No full-text available
To read the full-text of this research,
you can request a copy directly from the authors.
Application of real-time polymerase chain reaction to quantitate induced expression of interleukin-1? mRNA in ischemic brain tolerance
Abstract
A short duration of ischemia (i.e., ischemic preconditioning) was shown to result in significant tolerance to subsequent ischemic injury. Since previous reports suggest that interleukin-1β (IL-1β) may be involved in both ischemic damage and neuroprotection, the present work examined the expression of IL-1β mRNA in cortical brain tissue after an established preconditioning (PC) stimulus known to produce significant brain tolerance to focal stroke after 1–7 days. Significant induction of IL-1β mRNA was observed in the ipsilateral cortex at 6 hr (87 ± 9 copies of the mRNA per microgram of brain tissue compared to 16 ± 5 copies in sham-operated samples, P < 0.001, n = 4) and 8 hr (46 ± 4 copies, P < 0.01, n = 4) after PC by means of real-time Taqman polymerase chain reaction (PCR). The peak expression of IL-1β mRNA after PC was significantly (P < 0.01) lower than that after permanent occlusion of the middle cerebral artery (MCAO), i.e., 87 ± 9 and 546 ± 92 copies of RNA per microgram tissue at peak levels for PC and focal stroke, respectively. Immunohistochemistry studies revealed a parallel induction of IL-1β in the ipsilateral cortex after PC. The maximal expression of IL-1β was observed during the first week post-PC, showing marked parallelism with the duration of ischemic tolerance. These data suggest that the significant but low levels of IL-1β induction after PC may contribute to ischemic brain tolerance. J. Neurosci. Res. 59:238–246, 2000 © 2000 Wiley-Liss, Inc.
... Specificity test, reverse transcription, and PCR were carried out as described. 22 Absolute copy numbers of the target transcripts per nanogram of transcribed total RNA were determined with cloned plasmid DNA for rpL32 and MCP-1 as described earlier. 22 The MCP-1 clone was generated by use of the PCR product of the TaqMan sense primer and the Northern antisense primer (Table 1). ...
... 22 Absolute copy numbers of the target transcripts per nanogram of transcribed total RNA were determined with cloned plasmid DNA for rpL32 and MCP-1 as described earlier. 22 The MCP-1 clone was generated by use of the PCR product of the TaqMan sense primer and the Northern antisense primer (Table 1). Data were analyzed with a Sequence Detector V1.6 program (Perkin-Elmer). ...
... The real-time PCR uses the number of cycles needed to reach a fixed threshold amount of PCR product as a measure of the initial concentration of the target nucleic acid. 18,22 The sensitive fluorescence detection system allows the Ct to be observed when PCR amplification is still in the exponential phase, thus avoiding the possibility that reaction components become limiting. The modification of using a cloned plasmid DNA template to obtain a standard curve in addition to a housekeeping gene, as done in these experiments, permits the measurement of the absolute copy numbers of the transcript, allowing the detection and quantification of low abundant target molecules with high accuracy. ...
Chemokines are potent proinflammatory and immune modulators. Increased expression of chemokines, eg, monocyte chemoattractant protein-1 (MCP-1), has recently been described in clinical and experimental heart failure. The present report is aimed at exploring the expression, localization, and binding site regulation of MCP-1, a member of the C-C chemokine family, in a rat model of volume-overload congestive heart failure (CHF).
An aortocaval fistula was surgically created between the abdominal aorta and inferior vena cava. Rats with CHF were further subdivided into compensated and decompensated subgroups. Northern blot analysis and real-time quantitative polymerase chain reaction demonstrated upregulation of MCP-1 mRNA expression correlating with the severity of CHF (288+/-22, 502+/-62, and 826+/-138 copies/ng total RNA for sham, compensated, and decompensated animals, respectively; n=5, P:<0.05). MCP-1 protein was localized by immunohistochemistry in cardiomyocytes, vascular endothelium and smooth muscle cells, infiltrating leukocytes, and interstitial fibroblasts, and its intensity increased with severity of CHF. In addition, rats with CHF displayed a significant decrease of (125)I-labeled MCP-1 binding sites to myocardium-derived membranes (384.3+/-57.0, 181.3+/-8.8, and 123.3+/-14.1 fmol/mg protein for sham, compensated, and decompensated animals, respectively).
Volume-overload CHF in rats is associated with alterations in the expression, immunohistochemical localization, and receptor binding of the MCP-1 chemokine in the myocardium. These changes were more pronounced in rats with decompensated CHF. The data suggest that activation of the MCP-1 system may contribute to the progressive cardiac decompensation and development of CHF in rats with aortocaval fistula.
... Quantitative real-time TaqMan polymerase chain reaction (PCR) was applied to investigate the alterations in gene expression as described previously [4,27,28]. ...
... Absolute copy numbers of the target transcripts were determined using cloned plasmid DNA for rpL32 and MCP-1 to produce a standard curve [4,28]. MCP-1 and rpL32 plasmids contained 539 and 465 bp cDNA insert in a pBluescript cloning vector (2958 bp). ...
... The fluorescence signal is measured and is directly proportional to the amount of target molecules, as we have shown previously by comparing northern blots and TaqMan PCR for this particular target [4]. This PCRbased technique is especially valuable when the copy numbers of mRNA are low, as may be the case with cytokines [4,27,28]. Our data show a significantly lower MCP-1 expression in SFD þ Epro animals compared with SFD animals. ...
The purpose of this investigation was to determine whether angiotensin II receptor (AII1R) antagonism interferes with cardiac monocyte chemoattractant protein-1 (MCP-1) expression in hypertrophic cardiomyopathy and failure.
We studied the effects of the AII1R antagonist eprosartan on MCP-1 expression, and on the recruitment of macrophages into the myocardium in a model of cardiac hypertrophy and morbidity/mortality.
Stroke-prone spontaneously hypertensive rats fed a high-salt, high-fat diet (SFD) developed heart failure characterized by left ventricular (LV) hypertrophy/pathology and hypocontractility. These rats received either normal diet, SFD, or SFD with the daily administration of 30 mg/kg eprosartan for 28 weeks. LV function and wall thickness was assessed by echocardiography, MCP-1 expression was measured by TaqMan real-time polymerase chain reaction, enzyme-linked immunosorbent assay and immunohistochemistry, and macrophage infiltration into the LV was determined by microscopy.
Eprosartan reduced the rate of morbidity/mortality (P = 0.001), LV MCP-1 mRNA (P < 0.05) and protein expression (P < 0.01), and LV macrophage infiltration (P < 0.01), while preserving ventricular function (P < 0.05). Eprosartan also produced a moderate (16%; P < 0.05) decrease in blood pressure.
These data demonstrate that AII1R antagonism in an animal model of hypertensive heart disease reduces MCP-1 expression in the myocardium that results in reduced macrophage recruitment. These effects parallel the preservation of LV systolic function and the reduction in cardiac remodeling/disease progression and reduced morbidity/mortality. Suppression of MCP-1 expression might explain in part the beneficial effects of AII1R antagonism in this model.
... Of the cytokines that were upregulated post-AQ infusion, effects of preconditioning have been examined in only four: (1) interleukin-1ß (IL-1ß), (2) IL-10, (3) tumor necrosis factor-a (TNF-a), and (4) complement component 3 (C3). All four of these cytokines have been shown to be increased following precondi- tioning8485868788. IL-1ß, a pro-inflammatory cytokine, has been shown to increase within 6 hours after preconditioning [86] after which it returns to baseline within 3–4 days [67]. ...
... All four of these cytokines have been shown to be increased following precondi- tioning8485868788. IL-1ß, a pro-inflammatory cytokine, has been shown to increase within 6 hours after preconditioning [86] after which it returns to baseline within 3–4 days [67]. This is consistent with the present study, which demonstrates a rapid increase in IL- 1ß mRNA followed by a return to baseline levels by 2 days post- AQ (Table 1). ...
Ischemic stroke affects ∼795,000 people each year in the U.S., which results in an estimated annual cost of $73.7 billion. Calcium is pivotal in a variety of neuronal signaling cascades, however, during ischemia, excess calcium influx can trigger excitotoxic cell death. Calcium binding proteins help neurons regulate/buffer intracellular calcium levels during ischemia. Aequorin is a calcium binding protein isolated from the jellyfish Aequorea victoria, and has been used for years as a calcium indicator, but little is known about its neuroprotective properties. The present study used an in vitro rat brain slice preparation to test the hypothesis that an intra-hippocampal infusion of apoaequorin (the calcium binding component of aequorin) protects neurons from ischemic cell death. Bilaterally cannulated rats received an apoaequorin infusion in one hemisphere and vehicle control in the other. Hippocampal slices were then prepared and subjected to 5 minutes of oxygen-glucose deprivation (OGD), and cell death was assayed by trypan blue exclusion. Apoaequorin dose-dependently protected neurons from OGD - doses of 1% and 4% (but not 0.4%) significantly decreased the number of trypan blue-labeled neurons. This effect was also time dependent, lasting up to 48 hours. This time dependent effect was paralleled by changes in cytokine and chemokine expression, indicating that apoaequorin may protect neurons via a neuroimmunomodulatory mechanism. These data support the hypothesis that pretreatment with apoaequorin protects neurons against ischemic cell death, and may be an effective neurotherapeutic.
... Of the cytokines that were upregulated post-AQ infusion, effects of preconditioning have been examined in only four: (1) interleukin-1ß (IL-1ß), (2) IL-10, (3) tumor necrosis factor-a (TNF-a), and (4) complement component 3 (C3). All four of these cytokines have been shown to be increased following precondi- tioning8485868788. IL-1ß, a pro-inflammatory cytokine, has been shown to increase within 6 hours after preconditioning [86] after which it returns to baseline within 3–4 days [67]. ...
... All four of these cytokines have been shown to be increased following precondi- tioning8485868788. IL-1ß, a pro-inflammatory cytokine, has been shown to increase within 6 hours after preconditioning [86] after which it returns to baseline within 3–4 days [67]. This is consistent with the present study, which demonstrates a rapid increase in IL- 1ß mRNA followed by a return to baseline levels by 2 days post- AQ (Table 1). ...
Ischemic stroke affects ,795,000 people each year in the U.S., which results in an estimated annual cost of $73.7 billion. Calcium is pivotal in a variety of neuronal signaling cascades, however, during ischemia, excess calcium influx can trigger excitotoxic cell death. Calcium binding proteins help neurons regulate/buffer intracellular calcium levels during ischemia. Aequorin is a calcium binding protein isolated from the jellyfish Aequorea victoria, and has been used for years as a calcium indicator, but little is known about its neuroprotective properties. The present study used an in vitro rat brain slice preparation to test the hypothesis that an intra-hippocampal infusion of apoaequorin (the calcium binding component of aequorin) protects neurons from ischemic cell death. Bilaterally cannulated rats received an apoaequorin infusion in one hemisphere and vehicle control in the other. Hippocampal slices were then prepared and subjected to 5 minutes of oxygen-glucose deprivation (OGD), and cell death was assayed by trypan blue exclusion. Apoaequorin dose-dependently protected neurons from OGD – doses of 1% and 4% (but not 0.4%) significantly decreased the number of trypan blue-labeled neurons. This effect was also time dependent, lasting up to 48 hours. This time dependent effect was paralleled by changes in cytokine and chemokine expression, indicating that apoaequorin may protect neurons via a neuroimmunomodulatory mechanism. These data support the hypothesis that pretreatment with apoaequorin protects neurons against ischemic cell death, and may be an effective neurotherapeutic.
... A study showed that global IP in gerbil increased IL-1β levels in the blood and that systemic IL-1β administration prior to ischemia protected CA1 neurons, which was disappeared by co-administration of IL-1ra (Ohtsuki et al., 1996). Similarly, a preconditioning by brief (15 min) middle cerebral artery occlusion (MCAO) in spontaneously hypertensive rats induced low-level IL-β expression in the cortex during the tolerance period, indicating a contribution to ischemic tolerance by IL-1β (Wang et al., 2000). In the same model, Barone and the colleagues reported an increase in IL-1ra expression in the cortex during the tolerance period (Barone et al., 1998). ...
... IL-1β is thought to be a preconditioning stimulus as systemic administration of IL-1β prior to ischemic insults reduces neuronal injury, which is reversed by co-administration with IL-1ra (Ohtsuki et al., 1996). In addition, increased expression of IL-1β protein in glial cells in the cortex after IP was demonstrated during tolerance periods (Wang et al., 2000). In our BCCAO IP model, we showed increases in IL-1β mRNA expression levels at the time of tolerance period but its protein level did not reach the statistical significance. ...
Ischemic preconditioning (IP) is a phenomenon that organs develop a tolerance toward subsequent lethal ischemic insults. Among the factors that are involved in IP, IL-1beta and its endogenous receptor antagonist IL-1ra have been identified as important players in the induction of IP. The present study investigated whether IP affects the levels of these two antagonistic proteins during tolerance and reperfusion periods after ischemic stroke. The IP 24 h prior to ischemic stroke resulted in neuroprotection in the cortex. IP-induced protection is accompanied by increased IL-1beta gene and IL-1ra gene and protein levels during the tolerance period. In the post-ischemic cortex, IP resulted in the suppression of IL-1beta mRNA and protein levels at 6 h without affecting IL-1ra expression and the up-regulation of IL-1ra protein at 24 h. These findings demonstrate that IP differentially regulates cortical IL-1beta and IL-1ra expression before and after ischemic stroke and suggest that the shift toward an anti-inflammatory state in the post-ischemic cortex may contribute to IP-induced neuroprotection.
... IL-1β has also been shown to mediate ischemic tolerance, contributing to building a protective response [54]. Finally, IL-1β can reduce excitotoxicity neuronal cell death after the addition of ionotropic glutamate receptor agonists to primary neuronal and organotypic slice cultures [55][56][57][58]. Whether the observed increase in IL-1β transcriptional expression in our experimental model contributes to neuronal protection and/or recovery should be assessed in future studies. ...
Traumatic brain injury is a leading cause of disability and death worldwide and represents a high economic burden for families and national health systems. After mechanical impact to the head, the first stage of the damage comprising edema, physical damage, and cell loss gives rise to a second phase characterized by glial activation, increased oxidative stress and excitotoxicity, mitochondrial damage, and exacerbated neuroinflammatory state, among other molecular calamities. Inflammation strongly influences the molecular events involved in the pathogenesis of TBI. Therefore, several components of the inflammatory cascade have been targeted in experimental therapies. Application of Electromagnetic Field (EMF) stimulation has been found to be effective in some inflammatory conditions. However, its effect in the neuronal recovery after TBI is not known. In this pilot study, Yucatan miniswine were subjected to TBI using controlled cortical impact approach. EMF stimulation via a helmet was applied immediately or two days after mechanical impact. Three weeks later, inflammatory markers were assessed in the brain tissues of injured and contralateral non-injured areas of control and EMF-treated animals by histomorphometry, immunohistochemistry, RT-qPCR, Western blot, and ELISA. Our results revealed that EMF stimulation induced beneficial effect with the preservation of neuronal tissue morphology as well as the reduction of inflammatory markers at the transcriptional and translational levels. Immediate EMF application showed better resolution of inflammation. Although further studies are warranted, our findings contribute to the notion that EMF stimulation could be an effective therapeutic approach in TBI patients.
