Content uploaded by Huai-Jun Xue
Author content
All content in this area was uploaded by Huai-Jun Xue on Feb 09, 2015
Content may be subject to copyright.
This article was downloaded by: [Institute of Zoology]
On: 25 June 2012, At: 17:14
Publisher: Taylor & Francis
Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House,
37-41 Mortimer Street, London W1T 3JH, UK
Systematics and Biodiversity
Publication details, including instructions for authors and subscription information:
http://www.tandfonline.com/loi/tsab20
Distinct species or colour polymorphism? Life history,
morphology and sequence data separate two Pyrrhalta
elm beetles (Coleoptera: Chrysomelidae)
Rui-E Nie
a
b
c
, Huai-Jun Xue
a
, Yi Hua
a
b
, Xing-Ke Yang
a
& Alfried P. Vogler
c
d
a
Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese
Academy of Sciences, Beijing, 100101, China
b
Graduate University of Chinese Academy of Sciences, Beijing, 100101, China
c
Department of Entomology, The Natural History Museum, London, SW7 5BD, UK
d
Department of Life Sciences, Silwood Park Campus, Imperial College London, Ascot, UK
Available online: 18 Jun 2012
To cite this article: Rui-E Nie, Huai-Jun Xue, Yi Hua, Xing-Ke Yang & Alfried P. Vogler (2012): Distinct species or colour
polymorphism? Life history, morphology and sequence data separate two Pyrrhalta elm beetles (Coleoptera: Chrysomelidae),
Systematics and Biodiversity, DOI:10.1080/14772000.2012.687783
To link to this article: http://dx.doi.org/10.1080/14772000.2012.687783
PLEASE SCROLL DOWN FOR ARTICLE
Full terms and conditions of use: http://www.tandfonline.com/page/terms-and-conditions
This article may be used for research, teaching, and private study purposes. Any substantial or systematic
reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to
anyone is expressly forbidden.
The publisher does not give any warranty express or implied or make any representation that the contents
will be complete or accurate or up to date. The accuracy of any instructions, formulae, and drug doses should
be independently verified with primary sources. The publisher shall not be liable for any loss, actions, claims,
proceedings, demand, or costs or damages whatsoever or howsoever caused arising directly or indirectly in
connection with or arising out of the use of this material.
Systematics and Biodiversity (2012), iFirst, 1–14
Research Article
Distinct species or colour polymorphism? Life history, morphology
and sequence data separate two Pyrrhalta elm beetles
(Coleoptera: Chrysomelidae)
RUI-E NIE
1,2,3
, HUAI-JUN XUE
1
,YIHUA
1,2
, XING-KE YANG
1
& ALFRIED P. VOGLER
3,4
1
Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China
2
Graduate University of Chinese Academy of Sciences, Beijing 100101, China
3
Department of Entomology, The Natural History Museum, London SW7 5BD, UK
4
Department of Life Sciences, Silwood Park Campus, Imperial College London, Ascot, UK
(Received 17 December 2011; revised 28 March 2012; accepted 10 April 2012)
The elm leaf beetles Pyrrhalta maculicollis (Motschulsky, 1853) and P. aenescens (Fairmaire, 1878) (Chrysomelidae:
Galerucinae) are considered to be two separate species that occur in s ympatry and synchrony on the same plant host.
Conventionally they are distinguished by differences in elytron and pronotum colour, but this variation could just represent
intra-specific polymorphism. To test the status of P. maculicollis and P. aenescens we compared their biology, larval and
adult morphological characters, and molecular genetics. Using laboratory-bred cohorts of either colour type, biological and
morphological analyses showed great similarities in life cycle, body size, external morphology of eggs and pupae, and the
presence of spines on the internal sac of the aedeagus not seen in other species of Pyrrhalta. However, both groups showed
consistent differences in colour patterns, tubercles and setae of the larvae, while the number of spines on the internal sac
also differed consistently. The molecular phylogenetic analysis based on mitochondrial (COI, COII) and nuclear (ITS2)
markers recovered both colour types as deeply separated, reciprocally monophyletic lineages, and in addition found P.
maculicollis to be split into two divergent subgroups by both markers. A time-calibrated tree that included several further
species of Pyrrhalta and the related Galerucella indicated that P. maculicollis and P. aenescens separated in the Miocene, at
around 7.5 Ma (95% CI, 9.5–5.6 Ma).
Key words: biology, divergence time, molecular systematics, morphology, Pyrrhalta aenescens, Pyrrhalta maculicollis
Introduction
The elm leaf beetles Pyrrhalta maculicollis (Motschulsky,
1853) and P. aenescens (Fairmaire, 1878) (Coleoptera:
Chrysomelidae) can be serious pests of elm trees throughout
China. Adults and larvae feed on elm foliage, and severe in-
festations for several consecutive years may cause the death
of host trees. Both species are distributed in eastern Asia.
While P. maculicollis is found in China, Japan, Korea and
Russia, P. aenescens is mainly limited to northern China.
They are distributed sympatrically and synchronously over
a large geographic area, and even occur in microsympatry
on the same host species of elm, mainly Ulmus pumila
Linnaeus, 1753, U. laevis Pallas, 1784 and U. davidiana
Planch, 1873 (Fu et al., 2003; Xue & Yang, 2010). Until
now the biology of P. maculicollis has not been studied,
Correspondence to: Xing-Ke Yang. E-mail: yangxk@ioz.ac.cn;
and Alfried P. Vogler. E-mail: a.vogler@imperial.ac.uk
while information on P. aenescens is limited to a few obser-
vations on its biology, behaviour and control (Fang et al.,
2008).
