as well as their deficiency lead to eye disease. We identified at least two categories
of chemicals that affect retinal vasculature: compounds that cause a collapse and a loss of
vessels as well as compounds that cause a widening of vessel diameter. These compounds may
help to understand mechanisms that underlie the formation and patterning of blood vessels,
and each of these two categories can be potentially applied to alleviate the symptoms of a
different class of human diseases. For example, persistent fetal vasculature is a human
abnormality that involves a loss or a slowdown of hyaloid vasculature regression (Goldberg,
1997). One can thus imagine that albendazole or related chemicals could be used to induce a
degeneration of these vessels in children affected by this abnormality. Similarly, one can
imagine that this class of compounds could be used to slow down the progression of ocular
tumors. Zearalenone, on the other hand, appears to increase the diameter of blood vessels but
does not cause changes in their number, and thus could be used to treat different forms of retinal
blood vessel occlusion. Branch retinal vein occlusion, the second most common vascular
abnormality in the retina, is one example of a disease that could be alleviated by inducing an
increase of blood vessel diameter (McIntosh et al., 2007). Importantly, when tested in zebrafish,
albendazole and zearalenone appear to be more potent in the retina, compared to vessels in
other organs. This characteristic is desirable for chemicals that can be potentially applied to
treat eye disease.
Small molecule screens frequently result in the identification of compounds that produce a loss
of tissue phenotype. This is often due to their toxicity or the propensity to cause a developmental
delay. In the screen presented here, we have found both chemicals that cause vessel loss, and
compounds that enhance the wild-type phenotype: increase blood vessel diameter. The mode
of action of chemicals that cause a gain of a phenotypic feature is frequently more specific,
and tends be relevant to developmental or physiological processes confined to an organ or
tissue. Indeed, the phenotypes of the compounds that increase blood vessel diameter, Enalapril
Maleate, and Zearalenone, appear confined to the ocular vasculature as they do not disrupt
retinal architecture in any obvious way. Likewise, they do not affect the trunk vasculature even
following a treatment at the 20-somite stage. In contrast to that, 2 of the 3 compounds that
cause blood vessel loss also affect the organization of retinal neurons. In the case of one
chemical, mebendazole, vascular and neuronal phenotypes cannot be easily separated by
varying its concentration. This is a negative factor that reduces therapeutic potential of
mebendazole.
Although the strength of mebendazole-induced blood vessel loss is impressive, the therapeutic
potential of this compound is negatively impacted by the lack of specificity. In an effort to
reduce toxicity while preserving retina-specific blood vessel activity, we tested 5 compounds
related to albendazole and mebendazole (Fig. 5). Ethyl 1H-benzimidazol-2-ylcarbamate (EBC)
is the moiety shared by albendazole, mebendazole, and all other compounds tested. This moiety
alone is sufficient to produce a retina-specific vascular phenotype, although its potency is
lower, compared to the two original isolates (Table 2). The difference in potency between EBC
and albendazole is seen in the minimum amount needed to affect retinal blood vessels (Table
1 and 2). In excess of 10-fold higher molar concentration of EBC is required to induce an eye
phenotype, compared to albendazole. On the basis of this parameter, the addition of methyl N-
propyl sulphide group to the EBC moiety (as seen in albendazole) and the addition of an
acetophenone group (as seen in mebendazole) both result in an increased potency. If one defines
Kitambi et al. Page 7
Mech Dev. Author manuscript; available in PMC 2010 May 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
specificity as the strongest retinal phenotype that is not accompanied by trunk vasculature
defects, EBC and albendazole display similar specificity as they both cause a complete or a
nearly-complete elimination of blood vessels in the retina, without affecting the trunk
vasculature (Fig. 5). Albendazole, however, appears to be more specific when one considers
retinal architecture: at all effective concentrations, EBC causes at least a partial disorganization
of retinal neurons. Other EBC modifications seem to decrease specificity, compared to
albendazole. While BBC and MCBC do not affect the organization of retinal neurons, they
display lower specificity as defined above. MCB and MCNBC, on the other hand, cause a
disorganization of retinal architecture. The addition of 2-acetylthiophene group in MBC causes
a dramatic increase in potency but severely eliminates specificity: even at the lowest effective
concentration tested (X in Table 2), MBC phenotype affects both retinal and trunk vessels
(Table 2, and data not shown). The toxicity of this compound is also much higher as evaluated
by the overall lethality of embryos, compared to other chemicals tested.
Once promising chemicals are identified, a major challenge is to determine their mode of action.
Several strategies can be used to accomplish this goal. In some cases, the phenotype resulting
from a chemical treatment is informative enough to suggest candidate molecular pathways that
may be affected (Sachidanandan et al., 2008). When this is not a possible, a variety of
biochemical approaches are available, including affinity purification, the use of protein
microarrays, cell microarrays, and phage display (reviewed in Sleno and Emili, 2008;
Terstappen et al., 2007). Affinity purification is one option that has been frequently used for
the purification of target proteins from cultured cells or animal tissues (Bach et al., 2005;
Tanaka et al., 2005). This method can be easily adapted to extracts from whole zebrafish
embryos or from specific adult tissues, such as the eye.