... From animal studies we know that IL-1α is primarily expressed by CD11b + microglia and CD41 + platelets following focal cerebral ischemia [12,16]. IL-1β is expressed primarily by CD11b + microglia and macrophages in the acute phase [12,15] and by astrocytes at more chronic phases [68]. IL-1Ra is preferentially produced by resident microglia [12]. ...
Preclinical and clinical proof-of-concept studies have suggested the effectiveness of
pharmacological modulation of inflammatory cytokines in ischemic stroke. Experimental
evidence shows that targeting tumor necrosis factor (TNF) and interleukin (IL)-1 holds
promise, and these cytokines are considered prime targets in the development of new stroke
therapies. So far, however, information on the cellular expression of TNF and IL-1 in the human
ischemic brain is sparse.
We studied 14 cases of human post-mortem ischemic stroke, representing 21 specimens of
infarcts aged 1 to >8 days. We characterized glial and leukocyte reactions in the infarct/periinfarct
(I/PI) and normal-appearing tissue (NAT) and the cellular location of TNF, TNF
receptor (TNFR)1 and TNFR2, IL-1, IL-1, and IL-1 receptor antagonist (IL-1Ra). The
immunohistochemically stained tissue sections received a score reflecting the number of
immunoreactive cells and the intensity of the immunoreactivity (IR) in individual cells where
0 = no immunoreactive cells, 1 = many intermediately to strongly immunoreactive cells, and 2
= numerous and intensively immunoreactive cells. Additionally, we measured blood TNF,
TNFR, and IL-1 levels in surviving ischemic stroke patients within the first 8 hours and again
at 72 hours after symptom onset and compared levels to healthy controls.
We observed IL-1 and IL-1 IR in neurons, glia, and macrophages in all specimens. IL-1Ra
IR was found in glia, in addition to macrophages. TNF IR was initially found in neurons located
in I/PI and NAT but increased in glia in older infarcts. TNF IR increased in macrophages in all
specimens. TNFR1 IR was found in neurons and glia and macrophages, while TNFR2 was
expressed only by glia in I/PI and NAT, and by macrophages in I/PI. Our results suggest that
TNF and IL-1 are expressed by subsets of cells and that TNFR2 is expressed in areas with
increased astrocytic reactivity. In ischemic stroke patients, we demonstrate that plasma TNFR1
and TNFR2 levels increased in the acute phase after symptom onset compared to healthy
controls, whereas TNF, IL-1, IL-1, and IL-1Ra did not change.
Our findings of increased brain cytokines and plasma TNFR1 and TNFR2 support the
hypothesis that targeting post-stroke inflammation could be a promising add-on therapy in
ischemic stroke patients.
... IL-1β is constitutively expressed in the CNS [42] where it exerts neurotrophic factor-like activity [161] or regulates both the expression and activity of ion channels [181]. IL-1β is upregulated acutely after ischemic stroke (Fig. 1) [32,33,37] and peaks at 12-24 h (Fig. 2b) primarily in microglia and macrophages [32,37], and later in astroglial-like cells [183]. ...
Inflammation is currently considered a prime target for the development of new stroke therapies. In the acute phase of ischemic stroke, microglia are activated and then circulating immune cells invade the peri-infarct and infarct core. Resident and infiltrating cells together orchestrate the post-stroke inflammatory response, communicating with each other and the ischemic neurons, through soluble and membrane-bound signaling molecules, including cytokines. Inflammation can be both detrimental and beneficial at particular stages after a stroke. While it can contribute to expansion of the infarct, it is also responsible for infarct resolution, and influences remodeling and repair. Several pre-clinical and clinical proof-of-concept studies have suggested the effectiveness of pharmacological interventions that target inflammation post-stroke. Experimental evidence shows that targeting certain inflammatory cytokines, such as tumor necrosis factor, interleukin (IL)-1, IL-6, and IL-10, holds promise. However, as these cytokines possess non-redundant protective and immunoregulatory functions, their neutralization or augmentation carries a risk of unwanted side effects, and clinical translation is, therefore, challenging. This review summarizes the cell biology of the post-stroke inflammatory response and discusses pharmacological interventions targeting inflammation in the acute phase after a stroke that may be used alone or in combination with recanalization therapies. Development of next-generation immune therapies should ideally aim at selectively neutralizing pathogenic immune signaling, enhancing tissue preservation, promoting neurological recovery and leaving normal function intact.
... IL-1β is constitutively expressed in the CNS [42] where it exerts neurotrophic factor-like activity [161] or regulates both the expression and activity of ion channels [181]. IL-1β is upregulated acutely after ischemic stroke (Fig. 1) [32,33,37] and peaks at 12-24 h (Fig. 2b) primarily in microglia and macrophages [32,37], and later in astroglial-like cells [183]. ...
... Introduction A short duration of ischemia (i.e., ischemic preconditioning; IP) can provide significant brain protection to subsequent long-duration ischemia (i.e., termed ischemic tolerance; IT). Thus, injurious stimuli applied to an organ below its injury threshold can activate endogenous protective mechanisms that involve newly expressed protective proteins [1][2][3][4][5][6][7][8][9]. IP induced IT has been shown in the human nervous system and heart [10,11] suggesting that we can capture these endogenous neuroprotective mechanisms for use to protect the brain and heart in surgical patients. ...
There is interest in pharmacologic preconditioning for end-organ protection by targeting the HIF system. This can be accomplished by inhibition of prolyl 4-hydroxylase (PHD). GSK360A is an orally active PHD inhibitor that has been previously shown to protect the failing heart. We hypothesized that PHD inhibition can also protect the brain from injuries and resulting behavioral deficits that can occur as a result of surgery. Thus, our goal was to investigate the effect of pre-stroke surgery brain protection using a verified GSK360A PHD inhibition paradigm on post-stroke surgery outcomes. Vehicle or an established protective dose (30 mg/kg, p.o.) of GSK360A was administered to male Sprague-Dawley rats. Initially, GSK360A pharmacokinetics and organ distribution were determined, and then PHD-HIF pharmacodynamic markers were measured (i.e., to validate the pharmacological effects of the GSK360A administration regimen). Results obtained using this validated PHD dose-regimen indicated significant improvement by GSK360A (30mg/kg); administered at 18 and 5 hours prior to transient middle cerebral artery occlusion (stroke). GSK360A exposure and plasma, kidney and brain HIF-PHD pharmacodynamics endpoints (e.g., erythropoietin; EPO and Vascular Endothelial Growth Factor; VEGF) were measured. GSK360A provided rapid exposure in plasma (7734 ng/ml), kidney (45–52% of plasma level) and brain (1–4% of plasma level), and increased kidney EPO mRNA (80-fold) and brain VEGF mRNA (2-fold). We also observed that GSK360A increased plasma EPO (300-fold) and VEGF (2-fold). Further assessments indicated that GSK360A reduced post-stroke surgery neurological deficits (47–64%), cognitive dysfunction (60–75%) and brain infarction (30%) 4 weeks later. Thus, PHD inhibition using GSK360A pretreatment produced long-term post-stroke brain protection and improved behavioral functioning. These data support PHD inhibition, specifically by GSK360A, as a potential strategy for pre-surgical use to reduce brain injury and functional decline due to surgery-related cerebral injury.
... Introduction A short duration of ischemia (i.e., ischemic preconditioning; IP) can provide significant brain protection to subsequent long-duration ischemia (i.e., termed ischemic tolerance; IT). Thus, injurious stimuli applied to an organ below its injury threshold can activate endogenous protective mechanisms that involve newly expressed protective proteins [1][2][3][4][5][6][7][8][9]. IP induced IT has been shown in the human nervous system and heart [10,11] suggesting that we can capture these endogenous neuroprotective mechanisms for use to protect the brain and heart in surgical patients. ...
... Further, support for the assertion that IL-1β can promote positive outcomes is shown by the fact that IL-1β can reduce excitotoxic neuronal cell death, a main contributor to ischemic injury. Neuron death induced by the addition of ionotropic glutamate receptor agonists NMDA, AMPA, and kainate in primary neuronal cultures and in organotypic slice is effectively ameliorated with treatment with rather high concentrations of IL-1 (Bernardino et al 2005;Carlson et al 1999;Ohtsuki et al 1996;Pringle et al 2001;Wang et al 2000b). This may be due to its ability to protect neurons and promote growth and/or survival via stimulated production of neurotrophic factors (Carlson et al 1999;. ...
Acute inflammation is a self-limiting, complex biological response mounted to combat pathogen invasion, to protect against tissue damage, and to promote tissue repair should it occur. However, unabated inflammation can be deleterious and contribute to injury and pathology. Interleukin-1β (IL-1β), a prototypical "pro-inflammatory" cytokine, is essential to cellular defense and tissue repair in nearly all tissues. With respect to brain, however, studies suggest that IL-1β has pleiotrophic effects. It acts as a neuromodulator in the healthy central nervous system (CNS), has been implicated in the pathogenic processes associated with a number of CNS maladies, but may also provide protection to the injured CNS. Here, we will review the physiological and pathophysiological functions of IL-1β in the central nervous system with regard to synaptic plasticity. With respect to disease, emphasis will be placed on stroke, epilepsy, Parkinson's disease and Alzheimer's disease where the ultimate injurious or reparative effects of IL-1β appear to depend on time, concentration and environmental milieu.
... Data for TNF were obtained from: solid blue and red (Hill et al, 1999); solid green (Lambertsen et al, 2009); and dotted blue (Liu et al, 1994) and red (Berti et al, 2002). Data for IL-1b were obtained from: solid blue and red (Hill et al, 1999); solid green (Clausen et al, 2005); dotted blue (Wang et al, 1994); dotted red (Berti et al, 2002); and dotted green (Wang et al, 2000). Data for IL-6 were from: solid blue and red (Hill et al, 1999), dotted blue (Wang et al, 1995); and dotted red (Berti et al, 2002). ...
Inflammation is a hallmark of stroke pathology. The cytokines, tumor necrosis factor (TNF), interleukin (IL)-1, and IL-6, modulate tissue injury in experimental stroke and are therefore potential targets in future stroke therapy. The effect of these cytokines on infarct evolution depends on their availability in the ischemic penumbra in the early phase after stroke onset, corresponding to the therapeutic window (<4.5 hours), which is similar in human and experimental stroke. This review summarizes a large body of literature on the spatiotemporal and cellular production of TNF, IL-1, and IL-6, focusing on the early phase in experimental and human stroke. We also review studies of cytokines in blood and cerebrospinal fluid in stroke. Tumor necrosis factor and IL-1 are upregulated early in peri-infarct microglia. Newer literature suggests that IL-6 is produced by microglia, in addition to neurons. Tumor necrosis factor- and IL-1-producing macrophages infiltrate the infarct and peri-infarct with a delay. This information is discussed in the context of suggestions that neuronal sensitivity to ischemia may be modulated by cytokines. The fact that TNF and IL-1, and suppossedly also IL-6, are produced by microglia within the therapeutic window place these cells centrally in potential future stroke therapy.
... It was suggested that TNF-a and IL-1h in cerebral ischemia probably have dual functions: both exert neurotoxicity in the presence of inducible NO synthase (iNOS) up-regulation, while they may play roles in neuroprotection and plasticity in the absence of iNOS (Stoll et al., 2000). Cytokines, including IL-1h, are involved in ischemic brain tolerance (Wang et al., 2000), including that triggered by spreading depression (SD) (Jander et al., 2001). ...
... However, it should be taken into account that, under certain circumstances, controlled inflammation in the brain may also be beneficial for the recovery from brain injury (Morganti-Kossmann et al., 2001;Stoll et al., 2002). Indeed, cytokines, including IL-1β, may play a role in ischemic neuroprotection and plasticity (Stoll et al., 2000) and have also been implicated in ischemic brain tolerance (Wang et al., 2000). IL-1β is synthesized as a precursor molecule, pro-IL-1β, which is cleaved and converted into the mature, biologically active form by caspase-1, formerly referred to as interleukin-1β converting enzyme, ICE (Black et al., 1988;Howard et al., 1991;Thornberry et al., 1992). ...
The proinflammatory cytokine interleukin(IL)-1beta plays a crucial role in ischemic pathophysiology, since pharmacologic inhibition of its biological effects provides neuroprotection after stroke. However, there is evidence suggesting that under certain circumstances the cytokine may also exert beneficial functions on brain injury. We have investigated the regional and cellular expression of IL-1beta after ischemia-reperfusion injury in the brain of rat, and correlated cytokine expression with the activation/recruitment of glial cells in the damaged tissue. By using a double immunofluorescence histochemical approach, we observed an increased cytokine immunoreactivity in the ischemic core, as early as 1 h after middle cerebral artery occlusion, in few activated OX-42-positive microglial cells and in perivascular GFAP-positive astrocytes, suggesting that the cytokine may participate in the early response of the neurovascular unit to reduced blood supply. After 2 h ischemia, followed by 2 h reperfusion, cytokine staining was evident in the astrocytes of the penumbra and in activated microglial cells of the ischemic core. Microglial activation increases with the progression of damage and, after 22 h reperfusion, OX-42-immunopositive cells were strongly labelled for IL-1beta in the core and, even more intensely, in the penumbra. At this later stage, GFAP-positive cells, appearing hypertrophic and distributed in a ring-like pattern around the ischemic core, do no longer express IL-1beta. Thus, a specific cellular and regional pattern of IL-1beta expression characterises the progression of ischemia-reperfusion injury. Depending on the stage and intensity of the insult, the different cellular origin of the cytokine may suggest a distinct role of this neuroinflammatory mediator in ischemic pathophysiology.
... Primer and probes were chosen to bind in different exons or to span exon junctions to prevent amplification of genomic DNA. The forward and reverse primers, and internal probe sequences for each cytokine and the house keeping genes are given inTable 1 (for rpL32 (Wang et al., 2000); for TNFα, (Fink et al., 1998); for IL-10 (Overbergh et al., 2003). The comparative CT method, previously described (Livak et al., 1995) was used to calculate relative gene expression data since we have determined in preliminary experiments that the amplification efficiencies of the target genes and the reference genes (rpL32 and GAPDH) are approximately the same. ...
This study was designed to investigate whether the pattern of hypothalamic and splenic cytokine expression induced by peripheral administration of a bacterial lipopolysaccharide (LPS) is affected by prior exposure to LPS derived from another bacterial strain. Injection of LPS from Salmonella enteritidis (LPS(2)) alone resulted in increased hypothalamic gene expression of IL-1beta, IL-6, TNFalpha, IL-1ra and IL-10. However, pre-exposure to LPS derived from Escherichia coli (LPS(1)) 3 weeks before, significantly attenuated hypothalamic IL-1ra, IL-6 and IL-10 expression. IL-1beta expression also tended to be lower. This pattern contrasted with the robust cytokine expression in the spleen of LPS(2)-treated rats previously exposed to LPS(1), since pre-treatment with endotoxin resulted in a significantly greater response of IL-1beta and IL-1ra to LPS(2). Expression of TNFalpha and IL-10 also tended to be higher. Pre-treatment with LPS(1) did not significantly affect the marked increase in corticosterone and adrenaline blood levels induced by LPS(2). Thus, while endotoxin pre-exposure seemed not to induce a "tolerant" state in the periphery as judged by the immune and endocrine parameters evaluated upon re-stimulation, expression of four of the six cytokines measured was decreased in the hypothalamus. This is the first demonstration that endotoxin priming can differentially affect cytokine expression in the central nervous system and peripheral tissues when a host is confronted with a second, acute, pro-inflammatory stimulus. These results may provide new evidence for the involvement of cytokine pathways in the central nervous system in modulating peripheral inflammation and mediating cognitive and behavioural alterations during inflammatory diseases.