Adults of both species are very similar morphologically
except for differences in elytron colour: P. maculicollis is
brown, while P. aenescens is green. This raises the possi-
bility that the two species are merely colour variants of
a single species, in line with other prominent cases of
colour polymorphisms in Chrysomelidae, e.g. Chrysolina
aurichalcea Mannerheim, 1825 (Fujiyama, 1979; Shimizu
& Fujiyama, 1986; Yu et al., 1996); Chrysomela lapponica
Linnaeus, 1758 (Gross, 1997; Milyashevich, 2000), Pla-
teumaris sericea Linnaeus, 1760 (Kurachi et al., 2002) and
Chrysophtharta agricola Chapuis, 1877 (Nahrung & Allen,
2005).
Clarity about the taxonomic status of both species is
necessary to understand the basis of colour variation, and
may have implications for pest control if these morphs dif-
fer in their biology. To confirm that P. maculicollis and
ISSN 1477-2000 print / 1478-0933 online
C
2012 The Natural History Museum
http://dx.doi.org/10.1080/14772000.2012.687783
Downloaded by [Institute of Zoology] at 17:14 25 June 2012
2Rui-ENieet al.
P. aenescens are two separate species, we compared their
life-history and morphological characters at each develop-
mental stage in a search for diagnostic traits that might
distinguish them convincingly. In addition, mitochondrial
and nuclear markers were used to establish their relation-
ship and divergence time.
Materials and methods
Cultures
Laboratory cultures of P. maculicollis and P. aenescens were
established from female adults collected in Beijing, China,
in April 2010. Adults were individually reared in plastic
cups (9.0 cm diameter, 9.0 cm depth) on fresh elm leaves
with cut ends inserted in water-filled floral tubes. Egg clus-
ters were individually transferred to plastic Petri dishes on
damp filter paper. The number of eggs per batch and du-
ration were recorded, and egg length was measured from a
subsample (n = 30, mean ± sd) using a graticule eye piece
in a binocular microscope. Larvae were reared with fresh
elm leaves in a Petri dish and checked daily to record instar
changes until adult emergence. The duration of each instar
was recorded and body length of larvae, pupae and adults
were measured (n = 30, mean ± sd). All beetles were reared
under a 16-hour light: 8-hour dark daily cycle, at 25.0
◦
C.
Comparative morphology
Morphological characters of each developmental stage were
examined during rearing. The number of setae and other
characters of larvae were examined under a stereomicro-
scope. For micro-structures of mature larvae, we made
dissections following the methods of Booth et al. (1990),
mounted the dissections on glass slides with glycerol added
to prevent drying, and made observations using light mi-
croscopy. In addition, we took SEM micrographs to search
for differences. Tissues were subjected to ultrasound treat-
ment before being observed under the SEM. Samples were
transferred directly from absolute alcohol onto an SEM-
stub and examined (SEM XL20 ESEM-TMP) at low vac-
uum without prior fixation or coating.
Ten females and ten males of each species were dissected
for genitalia, using the following procedure: for fresh or
ethanol-preserved specimens, the abdomen was separated,
transferred to a vial containing 10% KOH which was heated
in a boiling water bath for 10 min. The genitalia were then
carefully removed in a cavity slide under distilled water us-
ing fine forceps and hooked minuten-pin dissecting needles.
Specimens were photographed with a camera lucida on a
Leica MZ 125 stereomicroscope and images combined us-
ing Helicon focus software. All pictures were evaluated and
assembled using Adobe Photoshop CS 8.0 and Illustrator
CS4 software.
Molecular protocols
DNA sequencing was performed on 35 specimens in to-
tal, using representatives of 11 species of Pyrrhalta,two
species of Galerucella and two species of Galeruca as out-
groups (Table 1). Individuals of the two focal species each
were taken from a different site in the Beijing region at
distances of 45–70 km. As far as possible, sympatric rep-
resentatives of the two species were used. Samples were
preserved in 100% ethanol and stored at −20
◦
C. DNA ex-
traction was from the head and prothorax of each specimen.
Voucher specimens for all sampled taxa were deposited in
the I nstitute of Zoology, Chinese Academy of Sciences.
Genomic DNA were obtained using a commercial kit
(Tiangen) and stored in 100 µL TE buffer (pH 8.0) at
−20
◦
C until used. Partial mitochondrial COI, COII and
ITS2 genes were amplified using the polymerase chain re-
action (PCR). The volume for the PCR reaction was 40 µL
including: 26.72 µL ddH
2
O, 4 µL10×NH
4
buffer, 1.6 µL
2.5 mM dNTP, 1.6 µL50mMMgCl
2
,0.08µL biotaq
DNA polymerase, 2 µLof10µM of each primer, and
2 µL DNA template. The PCR conditions were as follows:
an initial denaturation step of 5 min at 94
◦
C; 35 cycles
with a denaturation of 30 s at 94
◦
C, an annealing step of
50 s at 51–58
◦
C and an extension step of 60 s at 72
◦
C;
and a final extension step of 10 min at 72
◦
C. The an-
nealing temperatures for the three amplified regions were:
51
◦
C for COI, 54
◦
C for COII and 58
◦
C for ITS2. The
primers are listed in Table 2. The PCR products were sent to
Beijing Sunbiotech Co. Ltd. for sequencing with both for-
ward and reverse primers. Sequences were assembled using
Sequencer 4.8 software. The protein-coding nucleotide se-
quences of COI and COII were aligned using TransAlign
v.1.2 (Bininda-Emonds, 2005), while the ITS2 intergenic
region was aligned with Prank (L
¨
oytynoja & Goldman,
2005). The three markers were concatenated with Sequence
Matrix v.1.7.8. New sequences were deposited in Gen-
Bank (accession numbers JQ023031–JQ023126). For spec-
imens’ voucher details and sequence accession numbers see
Table 1.