Small-molecule screening is a powerful approach to drug discovery. A combination of this
approach with genomic studies, so-called chemogeneomics, promises to be even more
productive (Agrafiotis et al., 2002). The use of zebrafish in this dynamic field provides an
additional exciting dimension, as it allows one for an inexpensive high-throughput testing of
chemicals in the context of an intact organism. In this study, we explore a specific application
of this approach to the retinal vasculature. To our knowledge, an assay of this kind has not
been available so far. Our results suggest that this type of analysis can indeed become an
important addition to the existing genetic, cell biological, and biochemical methodologies.
4. Experimental procedures
4.1. Zebrafish strains
Zebrafish were raised on 14/10 hour light cycle. Embryos were obtained via natural mating,
and staged according to Kimmel et al. (Kimmel et al., 1995). Embryos older than 24 hpf were
treated with 0.03% Phenylthiourea (PTU) to block pigmentation. Transgenic fish expressing
EGFP under the control of fli1 (Tg(fli1:EGFPI)) were obtained from zebrafish resource center
(Oregon, USA). The Tg (flk1:GFP) line was provided by Zygogen Inc. (Atlanta, Georgia,
USA).
4.2. Imaging of zebrafish vasculature and image analysis
To study wild-type development of the ocular vasculature, transgenic zebrafish embryos were
anesthetized with 0.1% Tricane, and transferred onto a 1% Agarose bed in a Petri dish. A few
drops of 1% low melting point agarose were laid over each embryo and embryos was
immediately oriented as appropriate on the dorsal, ventral or lateral side. After agarose
solidified, 5 – 10 ml of egg water with 0.03% PTU was added to the Petri dish. The vasculature
of embedded embryos was then reconstructed using a Leica SP2 confocal microscope equipped
Kitambi et al. Page 8
Mech Dev. Author manuscript; available in PMC 2010 May 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
with a 40× water immersion lens. Images were collected and processed with ImageJ and Adobe
Photoshop Software.
To reveal details of wild-type vascular architecture, embryos were fixed in 4%
paraformaldehyde in PBST (phosphate buffered saline, 0.1% Tween) for 2 hrs, washed 2 times,
5 min. each, in PBST, and infiltrated with a medium containing equal amounts of 30% sucrose
and Neg-50 frozen section medium (Richard-Allen Scientific) overnight at 4°C. Subsequently,
embryos were embedded in neg-50 frozen section medium and 12 μm of sections were
collected. Sections were dried at room temperature for 30 min., washed 2 times, 5min each, in
PBST, coverslipped, and imaged using Leica SP2 confocal microscope equipped with a 40×
lens. Digital images were processed with Adobe Photoshop Software.
To generate movies showing blood circulation in the retina, embryos were incubated in egg
water containing 0.03% PTU until 72 hpf, transferred onto a 1% Agarose bed, immobilized as
above, and oriented either lateral side up (to image surface circulation) or ventral side up (to
image early ocular circulation). Blood circulation was recorded using a Leica SP2 confocal
microscope and Leica imaging software. The data were then exported at 5 frames per second
into AVI movie format.
To screen for effects of small molecules on the retinal vasculature, embryos were anesthetized
with 0.1% Tricane and transferred to depression glass slide filled with methyl cellulose.
Embryos were positioned on their sides and examined using a Zeiss Axiovert 200 inverted
microscope equipped with a 10× lens. Images of embryos were acquired with a cooled CCD
camera (Princeton Instrument MicroMAX) operated by LabView Software package (National
Instruments, Austin, TX), and processed using Adobe Photoshop Software. To evaluate the
number of blood vessels per retina, we counted the number of vessel segments that met the
following criteria: were characterized by roughly parallel walls, displayed distinct lumen, were
open at both ends, and stretched for a minimum of 15 arbitrary length units (measured in pixels
on Photoshop images). The results of these counts are provided in Fig. 4. Clumps of GFP-
positive tissue that did not have a lumen or were not open at both ends were considered
“collapsed vessels” and were not counted. To compare the width of vessels in wild-type and
chemically-treated retinae, the diameter of the widest vessel segment as defined above was
measured from each retina. A line along the long axis of this segment was drawn (such as
yellow lines in Fig. 3A) and the inner diameter was measured in its widest portion (other than
widening of its ends) by drawing a line perpendicular to segment’s long axis (red line in Fig.
3).
4.3. Small molecule screen
Two thousand compounds from the Spectrum Collection (Microsource Discovery Systems
Inc.) of small molecules were screened on zebrafish embryos placed in 96-well clear bottom
plates (Corning Inc.) in egg water containing PTU. Before screen compounds were added,
medium was replaced with 200ul of fresh PTU-containing egg water. Since the small molecules
were dissolved in DMSO, a series of DMSO concentrations was tested for the ability of affect
zebrafish embryogenesis. As ≥6μl of DMSO in 200μl of egg water is toxic to embryos, 2μl or
less was used in our experiments. Two variants of the screen were performed. In the first variant,
embryos were kept at the room temperature for the first 24 hours (ca. until the 20 somite stage),
and for each chemical tested ca. 100 nl of stock solution (10mM in DMSO) were added by pin
transfer. Embryos were then transferred to 28°C and their development was periodically
documented directly in 96-well plates at 24, 48, and 72 hpf using a 10× lens on a Zeiss Axiovert
200 Inverted microscope. In the second variant of the screen, embryos were also transferred
to 28°C after 24 hours of development at the room temperature, but chemicals were added at
68 hours after fertilization. Given the delay caused by storage at room temperature during the
Kitambi et al. Page 9
Mech Dev. Author manuscript; available in PMC 2010 May 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
first 24 hours of development, this corresponds to ca. pectoral fin stage. The phenotype was
periodically documented at 72, 96, 120, and 144 hpf as described above.