... The primers and probes used were as follows: for IL-1, those described in ref. 21; for IL-6, GACAGTGCATCATCGCTGTTCATA (forward primer), AGTCGGAGGCTTAATTACATATGTTC (reverse primer), and CAGAATTGCCATTGCAC AACTC-TTTTCTCATTT (probe) (accession no. NM_012589); for TNF␣, those described elsewhere (22); and for the normalizer rpL32, those described previously (23). The comparative threshold cycle (C t ) method (⌬⌬C t method), as previously described (24), was used to calculate relative gene expression data, since we determined in preliminary experiments that the amplification efficiencies of the target genes and the reference gene (rpL32) are approximately the same. ...
To explore the hypothesis that, in parallel with alterations in the hypothalamus-pituitary-adrenal axis and the sympathetic nervous system, hypothalamic cytokine expression and monoaminergic neurotransmitter concentrations are affected during the course of arthritis development induced by type II collagen. This hypothesis was based on evidence that acute inflammatory processes induce cytokine expression in the brain and affect neuronal activity. We also studied whether depletion of hypothalamic noradrenaline can affect peripheral joint disease.
Hypothalamic cytokine gene expression and neurotransmitter concentration, parameters of inflammation, and joint innervation were evaluated during arthritis development in rats induced by injection of type II collagen in Freund's incomplete adjuvant. Noradrenergic neurons in the brain were depleted with 6-hydroxydopamine.
Transiently increased corticosterone levels, followed by increased adrenaline levels and hypothalamic interleukin-1beta (IL-1beta) and IL-6 overexpression were observed only during the induction phase of the disease. Hypothalamic noradrenaline content was increased during the symptomatic phase and was paralleled by a gradual loss of noradrenergic fibers in the joints. The positive correlation between hypothalamic IL-1beta expression and noradrenaline content in control groups was not observed in rats in which arthritis developed. Depletion of hypothalamic noradrenergic neurons when arthritis was established did not affect the course of the disease.
The dissociation between hypothalamic cytokine gene expression and noradrenergic neuronal activity, the lack of sustained stimulation of the stress axes, and the loss of sympathetic signals in the joints indicate a disruption in communication between afferent immune messages to the central nervous system and 2 main efferent antiinflammatory pathways under control of the brain during collagen-induced arthritis.
... Some studies have demonstrated that pretreatment with cytokines such as TNF-␣ and IL-1 provides neuroprotection against neuronal insults (51)(52)(53)(54). However, pretreatment with sublethal injuries, including brief ischemia or oxygen/glucose deprivation, is well known to trigger tolerance against a subsequent neuronal insult, and this preconditioning pathway involves NMDARs and nitric oxide (55). ...
Glutamate excitotoxicity to a large extent is mediated through activation of the N-methyl-D-aspartate (NMDA)-gated ion channels in several neurodegenerative diseases and ischemic stroke. Minocycline, a tetracycline derivative with antiinflammatory effects, inhibits IL-1beta-converting enzyme and inducible nitric oxide synthase up-regulation in animal models of ischemic stroke and Huntington's disease and is therapeutic in these disease animal models. Here we report that nanomolar concentrations of minocycline protect neurons in mixed spinal cord cultures against NMDA excitotoxicity. NMDA treatment alone induced microglial proliferation, which preceded neuronal death, and administration of extra microglial cells on top of these cultures enhanced the NMDA neurotoxicity. Minocycline inhibited all these responses to NMDA. Minocycline also prevented the NMDA-induced proliferation of microglial cells and the increased release of IL-1beta and nitric oxide in pure microglia cultures. Finally, minocycline inhibited the NMDA-induced activation of p38 mitogen-activated protein kinase (MAPK) in microglial cells, and a specific p38 MAPK inhibitor, but not a p44/42 MAPK inhibitor, reduced the NMDA toxicity. Together, these results suggest that microglial activation contributes to NMDA excitotoxicity and that minocycline, a tetracycline derivative, represents a potential therapeutic agent for brain diseases.
... using a dilution series of target gene RT-PCR products (Wang et al, 2000). These standard curves (Fig. 1, A and B; standard dilutions [filled squares]) allowed us to determine mRNA copies of the studied genes in pilocarpine-treated (filled circles) and control rat neurons (empty squares). ...
... The validation of using real time quantitative PCR by the 5Ј fluorogenic nuclease assay (Taqman) in CNS has been demonstrated in recent studies Calver et al., 2000;Medhurst et al., 2000;Wang et al., 2000). In the present study we have applied a real time PCR method that employs a SYBR Green I dye, a molecule that binds in the double stranded DNA and is fluorescent when bound. ...
In mammals, gene transcription is a step subjected to tight regulation mechanisms. In fact, changes in mRNA levels in the central nervous system (CNS) can account for numerous phenotypic differences in brain function. We performed a high-resolution analysis of mRNA expression levels for 37 genes selected from a normal rat hippocampus cDNA library. mRNA amounts were quantified using a Real Time PCR SYBR Green assay. We found that, in general, individuals from an inbred rat population (n = 20) have shown 2-3 times differences in the basal level of expression of the genes analyzed. Up to several fold differences among individuals were observed for certain genes. These inter-individual differences were obtained after correction for the different amounts of mRNA in each sample. Power calculations were performed to determine the number of individuals required to detect reliable differences in expression levels between a control and an experimental group. These data indicated that, depending on the variability of the candidate gene selected, it was necessary to analyze from five to 135 individuals in each group to detect differences of 50% in the levels of mRNA expression between two groups investigated. The comparison of mRNA abundance from different genes revealed a wide range of expression levels for the 37 genes, showing a 26,000-fold difference between the highest and lowest expressed gene.
... Indeed, there is evidence of the direct ability of tumor necrosis factor-␣ and interleukin-1, cytokines pro-duced and elaborated into the circulation in response to hypoxia, to promote ischemic tolerance in brain. 19,20 The involvement of particular mediators and the expression mechanisms underlying the development of injury resistance in these models of retinal ischemic tolerance still require positive identification. ...
A brief period of noninjurious retinal ischemia, termed preconditioning, has been documented in rats to afford transient protection from retinal ischemic injury, a phenomenon known as ischemic tolerance. The present study was undertaken to develop and systematically characterize mouse models of ischemic tolerance.
Retinal ischemic injury was caused by elevating intraocular pressure for 30, 45, or 60 minutes in chloral hydrate-anesthetized ND4 Swiss-Webster mice. Random animals were preconditioned 24 hours earlier with either 5 minutes of retinal ischemia or by exposing conscious animals to hypoxia (11% oxygen) for 2 hours. Flash electroretinograms were recorded 1 day and 1 week after ischemia. At 1 or 4 weeks after ischemia, eyes were perfusion fixed for microscopic examination and quantification of layer thickness and cell counts.
Retinal ischemia resulted in significant, duration-dependent reductions in inner retinal layer thickness and cell loss in the inner nuclear and ganglion cell layers. A duration-dependent attenuation in a- and b-wave amplitudes was concomitantly noted. The ischemic and hypoxic preconditioning treatments significantly attenuated the ischemia-induced changes in retinal morphology and function, even after 4 weeks of recovery. Tolerance was observed at 24 hours after ischemic preconditioning, but not at 72 hours.
Two models of retinal ischemic tolerance are presented wherein ischemic or hypoxic preconditioning afforded morphologic and functional evidence of protection from retinal ischemic injury in mice. These two murine models should be useful for studies in mutant mice to elucidate endogenous genetic and molecular mechanisms of retinal protection that may then be used to design treatments for ischemic retinopathies.
... Primers and probe for TIMP-3 were designed using Primer Express software (PerkinElmer) from a rat TIMP-3 sequence (Gene Bank U27201). Each sample was also run with primers and probe for a "housekeeping gene," ribosomal protein rpl-32, based on published sequences (Wang et al., 2000). Primers (Integrated DNA Technologies, Inc., Coralville, Iowa, U.S.A.) and probes (PerkinElmer) were synthesized. ...
Programmed cell death occurs in ischemia when cell surface death receptors (DRs) are stimulated by death-inducing ligands (DILs). Matrix metalloproteinases are extracellular matrix-degrading enzymes involved in the shedding of DRs and DILs from the cell surface. Tissue inhibitor of metalloproteinase-3 (TIMP-3), which is bound to the extracellular matrix, has been shown to promote apoptosis in cancer cell lines by inhibiting cell surface sheddases. Since apoptosis is an important mechanism of cell death in ischemia, the authors hypothesized that TIMP-3 would be expressed in ischemic neurons that are undergoing programmed cell death. Spontaneously hypertensive rats had a 90-minute middle cerebral artery occlusion with reperfusion. Transcription of TIMP-3 mRNA was measured by quantitative reverse transcription-polymerase chain reaction at 2, 6, 24 and 48 hours after reperfusion. Western blots were used to measure TIMP-3 protein expression. Spatial distribution and production of TIMP-3 was studied by immunohistochemistry at 3, 24, and 48 hours, 5 days, and 3 weeks. DNA fragmentation in cells dying by necrosis and apoptosis was identified with terminal deoxynucleotidyl transferase-mediated 2'-deoxyuridine 5'-triphosphate-biotin nick end labeling (TUNEL). After 2 hours of reperfusion, TIMP-3 mRNA increased significantly in both ischemic and nonischemic hemispheres. Western blot analysis confirmed the identity of the TIMP-3, which appeared to be increased on the ischemic side. After 3 hours of reperfusion, TIMP-3 immunostaining was increased in neurons on the ischemic side, and by 24 hours the majority of the ischemic neurons were TIMP-3-positive. Dual-fluorescence staining for TUNEL and TIMP-3 showed that they were coexpressed in many neurons. The results suggest that ischemic neurons express TIMP-3, which may be inhibiting sheddases. The authors propose that TIMP-3 facilitates cell death in ischemic neurons. Further studies are needed to identify the sheddases inhibited by the TIMP-3, and on the effect of inhibition of matrix metalloproteinases on cell death mechanisms.
... Since a method for specific mRNA quantitation by the polymerase chain reaction (PCR) has been developed [54,55], the real-time reverse transcriptase-polymerase chain reaction (RT-PCR) method has been used in many fields, including neuropathology [56,57,58], demonstrating its applicability for studying brain injury pathology [59]. This study evaluated the efficiency of the real-time PCR method for FE65 and NSE mRNA quantitation and early DAI diagnosis in rats. ...
In cases of traumatic brain injury (TBI) in which the patient survived for only a short period of time and was without macroscopic changes at autopsy, it is difficult to diagnose TBI. To detect early diagnostic markers of diffuse axonal injury (DAI), real-time quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) in an experimental head trauma model of rat was chosen. The beta-amyloid precursor protein (beta-APP) is a well-known diagnostic marker of DAI which can be detected by immunolabeling as early as 1.5 h after injury. beta-APP has a binding protein, FE65, which is expressed in the brain of Alzheimer's disease patients along with beta-APP, but no involvement with brain injury has been reported. Neuron-specific enolase (NSE) is also a useful marker of DAI. We found that FE65 expression increased dramatically as early as 30 min after injury and decreased after peaking 1 h post-injury, although NSE showed no significant changes. These results suggest that real-time PCR of FE65 mRNA is useful for the diagnosis of DAI in forensic cases.
... 1. The ipsilateral and/or contralateral cortex was processed for RNA extraction as described previously (41,159). 2. The PCR primers and TaqMan probes for IL-1b and rpL32 were designed using a Software program from Perkin-Elmer according to the published rat IL-1 and rpL32 cDNA sequences as indicated previously (159). 3. The TaqMan probes were labeled with a reporter fluorescent dye, FAN (6- carboxyfluorescein), at the 5' end and a fluorescent dye quencher, TAMRA (6- carboxy-tetramethyl-rhodamine), at the 3' end. ...
Almost all injurious stimuli, when applied below the threshold of producing injury, activate endogenous protective mechanisms that significantly decrease the degree of injury after subsequent injurious stimuli. For example, a short duration of ischemia (i.e., ischemic preconditioning [PC]) can provide significant brain protection to subsequent long-duration ischemia (i.e., ischemic tolerance [IT]). PC/IT has recently been shown in human brain, suggesting that learning more about these endogenous neuroprotective mechanisms could help identify new approaches to treat patients with stroke and other central nervous system disorders/injury. This chapter provides a brief overview of PC/IT research, illustrates the types of data that can be generated from in vivo and in vitro models to help us understand gene and protein expression related to induced neuroprotective mechanisms, and emphasizes the importance of future research on this phenomenon to help discover new mechanisms and targets for the medical treatment of brain and other end-organ injuries.
... 49 Both IL-1 and TNF-␣ are up-regulated following sublethal ischemia in vivo. 50,51 Ischemic preconditioning appears to be dependent on TNF-␣ release as inhibition of TNF-␣ convertase (TACE/ ADAM17, which is involved in TNF-␣ release), blocked both the increase in TNF-␣ and the neuroprotective effects of preconditioning. 51 Pretreatment of hippocampal cell cultures with TNF-␣ induces protection against subsequent oxidative insults such as FeSO4 or amyloid b-peptide exposure. ...
Preconditioning occurs when a subinjurious exposure renders the brain less vulnerable to a subsequent damaging exposure. In this essay, various models of preconditioning in the immature brain are discussed. Adenosine, excitatory amino acids, nitric oxide, hypoxia-inducible factor, ATP-sensitive K+ channels, caspases, heat shock proteins, inflammatory mediators and gene expression all seem to be involved in sensing, transducing and executing preconditioning resistance. Also reviewed in this essay is evidence that some subinjurious exposures render the brain more vulnerable to a subsequent damaging exposure. We believe that unraveling the mechanisms of how the developing brain becomes inherently resilient or vulnerable will offer important insights into the pathogenesis of injury. Preconditioning of the brain or induction of tolerance of the immune system might be utilized in the future to decrease CNS vulnerability and the occurrence of perinatal brain injury.
... Levels of mRNAs for FOS, BDNF, and tPA, are increased by preischaemic conditioning with CSD [74]. TNF-a and IL1-b are believed to contribute to increased tolerance of ischaemia [75,76], and an antagonist to nuclear factor k-B (NF k-B) blocked NF k-B activity and reduced the pre-conditioning e¤ect [77]. It seems very likely that one or more of the currently identified expression cascades -or other(s) still to be detected, underlie the protective e¤ect of preischaemic conditioning with CSD, and increasing understanding of the molecular response to CSD may in time allow us to identify which of the several genes upregulated by CSD is/are responsible for the protective e¤ects of preconditioning, and so perhaps lead to novel therapy for cerebral ischaemia, or at least better protection of the brain when some degree of prospective risk exists. ...