Phylogenetic analyses and divergence
time estimate
The number of variable and parsimony informative sites
was assessed using MEGA v.4.0 (Tamura et al., 2007). We
used PAUP
∗
v.4.0b (Swofford, 2002) for maximum parsi-
mony (MP) analysis, conducting a heuristic search with
100 random taxon-addition replicates and tree bisection re-
connection (TBR) branch swapping. Gaps were treated as
missing data. Nodal support in MP analyses was assessed
by 1000 bootstrap searches with 100 random addition repli-
cates. Bayesian inference was performed using MrBayes
v.3.1.2 (Ronquist & Huelsenbeck, 2003). The most appro-
priate nucleotide substitution model (GTR + I + G) was
Downloaded by [Institute of Zoology] at 17:14 25 June 2012
Pyrrhalta elm beetles 3
Tabl e 1. Samples and gene registration information.
Species Locality
Specimen
code COI COII ITS2
Pyrrhalta aenescens (Fairmaire, 1878) China, Beijing, Yanqing N1 JQ023031 JQ023063 JQ023114
Pyrrhalta aenescens (Fairmaire, 1878) China, Beijing, Changping N2 JQ023041 JQ023073 JQ023117
Pyrrhalta aenescens (Fairmaire, 1878) China, Beijing, Botanical Garden N3 JQ023048 JQ023080 JQ023113
Pyrrhalta aenescens (Fairmaire, 1878) China, Beijing, Botanical Garden N4 JQ023057 JQ023089 JQ023116
Pyrrhalta aenescens (Fairmaire, 1878) China, Beijing, Yanqing N5 JQ023058 JQ023090 JQ023115
Pyrrhalta brunneipes Gressitt and Kimoto, 1963 China, Shannxi, Zhouzhi N6 JQ023059 JQ023091 JQ023118
Pyrrhalta discalis Gressitt and Kimoto, 1963 China, Guizhou, Dashahe N7 JQ023060 JQ023092 JQ023095
Pyrrhalta humeralis (Chen, 1942) China, Fujian, Wuyi Mountain N8 JQ023061 JQ023093 JQ023097
Pyrrhalta humeralis (Chen, 1942) China, Shannxi, Ningshang N9 JQ023062 JQ023094 JQ023099
Pyrrhalta humeralis (Chen, 1942) China, Yunnan, Dali N11 JQ023032 JQ023064 JQ023101
Pyrrhalta humeralis (Chen, 1942) China, Shannxi, Ningshan N12 JQ023033 JQ023065 JQ023098
Pyrrhalta humeralis (Chen, 1942) China, Shannxi, Zhouzhi N13 JQ023034 JQ023066 JQ023102
Pyrrhalta humeralis (Chen, 1942) China, Shannxi, Ningshan N14 JQ023035 JQ023067 JQ023100
Pyrrhalta humeralis (Chen, 1942) China, Shannxi, Ningshan N27 JQ023045 JQ023077 JQ023096
Pyrrhalta griseovillosa (Jacoby, 1890) China, Sichuan, Wolong Natural
Reserve
N15 JQ023036 JQ023068 JQ023125
Pyrrhalta griseovillosa (Jacoby, 1890) China, Sichuan, Wolong Natural
Reserve
N16 JQ023037 JQ023069 JQ023126
Pyrrhalta maculicollis (Motschulsky, 1853) China, Beijing, Yanqing N17 JQ023038 JQ023070 JQ023111
Pyrrhalta maculicollis (Motschulsky, 1853) China, Beijing, Olympic Park N18 JQ023039 JQ023071 JQ023112
Pyrrhalta maculicollis (Motschulsky, 1853) China, Beijing, Botanical Garden N19 JQ023040 JQ023072 JQ023107
Pyrrhalta maculicollis (Motschulsky, 1853) China, Beijing, Yanqing N20 JQ023042 JQ023074 JQ023109
Pyrrhalta maculicollis (Motschulsky, 1853) China, Shannxi, Ningshan N21 JQ023043 JQ023075 JQ023110
Pyrrhalta maculicollis (Motschulsky, 1853) China, Beijing, Changping N23 JQ023044 JQ023076 JQ023108
Pyrrhalta ningpoensis Gressitt and Kimoto, 1963 China, Shannxi, Ningshan N28 JQ023046 JQ023078 JQ023120
Pyrrhalta pusilla (Duftschmidt, 1825) Mongolia, Eoroo N29 JQ023047 JQ023079 JQ023105
Pyrrhalta seminigra (Jacoby, 1885) China, Shannxi, Ningshan N31 JQ023049 JQ023081 JQ023119
Pyrrhalta sulcatipennis (Chen, 1942) China, Guizhou, Kuankuoshui
Natural Reserve
N32 JQ023050 JQ023082 JQ023124
Pyrrhalta sulcatipennis (Chen, 1942) China, Guizhou, Zhouyi N33 JQ023051 JQ023083 JQ023123
Pyrrhalta wilcoxi Gressitt and Kimoto, 1965 China, Guizhou, Kuankuoshui
Natural Reserve
N34 JQ023052 JQ023084 JQ023103
Pyrrhalta wilcoxi Gressitt and Kimoto, 1965 China, Guizhou, Kuankuoshui
Natural Reserve
N35 JQ023053 JQ023085 JQ023104
Galeruca nigrolineata (Mannerheim, 1825) Mongolia, Bugat N36 JQ023054 JQ023086 JQ023121
Galeruca tanaceti incisicollis (Motschulsky,
1860)
Mongolia, Hyalganat N37 JQ023055 JQ023087 JQ023122
Galerucella birmanica (Jacoby, 1889) Unknown G1 EF512832 EF512799 EF512752
Galerucella birmanica (Jacoby, 1889) Unknown G2 EF512833 EF512800 EF512753
Galerucella grisescens (Joannis, 1865) Unknown G3 EF521825 EF512801 EF512754
Galerucella grisescens (Joannis, 1865) China, Chongqing N38 JQ023056 JQ023088 JQ023106
selected using the Akaike Information Criterion (AIC) in
MrModeltest v.2.2 (Nylander, 2004). The MCMC search
was conducted for 1 000 000 generations, and sampling
was done every 100 generations until the average standard
deviation of split frequencies was below 0.01. The first 25%
of trees were discarded as ‘burn-in’ and posterior probabil-
ities were estimated for each node. To test for congruence
with phylogenetic trees, we conducted MP and Bayesian
Tabl e 2. Primers used for PCR in this study.