The first variant of the screen produced very high lethality and no compounds of interest were
identified. The second variant resulted in the identification of 5 compounds that produce
specific phenotypic changes in the eye vasculature. Chemicals that produced phenotypic
changes in the initial rounds of screening were purchased in a larger quantity, and 10 mg of
each was dissolved in 2ml of DMSO. To determine the minimum amount of each compound
sufficient to produce a phenotype, a series of dilutions was prepared in egg water containing
PTU (Table 1). These dilutions were tested on embryos as described above.
As two related chemicals, albendazole and mebendazole, produced similar phenotypes, we
decided to test other compounds structurally related to these two. The region shared between
albendazole and mebendazole was used to search a database of available chemicals
(www.hit2lead.com). This search resulted in the identification of 8 compounds, which contain
the substructure shared between albendazole and mebendazole. Out of these, 5 compounds
were selected for further testing. based on differences from the query structure. 5 mg of each
were obtained from ChemBridge corporation and dissolved in 1ml of DMSO. This stock
solution was diluted by adding 4, 3, 2, 1, 0.5, or 0.25μl to 200μl of with egg water and tested
for phenotypic effects on embryos. Phenotypic changes were monitored and recorded as above
(Table 2).
4.4 Morpholino knockdown
Antisense knockdowns were performed using standard protocols, as described previously using
either 5 μg/μl or 9 μg/μl of CATTGATATGATTCATGTACCTGAA splice-site directed
morpholino. Knockdown efficiency was monitored via RT-PCR as described previously
(Tsujikawa and Malicki, 2004), using the primers TTAAAGGTCCCATCCCTGCTCATC and
TTAAAGGTCCCATCCCTGCTCATC.
Supplementary Material
Refer to Web version on PubMed Central for supplementary material.
Acknowledgments
We would like to thank Dr. William F. Sewell from the Department of Otolaryngology at Harvard Medical School
for providing access to an inverted microscope, Dr. Chengtian Zhao for help with designing anti-ACE morpholino,
Drs. Agneta Mode, Arindam Majumdar, and Breandan Kennedy for comments on earlier versions of this manuscript,
Drs. Jan Åke Gustafsson, Agneta Mode, Lotta Hambraeus, Sodertorns Hogskola, and Department of Biosciences and
Medical Nutrition at Karolinska Institutet for funding and support. Drs. Peter Schulter, Amy Doherty, and David Kokel
from Randall Peterson lab as well as Dr. Caroline Shamu of the Institute of Chemistry and Cell Biology at Harvard
Medical School provided valuable technical advice during this work. This project was funded in part by a National
Eye Institute award RO1 EY016859 (to JM).
References
Agrafiotis DK, Lobanov VS, Salemme FR. Combinatorial informatics in the post-genomics ERA. Nat
Rev Drug Discov 2002;1:337–46. [PubMed: 12120409]
Alvarez Y, Cederlund ML, Cottell DC, Bill BR, Ekker SC, Torres-Vazquez J, Weinstein BM, Hyde DR,
Vihtelic TS, Kennedy BN. Genetic determinants of hyaloid and retinal vasculature in zebrafish. BMC
Dev Biol 2007;7:114. [PubMed: 17937808]
Amsterdam A, Nissen RM, Sun Z, Swindell EC, Farrington S, Hopkins N. Identification of 315 genes
essential for early zebrafish development. Proc Natl Acad Sci U S A 2004;101:12792–7. [PubMed:
15256591]
Kitambi et al. Page 10
Mech Dev. Author manuscript; available in PMC 2010 May 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Avanesov A, Malicki J. Approaches to study neurogenesis in the zebrafish retina. Methods Cell Biol
2004;76:333–84. [PubMed: 15602883]
Bach S, Knockaert M, Reinhardt J, Lozach O, Schmitt S, Baratte B, Koken M, Coburn SP, Tang L, Jiang
T, Liang DC, Galons H, Dierick JF, Pinna LA, Meggio F, Totzke F, Schachtele C, Lerman AS, Carnero
A, Wan Y, Gray N, Meijer L. Roscovitine targets, protein kinases and pyridoxal kinase. J Biol Chem
2005;280:31208–19. [PubMed: 15975926]
Barrowman MM, Marriner SE, Bogan JA. The fumarate reductase system as a site of anthelmintic attack
in Ascaris suum. Biosci Rep 1984;4:879–83. [PubMed: 6518278]
Bicket DP. Using ACE inhibitors appropriately. Am Fam Physician 2002;66:461–8. [PubMed:
12182524]
Choi J, Dong L, Ahn J, Dao D, Hammerschmidt M, Chen JN. FoxH1 negatively modulates flk1 gene
expression and vascular formation in zebrafish. Dev Biol 2007;304:735–44. [PubMed: 17306248]
Davies RO, Gomez HJ, Irvin JD, Walker JF. An overview of the clinical pharmacology of enalapril. Br
J Clin Pharmacol 1984;18(Suppl 2):215S–229S. [PubMed: 6099737]
Driever W, Solnica-Krezel L, Schier AF, Neuhauss SC, Malicki J, Stemple DL, Stainier DY, Zwartkruis
F, Abdelilah S, Rangini Z, Belak J, Boggs C. A genetic screen for mutations affecting embryogenesis
in zebrafish. Development 1996;123:37–46. [PubMed: 9007227]
Easter S, Nicola G. The development of vision in the zebrafish (Danio rerio). Dev Biol 1996;180:646–
663. [PubMed: 8954734]
Goldberg MF. Persistent fetal vasculature (PFV): an integrated interpretation of signs and symptoms
associated with persistent hyperplastic primary vitreous (PHPV). LIV Edward Jackson Memorial
Lecture. Am J Ophthalmol 1997;124:587–626. [PubMed: 9372715]
Grunwald JE, Hariprasad SM, DuPont J, Maguire MG, Fine SL, Brucker AJ, Maguire AM, Ho AC.