1. Cortical spreading depression is a non-physiological global depolarisation of neurones and astrocytes that can be initiated with varying degrees of difficulty in the normally perfused cerebral cortex in the experimental laboratory. Induction is typically with electrical stimulation, needling of the cerebral cortex, or superfusion of isotonic or more concentrated potassium chloride solution. The phenomenon propagates across the cerebral cortex at a rate of 2-5 mm per minute, and is accompanied by marked but transient increases in cerebral blood flow, in local tissue oxygen tension, and most probably in metabolic rate. 2. Peri-infarct depolarisation is also a depolarisation event affecting neurones and glia, with an electrophysiological basis similar or identical to CSD, but occurring spontaneously in the ischaemic penumbra or boundary zone in focal cerebral cortical ischaemia. Most such events arise from the edge of the ischaemic core, and propagate throughout the penumbra, at a rate similar to that of cortical spreading depression. 3. Cortical spreading depression in the normally perfused cortex does not result in histological damage whereas peri-infarct depolarisations augment neuronal damage in the penumbra, and are believed by many authors to constitute an important, or the principal, mechanism by which electrophysiological penumbra progressively deteriorates, ultimately undergoing terminal depolarisation and thus recruitment into an expanded core lesion. 4. There is some experimental evidence to suggest that under some circumstances induction of episodes of cortical spreading depression can confer protection against subsequent ischaemic insults. 5. Although cortical spreading depression and peri-infarct depolarisations have been extensively studied in the experimental in vivo models, there is now clear evidence that depolarisations also occur and propagate in the human brain in areas surrounding a focus of traumatic contusion. 6. Whether such events in the injured human brain represent cortical spreading depression or peri-infarct depolarisation is unclear. However, invasive and probably non-invasive monitoring methods are available which may serve to distinguish which event has occurred. 7. Much further work will be needed to examine the relationship of depolarisation events in the injured brain with outcome from cerebral ischaemia or head injury, to examine the factors which influence the frequency of depolarisation events, and to determine which depolarisation events in the human brain augment the injury and should be prevented.
... It was suggested that TNF-a and IL-1h in cerebral ischemia probably have dual functions: both exert neurotoxicity in the presence of inducible NO synthase (iNOS) up-regulation, while they may play roles in neuroprotection and plasticity in the absence of iNOS (Stoll et al., 2000). Cytokines, including IL-1h, are involved in ischemic brain tolerance (Wang et al., 2000), including that triggered by spreading depression (SD) (Jander et al., 2001). In the peripheral nervous system, neuroinflammation is a prerequisite for successful regeneration that is impeded in the CNS (Stoll et al., 2000). ...
Hypoxia-inducible factor-1 (HIF-1) is a heterodimeric transcription factor composed of HIF-1alpha and HIF-1beta subunits and involved in the regulation of gene expression in adaptive response to hypoxia. This study reports that the inflammatory cytokine interleukin-1beta (IL-1beta) shares common features of other known HIF-1alpha-regulated genes. Both human and mouse IL-1beta genes carry multiple HIF-1-binding sites in their promoter regions and are up-regulated by hypoxia and CoCl2 in human and mouse astrocytes in parallel with up-regulation of HIF-1alpha mRNA and protein. Inhibition of HIF-1alpha degradation by proteasome inhibitor, MG-132, potentiated hypoxia-induced IL-1beta release from human astrocytes, and this response was blocked in the presence of CdCl2. Mouse astrocytes with Hif1alpha+/- genotype demonstrated attenuated up-regulation of both HIF-1alpha and IL-1beta by hypoxia and CoCl2. Mutation of HIF-1-binding sites in the IL-1beta promoter abolished hypoxia-induced transactivation of the reporter gene transfected into human astrocytes. Similarly, HIF-1 binding "decoy" oligonuleotide transfected into astrocytes inhibited both hypoxia-induced transactivation of the HIF-1 reporter gene and IL-1beta secretion from transfected astrocytes. Collectively, the evidence suggests that the transcriptional activation of IL-1beta in astrocytes exposed to hypoxia occurs via HIF-1.
... The RNA was purified from the whole hemispheres since the injury induced by the intraluminal tMCAo model affects both cortical and subcortical territories. Many of our findings are supported by previous reports [2,42,43] and additional immunohistochemical observations. However, we were not able to show an effect of parecoxib administration due to the divided treatment response of parecoxib, large biological variation in stroke volume, and small sample sizes. ...
Anti-inflammatory treatment affects ischemic damage and neurogenesis in rodent models of cerebral ischemia. We investigated the potential benefit of COX-2 inhibition with parecoxib in spontaneously hypertensive rats (SHRs) subjected to transient middle cerebral artery occlusion (tMCAo).
Sixty-four male SHRs were randomized to 90 min of intraluminal tMCAo or sham surgery. Parecoxib (10 mg/kg) or isotonic saline was administered intraperitoneally (IP) during the procedure, and twice daily thereafter. Nineteen animals were euthanized after 24 hours, and each hemisphere was examined for mRNA expression of pro-inflammatory cytokines and COX enzymes by quantitative RT-PCR. Twenty-three tMCAo animals were studied with diffusion and T2 weighted MRI within the first 24 hours, and ten of the SHRs underwent follow-up MRI six days later. Thirty-three SHRs were given 5-bromo-2'-deoxy-uridine (BrdU) twice daily on Day 4 to 7 after tMCAo. Animals were euthanized on Day 8 and the brains were studied with free-floating immunohistochemistry for activated microglia (ED-1), hippocampal granule cell BrdU incorporation, and neuronal nuclei (NeuN). Infarct volume estimation was done using the 2D nucleator and Cavalieri principle on NeuN-stained coronal brain sections. The total number of BrdU+ cells in the dentate gyrus (DG) of the hippocampus was estimated using the optical fractionator.
We found a significant reduction in infarct volume in parecoxib treated animals one week after tMCAo (p < 0.03). Cortical ADC values in the parecoxib group were markedly less increased on Day 8 (p < 0.01). Interestingly, the parecoxib treated rats were segregated into two subgroups, suggesting a responder vs. non-responder phenomenon. We found indications of mRNA up-regulation of IL-1beta, IL-6, TNF-alpha and COX-2, whereas COX-1 remained unaffected. Hippocampal granule cell BrdU incorporation was not affected by parecoxib treatment. Presence of ED-1+ activated microglia in the hippocampus was related to an increase in BrdU uptake in the DG.
IP parecoxib administration during tMCAo was neuroprotective, as evidenced by a large reduction in mean infarct volume and a lower cortical ADC increment. Increased pro-inflammatory cytokine mRNA levels and hippocampal granule cell BrdU incorporation remained unaffected.
... The first gene we identified is a shrimp ribosomal protein L24 (srpl24). This result initially surprised us since ribosomal proteins form the majority of cellular proteins, and ribosomal protein genes were considered as housekeeping genes which were expressed at a constant level (Wang et al., 2000; Irusta et al., 2003; Bartholomay et al., 2004; Jonsson-Rylander et al., 2005). Further literature search showed that there are two types of ribosomal proteins presented in eukaryote cells. ...
In order to identify genes involved in oogenesis in shrimp, an ovarian cDNA library of Marsupenaeus japonicus was screened using a suppression-subtraction hybridization (SSH)-enriched probe. More than 20 genes were identified as differentially expressed genes between the ovary and the testis. Unexpectedly, one of these genes is a ribosomal protein that is normally considered a housekeeping gene. Northern blot shows that the shrimp ribosomal protein L24 gene (srpl24) is 0.6 kb in length. The expression level of srpl24 in the ovary is much higher than in the testis. Bioinformatics analyses show that srpl24 encodes a protein of 164 aa with a predicted molecular mass of 18.2 kDa, which is a cytoplasmic ribosomal protein. Real time PCR analyses demonstrated that the relative abundance of srpl24 mRNA in the different organs is: ovary > testis, hepatopancreas, muscle and eye. The highest expression level of srpl24 in the ovary suggests that srpl24 has an important role in oogenesis. It is the first reported rpl24 in crustaceans and is the first reported rpl24 that is differentially expressed between the ovary and the testis in animals.
... The inflammatory response is intended as a cellular defense mechanism to remove or inactivate harmful agents. While most studies suggest that IL-1b signaling is harmful to the injured CNS (Relton and Rothwell 1992;Toulmond and Rothwell 1995;Yamasaki et al. 1995;Betz et al. 1996;Relton et al. 1996;Yang et al. 1997;Boutin et al. 2001;Nesic et al. 2001;Tehranian et al. 2002;Jones et al. 2005;Lu et al. 2005), some report neuroprotective effects that appear to be dependent on the concentration of cytokine and the timing of the response relative to insult Ohtsuki et al. 1996;Carlson et al. 1999;Wang et al. 2000;Pringle et al. 2001;Bernardino et al. 2005;Shaftel et al. 2007b). Importantly, IL-1b alone, in the absence of additional CNS impairment, is not neurotoxic (Relton and Rothwell 1992;Yamasaki et al. 1995;Lawrence et al. 1998;Rothwell 1999;Shaftel et al. 2007a). ...
Interleukin-1 (IL-1) is a proinflammatory cytokine released by many cell types that acts in both an autocrine and/or paracrine fashion. While IL-1 is best described as an important mediator of the peripheral immune response during infection and inflammation, increasing evidence implicates IL-1 signaling in the pathogenesis of several neurological disorders. The biochemical pathway(s) by which this cytokine contributes to brain injury remain(s) largely unidentified. Herein, we review the evidence that demonstrates the contribution of IL-1beta to the pathogenesis of both acute and chronic neurological disorders. Further, we highlight data that leads us to propose IL-1beta as the missing mechanistic link between a potential beneficial inflammatory response and detrimental glutamate excitotoxicity.
Interleukin-1β (IL-1β) is a key mediator in the inflammatory response essential to cellular defense against pathogen invasion and to the repair of tissue damage. While some studies suggest that IL-1β signaling is harmful to the injured central nervous system, others report neuroprotective effects that appear to be context-dependent. Previously, the Hewett laboratory demonstrated IL-1β-mediated increases in the cystine-glutamate transporter, system xc-, as a novel contributor to inflammatory hypoxic neuronal injury. The focus of this doctoral research was to elucidate the specific cell type(s) in mixed cortical cultures that respond to IL-1β by enhancing the activity of system xc-, the molecular mechanism by which this occurs, and the physiological and pathophysiological consequences of this regulation. IL-1β exposure enhances expression of the substrate-specific light chain of system xc-, xCT, in astrocyte cultures in a time-dependent manner. By utilizing pharmacological inhibitors and cells derived from animals harboring a mutation in the Slc7a11 gene (sut mice) that encodes for xCT, we provide evidence that alterations in system xc- activity in astrocytes exclusively mediate the potentiation of hypoxic neuronal injury by IL-1β and initiates hypoglycemic neuronal injury. Even though the IL-1β-mediated enhanced efflux of glutamate, which occurs by virtue of its obligate exchange, can be deleterious, cystine import via system xc- is critical for the synthesis of the antioxidant glutathione (GSH). Since astrocytes function as the predominant provider of GSH in the CNS, we assessed whether IL-1β treatment altered astrocyte GSH levels. Cortical astrocyte cultures treated with IL-1β exhibit a time-dependent increase in extracellular GSH levels, suggesting both enhanced synthesis and export that is associated with protection against oxidative stress in cultures exposed to tert-butyl hydroperoxide. Hence, IL-1β may be an important stimulus for increasing astrocytic GSH production, and thus, total antioxidant capacity in the brain. These findings unequivocally demonstrate that IL-1β and astrocytic system xc- contribute to neuronal injury and neuroprotection in a context-dependent manner.
Stressor-induced tolerance is a central mechanism in the response of bacteria, plants, and animals to potentially harmful environmental challenges. This response is characterized by immediate changes in cellular metabolism and by the delayed transcriptional activation or inhibition of genetic programs that are not generally stressor specific (cross-tolerance). These programs are aimed at countering the deleterious effects of the stressor. While induction of this response (preconditioning) can be established at the cellular level, activation of systemic networks is essential for the protection to occur throughout the organs of the body. This is best signified by the phenomenon of remote ischemic preconditioning, whereby application of ischemic stress to one tissue or organ induces ischemic tolerance (IT) in remote organs through humoral, cellular and neural signaling. The immune system is an essential component in cerebral IT acting simultaneously both as mediator and target. This dichotomy is based on the fact that activation of inflammatory pathways is necessary to establish IT and that IT can be, in part, attributed to a subdued immune activation after index ischemia. Here we describe the components of the immune system required for induction of IT and review the mechanisms by which a reprogrammed immune response contributes to the neuroprotection observed after preconditioning. Learning how local and systemic immune factors participate in endogenous neuroprotection could lead to the development of new stroke therapies.
A brief period of cerebral ischemia confers transient tolerance to a subsequent ischemic challenge in the brain. This phenomenon of ischemic tolerance has been confirmed in various animal models of forebrain ischemia and focal cerebral ischemia. Since the ischemic tolerance afforded by preceding ischemia can bring about robust protection of the brain, the mechanism of tolerance induction has been extensively studied. It has been elucidated that ischemic tolerance protects neurons, and at the same time, it preserves brain function. Further experiments have shown that metabolic and physical stresses can also induce cross-tolerance to cerebral ischemia, but the protection by cross-tolerance is relatively modest. The underlying mechanism of ischemic tolerance still is not fully understood. Potential mechanisms may be divided into two categories: (1) A cellular defense function against ischemia may be enhanced by the mechanisms inherent to neurons. They may arise by posttranslational modification of proteins or by expression of new proteins via a signal transduction system to the nucleus. These cascades of events may strengthen the influence of survival factors or may inhibit apoptosis. (2) A cellular stress response and synthesis of stress proteins may lead to an increased capacity for health maintenance inside the cell. These proteins work as cellular "chaperones" by unfolding misfolded cellular proteins and helping the cell to dispose of unneeded denatured proteins. Recent experimental data have demonstrated the importance of the processing of unfolded proteins for cell survival and cell death. The brain may be protected from ischemia by using multiple mechanisms that are available for cellular survival. If tolerance induction can be manipulated and accelerated by a drug treatment that is safe and effective enough, it could greatly improve the treatment of stroke.
The molecular techniques including Northern blot, dot blot,in situ hybridization, etc. have been successfully used to estimate semi-quantitatively mRNA levels in plant samples. In this study,
we employed a real-time reverse transcription-PCR (RT-PCR) assay using SYBR Green I fluorescence methodology to evaluate accurate
quantitation and sequence specific detection ofAux/IAA mRNA levels inArabidopsis. Results obtained indicate a linear dynamic range of 102–106
Aux/IAA mRNA copies with standard deviations of generally less than 15%. As a model experiment, the outcome of analysis of expression
patterns of fiveAux/IAA genes inArabidopsis under various chemical and temperature treatments is presented. The method presented here provides a sensitive and rapid
technique to evaluate plantAux/IAA mRNA expression levels in nanogram order.