Markers Primers names Sequences References
COI C1-J-2183 5
- CAACATTTATTTTGATTTTTTGG - 3
(Simon et al., 1994)
TL2-N-3014 5
- TCCATTGCACTAATCTGCCATATTA - 3
COII TL2-J-3037 5
- ATGGCAGATTAGTGCAATGG - 3
(Simon et al., 1994)
TK-N-3785 5
- GTTTAAGAGACCAGTACTTG - 3
ITS2 TS-J-5.8S
b
5
- TGGRTCGATGGAGAACGCAGC - 3
(Swigo
ˇ
nov
´
a & Kjer, 2004)
ITS2-N-610
b
5
- TCTCACCTGCTCTGAGGTCGATAT - 3
Downloaded by [Institute of Zoology] at 17:14 25 June 2012
4Rui-ENieet al.
Figs 1–9. The developmental stages of P. maculicollis. 1, teneral adult; 2, mature adult; 3, eggs; 4, first instar larva; 5, second instar larva;
6, third instar larva; 7, pupa, dorsal; 8, pupa, ventral; 9, pupa, lateral.
Downloaded by [Institute of Zoology] at 17:14 25 June 2012
Pyrrhalta elm beetles 5
Figs 10–18. The developmental stages of P. aenescens. 10, teneral adult; 11, mature adult; 12, eggs; 13, First instar larva; 14, second
instar larva; 15, third instar larva; 16, pupa, dorsal; 17, pupa, ventral; 18, pupa, lateral.
Downloaded by [Institute of Zoology] at 17:14 25 June 2012
6Rui-ENieet al.
Figs 19–22. SEM images of P. maculicollis larva. 19, head, lateral; 20, mouthpart, ventral; 21, thorax, lateral; 22, pygopod, ventral.
analysis on the combined and separate mitochon-
drial datasets (COI and COII) and nuclear dataset
(ITS2).
Divergence times of the two species were estimated
with BEAST v.1.6.1 (Drummond & Rambaut, 2007)
based on the combined data sets (COI and COII), and
calibrated using substitution rates for COI in Plateu-
maris (Coleoptera: Chrysomelidae) and COII in Timar-
cha (Coleoptera: Chrysomelidae) of 0.016 and 0.0076 nu-
cleotide changes per site per million years, respectively
(G
´
omez-Zurita et al., 2000; Sota & Hayashi, 2007). Based
on these values, we conducted a BEAST analysis with the
most appropriate nucleotide substitution model (GTR + I
+ G), a relaxed clock with log-normal branch length dis-
tribution, and a Yule speciation model. The analysis was
conducted for 60 million generations of a MCMC and a
25% burn-in to obtain the final dated tree and posterior
probabilities in Tracer v.1.5, TreeAnnotator v.1.6.1, Log-
Combiner v.1.6.1 (http://beast.bio.ed.ac.uk/) and displayed
in Figtree v.1.3.1 (http://tree.bio.ed.ac.uk/).
Results
Life histories of the two species
Basic life-history observations were made on both groups
of females assigned to P. maculicollis and P. aenescens
based on the elytral colour pattern. The eggs of the two
species were laid in clusters and batch sizes ranged from
1–25 eggs. Egg development time was 4.38 ± 0.49 days
for P. maculicollis and 4.24 ± 0.50 days for P. aenescens.
Likewise, the durations for each instar were very similar
in both species (4.83 ± 0.65 days, 3.53 ± 0.65 days and
9.00 ± 0.67 days for the first, second and third instar
larvae in P. maculicollis vs. 5.15 ± 0.71 days, 3.09 ±
0.46 days and 9.24 ± 0.97 days for P. aenescens). Third
instar larvae ceased feeding and, after a short roaming
period, turned into C-shaped prepupae that moulted into
pupae after 3 days. The pupal stage duration was 6.97 ±
0.61 days for P. maculicollis, and 7.27 ± 0.87 days for P.
aenescens. Adults emerged with light yellow elytra initially
(Figs 1, 10), but the elytra of P. maculicollis turned brown
Downloaded by [Institute of Zoology] at 17:14 25 June 2012
Pyrrhalta elm beetles 7
Figs 23–26. SEM images of P. aenescens larva. 23, head, lateral; 24, mouthpart, ventral; 25, thorax, lateral; 26, pygopod, ventral.
3–4 hours after emergence (Fig. 2), while they turned
green in P. aenescens (Fig. 11). Mating started 3–4 days
after emergence, after which egg deposition started for a
total of about 300 eggs per female over its lifetime in both
species.
Morphological characters
Both cohorts were very similar in morphological characters
of eggs and pupae. The oval-shaped, light yellow eggs were
similar in size (P. maculicollis:1.08± 0.08 mm long; P. ae-
nescens:1.00± 0.07 mm) (Figs 3, 12). Pupae were orange
to bright yellow with black setae on the dorsal side (Figs
7–9, 16–18) and also were similar in size (P. maculicollis:
7.36 ± 0.19 mm long; P. aenescens:7.91± 0.41 mm).