Foveolar choroidal blood flow in age-related macular degeneration. Invest Ophthalmol Vis Sci
1998;39:385–90. [PubMed: 9477998]
Haffter P, Granato M, Brand M, Mullins MC, Hammerschmidt M, Kane DA, Odenthal J, van Eeden FJ,
Jiang YJ, Heisenberg CP, Kelsh RN, Furutani-Seiki M, Vogelsang E, Beuchle D, Schach U, Fabian
C, Nusslein-Volhard C. The identification of genes with unique and essential functions in the
development of the zebrafish, Danio rerio. Development 1996;123:1–36. [PubMed: 9007226]
Hu M, Easter SS. Retinal neurogenesis: the formation of the initial central patch of postmitotic cells. Dev
Biol 1999;207:309–321. [PubMed: 10068465]
Isogai S, Lawson ND, Torrealday S, Horiguchi M, Weinstein BM. Angiogenic network formation in the
developing vertebrate trunk. Development 2003;130:5281–90. [PubMed: 12954720]
Kato M, Patel MS, Levasseur R, Lobov I, Chang BH, Glass DA 2nd, Hartmann C, Li L, Hwang TH,
Brayton CF, Lang RA, Karsenty G, Chan L. Cbfa1-independent decrease in osteoblast proliferation,
osteopenia, and persistent embryonic eye vascularization in mice deficient in Lrp5, a Wnt coreceptor.
J Cell Biol 2002;157:303–14. [PubMed: 11956231]
Killingsworth MC, Sarks JP, Sarks SH. Macrophages related to Bruch’s membrane in age-related macular
degeneration. Eye 1990;4(Pt 4):613–21. [PubMed: 2226993]
Kimmel CB, Ballard WW, Kimmel SR, Ullmann B, Schilling TF. Stages of embryonic development of
the zebrafish. Dev Dyn 1995;203:253–310. [PubMed: 8589427]
Lang RA, Bishop JM. Macrophages are required for cell death and tissue remodeling in the developing
mouse eye. Cell 1993;74:453–62. [PubMed: 8348612]
Lawson ND, Weinstein BM. In vivo imaging of embryonic vascular development using transgenic
zebrafish. Dev Biol 2002;248:307–18. [PubMed: 12167406]
Lobov IB, Rao S, Carroll TJ, Vallance JE, Ito M, Ondr JK, Kurup S, Glass DA, Patel MS, Shu W, Morrisey
EE, McMahon AP, Karsenty G, Lang RA. WNT7b mediates macrophage-induced programmed cell
death in patterning of the vasculature. Nature 2005;437:417–21. [PubMed: 16163358]
Mathew LK, Sengupta S, Kawakami A, Andreasen EA, Lohr CV, Loynes CA, Renshaw SA, Peterson
RT, Tanguay RL. Unraveling tissue regeneration pathways using chemical genetics. J Biol Chem
2007;282:35202–10. [PubMed: 17848559]
McIntosh RL, Mohamed Q, Saw SM, Wong TY. Interventions for branch retinal vein occlusion: an
evidence-based systematic review. Ophthalmology 2007;114:835–54. [PubMed: 17397923]
Kitambi et al. Page 11
Mech Dev. Author manuscript; available in PMC 2010 May 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Melet F, Motro B, Rossi DJ, Zhang L, Bernstein A. Generation of a novel Fli-1 protein by gene targeting
leads to a defect in thymus development and a delay in Friend virus-induced erythroleukemia. Mol
Cell Biol 1996;16:2708–18. [PubMed: 8649378]
Meyer D, Wolff CM, Stiegler P, Senan F, Befort N, Befort JJ, Remy P. Xl-fli, the Xenopus homologue
of the fli-1 gene, is expressed during embryogenesis in a restricted pattern evocative of neural crest
cell distribution. Mech Dev 1993;44:109–21. [PubMed: 8155576]
Morgan UM, Reynoldson JA, Thompson RC. Activities of several benzimidazoles and tubulin inhibitors
against Giardia spp. in vitro. Antimicrob Agents Chemother 1993;37:328–31. [PubMed: 8452365]
Mutlu F, Leopold IH. The Structure of Fetal Hyaloid System and Tunica Vasculosa Lentis. Arch
Ophthalmol 1964;71:102–10. [PubMed: 14066026]
Nasevicius A, Ekker SC. Effective targeted gene ‘knockdown’ in zebrafish. Nat Genet 2000;26:216–220.