A short duration of ischemia (i.e., ischemic preconditioning) results in significant brain protection to subsequent severe ischemic insult. Because previous studies suggest that tumor necrosis factor-alpha (TNF-alpha) plays a role in both promoting ischemic damage and neuroprotection, the present work aimed to evaluate the expression of TNF-alpha mRNA in an established model of ischemic preconditioning using a transient 10-minute occlusion of the middle cerebral artery. Because the level of TNF-alpha mRNA expression in the brain was too low to be consistently detected by Northern technique, a real-time polymerase chain reaction method was applied to quantitate the absolute copy number of TNF-alpha transcript in rat brain after the preconditioning procedure. TNF-alpha mRNA was induced in the ipsilateral cortex as early as 1 hour (27 +/- 1 copies of mRNA per microgram of tissue compared to 11 +/- 3 copies in sham-operated samples) after preconditioning, reached a peak level at 6 hours (49 +/- 10 copies of transcript, n = 4, P < 0.01), and persisted up to 2 days. These data not only demonstrate the utility of real-time polymerase chain reaction for sensitive and accurate measurement of mRNA expression in normal and injured tissues but also suggest a potential role of TNF-alpha in the phenomenon of ischemic preconditioning.
Differential gene expression plays an important role in normal development and pathophysiological conditions. The accurate quantitation of mRNA expression is critical to assess the differential gene expression. While a number of techniques, such as Northern analysis, (semi-)quantitative reverse transcription polymerase chain reaction (RT-PCR) and in situ hybridization, are available to measure the levels of mRNA expression, certain limitations exist, including the insensitive and inaccurate quantitation of mRNA expressed at low abundance. In the present study, we describe the application of a recently developed TaqMan real-time quantitative RT-PCR for the detection of interleukin-1beta (IL-1beta) mRNA expression in rat cortical tissue after a short duration of ischemia (i.e., ischemic preconditioning). The principle of the TaqMan real-time detection is based on the fluorogenic 5' nuclease assay that allows simple and rapid quantitation of a target sequence during the extension phase of PCR amplification. Using a cloned plasmid DNA as a standard and normalizing RNA samples with a housekeeping gene for the TaqMan real-time PCR, we detected the significant induction in absolute copy numbers of IL-1beta mRNA in the ipsilateral cortex after preconditioning, suggesting a potential role of this inflammatory cytokine in ischemic brain tolerance.
The possible role of inflammatory reaction of the cerebral artery in the pathogenesis of cerebral vasospasm has been noted in recent studies. We quantitatively measured the levels of expression of genes related to inflammation in the spastic artery in a canine double-hemorrhage model.
Twenty dogs were assigned to 4 groups: group D0, control; group D2, dogs killed 2 days after cisternal injection of blood; group D7, dogs given double cisternal injections of blood and killed 7 days after the first injection; and group D14. Angiography was performed twice: on the first day and before the animals were killed. Total RNA was extracted from the basilar artery. The expressions of interleukin (IL)-1alpha, IL-6, IL-8, IL-10, tumor necrosis factor-alpha, E-secretin, fibronectin, intercellular adhesion molecule (ICAM)-1, vascular cell adhesion molecule-1, transforming growth factor-ss, basic fibroblast growth factor, and collagen types I, III, and IV were examined with TaqMan real-time quantitative reverse transcription-polymerase chain reaction.
Prolonged arterial narrowing peaking on 7 day was observed. There was a significant difference in vessel caliber between D0, D2, D7, and D14 groups (P:<0.0001). There were significant differences in mRNA expression in the basilar artery for IL-1alpha, IL-6, IL-8, ICAM-1, and collagen type I between D0, D2, D7, and D14 groups (P:=0.0079, 0. 0196, 0.0040, 0.0017, and <0.0001, respectively). The average level of mRNA was highest in D7 for IL-1alpha, IL-6, IL-8, and ICAM-1 (17-, 16-, 131-, and 1.7-fold compared with those of D0, respectively) and in D14 for collagen type I (10.9-fold).
Increased expression of genes related to inflammation in the spastic artery suggests that inflammatory reaction of the cerebral artery is associated with sustained contraction.
CD44 is a transmembrane glycoprotein involved in endothelial cell recognition, lymphocyte trafficking, and regulation of cytokine gene expression in inflammatory diseases. The present report describes the discovery of upregulated CD44 gene expression and its spatial and temporal distribution in the brain after focal stroke.
Rats were subjected to permanent occlusion of the middle cerebral artery (MCAO). Suppression subtractive hybridization (SSH) strategy was used to identify differentially expressed genes. Northern blotting and real-time polymerase chain reaction were used to evaluate the expression of CD44 and hyaluronan synthase 2 (HAS-2) mRNA. Western blotting and immunohistochemistry were used to examine CD44 expression and cellular distribution.
CD44 upregulation after focal stroke was discovered by the SSH approach and confirmed by DNA sequencing. Northern blot using a pooled poly(A)+ RNA revealed 3 splice variants of CD44 mRNA, and their inducible expression started at 6 hours (5.3-fold increase over sham operation), peaked at 24 hours (28.6-fold increase), and persisted up to 72 hours (17.8-fold increase) after MCAO. A parallel induction profile of HAS-2 mRNA was observed in the ischemic brain tissue. The levels of CD44 were markedly elevated at 6 hours (1.8-fold increase over sham; n=3), 24 hours (2.9-fold, peak induction; P<0.01), and 72 hours (2.4-fold increase; P<0.05) after MCAO by means of Western analysis. Immunohistochemical and confocal microscopy confirmed that constitutive expression of CD44 is limited to microvessels in normal brain but is strongly induced after ischemia, where the immunoreactive signal mainly resided in endothelial cells and monocytes. Double-labeling immunohistochemistry demonstrated that a marked induction of CD44 in the ischemic lesion is dominantly located in microglia and a subset of macrophages.
The discovery of concomitant induction of CD44 and HAS-2 mRNA expression and the localization of CD44 in the microglia, macrophages, and microvessels of the ischemic brain tissue suggest that an active interaction between CD44 and hyaluronan may occur and play a role in the known inflammatory response and tissue remodeling after stroke.
Sequencing of the human genome is nearing completion and biologists, molecular biologists, and bioinformatics specialists have teamed up to develop global genomic technologies to help decipher the complex nature of pathophysiologic gene function. This review will focus on differential gene expression in ischemic stroke. It will discuss inheritance in the broader stroke population, how experimental models of spontaneous stroke might be applied to humans to identify chromosomal loci of increased risk and ischemic sensitivity, and also how the gene expression induced by stroke is related to the poststroke processes of brain injury, repair, and recovery. In addition, we discuss and summarise the literature of experimental stroke genomics and compare several approaches of differential gene expression analyzes. These include a comparison of representational difference analysis we have provided using an experimental stroke model that is representative of stroke evolution observed most often in man, and a summary of available data on stroke differential gene expression. Issues regarding validation of potential genes as stroke targets, the verification of message translation to protein products, the relevance of the expression of neuroprotective and neurodestructive genes and their specific timings, and the emerging problems of handling novel genes that may be discovered during differential gene expression analyses will also be addressed.
Ischemia-reperfusion brain injury initiates an inflammatory response involving the expression of adhesion molecules and cytokines, some of which are regulated by the nuclear transcription factor NF-kappaB. In this study the authors examined mRNA expression levels for several important genes associated with inflammation at five time points (3, 6, 12, 24, and 72 hours) after transient middle cerebral artery occlusion (MCAO) in Sprague-Dawley rats. A sensitive and quantitative technique (TaqMan real-time QRT-PCR) was used to simultaneously measure mRNA levels for key cell adhesion molecules and inflammatory cytokines. Gene expression increased significantly in the injured hemisphere for interleukin (IL)-1beta (12-fold increase at 24 hours), IL-6 (25-fold increase at 6 hours) and ICAM-1 (4-fold increase at 24 hours), and the interhemispheric differences for these genes were significant for every time point examined (P < 0.05 for all values). Tumor necrosis factor-alpha mRNA was upregulated in the injured versus uninjured hemisphere from 3 to 24 hours (5-fold increase at 6 hours), while E-selectin showed a significant increase in mRNA levels from 6 to 24 hours after MCAO (10-fold increase at 6 hours) (P < 0.05 for all values). VCAM-1 mRNA levels did not respond differentially to injury at any time point between the two brain hemispheres. At all time points examined, activated NF-kappaB immunoreactivity was observed in cells throughout the infarct-damaged tissue. These results are consistent with the proinflammatory properties of the induced molecules, which are involved in the initiation of the inflammatory cascade, and may thus contribute to secondary cellular responses that lead to further brain damage.
The immunosuppressant cyclosporin A (CsA) has been shown to have neuroprotective action. The inhibition of both calcineurin activation and mitochondrial permeability transition pore (mtPTP) opening are considered the primary neuroprotective mechanisms of CsA. Here we have evaluated the effect of CsA on significantly reducing infarct size induced by transient middle cerebral artery occlusion (MCAO) in rats, and examined variable therapeutic applications for brain infarction. Experimental rats were divided into 12 groups according to: CsA administration time (immediately after occlusion or immediately after reperfusion); dosage (between 10 and 50 mg/kg); route (i.v. or i.p.); and with or without needle insertion, which hypothetically disrupts the blood brain barrier (BBB). Neuroprotective effects of CsA were hardly noticeable when administered immediately after occlusion or by i.v. injection. By needle insertion, CsA administration significantly reduced infarct size, although vehicle treatment also reduced infarct size compared with nontreatment animals, i.e. no needle insertion. These results suggest that needle insertion allows endogenous neuroprotective substances to pass into the brain. Furthermore, single dosages over 30 mg/kg CsA were excessive and negated potential neuroprotective effects. However, two i.p. administrations of 20 mg/kg CsA immediately and 24 hrs after reperfusion significantly ameliorated the infarct size compared to the vehicle-treated group. We conclude that CsA exhibits significant neuroprotective activity, although its therapeutic application for stroke may be limited by very strict and precise management requirements.
Anti-inflammatory treatment with the proteasome inhibitor MLN519 has been previously reported to be neuroprotective against ischemic brain injury in rats. These effects have been related to inhibition of the transcription factor NF-kappaB, which is activated through ubiquitin-proteasomal degradation. The aim of this study was to evaluate the effects of MLN519 to alter the expression of several inflammatory genes under the control of NF-kappaB. Male Sprague-Dawley rats underwent middle cerebral artery occlusion (MCAo) followed by vehicle or MLN519 (1.0 g/kg, i.v.) treatment immediately after reperfusion of blood to the brain at 2h. Gene expression was evaluated 3-72 h post-MCAo. The most striking effects of intravenous treatment with MLN519 were associated with reductions in ICAM-1 expression at 3 h followed by reductions in E-selectin (12-72 h). Less dramatic reductions were observed in IL-1Beta (3-24 h) and TNF-Alpha (24 h) with no apparent effects on IL-6 and VCAM-1 mRNA levels. Immunohistochemical analysis revealed that the genes most dramatically affected by MLN519 had highest expression in endothelial cells and leukocytes (E-selectin, ICAM-1),indicating that these cell types may be the primary targets of intravenously delivered MLN519 treatment.
Cytokines are involved in ischemic tolerance, including that triggered by spreading depression (SD), yet their roles in neuroprotection remain incompletely defined. The latter may stem from the pleiotropic nature of these signaling molecules whose complexities for interaction might be better deciphered through simultaneous measurement of multiple targeted proteins. Accordingly, the authors used microsphere-based flow cytometric immunoassays and hippocampal organotypic cultures (HOTCs) to characterize the magnitude, time course, and diversity of cytokine (interleukin [IL] 1alpha, IL-1beta, IL-2, IL-4, IL-6, IL-10, granulocyte-macrophage colony-stimulating factor [GM-CSF], interferon-gamma [IFN-gamma], and tumor necrosis factor-alpha [TNF-alpha]) response to SD. GM-CSF was not detected in HOTCs or media. However, SD triggered a significant, generalized increase in seven cytokines evident in HOTCs 6 hours later, with the remaining cytokine, IL-1beta, becoming significantly different at 1 and 3 days. Additionally, these changes extended to include surrounding media for IL-6 and TNF-alpha by 1 and 3 days. This increase was localized to microglia via immunostaining for IL-1alpha, IL-1beta, and interferon-y. IL-10, although significantly more abundant in HOTCs 6 hours after SD, was significantly less abundant in surrounding media at that time and at 1 day. Finally, the generalized early increase in tissue cytokines later settled to a pattern at 3 days of recovery centering on changes in IL-1alpha, IL-1beta, and TNF-alpha, cytokines capable of modulating ischemic injury.
There is evidence that physical activity is associated with decreased brain injury resulting from transient middle cerebral artery (MCA) occlusion. We investigated whether exercise could reduce stroke-induced brain inflammatory injury and its associated mediators. Sprague Dawley rats (3 months old) were subjected to 30 min exercise on a treadmill each day for 1–3 weeks. Stroke, in exercised and non-exercised animals, was then induced by a 2-h MCA occlusion followed by 48 h of reperfusion using an intraluminal filament. Endothelial expression of the intercellular adhesion molecule 1 (ICAM-1) and leukocyte infiltration were determined by immunocytochemistry. Expressions of tumor necrosis factor-α (TNF-α) and ICAM-1 mRNA were detected using a real-time reverse transcriptase-polymerase chain reaction in ischemic rats with or without exercise, and in non-ischemic control rats following exercise. Expression of TNF-α increased after exercise for 2 and 3 weeks. The overexpression of TNF-α was not further elevated in 3-week exercised rats subjected to a transient MCA occlusion and 6 or 12 h of reperfusion, as compared to that in non-exercised rats. Furthermore, ICAM-1 mRNA expression remained at significantly (PPICAM-1-positive vessels and infiltrating leukocytes in the frontoparietal cortex and dorsolateral striatum in ischemic rats after 48 h of reperfusion. Exercised ischemic rats demonstrated an 11±7% infarct volume of contralateral hemisphere as compared to a 52±3% volume in non-exercised ischemic rats. The data suggests that exercise inhibits inflammatory injury (i.e., decreased expression of inflammatory mediators and reduced accumulation of leukocytes) during reperfusion, leading to reduced brain damage. Chronically increased expression of TNF-α during exercise prevent the same downstream inflammatory events as does acutely elevated TNF-α after ischemia/reperfusion.
The human immunodeficiency virus type 1 (HIV-1) coat glycoprotein gp120 represents a likely contributor to the development of HIV-1 associated dementia (HAD), a neurological syndrome often observed in AIDS patients and characterised by significant neuronal loss in the neocortex. Since recent studies have highlighted that female sex hormones represent potential neuroprotective agents against damage produced by acute and chronic injuries in the adult brain, we have investigated whether estrogens exert protection in a rat model of gp120 neurotoxicity. Our results demonstrate that systemic administration of 17beta-estradiol (E2, 0.02-0.2 mg/kg) significantly reduces apoptotic cell death observed in the neocortex of rat following subchronic i.c.v. administration of gp120 (100 ng/rat/day). Furthermore, both tamoxifen and ICI182,780, two selective antagonists of estrogen receptors (ER) in the brain, reverted the neuroprotective effect of E2. The molecular mechanism of estrogenic neuroprotection does not appear to involve modulation of the antiapoptotic Bcl-2 or the proapoptotic Bax since we failed to observe changes in the levels of the two proteins in the neocortical tissue after gp120 and/or E2 treatment. However, we detected increased levels of IL-1beta in the neocortex of rats injected with gp120, as early as 6h after drug administration, and this effect was potentiated following pretreatment with E2. Taken together, our results demonstrate that E2 exerts neuroprotection against gp120 neurotoxicity in vivo through a mechanism involving ER activation and, possibly, via modulation of neocortical levels of IL-1beta.