The basic structures of the larvae of the two species
(Figs 19–26) and the arrangement of their tubercles were
very similar. In general, mesothorax and metathorax of the
two species had two pairs of subequal tubercles arranged in
a row anteriorly and two pairs of tubercles (one large, one
small) posteriorly; the dorsal side of abdomen segments
I–VII had 2 pairs of tubercles anteriorly and 3 pairs of
tubercles posteriorly.
However, there were some recognizable differences be-
tween the larvae of the two species. First, the larvae of P. ae-
nescens were more strongly sclerotized and pigmented than
P. maculicollis. The dorsal tubercles and the adjacent scle-
rotized cuticle together formed a black longitudinal stripe
in P. aenescens, running from the mesothorax to the end of
the abdomen (Fig. 15), while the dorsum of P. maculicol-
lis was yellowish with brown punctured tubercles (Fig. 6).
Secondly, the dorsal colour of the first and second instar
larvae was different: in P. aenescens it was black (Figs 4,
5), while P. aenescens had brown punctured tubercles (Figs
13, 14). Thirdly, the numbers of setae and associated tuber-
cles between the two species were different. Individuals as-
signed to P. aenescens exhibited a distinct tubercle present
Downloaded by [Institute of Zoology] at 17:14 25 June 2012
8Rui-ENieet al.
Figs 27–30. The genitalia of P. maculicollis. 27, aedeagus, dorsal; 28, aedeagus, lateral; 29, internal sac; 30, spermatheca.
anterior to the abdominal spiracles, while P. maculicollis
lacked this tubercle. The number of setae present on the tu-
bercles of the two species also showed some differences (see
Table 3).
With respect to the genitalia, the spermatheca showed no
obvious differentiation (Figs 30, 34), but the aedeagi were
different. The vertex of the aedeagus of P. maculicollis was
found to be blunt (Figs 27, 28) while that of P. aenescens was
pointed (Figs 31, 32). Perhaps most significantly, the num-
ber of spines on the internal sac differed: 28–30 in P. mac-
ulicollis (Fig. 29), but only 14–15 in P. aenescens (Fig. 33).
Phylogenetic relationships
Intra- and inter-specific variation in P. maculicollis and P.
aenescens were assessed using the COI, COII and ITS2
markers. In addition to the two focal species, further repre-
sentatives of Pyrrhalta, Galerucella and Galeruca (Table 1)
were included to provide the wider phylogenetic context for
this species pair. The dataset consisted of 35 sequences, for
a total of 1941 bp comprising 665 (34.26%) variable sites
and 575 (29.62%) parsimony informative sites, of which
ITS2 contributed 624 bp, including 239 (38.30%) vari-
able and 195 (31.25%) parsimony informative sites. The
Tabl e 3. Number of pairs of setae on body tubercles. There are two pairs of symmetrical tubercles
from mesothorax to the end of abdomen segment (dorsal side). These setae numbers are given
separately in the t able for the inner pair of tubercles and an outer pair. The count followed the
scheme of Lee (1990).
Location P. maculicollis P. aenescens
Frons 4 5
Pronotum 39 38
Mesothorax and metathorax First row 8 + 65+ 3
(dorsal side) Second row 6 + 10 5 + 7
Abdomen (dorsal side) First row 7 + 54+ 3
Second row 5 + 54+ 5
Downloaded by [Institute of Zoology] at 17:14 25 June 2012
Pyrrhalta elm beetles 9
Figs 31–34. The genitalia of P. aenescens. 31, aedeagus, dorsal; 32, aedeagus, lateral; 33, internal sac; 34, spermatheca.
mitochondrial datasets (COI and COII, 1317 bp) included
426 (32.35%) variable sites and 380 (28.85%) parsimony
informative sites. When considering only sequences of P.
maculicollis and P. aenescens, there were 200 (10.34%)
variable sites and 191 (9.87%) parsimony informative sites
in combined data of three genes, 169 (12.83%) variable
sites and 160 (12.15%) parsimony informative sites in mi-
tochondrial datasets, while there were 121 (19.39%) vari-
able and 75 (12.10%) parsimony informative sites in the
ITS2 dataset.
Phylogenetic trees had very similar topologies under par-
simony and Bayesian Inference (Figs 35, 36). The phy-
logenetic analysis showed that the sets of haplotypes ob-
tained from P. maculicollis and P. aenescens each were
monophyletic, and both sets were sister lineages in com-
bined (Fig. 35) and in separate COI/COII and ITS2 data
analyses (Fig. 36). The P. maculicollis/P. aenescens clade
formed a deep lineage, although its position relative to other
groups of Pyrrhalta differed in the separate analyses of mi-
tochondrial and nuclear markers, as well as the standard tree
searches (parsimony, Bayesian) and the BEAST analysis of
the combined dataset. Calibrated with the rate of nucleotide
variation in COI and COII found in studies of related
chrysomelids, the time of divergence of both species was
estimated to 7.5 Ma (95% CI range 9.5–5.6 Ma) (Fig. 37).
Two individuals of P. maculicollis were highly divergent in
both the mitochondrial and nuclear markers (corresponding
to a s plit at 3.1 Ma), suggesting that this species may be
separated into additional subgroups.