[PubMed: 11017081]
Nawrocki, W. PhD Thesis Thesis. University of Oregon; Eugine, Oregon: 1985. Development of the
neural retina in the zebrafish, Brachydanio rerio.
North TE, Goessling W, Walkley CR, Lengerke C, Kopani KR, Lord AM, Weber GJ, Bowman TV, Jang
IH, Grosser T, Fitzgerald GA, Daley GQ, Orkin SH, Zon LI. Prostaglandin E2 regulates vertebrate
haematopoietic stem cell homeostasis. Nature 2007;447:1007–11. [PubMed: 17581586]
Patchett AA, Harris E, Tristram EW, Wyvratt MJ, Wu MT, Taub D, Peterson ER, Ikeler TJ, ten Broeke
J, Payne LG, Ondeyka DL, Thorsett ED, Greenlee WJ, Lohr NS, Hoffsommer RD, Joshua H, Ruyle
WV, Rothrock JW, Aster SD, Maycock AL, Robinson FM, Hirschmann R, Sweet CS, Ulm EH, Gross
DM, Vassil TC, Stone CA. A new class of angiotensin-converting enzyme inhibitors. Nature
1980;288:280–3. [PubMed: 6253826]
Peterson RT, Fishman MC. Discovery and use of small molecules for probing biological processes in
zebrafish. Methods Cell Biol 2004;76:569–91. [PubMed: 15602893]
Peterson RT, Link BA, Dowling JE, Schreiber SL. Small molecule developmental screens reveal the
logic and timing of vertebrate development. Proc Natl Acad Sci U S A 2000;97:12965–9. [PubMed:
11087852]
Peterson RT, Shaw SY, Peterson TA, Milan DJ, Zhong TP, Schreiber SL, MacRae CA, Fishman MC.
Chemical suppression of a genetic mutation in a zebrafish model of aortic coarctation. Nat Biotechnol
2004;22:595–9. [PubMed: 15097998]
Provis JM. Development of the primate retinal vasculature. Prog Retin Eye Res 2001;20:799–821.
[PubMed: 11587918]
Pujic Z, Malicki J. Mutation of the zebrafish glass onion locus causes early cell-nonautonomous loss of
neuroepithelial integrity followed by severe neuronal patterning defects in the retina. Developmental
Biology 2001;234:454–69. [PubMed: 11397013]
Ross RD, Barofsky JM, Cohen G, Baber WB, Palao SW, Gitter KA. Presumed macular choroidal
watershed vascular filling, choroidal neovascularization, and systemic vascular disease in patients
with age-related macular degeneration. Am J Ophthalmol 1998;125:71–80. [PubMed: 9437316]
Sachidanandan C, Yeh J, Peteerson Q, Peteerson R. Identification of a Novel Retinoid by Small Molecule
Screening with Zebrafish Embryos. PLOS ONE 2008;3:1–9.
Saint-Geniez M, D’Amore PA. Development and pathology of the hyaloid, choroidal and retinal
vasculature. Int J Dev Biol 2004;48:1045–58. [PubMed: 15558494]
Sleno L, Emili A. Proteomic methods for drug target discovery. Curr Opin Chem Biol 2008;12:46–54.
[PubMed: 18282485]
Smith LE. Pathogenesis of retinopathy of prematurity. Growth Horm IGF Res 2004;(14 Suppl A):S140–
4. [PubMed: 15135797]
Tanaka M, Bateman R, Rauh D, Vaisberg E, Ramachandani S, Zhang C, Hansen KC, Burlingame AL,
Trautman JK, Shokat KM, Adams CL. An unbiased cell morphology-based screen for new,
biologically active small molecules. PLoS Biol 2005;3:e128. [PubMed: 15799708]
Terstappen GC, Schlupen C, Raggiaschi R, Gaviraghi G. Target deconvolution strategies in drug
discovery. Nat Rev Drug Discov 2007;6:891–903. [PubMed: 17917669]
Thompson MA, Ransom DG, Pratt SJ, MacLennan H, Kieran MW, Detrich HW 3rd, Vail B, Huber TL,
Paw B, Brownlie AJ, Oates AC, Fritz A, Gates MA, Amores A, Bahary N, Talbot WS, Her H, Beier
Kitambi et al. Page 12
Mech Dev. Author manuscript; available in PMC 2010 May 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
DR, Postlethwait JH, Zon LI. The cloche and spadetail genes differentially affect hematopoiesis and
vasculogenesis. Dev Biol 1998;197:248–69. [PubMed: 9630750]
Tran TC, Sneed B, Haider J, Blavo D, White A, Aiyejorun T, Baranowski TC, Rubinstein AL, Doan TN,
Dingledine R, Sandberg EM. Automated, quantitative screening assay for antiangiogenic compounds
using transgenic zebrafish. Cancer Res 2007;67:11386–92. [PubMed: 18056466]
Tsujikawa M, Malicki J. Intraflagellar transport genes are essential for differentiation and survival of
vertebrate sensory neurons. Neuron 2004;42:703–16. [PubMed: 15182712]
Venkatesan P. Albendazole. J Antimicrob Chemother 1998;41:145–7. [PubMed: 9533454]
Weber BH, Vogt G, Pruett RC, Stohr H, Felbor U. Mutations in the tissue inhibitor of metalloproteinases-3
(TIMP3) in patients with Sorsby’s fundus dystrophy. Nat Genet 1994;8:352–6. [PubMed: 7894485]
Wienholds E, Schulte-Merker S, Walderich B, Plasterk RH. Target-selected inactivation of the zebrafish
rag1 gene. Science 2002;297:99–102. [PubMed: 12098699]
Wise, G.; Dollery, C.; Henkind, P. The Retinal Circulation. Harper & Row; New York: 1971.