Administration of endotoxin (LPS) in humans results in profound physiological responses, including activation of peripheral blood mononuclear cells and the release of inflammatory factors. The time course of the response of selected inflammatory proteins was examined in healthy subjects (n = 6) administered a single intravenous dose of the purified derivative of endotoxin (3.0 ng/kg). Microarray analysis demonstrated changes in the expression of a number of genes, which were confirmed in separate in vitro endotoxin stimulation experiments. Subsequent TaqMan analysis of genes of interest indicated time-dependent changes in the expression of many of these genes. This included pre-B cell enhancing factor, which was identified on microarray analysis as being markedly upregulated following endotoxin stimulation. Protein expression of the genes examined by TaqMan analysis was measured and demonstrated the appearance of tumor necrosis factor (TNF)-alpha and sTNF-R proteins in the plasma beginning within 1 h after dosing, followed by other cytokines/ inflammatory markers (e.g., IL-1ra, G-CSF, IL-6, IL-8, and IL-10) and suppressors of cytokine signaling (SOCS-1 and SOCS-3). In general, cytokine protein expression correlated well with gene expression; however, the temporal profile of expression of some genes did not correlate well with the protein data. For many of these proteins, the lack of correlation was attributable to alternate tissue sources, which were demonstrated on TaqMan analysis. Principal component analysis indicated that cytokines could be grouped according to their temporal pattern of response, with most transcript levels returning to baseline 24 h following endotoxin administration. The combination of cDNA microarray and TaqMan analysis to identify and quantify changes in gene expression, along with the analysis of protein expression, can be useful in investigating inflammatory and other diseases.
Sophora Japonica L. (SJ) is a traditional Chinese herb used to cool blood, stop bleeding and to treat hemorrhoids with bleeding. Although several recent studies found that both SJ and Ginkgo biloba have the same components of quercetin and rutin, only Ginkgo biloba has been widely used to treat cerebrovascular disorders and dementia in humans. This study investigated the effect of SJ on cerebral infarct in rats. A total of 66 Sprague-Dawley (SD) rats were studied. Focal cerebral infarct was established by occluding the bilateral common carotid arteries and the right middle cerebral artery for 90 minutes. After 24 hours of reperfusion, the neurological status was evaluated. The rats were then killed, and brain tissue was stained with 2,3,5-triphenyl-tetrazolium chloride. The grading scale of neurological deficit and the ratio of cerebral infarction area were used as an index to evaluate the effect of SJ on cerebral infarct. In addition, the number of ED1 and interleukin-1beta immunostaining positive cells, and apoptotic cells were measured in the cerebral infarction zone. The results indicated that pre-treatment with 100 or 200 mg/kg SJ and post-treatment with 200 mg/kg SJ significantly reduced the grade of neurological deficit and the ratio of cerebral infarction area. In addition, pre-treatment with 200 mg/kg SJ also significantly reduced ED1 and interleukin-1beta immunostaining positive cells, and apoptotic cells in ischemia-reperfusion cerebral infarct rats. This study demonstrated that SJ could reduce the cerebral infarction area and neurological deficit induced by ischemia-reperfusion in rats, suggesting its potential as a treatment for cerebral infarct in humans. This effect of SJ involves its suppressive action of microglia, interleukin-1beta and apoptosis.
Ischemic preconditioning involves a brief exposure to ischemia in order to develop a tolerance to injurious effects of prolonged ischemia. The molecular mechanisms of neuroprotection that lead to ischemic tolerance are not yet completely understood. However, it seems that two distinct phases are involved. Firstly, a cellular defense function against ischemia may be developed by the mechanisms inherent to neurons such as posttranslational modification of proteins or expression of new proteins via a signal transduction system to the nucleus. Secondly, a stress response and synthesis of stress proteins (heat shock proteins) may be activated. These mechanisms are mediated by chaperones. The objective of ischemic preconditioning research is to identify the underlying endogenous protective cellular receptors and signaling cascades, with the long-term goal of allowing therapeutic augmentation of the endogenous protective mechanisms in cerebral ischemia and possibly development of new neuroprotective strategies for ischemic stroke treatment.
We hypothesized that exercise preconditioning strengthens brain microvascular integrity against ischemia/reperfusion injury through the tumor necrosis factor (TNF)-integrin signaling pathway. Adult male Sprague Dawley rats (n = 24) were studied in: (1) exercise (the animals run on a treadmill 30 min each day) for 3 weeks, (2) non-exercise. Six animals from each group (n = 12) were subjected to stroke, the remaining animals served as controls (n = 6 x 2). Brain infarction and edema were determined by Nissl staining. Cerebral integrin expression was detected by immunochemistry and stereological methods. In addition, we used flow cytometry to address the causal role of TNF-alpha in inducing the expression of integrins in the human umbilical vein endothelial cells under TNF-alpha or vascular endothelial growth factor (VEGF) pretreatment. Exercise reduces brain infarction and brain edema in stroke. Expressions of integrin subunit alpha(1), alpha(6), beta(1), and beta(4) were increased after exercise. Exercise preconditioning reversed stroke-reduced integrin expression. An in vitro study revealed a causal link between the gradual upregulation of TNF-alpha (rather than VEGF) and cellular expression of integrins. These results demonstrated an increase in cerebral expression of integrins and a decrease in brain injury from stroke after exercise preconditioning. The study suggests that upregulation of integrins during exercise enhances neurovascular integrity after stroke. The changes in integrins might be altered by TNF-alpha.
Cerebral ischemia is a multi-faceted neurodegenerative pathology that causes cellular injury to neurons within the central nervous system. In light of the underlying mechanisms being elucidated, clinical trials to find possible neuroprotectants to date have failed, thus highlighting the need for new putative targets to offer protection. Recent evidence has clearly shown that anesthetics can confer significant protection and or induce a preconditioning effect against cerebral ischemia-induced injury. This review will focus on the putative protection/preconditioning that is afforded by anesthetics, their possible interaction with GABA(A) and glutamate receptors and two-pore potassium channels. In addition, the interaction with inflammatory, apoptotic and underlying molecular (particularly immediately early genes and inducible nitric oxide synthase etc) pathways, the activation of K(ATP) channels and the ability to provide lasting protection will also be addressed.
In previous studies, we have used histological methods to characterize cellular changes, and validated the use of the myeloperoxidase
(MPO) activity assay to quantitate increased neutrophil infiltration in ischemic stroke. We also identified increased leukotriene
B4 (LTB4) binding sites as a potential marker for neutrophil infiltration into, focal ischemic tissue. However, these studies were
conducted at only one time-point, 24 h after ischemia. In the present study, we examined the full time-course of MPO activity
and LTB4 receptor binding following middle cerebral artery occlusion (MCAO) made permanently (PMCAO) or transiently (160 min followed
by reperfusion; TMCAO) in spontaneously hypertensive rats, and compared the results to previously characterized histologic
changes in these models. Ischemic and contralateral (control) cortical tissue samples were assayed for MPO (U/g wet wt) and
[3H]LTB4 receptor binding (fmol/mg protein). Following PMCAO, MPO activity significantly increased as early as 12 h and continued
to increase over the next 5 d (p<0.05). Following TMCAO, MPO activity was significantly elevated already after only 6 h of reperfusion and also continued
to increase over the next 5 d of reperfusion (p<0.05). LTB4 receptor binding and MPO activity were highly correlated during periods when both measures increased together (i.e., 0.5–5dp<0.01). However, by 15 d post-MCAO, LTB4 receptor binding remained elevated after MPO activity levels had returned to normal. This persistent LTB4 binding was associated with the significant gliosis that was characterized previously to persist in these models. The time-course
of increased MPO activity and initially increased LTB4 binding post-MCAO correspond very well to our previous histological data that characterized the time-course for leukocyte
infiltration under these conditions. Therefore, the increased MPO activity over time was associated with initial neutrophil
and later mononuclear cell infiltration into ischemic tissue in these models. In addition, the present studies utilized histochemical
analysis to demonstrate peroxidase activity in macrophages within the cerebral infarct following MCAO, thus validating that
MPO activity originates from the later infiltrating mononuclear cells in addition to the early infiltrating neutrophils that
had been previously characterized in the same manner. TMCAO produces a significantly larger and earlier increase in ischemic
cortex MPO activity and a similar later increase in MPO activity compared to PMCAO treatment. Clearly, reperfusion of cerebral
tissue following ischemia greatly exacerbates the degree of cerebral tissue inflammation. These biochemical assays, especially
the MPO activity assay, have now been validated for quantitating the early and late phases of the cerebral inflammatory reaction
to tissue injury.
A new method of total RNA isolation by a single extraction with an acid guanidinium thiocyanate-phenol-chloroform mixture is described. The method provides a pure preparation of undegraded RNA in high yield and can be completed within 4 h. It is particularly useful for processing large numbers of samples and for isolation of RNA from minute quantities of cells or tissue samples.
Interleukin 1 (IL 1) inhibits the growth of human melanoma A375 cells. To identify the subcellular events preceding inhibition of growth by IL 1, we have examined the effect of IL 1 on protein synthesis caused by A375 cells. IL 1 selectively and predominantly induced a 25-kDa polypeptide (p25) in A375 cells after 12 h. On subcellular fractionation, p25 was exclusively located in the 10,000 x g-pelleted (mitochondria-enriched) fraction. To identify the p25 moiety, it was purified to homogeneity by sequential chromatography on DEAE-Sephacel and reverse-phase, high-pressure liquid chromatography and its amino-terminal amino acid sequence was determined. The sequence of the 35 amino-terminal amino acids of the p25 moiety was identical to that of human manganese superoxide dismutase (Mn SOD). The enzymatic activities of SOD were induced only in the mitochondria-enriched fraction of IL 1-treated A375 cells. However, IL 1 also induced Mn SOD in normal human skin fibroblasts and peripheral blood mononuclear cells, whose growth was stimulated by IL 1. The results show that induction of Mn SOD by IL 1 is a common biochemical event in IL 1-responsive cells.
Interleukin 1 (IL 1) is a polypeptide that is produced after infection, injury, or antigenic challenge. Although the macrophage is a primary source of IL 1, epidermal, epithelial, lymphoid, and vascular tissues synthesize IL 1. When IL 1 gains access to the circulation, it acts like a hormone and induces a broad spectrum of systemic changes in neurological, metabolic, hematologic, and endocrinologic systems. Some of the IL 1 that is synthesized remains associated with the plasma membrane and induces changes in local tissues without producing systemic responses. IL 1 affects mesenchymal tissue remodeling where it contributes to both destructive and repair processes. IL 1 activates lymphocytes and plays an important role in the initiation of the immune response. Receptors for IL 1 have been identified, but receptors are scarce and their affinities often do not match the potency of the biological response. The most consistent property of IL 1 is up-regulation of cellular metabolism and increased expression of several genes coding for biologically active molecules. IL 1 is a highly inflammatory molecule and stimulates the production of arachidonic acid metabolites. IL 1 also acts synergistically with other cytokines, particularly tumor necrosis factor. The multitude of biological responses to IL 1 is an example of the rapid adaptive changes that take place to increase the host's defensive mechanisms.
Marked increases in the brain expression of interleukin (IL)-1 have been reported in rats after permanent occlusion of a large cerebral artery. Interactions between endothelial cells and leukocytes have been implicated in the pathogenesis of several types of ischemic injury to the myocardium and other organs. In this study we asked whether inhibiting the effects of IL-1 would affect the outcome of an experimental brain infarct. Adult male Wistar rats (n = 13) with permanent occlusion of the middle cerebral artery were given IL-1 receptor antagonist. A second group (n = 13) with the same type of brain injury was given a placebo. A third group, subjected to a sham operation, was given either IL-1 receptor antagonist (n = 2) or a placebo (n = 2). Experiments were terminated after either 24 hours or 7 days. Compared with the control group, animals treated with IL-1 receptor antagonist improved their neurological score (P < 0.05), experienced less pronounced changes in body weight (P < 0.05), and had fewer necrotic neurons (P < 0.001) and fewer leukocytes in the ischemic hemisphere (P < 0.001) as well as a smaller area of pallor (P < 0.05) in the ischemis hemisphere. The results suggest that inhibiting the proinflammatory effects of IL-1 with a receptor antagonist is an effective way of influencing the leukocyte responses elicited by an arterial occlusion. Such leukocyte inhibition seemingly attenuates the number of necrotic neurons resulting from the occlusion of a large brain artery.
A novel approach to quantitative reverse transcriptase polymerase chain reaction (QC RT-PCR) using real time detection and the 5' nuclease assay has been developed. Cystic fibrosis transmembrane transductance regulator (CFTR) target mRNA is reverse transcribed, amplified, detected, and quantitated in real time. A fluorogenic probe was designed to detect the CFTR amplicon. Relative increase in 6-carboxy-fluorescein reporter fluorescent emission is monitored during PCR amplification using an analytical thermal cycler. An internal control template containing the same primer sequences as the CFTR amplicon, but a different internal sequence, has been designed as a control. An internal control probe with a reporter fluorescent dye tetrachloro-6-carboxy-fluorescein was designed to hybridize to the internal control amplicon. The internal control template is placed in each reaction tube and is used for quantitative analysis of the CFTR mRNA. This method provides a convenient and high-throughput format for QC RT-PCR.
We have developed a novel "real time" quantitative PCR method. The method measures PCR product accumulation through a dual-labeled fluorogenic probe (i.e., TaqMan Probe). This method provides very accurate and reproducible quantitation of gene copies. Unlike other quantitative PCR methods, real-time PCR does not require post-PCR sample handling, preventing potential PCR product carry-over contamination and resulting in much faster and higher throughput assays. The real-time PCR method has a very large dynamic range of starting target molecule determination (at least five orders of magnitude). Real-time quantitative PCR is extremely accurate and less labor-intensive than current quantitative PCR methods.
Focal brain ischemia induces inflammation, extracellular matrix remodeling, gliosis, and neovascularization. Osteopontin (OPN) is a secreted glycoprotein that has been implicated in vascular injury by promoting cell adhesion, migration, and chemotaxis. To investigate the possible involvement of OPN in brain matrix remodeling after focal stroke, we examined the expression of OPN in ischemic cortex after permanent or temporary occlusion of the middle cerebral artery (MCAO) of the rat. OPN mRNA and protein levels in nonischemic cortex were not detected consistently, although significant induction of OPN was observed in the ischemic cortex. OPN mRNA increased 3.5-fold at 12 hr and reached peak levels 5 d (49.5-fold; p < 0.001) after permanent MCAO. The profile of OPN mRNA induction after transient MCAO (160 min) with reperfusion was essentially the same as that of permanent MCAO. In situ hybridization and immunohistochemical studies demonstrated strong induction of OPN in the ischemic cortex, which was localized primarily in a subset of ED-1-positive macrophages that accumulated in the ischemic zone. Moreover, OPN immunoreactivity was detected in the matrix of ischemic brain, suggesting a functional role of the newly deposited matrix protein in cell-matrix interactions and remodeling. Indeed, using a modified Boyden chamber, we demonstrated a dose-dependent chemotactic activity of OPN in C6 astroglia cells and normal human astrocytes. Taken together, these data suggest that the upregulation of OPN after focal brain ischemia may play a role in cellular (glia, macrophage) migration/activation and matrix remodeling that provides for new matrix-cell interaction.