The genus Pyrrhalta was paraphyletic with respect to
Galerucella birmanica and Galerucella grisescens that
were placed within this genus, as sister to P. pusilla.Close
relationship of Pyrrhalta and Galerucella have been recog-
nized before, and may require a more precise definition of
Pyrrhalta and Galerucella and the reassignment of some
species with an intermediate set of traits. This uncertainty
about generic limits is also reflected in the changing tax-
onomy. For example, Galerucella was placed as one of
four subgenera of Pyrrhalta by Wilcox (1965), while it was
considered a separate genus by some other taxonomists
(Gressitt & Kimoto, 1963; Silfverberg, 1974; Nokkala &
Nokkala, 2004).
Discussion
We made systematic comparisons of the biology and mor-
phology of P. maculicollis and P. aenescens that so far have
Downloaded by [Institute of Zoology] at 17:14 25 June 2012
10 Rui-E Nie et al.
Fig. 35. Strict consensus of four MP trees obtained from combined COI, COII and ITS2 data (1939 bp). Tree length = 1534; CI = 0.566;
HI = 0.433; RI = 0.831. MP bootstrap values (first number) and Bayesian analysis posterior probabilities (second number) > 50% are
shown on the branches.
been distinguished mainly based on their elytral coloration.
We can now separate both species by the colour patterns
and chaetotaxy of the larvae, and by the number of spines
on the i nternal sac of the aedeagus. However, both cohorts
did not differ to any notable extent in their life cycles or in
morphological characters of eggs and pupae. The spines on
the internal sac of the aedeagus, despite their very differ-
ent numbers in the two species (Figs 29, 33), are a striking
Downloaded by [Institute of Zoology] at 17:14 25 June 2012
Pyrrhalta elm beetles 11
Fig. 36. Strict consensus of MP trees based on mitochondrial (left panel) and nuclear (right panel) markers. For mitochondrial genes
(1317 bp, number of MP trees = 4, tree length = 1130; CI = 0.508; HI = 0.492; RI = 0.811), nuclear gene (624 bp, number of MP trees
= 14, tree length = 395; CI = 0.746; HI = 0.253; RI = 0.900) obtained from ITS2 (624 bp). MP bootstrap values and Bayesian analysis
posterior probabilities > 50% are shown on the branches.
synapomorphy of the P. maculicollis/P. aenescens clade, and
have not been found in more than 50 species of Pyrrhalta
investigated to date (unpublished data). Consequently, the
two groups are now confirmed as separate species that are
consistently diagnosable by adult and larval morphological
characters, while their close relationship is also strongly
supported.
The ITS and mtDNA datasets, individually and in com-
bination, supported these conclusions. Both groups were
recovered as independent clades whose extent was per-
fectly concordant in nuclear and mitochondrial markers.
This demonstrates that these lineages are independent, evo-
lutionarily separated gene pools. Similar arguments have
been made, for example, in related flea beetles of the sub-
family Alticinae, where the concordance of groups sepa-
rated at ITS and mtDNA has been used to establish the
existence of an unrecognized species, which was also spe-
cific for a new host plant (Jenkins et al., 2009). Sampling
for both species to date was limited to sites around Beijing,
except for a single specimen from Shannxi, and therefore it
is not clear to what degree the study reflects the wider geo-
graphic patterns. However, we found that even the Beijing
populations contain divergent haplotypes, indicating that
these populations capture some level of intra-specific vari-
ation that is comparable to more thoroughly sampled leaf
beetle groups (e.g. G
´
omez-Zurita et al., 2007; Jenkins et al.,
2009). The finding of two distant subtypes in P. maculicol-
lis in the Beijing region shared with the single Shannxi
specimen also raises interesting questions about the ge-
ographic distribution of subgroups within these species.
However, despite the presence of this deep branch within
P. maculicollis, the separation from P. aenescens remains
very strong and therefore the conclusion about species inde-
pendence is unlikely to be reversed by sampling additional
haplotypes.
Both species were also consistently recovered as sister
taxa in a representative sample of Pyrrhalta and the closely
related genus Galerucella. The molecular clock estimates
trace back the common ancestor of P. maculicollis and P.
aenescens to the Miocene, showing a level of divergence
that is comparatively high among sister species in most
groups of insects. The estimated time of divergence was
based on external molecular clock calibrations for either
gene from two separate studies of Chrysomelidae at the
genus level that provided rate estimates of 0.016 and 0.0076
nucleotide changes per site per million years (divergence
rate of 3.2% My
−1
and 1.42% My
−1
) for the COI and COII
genes, respectively. The rate for COI is approximately twice
Downloaded by [Institute of Zoology] at 17:14 25 June 2012
12 Rui-E Nie et al.
Fig. 37. Majority-rule consensus tree from the MCMC stationary distribution of the partitioned coalescent Bayesian divergence time
based on the combined data of COI and COII genes. Numbers above each node are posterior probabilities. Horizontal bars mark the
confidence interval around the node ages, with the mean node age given.
as high as COII, in these estimates taken from independent
studies, which is consistent with the ratio estimated from
whole mitochondrial genomes of various basal lineages of
the Coleoptera (Pons et al., 2010), but whose absolute rates
are much higher overall. The values used here are similar
to the ‘standard’ mean mitochondrial rate of 2.3% My
−1
(Brower, 1994) or recent carefully calibrated estimates for
COI in tenebrionid beetles of 3.54 My
−1
(Papadopoulou
et al. , 2010).
The two species are syntopic, synchronous and synhospi-
talic (sensu Eichler, 1966), and have been observed feeding
together on the same tree. Their highly similar life cycle
and morphology raises the question about what factors may
have led to species divergence. It is difficult to see how spe-
ciation in Pyrrhalta could proceed in complete sympatry
without host shifts and temporal isolation, but none of this
is evident in the P. maculicollis and P. aenescens pair. There-
fore, the most plausible scenario is secondary contact after
Downloaded by [Institute of Zoology] at 17:14 25 June 2012
Pyrrhalta elm beetles 13
allopatric speciation and natural selection (reinforcement)
strengthening sexual isolation after they became sym-
patric (Liou & Price, 1994; Noor, 1999; Lukhtanov et al.,
2005).