Xu Q, Wang Y, Dabdoub A, Smallwood PM, Williams J, Woods C, Kelley MW, Jiang L, Tasman W,
Zhang K, Nathans J. Vascular development in the retina and inner ear: control by Norrin and
Frizzled-4, a high-affinity ligand-receptor pair. Cell 2004;116:883–95. [PubMed: 15035989]
Yu PB, Hong CC, Sachidanandan C, Babitt JL, Deng DY, Hoyng SA, Lin HY, Bloch KD, Peterson RT.
Dorsomorphin inhibits BMP signals required for embryogenesis and iron metabolism. Nat Chem
Biol 2008;4:33–41. [PubMed: 18026094]
Zhu M, Provis JM, Penfold PL. The human hyaloid system: cellular phenotypes and inter-relationships.
Exp Eye Res 1999;68:553–63. [PubMed: 10328969]
Zinedine A, Soriano JM, Molto JC, Manes J. Review on the toxicity, occurrence, metabolism,
detoxification, regulations and intake of zearalenone: an oestrogenic mycotoxin. Food Chem Toxicol
2007;45:1–18. [PubMed: 17045381]
Zon LI, Peterson RT. In vivo drug discovery in the zebrafish. Nat Rev Drug Discov 2005;4:35–44.
[PubMed: 15688071]
Kitambi et al. Page 13
Mech Dev. Author manuscript; available in PMC 2010 May 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Fig. 1.
Early development of retinal vasculature in zebrafish. Confocal images of GFP expression in
the eyes of fli1:EGFP (B, E, F, J, K) and flk1:GFP (A, C, D, G, H, I, L, M, N) transgenic
zebrafish. The retinal artery or its presumptive primordium are indicated by white arrows. Red
arrows point to the surface vasculature. Red arrowheads indicate the intraocular ring vessel.
Yellow arrowheads indicate the intraocular vessel network, whereas the connection between
the intraocular and surface vessels is indicated by asterisks. Yellow arrows show the direction
of blood flow. (A) GFP-expressing cells are absent the eye at 18 hpf. (B) GFP-positive cells
are seen in the retina by 24 hpf (B, white arrow). (C) By 28 hpf, GFP-positive cells are seen
in the choroid fissure (white arrow), behind the lens, and in the posterior grove (red arrow).
(D, E) By 48 hpf, GFP-positive cells form a network of vessels around the medial side of the
lens, annular collection duct (asterisk) is established, and surface vessels are differentiated.
Retinal blood flow is present by 72 hpf. (F) In the surface vasculature, blood enters through
the nasal vessel (nrv) and exits through the dorsal (drv) and ventral (vrv) vessels. (G – I) Blood
from the intraocular vasculature flows through the annular collection duct (asterisks) into the
surface vessels. (J – K) Intraocular vessels gradually rearrange to form a roughly radial array
by 144 hpf. (L) Intraocular and surface vasculatures at 9 dpf. (M) Choriodal vessels form a
network on the outer surface of the eye at 9 dpf. (N) The eye vasculature at 30 dpf. Circle
indicates the optic disc region. The retina was dissected and mounted on a flat surface to obtain
this image. e, optic lobe; L, lens. In (A–M) anterior is left. In (A–C, G, H, L, F, M, and N)
dorsal is up. Panels (A, B, C, F, H, L and M) show roughly the lateral view of the eye. Panels
(D–E, I, J, and K) show ventral view of the eye.
Kitambi et al. Page 14
Mech Dev. Author manuscript; available in PMC 2010 May 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Fig. 2.
Characterization of early retinal vasculature. Confocal images of cryosections through eyes of
fli1:EGFP transgenic animals. (A – C) Transverse sections through the retina. Intraocular
vessels (yellow arrowheads) wrap around the lens, and are connected to the surface vessel
(asterisk) at 72 hpf. Dorsal is up and lateral to the left. (D) A somewhat oblique longitudinal
section through the region behind the lens reveals a vessel network on the surface of the lens.
Posterior is to the right, lateral is down. (E) A transverse tangential section through the rostral
eye showing the choriodal vessel network at 9 dpf. (F) A transverse section tangential to the
lens showing the intraocular ring vessel (red arrowhead) and the intraocular vessel network
(yellow arrowheads) at 9 dpf. (G) A transverse section showing intraocular vessels at 9 dpf,
dorsal is up, and lateral to the left. The retinal artery is indicated by white arrow.