: The expression of interleukin-1β (IL-1β) mRNA in the cerebral cortex, hippocampus, striatum, and thalamus of rats was studied after transient forebrain ischemia. IL-1β mRNA was not detected in all these regions of sham-operated control rats. IL-1β mRNA was induced after transient forebrain ischemia and reached a detectable level in all regions examined 15 min after the start of recirculation. The induction of IL-1β mRNA had a few peaks, that is, peaks were observed at 30 and 240 min in the four regions examined, and another peak was observed at 90 min in the striatum. One day after the start of recirculation, IL-1β mRNA levels were markedly decreased, but even 7 days after that, IL-1β mRNA was found at very low levels in all regions examined. The amounts of c-fos and β-actin mRNAs on the same blots were also examined. The induction of c-fos mRNA was transient and had only one peak in all regions examined, whereas the levels of β-actin mRNA in these regions were fairly constant throughout the recirculation period. Thus, we provide the first evidence for a characteristic expression of IL-1β mRNA in several brain regions after transient forebrain ischemia.
Focal cerebral ischemia elicits local inflammatory reaction as demonstrated by the accumulation of inflammatory cells and mediators in the ischemic brain. Interferon-inducible protein-10 (IP-10) is a member of the C-X-C chemokine family that possesses potent chemoattractant actions for monocytes, T cells, and smooth muscle cells. To investigate a potential role of IP-10 in focal stroke, we studied the temporal expression of IP-10 mRNA after occlusion of the middle cerebral artery in rat by means of northern analysis. IP-10 mRNA expression after focal stroke demonstrated a unique biphasic profile, with a marked increase early at 3 h (4.9-fold over control; p < 0.01), a peak level at 6 h (14.5-fold; p < 0.001) after occlusion of the middle cerebral artery, and a second wave induction 10–15 days after ischemic injury (7.2- and 9.3-fold increase for 10 and 15 days, respectively; p < 0.001). In situ hybridization confirmed the induced expression of IP-10 mRNA and revealed its spatial distribution after focal stroke. Immunohistochemical studies demonstrated the expression of IP-10 peptide in neurons (3–12 h) and astroglial cells (6 h to 15 days) of the ischemic zone. To explore further the potential role of IP-10 in focal stroke, we demonstrated a dose-dependent chemotactic action of IP-10 on C6 glial cells and enhanced attachment of rat cerebellar granule neurons. Taken together, the data suggest that ischemia induces IP-10, which may play a pleiotropic role in prolonged leukocyte recruitment, astrocyte migration/activation, and neuron attachment/sprouting after focal stroke.
To determine the contribution of interleukin 1 (IL-1) on ischemic brain edema formation, the effect of recombinant human interleukin 1β (rhIL-1β), or zine protoporphyrin (ZnPP) as an IL-1 blocker, on brain edema was studied in rats. The animals were subjected to 60 min of ischemia in a middle cerebral artery occlusion model. Immediately after reperfusion, rhIL-1β at a dose of , or ZnPP at doses of 1 and were topically applied into lateral cerebroventricle. In rhIL-1β-treated rats, ischemic brain edema formation was significantly increased in the dorsal and ventral areas of the caudate putamen 24 h after reperfusion, compared to that of vehicle-treated control rats. Furthermore, in ZnPP-treated rats, brain edema was decreased in both caudate-putamen areas. This suggests that IL-1 plays an important role in pathogenesis for post-ischemic brain edema.
A review of the sensitivity of genetically hypertensive rats to cerebral ischemia was presented together with original data describing the systematic comparison of the effects of focal ischemia (permanent and temporary with reperfusion) performed in hypertensive and normotensive rats (i.e., blood pressures verified in conscious instrumented rats). Microsurgical techniques were used to isolate and occlude the middle cerebral artery (MCAO) of spontaneously hypertensive (SHR), Sprague-Dawley (SD) and Wistar Kyoto (WKY) rats at the level of the inferior cerebral vein. Following permanent (24 h) MCAO, persistent and similar decreases in local microvascular perfusion (i.e., to 15.6 +/- 1.7% of pre-MCAO levels) were verified in the primary ischemic zone of the cortex for all strains using Laser-Doppler flowmetry. A contralateral hemiplegia that occurred following MCAO, evidenced by forelimb flexion and muscle weakness, was greater in SHR (neurological grade = 2.0 +/- 0.1) than SD (1.0 +/- 0.4) or WKY (0.7 +/- 0.4) rats (N = 7-9, p less than 0.05). SHR also exhibited sensory motor deficits following MCAO compared to sham-operation, with decreased normal placement response of the hindlimb (% normal = 20 vs. 83, N = 23-30, p decreased rota-rod (41 +/- 7 vs. 126 +/- 19 on rod, N = 10-15, p less than 0.05) and balance beam (25 +/- 5 vs. 116 +/- 29 s on beam, N = 5-7, p less than 0.05) performance. However, an index of general motor activity was not affected by permanent MCAO. Triphenyltetrazolium-stained forebrain tissue analyzed by planimetry revealed a significantly larger and more consistent cortical infarction in SHR (hemispheric infarction = 27.9 +/- 1.5%) compared to SD (15.4 +/- 4.1%) and WKY (4.0 +/- 2.4%) rats (N = 7-9, p less than 0.05), occupying predominantly the frontal and parietal areas. Also, a significant degree of ipsilateral hemispheric swelling (4.6 +/- 0.9%, N = 7-9, p less than 0.05) and increased brain water content (78.4 +/- 0.3% to 80.4 +/- 0.2%, N = 8-9, p less than 0.05) was identified in SHR that was not observed in SD or WKY rats. A novel model of temporary MCAO also was evaluated in the hypertensive and normotensive rat strains. Initially, the effect of increasing MCAO-time followed by 24 h reperfusion in SHR was studied. During temporary MCAO (20 to 300 min), persistent and stable decreases in local microvascular perfusion (i.e., to 15-20% of pre-MCAO levels) were verified in the primary ischemic zones of the cortex.(ABSTRACT TRUNCATED AT 400 WORDS)
Cytokines have diverse actions in the brain, some of which may facilitate either neurodegeneration or neuroprotection. The expression of cytokines, particularly interleukins-1 and -6 (IL-1, IL-6) and tumor necrosis factor alpha, is rapidly and markedly induced in response to experimentally induced or clinical neurodegeneration. We have demonstrated that central administration of the IL-1 receptor antagonist (IL-1ra) markedly inhibits neurodegeneration induced by focal cerebral ischaemia, local infusion of glutamate receptor agonists or traumatic brain injury in the rat. In contrast, IL-1ra offers no protection against degeneration of primary cortical neurones in culture caused by exposure to agonists of ionotrophic or metabotrophic receptors. In vivo, administration of IL-1 beta exacerbates ischaemic brain damage, whereas in cell culture, exogenous IL-1 is neuroprotective at concentrations in the nM range, an effect which appears to be mediated by release of endogenous nerve growth factor. Higher concentrations of IL-1 (microM range) are neurotoxic to neurones in culture and may mimic the involvement of IL-1 in neurodegeneration in vivo. Thus, excessive production of cytokines such as IL-1 appears to mediate experimentally induced neurodegeneration in vivo, while neuroprotective effects of low concentrations of the cytokine suggest a dual role for IL-1 in neuronal survival.
Cytokines have been shown to be induced following a variety of central nervous system (CNS) insults, and may play a role in the pathophysiological sequelae of CNS injury. In the present study, we characterized the regional expression of interleukin-1 beta (IL-1 beta) mRNA in specific brain regions following experimental lateral fluid-percussion traumatic brain injury (TBI) in rats. Adult Sprague-Dawley rats (n = 42) were anesthetized with sodium pentobarbital (60 mg/kg, i.p.) and subjected to lateral fluid-percussion brain injury of moderate severity (2.4 atm.) centered over the left parietal cortex, or 'sham' treatment (anesthesia and surgery without injury). Animals were sacrificed at 1, 6 and 24 h post injury, brains were removed, and tissue samples of left (injured) parietal cortex (LC), corresponding area in the contralateral right cortex (RC), cortex adjacent to injured parietal cortex (LA), corresponding adjacent area in the right cortex (RA), left hippocampus (LH) and right hippocampus (RH) were prepared. Total RNA was isolated and Northern blot hybridization was performed and the quantity of brain tissue IL-1 beta mRNA is presented as percent relative radioactivity of IL-1 beta positive macrophage RNA which was loaded on same gel.(ABSTRACT TRUNCATED AT 250 WORDS)
The expression of tumor necrosis factor alpha (TNF-alpha) and interleukin 1 beta (IL-1 beta) mRNAs was significantly increased in the rat ischemic cortex following temporary occlusion of the middle cerebral artery (TMCAO) with reperfusion. Northern blot analysis demonstrated that the induction of TNF-alpha and IL-1 beta mRNAs occurred as early as 1 h after reperfusion, exhibiting a 4.6-fold increase (p < 0.05, n = 4) and 6.8-fold increase (p < 0.05, n = 4) in the ischemic cortex over control, respectively. TNF-alpha mRNA reached its peak at 3 h (8.0-fold, p < 0.05), whereas IL-1 beta mRNA reached its peak at 6 h (29.5-fold, p < 0.05). Both cytokine mRNA levels remained elevated for up to 2 d after reperfusion. In contrast to the time course of these cytokine mRNAs, c-fos and zif268 mRNAs, two early response genes, displayed a greater and earlier time-response profile. The early induction of c-fos and zif268 mRNAs in temporary brain ischemia with reperfusion suggests their roles in transcriptional regulation. The later concomitant expression of TNF-alpha and IL-1 beta suggests that these cytokines play an important role in the inflammatory response associated with focal ischemia.
It has been suggested that interleukin-1 (IL-1) is a potent inflammatory mediator and that it is synthesized and secreted into the brain parenchyma. The aim of the present study is to evaluate the contribution of IL-1 to brain edema formation after focal brain ischemia.
The brain water content was measured to evaluate postischemic brain injury in rats after 60 minutes of middle cerebral artery occlusion and reperfusion. The effects of exogenous application of recombinant human interleukin-1 beta (rhIL-1 beta), anti-interleukin-1 beta neutralizing antibodies (anti-IL-1 beta), and the IL-1 blocker zinc protoporphyrin (ZnPP) on brain water content were observed, and histological technique was used to measure the infarction size and number of inflammatory cells infiltrated into the brain.
Transient ischemia induced marked increase of brain water content, necrosis, and neutrophilic infiltration in the cortex perfused by the middle cerebral artery and the dorsal and ventral areas of the caudate putamen. Injection of rhIL-1 beta into the left lateral ventricle immediately after reperfusion markedly enhanced ischemic brain edema formation in these three areas in a dose-dependent manner (88.4 +/- 0.7% and 86.6 +/- 0.4% in the dorsal and ventral parts of the caudate putamen, respectively, in rats treated with 10 ng rhIL-1 beta; P < .01). rhIL-1 beta also increased the size of the brain infarction, and it tended to increase the number of infiltrating neutrophils in ischemic areas and the number of neutrophils adherent to the endothelium. In contrast, administration of anti-IL-1 beta and ZnPP into the left cerebral ventricle attenuated the postischemic increase of brain water content and decreased the size of brain infarction (83.5 +/- 2.0% and 79.9 +/- 2.0% in the dorsal and ventral parts of the caudate putamen, respectively, in rats treated with 10 micrograms anti-IL-1 beta; P < .01). The number of neutrophils that infiltrated into ischemic areas also tended to decrease with anti-IL-1 beta or ZnPP treatment.
Application of rhIL-1 beta augmented the increase of brain water content, and application of anti-IL-1 beta depressed the increase of water content. These results tended to correlate with the neutrophilic infiltration into the parenchyma. It thus appears that IL-1 beta may play an important role in ischemic brain damage after reperfusion.
Expression of interleukin-1 beta (IL-1 beta) mRNA in the rat brain after transient forebrain ischemia was investigated by in situ hybridization histochemistry. Thirty min after the start of recirculation, IL-1 beta mRNA was induced in the several brain regions, including the olfactory bulb, cerebral cortex, hippocampus, striatum and thalamus where neuronal degeneration was reported to be observed after transient forebrain ischemia. The hybridization signals were observed both on the glial cells and around the vascular walls.
The expression of interleukin-1 beta (IL-1 beta) mRNA in the brain in response to cerebral ischaemia in rats was examined using in situ hybridization histochemistry. Focal cerebral ischaemia was induced in spontaneously hypertensive rats by permanent occlusion of the left middle cerebral artery (MCAO). Whereas no IL-1 beta mRNA could be detected in non-operated and sham-operated rats, middle cerebral artery occlusion induced the expression of IL-1 beta mRNA within 15 min in the ischaemic brain regions prone to become necrotic after 1-2 days. The message appeared as spot-like signals, reached a peak after 3 h and then declined to undetectable levels within 4 days. Additionally, a pronounced but brief induction of IL-1 beta mRNA could be detected 1 h after MCAO in the meninges near the watershed zone. The results demonstrate that the inflammatory cytokine IL-1 beta is induced in a time-dependent way after brain ischaemia.
Interleukin-1 beta is a proinflammatory cytokine produced by blood-borne and resident brain inflammatory cells. The present study was conducted to determine if interleukin-1 beta mRNA was produced in the brain of rats subjected to permanent focal ischemia.
Rat interleukin-1 beta cDNA, synthesized from stimulated rat peritoneal macrophage RNA by reverse transcription and polymerase chain reaction and cloned in plasmid Bluescript KS+, was used to evaluate the expression of interleukin-1 beta mRNA in cerebral cortex from spontaneously hypertensive rats and normotensive rats subjected to permanent middle cerebral artery occlusion. Interleukin-1 beta mRNA was quantified by Northern blot analysis and compared with rat macrophage RNA standard. To correct for gel loading, blots were also analyzed with cyclophilin cDNA, which encodes an abundant, conserved protein that was unchanged by the experimental conditions.
Interleukin-1 beta mRNA produced in the ischemic zone was significantly increased from 6 hours to 120 hours, with a maximum of 211 +/- 24% of interleukin-1 beta reference standard, ie, 0.2 ng stimulated rat macrophage RNA, mRNA compared with the level in nonischemic cortices (4 +/- 2%) at 12 hours after ischemia (P < .01; n = 6). Interleukin-1 beta mRNA at 12 hours after ischemia was markedly elevated in hypertensive rats over levels found in two normotensive rat strains. Neurological deficits were also apparent only in the hypertensive rats.
Brain interleukin-1 beta mRNA is elevated acutely after permanent focal ischemia and especially in hypertensive rats. These data suggest that this potent proinflammatory and procoagulant cytokine might have a role in brain damage following ischemia.