Three types of (pre-mating) isolation mechanisms are tra-
ditionally recognized as habitat isolation, allochronic iso-
lation and sexual isolation (Funk et al., 2002). Complete
sexual isolation between both species is evident from the
genetic separation in unlinked markers (mtDNA and ITS2).
Therefore, further study is required to establish how the
effective sexual isolation and/or post-mating reproductive
isolating mechanisms are maintained. The divergent body
coloration of the adults may contribute to the mate recog-
nition mechanism, although there are no reported cases
in beetles. Alternatively, the coloration may indicate slight
differences in the predator avoidance behaviour or other dif-
ferences in physiology or behaviour under which different
body coloration is advantageous, such as heat absorption
due to different refractive properties. Predator avoidance
may also explain the differences in larval coloration due to
unobserved differences in feeding preferences under which
these colour patterns provide greatest protection. Rather
than a single polymorphic species maintained by balanc-
ing selection and changing environmental conditions (e.g.
Van’t Hof et al., 2011), the P. maculicollis and P. aenescens
pair represents two coexisting species that may segregate in
slightly different niche spaces under which different larval
and adult body coloration is advantageous.
Acknowledgments
We thank Jun-Zhi Cui and Wen-Zhu Li for collecting field
materials and taking photos. We are grateful to Si-Qin Ge,
Ming Bai, Xia Wan, four anonymous reviewers for valu-
able comments, and Ai-Ping Liang for assistance with ex-
perimental equipment. This research was supported by the
National Basic Research Program of China (973 Program)
(No. 2011CB302102), a Key Innovation-Project of CAS
(No. KSCX2-YW-Z-0911), and a grant from the National
Science Foundation of China (No. 3010300101).
References
BININDA-EMONDS, O. 2005. TransAlign: using amino acids to
facilitate the multiple alignment of protein-coding DNA se-
quences. BMC Bioinformatics 6, 156.
B
OOTH, R.G., COX,M.L.&MADGE, R.B. 1990. IIE Guides to
Insects of Importance to Man. 3. Coleoptera. International
Institute of Entomology, London.
B
ROWER, A.V.Z. 1994. Rapid morphological radiation and conver-
gence among races of the butterfly Heliconius erato inferred
from patterns of mitochondrial DNA Evolution. Proceedings
of the National Academy of Sciences USA 91, 6491–6495.
D
RUMMOND,A.J.&RAMBAUT, A. 2007. BEAST: Bayesian evolu-
tionary analysis by sampling trees. BMC Evolutionary Biology
7, 214.
E
ICHLER, W. 1966. Two new evolutionary terms for speciation in
parasitic animals. Systematic Zoology 15, 216–218.
F
ANG, S.A., ZHANG,J.,SHAO, B.F., XU, G.Y., YANG,A.N.&XU,
W. 2008. The occurrence damage and control of Galerucella
aenesceus Fairm. Journal of Hebei Agricultural Sciences 12,
4–42.
F
U, L.G., XIN,Y.Q.&WHITTEMORE, A. 2003. Ulmaceae. Flora of
China 5, 1–19.
F
UJIYAMA, S. 1979. On the colour polymorphism in Chrysolina au-
richalcea (Mannerheim) (Coleroptera: Chrysomelidae) col-
lected from mountain districts. Journal of the Faculty of Sci-
ence, Shinshu University 14, 99–106.
F
UNK, D.J., FILCHAK,K.E.&FEDER, J.L. 2002. Herbivorous in-
sects: model systems for the comparative study of speciation
ecology. Genetica 116, 251–267.
G
´
OMEZ-ZURITA,J.,JUAN,C.&PETITPIERRE, E. 2000. The
evolutionary history of the genus Timarcha (Coleoptera,
Chrysomelidae) inferred from mitochondrial COII gene and
partial 16S rDNA sequences. Molecular Phylogenetics and
Evolution 14, 304–317.
G
´
OMEZ-ZURITA,J.,HUNT,T.,KOPIKU,F.&VOGLER, P. 2007. Re-
calibrated tree of leaf beetles (Chrysomelidae) indicates inde-
pendent diversification of angiosperms and their insect herbi-
vores. PLoS One 2,1–8.
G
RESSITT,J.L.&KIMOTO, S. 1963. Pacific Insect Monograph.
The Chrysomelidae (Coleoptera) of China and Korea. Part 2.
Entomology Department, Bernice, D. Bishop Museum, Hon-
olulu, Hawaii.
G
ROSS, J. 1997. Speziation beim Blattk
¨
afer Chrysomela lapponica
L.: Vergleichende Studien zu Chemischer
¨
Okologie, Verhalten
und Morphologie verschiedener Ontogenesestadien aus zwei
allopatrischen Populationen. Sitzungberichte der Gesellschaft
Naturforschender Freunde zu Berlin 36, 125–142.
J
ENKINS, T.M., BRAMAN, S.K., CHEN,Z.,EATO N , T.D., PETTIS,G.V.
&B
OYD, D.W. 2009. Insights into flea beetle (Coleoptera:
Chrysomelidae: Galerucinae) host specificity from con-
cordant mitochondrial and nuclear DNA phylogenies. An-
nals of the Entomological Society of America 102, 386–
395.
K
URACHI,M.,TAKAKU,Y.,KOMIYA,Y.&HARIYAMA, T. 2002.
The origin of extensive colour polymorphism in Plateumaris
sericea (Chrysomelidae, Coleoptera). Naturwissenschaften
89, 295–298.