Kitambi et al. Page 15
Mech Dev. Author manuscript; available in PMC 2010 May 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Fig. 3.
Phenotypic changes in the retinal vasculature following treatment with different chemicals.
Shown are lateral views of the retinal vasculature through the lens at 96 hpf (3 left-most
columns of images), as well as lateral views of the trunk vasculature (right-most column of
images, dorsal is up). Each row shows three examples of the phenotype induced in the retina
and one example of trunk phenotype. Note that in the most extreme cases, vessels are not
observed at all and GFP-positive tissue forms irregular clumps. Such clumps of tissue are not
counted as vessel segments in graphs presented in Fig. 4. The name, formula, and the structure
of each chemical are provided to the left of image panels.
Kitambi et al. Page 16
Mech Dev. Author manuscript; available in PMC 2010 May 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Fig. 4.
The number and thickness of retinal and trunk vessels following treatment with different
chemicals. (A) Top left image panels illustrate the method of counting and measuring vessels.
In the control image panel, yellow lines indicate the vessel segments. The image of a treated
retina shows an example of vessel segment thickness measurement (the line in red indicates
thickness). Graphs in panel A show the number of ocular vessel segments in control and
chemically treated animals. x-axis provides the number of vessel segments per eye; each circle
represents a single retina. Retinae with absent or collapsed vessels only are given the value of
0. The average number of blood vessel segments (Avg) per eye is provided in the upper left
corner of each graph. In cases where the number of retinae in the zero category exceeds 10, its
size is provided numerically as ZC (zero category). In this experiment, for each compound, we
chose the highest concentration that is known to produce retinal blood vessel changes but does
not affect trunk vasculature (Mebendazole) or retinal lamination (Enalapril Maleate,
Pyrogallin, Albendazole, and Zearalenone). (B) Vessel thickness measurements in control and
chemically-treated embryos. Untreated controls are indicated as C1 and C2, while small
molecule tests as T1 and T2. T1 represents the highest concentration producing eye-specific
vasculature phenotype that does not cause a disorganization of the retina and T2 represents the
lowest concentration sufficient to produce an eye vasculature phenotype. In the case of
mebendazole, neuronal organization is affected at all concentrations tested, and so we provide
data for the highest concentration that affects the eye but not the trunk vasculature. Statistically
significant values were obtained for T1 and T2 concentrations of each compound with respect
to the retinal vessels (Enalapril Maleate: p < 0.001 for T1, p < 0.001 for T2; Pyrogallin: p value
not significant for T1, p < 0.001 for T2; Albendazole: p not significant for both T1 and T2,
Kitambi et al. Page 17
Mech Dev. Author manuscript; available in PMC 2010 May 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
most likely due to small sample size, Mebendazole: p not significant for T1, p < 0.05 for T2;
Zearalenone: p < 0001 for T1, p < 0.001 for T2. Trunk vessel thickness is provided for the T1
treatment only. The trunk vessel thickness measurements also yielded statistically significant
values for albendazole p < 0.01 and mebendazole p < 0.001. (C) Confocal images of transverse
sections through control and chemically-treated retinae, showing the organization of neuronal
layers. Retinal ganglion cells including the optic nerve and photoreceptors are visualized with
Zn-8 and Zpr-1 antibodies, respectively (both in red) and intraocular vessels are marked by
GFP expression (green). To visualize plexiform layers, sections were counterstained with
fluorophore-conjugated phalloidin (blue). The concentrations of chemicals used for
experiments shown in these panels are indicated in Table 1 in italics.
Kitambi et al. Page 18
Mech Dev. Author manuscript; available in PMC 2010 May 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Fig. 5.
Phenotypic changes produced by compounds structurally similar to albendazole and
mebendazole. The left-most column of panels shows confocal images of transverse sections
through control and chemically-treated retinae. The concentrations of chemicals used for
experiments shown in these panels are indicated in Table 2 in italics. Panels in the middle two
columns of images show lateral views of the retinal vasculature through the lens at 96 hpf. The
right-most column of images shows lateral views of the trunk vasculature. Graphs to the right
are plotted as in Fig. 4. In all images, dorsal is up and anterior is left.
Kitambi et al. Page 19
Mech Dev. Author manuscript; available in PMC 2010 May 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Kitambi et al. Page 20
Table 1
Summary of phenotypic changes produced by different dilutions of chemicals in the retina and trunk. Appropriate dilutions (provided in parentheses) were
prepared and used to treat embryos (C1–C7). X represents the “T1” concentration from Fig 4. It is the highest concentration tested that produces phenotype
in the retina but not in the trunk. Its molar value is indicated next to each compound name. In each table cell, font is color-coded as follows: blue indicates
concentrations that do not affect retinal lamination; red indicates concentrations that cause defects of the retinal architecture; black indicates concentrations
for which we did not test retinal lamination. At high concentrations, all chemicals are toxic, and cause death followed by a rapid decomposition of larvae
(cells in grey). At somewhat lower concentrations, fish lack heart beat but the GFP signal persists in blood vessels (cells in orange). These animals are also
considered dead. As concentrations are lowered further, the compounds do not affect the heart beat but trunk and/or retina vessels are affected (cells in
yellow). The concentrations that do not produce any obvious phenotypic changes in this assay are indicated in light green.