The temporal evolution of cerebral infarction was examined in rats subjected to transient occlusion of both common carotid arteries and the right middle cerebral artery. After severe (90-min) ischemia, substantial right-sided cortical infarction was evident within 6 h and fully developed after 1 day. After mild (30-min) ischemia, no cortical infarction was present after 1 day. However, infarction developed after 3 days; by 2 weeks, infarction volume was as large as that induced by 90-min ischemia. These data suggest that infarction after mild focal ischemia can develop in a surprisingly delayed fashion. Some evidence of neuronal apoptosis was present after severe ischemia, but only to a limited degree. However, 3 days after mild ischemia, neurons bordering the maturing infarction exhibited prominent TUNEL staining, and DNA prepared from the periinfarct area of ischemic cortex showed internucleosomal fragmentation. Furthermore, pretreatment with 1 mg/kg cycloheximide markedly reduced infarction volume 2 weeks after mild ischemia. These data raise the possibility that apoptosis, dependent on active protein synthesis, contributes to the delayed infarction observed in rats subjected to mild transient focal cerebral ischemia.
The effects of transient global ischemia using bilateral carotid artery occlusion on regional cytokine levels in gerbil brain were investigated using enzyme-linked immunoassay techniques. Brain concentrations of interleukin-6 (IL-6), interleukin-1 beta (IL-1 beta), and tumor necrosis factor-alpha (TNF-alpha) were increased during the early recirculation period ( < 6 h) after 10 min of ischemia, with lesser degrees of elevation following only 5 min of ischemia. TNF-alpha levels in the hippocampus and striatum were significantly increased as early as 1 h after recirculation, declining sharply to control levels by 12 h, then transiently increasing at 24 h. Elevated levels of IL-1 beta and IL-6 were not seen until 3-6 h post-occlusion. No significant increases in cytokine concentrations were observed in the cerebellum or thalamus. These results suggest that regionally selective increases in cytokines may be involved in the pathophysiological changes in hippocampus and striatum following transient cerebral ischemia.
Recombinant human interleukin-1 receptor antagonist (rhIL-1ra) markedly protects against focal cerebral ischaemia in the rat, implicating endogenous IL-1 in the events leading to cerebral infarction. The present experiments investigated the effect of intracerebroventricular (i.c.v.) administration of IL-1 beta or rhIL-1ra on ischaemia damage and physiological parameters after permanent middle cerebral artery occlusion in the rat. IL-1 beta (5 ng. i.c.v.) markedly (92%) enhanced infarct volume and caused a significant rise in body temperature, but rhIL-1ra (10 micrograms, i.c.v.) significantly reduced infarct volume and did not significantly affect heart rate, blood pressure, or body temperature, rhIL-1ra administered 30 min before, or at the time of ischaemia significantly reduced infarct volume in cortex (55 and 60%, respectively) and striatum (52 and 41%, respectively). rhIL-1ra administered 30 min after ischaemia significantly reduced total and cortical infarct volume (26 and 29%, respectively), but did not significantly protect striatal tissue. The effects of rhIL-1ra were still evident in both cortex and striatum 7 days after ischaemia. These results support the role of IL-1 in ischaemic brain damage, revealing potent, sustained, neuroprotective effects of rhIL-1ra in the cortex and striatum, which cannot be attributed directly to changes in physiological parameters.
A series of experiments was performed to determine the role of interleukin (IL)-1 in the induction of tolerance to global ischemia in Mongolian gerbils. In Group I, a 2-min "preconditioning" ischemia protected CA1 hippocampal neurons in gerbils subjected to 3.5 min ischemia 3 days later. CA1 neuronal density was: sham, 171 +/- 3/mm; 3.5 min ischemia, 30 +/- 30/mm; 2 and 3.5 min ischemia 162 +/- 6/mm. Experiments in Group II addressed the role of IL-1 in the induction of tolerance by sublethal ischemia. Arterial IL-1 alpha and IL-1 beta became elevated between 1 and 3 days after a 2-min ischemic exposure. IL-1 alpha was: sham, 6.4 +/- 0.6 ng/ml; and 2-day, 10.2 +/- 1.2 ng/ml. IL-1 beta was: sham, 6.4 +/- 0.5 ng/ml; and 2-day, 17.3 +/- 2 ng/ml. Recombinant human IL-1 receptor antagonist (IL-1ra) i.p. blocked ischemic tolerance induction by 2-min preconditioning ischemia: 2-min ischemia + vehicle, 162 +/- 6/mm; and 2-min ischemia + IL-1ra, 67 +/- 17/mm. Experiments in Group III assessed the capacity of IL-1 to induce tolerance to brain ischemia. IL-1 alpha i.p. (0, 10, 20 micrograms/kg) for 3 days prior to 3.5-min forebrain ischemia provided significant CA1 neuroprotection in a dose-dependent manner: 2 +/- 2, 68 +/- 83, and 129 +/- 42/mm, respectively. IL-1 beta (15 micrograms/kg) in combination with either IL-1ra (100 mg/kg) or IL-1ra vehicle i.p. on the same schedule demonstrated a significant CA1 neuroprotection that could be nullified by IL-1ra: IL-1 beta + IL-1ra vehicle, 153 +/- 16/mm; and IL-1 beta + IL-1ra, 67 +/- 36/mm. Recognition that tolerance arises from stimulation of a known receptor (IL-1RI) permits molecular analysis of the intracellular signaling that is critical for production of that state.
The expression of interleukin-1 beta (IL-1 beta) is upregulated after focal brain ischemia, and previous work has demonstrated its involvement in ischemic injury. The IL-1 receptor antagonist (IL-1ra), a natural competitive antagonist of IL-1 receptors (IL-1Rs), has been demonstrated to play a role in attenuating brain ischemic injury. To hypothesize the involvement of the IL-1 system in ischemic injury, we examined other IL-1 components, including IL-1ra, IL-1RI, and IL-1RII for their mRNA expression after focal stroke.
Quantitative reverse transcription and polymerase chain reaction (RT-PCR) technique was used to examine the mRNA expression profile of IL-1ra and two IL-1R isoforms in a temporal fashion (n = 4 for each time point) after permanent occlusion of the middle cerebral artery (MCAO) in spontaneously hypertensive rats. IL-1ra and IL-1R mRNA expression was confirmed by Northern blot analysis using poly(A) RNA isolated after 2 and 12 hours of MCAO.
Very low levels of IL-1ra mRNA were detected in sham-operated or nonischemic cortex. IL-1ra mRNA in ischemic cortex was greatly increased at 12 hours (16.5-fold increase over sham samples, P < .001) and remained elevated for up to 5 days (17.2-fold increase, P < .01) after MCAO. IL-1RI mRNA was relatively highly expressed in normal cortex and was further elevated late after ischemic injury (3.3-fold increase at day 5, P < .001). In contrast, the low basal expression of IL-1RII mRNA was remarkably elevated at 6 hours (5.3-fold increase, P < .05), reaching peak levels 12 hours (10.3-fold increase, P < .001) after MCAO.
Differential expression of IL-1 beta, IL-1ra, IL-1RI, and IL-1RII mRNAs after focal stroke may suggest a distinct role(s) for each component of the IL-1 system in ischemic injury. The data also stress the importance of evaluating all the components of a given cytokine system (eg, agonist, receptors, and natural antagonist) after focal stroke.
The mRNA expression of the proinflammatory cytokine interleukin-1beta (IL-1beta) has been shown to be induced in neural elements during ischemia. It is not clear which cells generate the IL-1beta mRNA and eventually synthesize IL-1 protein and which cells respond to this signaling by producing IL-1 receptors during ischemia. To clarify this question, rats were subjected to global ischemia by bilateral carotid occlusion and hypotension for 20 minutes, followed by reperfusion for 2 hours (n = 7), 8 hours (n = 7), or 24 hours (n = 7). Cryostat sections were hybridized using antisense oligonucleotide probes (30 dimer). Multiple cell markers were used in immunohistochemical staining to identify the cells expressing IL-1beta and IL-1R protein. The sham animals (n = 5) showed no or only a weak expression of IL-1R or IL-1beta mRNA. The number of IL-1beta mRNA-expressing cells was significantly increased by 2 hours of reperfusion in several brain areas including cortex (12-fold compared with sham) and caudate-putamen (14-fold), and was maximally increased in most hippocampal regions by 8 hours of reperfusion (mean +/- SD of positive cells/field versus sham equivalent being 37.9 +/- 12.3 versus 4.0 +/- 3.3; 30.6 +/- 9.0 versus 3.1 +/- 2.3; 41.3 +/- 17.5 versus 2.9 +/- 1.9; in CA1; CA2; CA3/CA4 regions of the hippocampus, respectively). IL-1beta mRNA signal was also intensified in the white matter areas. Changes in IL-1R mRNA were seen in the hippocampus (after 2 hours CA1: 16-fold; CA2: 17-fold; DG: 24-fold increase; and CA3/CA4: 10-fold increase after 8 hours), and the expression was prolonged especially in CA1 and CA2 regions up to 24 hours of reperfusion. The major cellular source of IL-1beta protein was glia (astrocytes, oligodendrocytes, microglia, and scattered perivascular macrophages/monocytes), while neurons and sporadic microvascular endothelia showed IL-1R immunoreactivity. The data suggest that neurons in discrete areas vulnerable for selective neuronal death, and possibly the vascular endothelium, are target cells for ischemia-induced glial IL-1beta production.
Rapid and marked increased levels of expression of interleukin 1beta (IL-1beta) mRNA have been detected in animal models of cerebral ischemia. However, the protein production of IL-1beta and the cellular sources of IL-1beta are largely undefined after cerebral ischemia. In the present study, we have measured the cellular localization of IL-1beta protein in brain tissue from non-ischemic and ischemic mice using immunohistochemistry. Male C57B/6J (n=45) mice were subjected to middle cerebral artery (MCA) occlusion by a clot or a suture. The mice were sacrificed at time points spanning the period from 15 min to 24 h after onset of the MCA occlusion. Non-operated and sham-operated mice were used as control groups. A monoclonal anti-IL-1beta antibody was used to detect IL-1beta. In the non-operated and sham-operated mice, a few IL-1beta immunoreactive cells were detected scattered throughout both hemispheres. IL-1beta immunoreactive cells increased in the ischemic lesion as early as 15 min and peaked at 1 h to 2 h after MCA occlusion. IL-1beta immunoreactivity was detected in the cortex of the contralateral hemisphere 1 h after ischemia. By 24 h after onset of ischemia, IL-1beta immunoreactivity was mainly present adjacent to the ischemic lesion and in the non-ischemic cortex. IL-1beta immunoreactivity was found on endothelial cells and microglia. This study demonstrates an early bilateral expression of IL-1beta on endothelium after MCA occlusion in mice.
A short duration of ischemia (ie, ischemic preconditioning [PC]) can provide significant brain protection to subsequent ischemic events (ie, ischemic tolerance [IT]). The present series of studies was conducted to characterize the temporal pattern of a PC paradigm, to systematically evaluate the importance of protein synthesis in PC-induced IT, and to explore candidate gene expression changes associated with IT.
Temporary middle cerebral artery occlusion (MCAO) (10 minutes) was used for PC. Various periods of reperfusion (ie, 2, 6, and 12 hours and 1, 2, 7, 14, and 21 days) were allowed after PC and before permanent MCAO (PMCAO) (n=7 to 9 per group) to establish IT compared with non-PC (sham-operated) rats (n=22). Infarct size, forelimb and hindlimb motor function, and cortical perfusion (laser-Doppler flowmetry; n=9 per group) were measured after PMCAO. The effects of the protein synthesis inhibitor cycloheximide administered just before PC (n= 13 to 17) or administered long after PC but just before PMCAO (n=7 to 8) on IT were also determined. Interleukin- receptor antagonist mRNA (reverse transcriptase and polymerase chain reactions [n=20] and Northern analysis [n=50]) and protein expression (immunohistochemistry [n=16]) after PC and early response gene expression (Northern analysis [n=16]) after PMCAO in PC animals were determined.
Hemispheric infarct was significantly (P<0.01) reduced only if PC was performed 1 day (decreased 58.4%), 2 days (decreased 58.1%), or 7 days (decreased 59.4%) before PMCAO. PC significantly (P<0.01) reduced neurological deficits (similar to reductions in infarct size). Cycloheximide eliminated ischemic PC-induced IT effects on both brain injury and neurological deficits if administered before PC (P<0.05) but not if administered long after PC but before PMCAO. PC did not produce any significant brain injury, alter cortical blood flow after PMCAO, or produce contralateral cortical neuroprotection. Interleukin-1 receptor antagonist mRNA and protein expression were increased significantly (P<0.01) only during the IT period. PC rats also exhibited a significant (P<0.01) reduction in c-fos and zif268 mRNA expression after PMCAO.
PC is a powerful inducer of ischemic brain tolerance as reflected by preservation of brain tissue and motor function. PC induces IT that is dependent on de novo protein synthesis. New protein(s) that occurs at the PC brain site 1 to 7 days after PC contributes to the neuroprotection. Those proteins that are produced after the more severe PMCAO in PC animals apparently do not contribute to IT. The PC-induced IT is also associated with increased expression of the neuroprotective protein interleukin-1 receptor antagonist and a reduced postischemic expression of the early response genes c-fos and zif268. (Stroke. 1998;29:1937-1951.)
Brief occlusion of the middle cerebral artery (i.e., ischemic preconditioning; PC) induces significant brain protection to subsequent severe ischemic events. In an effort to discover genes responsible for ischemic tolerance, we have applied a new technique, suppression subtractive hybridization (SSH), to identify genes that are upregulated by PC. Using this SSH approach, a cDNA that encodes tissue inhibitor of matrix metalloproteinase- (TIMP-1) was identified. Time course studies using Northern analysis revealed that TIMP-1 mRNA was significantly elevated at 24 hours (3.3-fold over controls, P < 0.05, n = 5) and 2 days (4.3-fold increase, P < 0.01) after PC, corresponding to the onset of significant ischemic tolerance. Our data not only demonstrate the utility of this new polymerase chain reaction-based SSH strategy for discovery of genes differentially expressed in PC, but also suggest a potential role of TIMP-1 in PC-induced ischemic tolerance.
The cytokine interleukin-1 (IL-1) has been implicated in the exacerbation of ischemic damage in the brains of rodents. This study has ascertained the cellular localization and chronologic and topographic distribution of pro/mature interleukin-1beta (IL-1beta) protein 0.5, 1, 2, 6, 24, and 48 hours after ischemia by subjecting rats to permanent unilateral occlusion of the middle cerebral artery. Interleukin-1beta was localized immunocytochemically in vibratome sections of perfusion-fixed brains. The cells that expressed IL-1beta had the morphologic features of microglia and macrophages. Interleukin-1beta was first detected 1 hour after occlusion in ipsilateral meningeal macrophage-like cells. By 6 hours, pro/mature IL-1beta-immunoreactive (IL-1(beta)ir) putative microglia were present in the ischemic cerebral cortex, corpus callosum, caudoputamen, and surrounding tissue. By 24 and 48 hours after ischemia, the number and spread of IL-1(beta)ir cells increased greatly, including those resembling activated microglia and macrophages, as the core of the infarct became infiltrated. Interleukin-1(beta)ir cells also were present in apparently undamaged tissue, adjacent to the lesion ipsilaterally, and contralaterally in the cerebral cortex, dorsal corpus callosum, dorsal caudoputamen, and hippocampus. These results support the functional role of IL-1 in ischemic brain damage and reveal a distinct temporal and spatial expression of IL-1beta protein in cells believed to be microglia and macrophages.