L
EE, J.E. 1990. Immature stages of Pyrrahalta humeralis Chen and
Galeruca vicina Solsky from Japan (Coleoptera: Chrysomel-
idae). Esakia 1, 81–91.
L
IOU,L.W.&PRICE, T.D. 1994. Speciation by reinforcement of
premating isolation. Evolution 48, 1451–1459.
L
¨
OYTYNOJA,A.&GOLDMAN, N. 2005. An algorithm for pro-
gressive multiple alignment of sequences with insertions.
Proceedings of the National Academy of Sciences USA 102,
10557.
L
UKHTANOV, V.A., KANUL, N.P., PLOTKIN, J.B., DANTCHENKO, A.V.,
H
AIG,D.&PIERCE, N.E. 2005. Reinforcement of pre-zygotic
isolation and karyotype evolution in Agrodiaetus butterflies.
Nature 436, 385–389.
M
ILYASHEVICH, O.Y. 2000. Leaf Beetles of the Genus Chrysomela
L. in Palearctic Fauna (Species Composition, Biology and
Phenetic Analysis of Populations). PhD Thesis, Byelorussian
Institute for Plant Protection, Priluki, Byelorussia [in Rus-
sian].
N
AHRUNG,H.&ALLEN, G. 2005. Maintenance of colour polymor-
phism in the leaf beetle Chrysophtharta agricola (Chapuis)
(Coleoptera: Chrysomelidae: Paropsini). Journal of Natural
History 39, 79–90.
N
OKKALA,C.&NOKKALA, S. 2004. Molecular phylogeny
and systematics of Galerucella and related taxa. In:
Downloaded by [Institute of Zoology] at 17:14 25 June 2012
14 Rui-E Nie et al.
JOLIVERT,P.H.,SANTIAGO-BLAY,J.A.&SCHMITT,M.,Eds.,
New Developments in the Biology of Chrysomelidae.
Kluwer, Boston, pp. 125–130.
N
OOR, M.A.F. 1999. Reinforcement and other consequences of
sympatry. Heredity 83, 503–508.
N
YLANDER, J.A.A. 2004. MrModeltest V2. Program distributed by
the author. Evolutionary Biology Centre, Uppsala University,
Sweden.
P
APADOPOULOU,A.,ANASTASIOU,L.&VOGLER, A. P. 2010. Re-
visiting the insect mitochondrial molecular clock: the Mid-
Aegean Trench calibration. Molecular Biology and Evolution
27, 1659–1672.
P
ONS,J.,RIBERA,I.,BERTRANPETIT,J.&BALKE, M. 2010. Nu-
cleotide substitution rates for the full set of mitochondrial
protein-coding genes in Coleoptera. Molecular Phylogenetics
and Evolution 56, 796–807.
R
ONQUIST,F.&HUELSENBECK, J.P. 2003. MrBayes 3: Bayesian
phylogenetic inference under mixed models. Bioinformatics
19, 1572–1574.
S
HIMIZU,N.&FUJIYAMA, S. 1986. Multiple matings of Chrysolina
aurichalcea (Mannerheim) (Coleoptera: Chrysomelidae).
Journal of the Faculty of Science, Shinshu University
21, 23–30.
S
ILFVERBERG, H. 1974. The west Palearctic species of Galerucella
Crotch and related genera (Coleroptera, Chrysomelidae). No-
tulae Entomologicae 54, 1–11.
S
IMON,C.,FRATI,F.,BECKENBACH,A.,CRESPI,B.,LUI,H.&
F
LOOK, P. 1994. Evolution, weighting, and phylogenetic util-
ity of mitochondrial gene sequences and a compilation of
conserved polymerase chain reaction primers. Annals of the
Entomological Society of America 87, 651–701.
S
OT A,T.&HAYASHI, M. 2007. Comparative historical biogeogra-
phy of Plateumaris leaf beetles (Coleoptera: Chrysomelidae)
in Japan: interplay between fossil and molecular data. Journal
of Biogeography 34, 977–993.
S
WIGO
ˇ
NOV
´
A,Z.&KJER, K.M. 2004. Phylogeny and host-plant
association in the leaf beetle genus Trirhabda LeConte
(Coleoptera: Chrysomelidae). Molecular Phylogenetics and
Evolution 32, 358–374.
S
WOFFORD, D. L. 2002. PAU P
∗
: Phylogenetic analysis using
parsimony (
∗
and other methods). Version 4.0b10. Sinauer,
Sunderland, MA.
T
AMURA,K.,DUDLEY,J.,NEI,M.&KUMAR, S. 2007. MEGA4:
Molecular Evolutionary Genetics Analysis (MEGA) Software
Version 4.0. Molecular Biology and Evolution 24, 1596–
1599.
V
AN’T HOF, A.E., EDMONDS,N.,DAL
´
LKOV
´
A,M.,MAREC,F.&
S
ACCHERI, I. J. 2011. Industrial melanism in British peppered
moths has a singular and recent mutational origin. Science
332, 958–960.
W
ILCOX, J.A. 1965. A Synopsis of the North American Galerucinae
(Coleoptera: Chrysomelidae).UniversityoftheStateofNew
York, State Education Department, New York.
X
UE,H.J.&YANG, X.K. 2010. Species catalogue of Pyrrhalta
Joannis (Coleoptera: Chrysomelidae: Galerucinae) of the
world. Entomotaxonomia 32, 119–136.
Y
U, P.Y., WANG,S.Y.&YANG, X.K. 1996. Economic Insect Fauna
of China, Vol. 54, Coleoptera: Chrysomelidae (II). Science
Press, Beijing.
Associate Editor: Dick Vane-Wright
Downloaded by [Institute of Zoology] at 17:14 25 June 2012