C1 C2 C3 C4 C5 C6 C7
Eye Enalapril Maleate (x = 100 μM)
Normal (0.031X) Normal (0.062X) Normal (0.12X) Normal (0.25X) Thick vessels (0.5X) Thick vessels (X) Fish decomposed (2X)
Trunk Normal (0.031X) Normal (0.062X) Normal (0.12X) Normal (0.25X) Normal (0.5X) Normal (X) Fish decomposed (2X)
Eye Pyrogallin (x = 60 μM)
Normal (0.125X) Fewer Vessels (0.25X) Fewer Vessels (0.5X) Fewer Vessels (X) Fewer Vessels (2X) Fish decomposed (4X) Fish decomposed (8X)
Trunk Normal (0.125X) Normal (0.25X) Normal (0.5X) Normal (X) Partial vessel loss (2X) Fish decomposed (4X) Fish decomposed (8X)
Eye Albendazole (x = 9 μM)
Fewer Vessels (0.25X) Fewer Vessels (0.5X) Fewer Vessels (X) Fewer Vessels (5X) Fewer Vessels (10X) Fish decomposed (20X)Fish decomposed (40X)
Trunk Normal (0.25X) Normal (0.5X) Normal (X) Partial vessel loss (5X) Partial vessel loss (10X) Fish decomposed (20X)Fish decomposed (40X)
Eye Mebendazole (x = 4 μM)
Fewer Vessels (0.5X) Fewer Vessels (X) Fewer Vessels (2X) Fewer Vessels (10X) Fewer Vessels, fish dead (20X) Fish decomposed (40X)Fish decomposed (80X)
Trunk Normal (0.5X) Normal (X) Partial vessel loss (2X) Partial vessel loss (10X) Partial vessel loss, fish dead (20X) Fish decomposed (40X)Fish decomposed (80X)
Eye Zearalenone (x = 8 μM)
Normal (0.25X) Thick vessels (0.5X) Thick vessels (X) Thick vessels, fish dead (5X) Fish decomposed (10X) Fish decomposed (20X) Fish decomposed (40X)
Trunk Normal (0.25X) Normal (0.5X) Normal (X) Normal vessels, fish dead (5X) Fish decomposed (10X) Fish decomposed (20X)Fish decomposed (40X)
Mech Dev. Author manuscript; available in PMC 2010 May 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Kitambi et al. Page 21
Table 2
Compounds structurally similar to albendazole and mebendazole. Content, formatting, and color codes are as in Table 1.
C1 C2 C3 C4 C5 C6 C7
Eye methyl {5-chloro-6-[(1-chloro-2-naphthyl)oxy]-1H-benzimidazol-2-yl}carbamate (MCBC) (x =
Normal (0.12X) Normal (0.25X) Fewer Vessels (0.5X) Fewer Vessels (X) Fewer Vessels, fish dead (2X) Fish decomposed (4X) Fish decomposed (8X)
Trunk Normal (0.12X) Normal (0.25X) Normal (0.5X) Normal (X) Partial vessel loss, fish dead (2X) Fish decomposed (4X) Fish decomposed (8X)
Eye methyl [5-(2-thienylcarbonyl)-1H-benzimidazol-2-yl]carbamate (MBC) (x = 2.1 μM)
Absent (X) Absent, fish dead (2X) Absent, fish dead (4X) Absent, fish dead (20X) Fish decomposed (40X) Fish decomposed (80X) Fish decomposed (160X)
TrunkPartial vessel loss (X) Fewer Vessels, fish dead
(2X) Fewer Vessels, fish dead (4X)Fewer Vessels, fish dead (20X) Fish decomposed (40X) Fish decomposed (80X) Fish decomposed (160X)
Eye methyl {6-chloro-5-[(4-chloro-1-naphthyl)oxy]-1H-benzimidazol-2-yl}carbamate (MCNBC) (x=30 μM)
Normal (0.12X) Normal (0.25X) Absent (0.5X) Absent (X) Absent (2X) Fish decomposed (4X) Fish decomposed (8X)
Trunk Normal (0.12X) Normal (0.25X) Normal (0.5X) Normal (X) Partial vessel loss, Fish dead (2X) Fish decomposed (4X) Fish decomposed (8X)
Eye butyl 2-({2-[(methoxycarbonyl)amino]-1H-benzimidazol-5-yl}carbonyl)benzoate (BBC) (x =
Normal (0.062X) Normal (0.125X) Normal (0.25X) Fewer Vessels (0.5X) Fewer Vessels (X) Fewer Vessels, fish dead (2X) Fish decomposed (4X)
Trunk Normal (0.062X) Normal (0.125X) Normal (0.25X) Normal (0.5X) Normal (X) Fewer Vessels, fish dead (2X) Fish decomposed (4X)
Eye ethyl 1H-benzimidazol-2-ylcarbamate (EBC) (x = 70 μM)
Normal (0.125X) Normal (0.25X) Absent (0.5X) Absent (X) Absent, fish dead (2X) Fish decomposed (4X) Fish decomposed (8X)
Trunk Normal (0.125X) Normal (0.25X) Normal (0.5X) Normal (X) Absent, fish dead (2X) Fish decomposed (4X) Fish decomposed (8X)
Mech Dev. Author manuscript; available in PMC 2010 May 1.
