A new pycnidial fungus with clamped hyphae from Central America

Abstract

A fungus forming white gelatinous pycnidia on rotting wood was collected in Panama. The presence of hyphal clamps and dolipores
with continuous parenthesomes indicates that the fungus belongs to the Basidiomycota, Agaricomycotina. In a phylogenetic hypothesis
inferred from DNA sequence analysis, the species shows a close relationship with members of the Auriculariales. A new genus
and species is described in order to accommodate this anamorph, being the first taxon of the Auriculariales to be known which
forms pycnidia.

Full text

1 23
Mycological Progress
ISSN 1617-416X
Volume 11
Number 2
Mycol Progress (2012) 11:561-568
DOI 10.1007/s11557-011-0771-0
A new pycnidial fungus with clamped
hyphae from Central America
Roland Kirschner, I-Shu Lee & Meike
Piepenbring

1 23
Your article is protected by copyright and
all rights are held exclusively by German
Mycological Society and Springer. This e-
offprint is for personal use only and shall not
be self-archived in electronic repositories.
If you wish to self-archive your work, please
use the accepted author’s version for posting
to your own website or your institution’s
repository. You may further deposit the
accepted author’s version on a funder’s
repository at a funder’s request, provided it is
not made publicly available until 12 months
after publication.

ORIGINAL ARTICLE
A new pycnidial fungus with clamped hyphae
from Central America
Roland Kirschner &I-Shu Lee &Meike Piepenbring
Received: 11 March 2011 /Revised: 22 May 2011 /Accepted: 27 May 2011 /Published online: 23 June 2011
#German Mycological Society and Springer 2011
Abstract A fungus forming white gelatinous pycnidia on
rotting woodwas collected in Panama. The presence ofhyphal
clamps and dolipores with continuous parenthesomes
indicates that the fungus belongs to the Basidiomycota,
Agaricomycotina. In a phylogenetic hypothesis inferred
from DNA sequence analysis, the species shows a close
relationship with members of the Auriculariales. A new
genus and species is described in order to accommodate
this anamorph, being the first taxon of the Auriculariales
to be known which forms pycnidia.
Keywords Anamorphic Basidiomycota .Costa Rica .
Tropical fungi
Introduction
Coelomycetes are anamorphic fungi that produce conidia or
spermatia inside a cavity lined by fungal or fungal/host tissue.
The characteristics of the conidioma wall, conidiophores, and
conidia, as well as the mode of conidiogenesis, are used for
identifying coelomycetous fungi (Sutton 1980). The term
“coelomycete”is a morphological one, not a systematic one,
though the majority of coelomycetous fungi are anamorphic
Ascomycota. Except for spermatogonia of rust fungi,
coelomycetous basidiomycetes are extremely rare (Kirschner
and Oberwinkler 2009). Some coelomycetous taxa show
obvious relationships to the Basidiomycota by having
clamps at the septa, but detailed systematic relationships of
these taxa have not been investigated (Nag Raj 1993). An
undescribed species forming pycnidia composed of clamped
hyphae was discovered by Liuba Kisimova-Horovitz in
Costa Rica in 1993 and presented during an informal
meeting in 2000. The taxon remained, however, unnamed.
In 2005, we found a specimen in Panama, which could be
identified with the unnamed species from Costa Rica
because of the excellent drawings and description provided
by L. Kisimova-Horovitz based on light microscopy. In
addition to light microscopy, also cultivation attempts, DNA
sequence analysis and transmission electron microscopy,
were applied for further characterization. The taxon was
revealed to be undescribed and is, therefore, described here
as new.
Materials and methods
Collections were made in a mountainous forest in the
western part of Panama, in the vicinity of the border with
Costa Rica. Pycnidia of the fungus were observed in the
field and brought to the laboratory the same day. For
attempts to cultivate the fungus, conidia and whole
pycnidia were transferred to 2% malt extract agar and
media composed of autoclaved wood chips embedded in
1.5% water agar. The remaining material was dried on a
Dörrex oven at about 70°C. The dry specimens were stored
in sealed plastic bags. For the structural analysis of the
pycnidial wall, longitudinal sections (15–20 μm thick)
through dried pycnidia were made with a cryotome and
mounted in a mixture containing cotton blue and lactic acid
R. Kirschner :I.-S. Lee (*)
Department of Life Sciences, National Central University,
No. 300, Jhongda Rd.,
Jhongli City, 320 Taoyuan, Taiwan
e-mail: jesusleee@yahoo.com.tw
M. Piepenbring
Department of Mycology, Institute for Ecology,
Evolution and Diversity, Goethe University,
Siesmayerstr. 72, Building B,
60323 Frankfurt, Germany
Mycol Progress (2012) 11:561–568
DOI 10.1007/s11557-011-0771-0
Author's personal copy

as explained by Kirschner and Chen (2008). Dried specimens
were stained in 1% aqueous phloxine and squashed in 5%
aqueous KOH in order to investigate cellular characteristics.
Measurements are given as mean value ± standard deviation
with extreme values in parentheses if 30 individual measure-
ments were obtained. Ranges demarked by the extreme
values are specified if fewer than 14 individual measure-
ments were obtained. For transmission electron microscopy
(TEM) and nuclear DNA analysis with primers NL1 and
NL4 for the large subunit ribosomal RNA gene (LSU rDNA)
sequences and primers ITS1f and ITS4 for ITS sequences, all
based on dried pycnidia, the techniques and equipment used
were as described in Kirschner (2009).
The partial nuc LSU rDNA sequences used for the analysis
were retrieved from Weiß and Oberwinkler (2001): Auricu-
laria auricula-judae AF291289, Basidiodendron caesioci-
nereum var. trachysporum AF291294, Basidiodendron
cinereum AF291295, Basidiodendron eyrei AF291296, Basi-
diodendron grandinioides AF291297, Boletus edulis
AF291300, Bourdotia galzinii AF291301, Craterocolla
cerasi AF291308, Dacrymyces stillatus AF291309, Daeda-
lea quercina AF291313, Ditiola haasii AF291314, Ductifera
pululahuana AF291315, Ductifera sucina AF291316, Efi-
bulobasidium rolleyi AF291317, Exidia japonica AF291320,
Exidida saccharina AF291323, Exidiopsis calcea
AF291326, Exidiopsis grisea AF291328, Femsjonia pezizi-
formis AF291330, Guepiniopsis buccina AF291332, Heter-
ochaete shearii AF291335, Heterochaetella brachyspora
AF291337, Hyaloria pilacre AF291338, Hymenochaete
rubiginosa AF291339, Myxarium grilletii AF291349, Myxa-
rium nucleatum AF291351, Myxarium subhyalinum
AF291352, Protodontia piceicola AF291266, Pseudohyd-
num gelatinosum AF291360, Sebacina allantoidea
AF291367, Stypella vermiformis AF291369, Suillus grevillei
AF291370, Thelephora palmata AF291265, and Tremiscus
helvelloides AF291377. Additional sequences were retrieved
from Binder and Hibbett (2002:Gloeophyllum sepiarium
AF393059), Giachini et al. (2010:Clavariadelphus ligula
AY57 4 6 50, Ramaria botrytis AY574699), Kim et al. (2005:
Antrodia juniperina AY515346, Piptoporus soloniensis
AY515354), Kirschner and Chen (2004:Helicomyxa ever-
hartioides AY640107), Kirschner et al. (2010:Ovipoculum
album GU292814), Larsson et al. (2004:Tome n t e l la
botryoides AY586717, 2006: Hyphodontia subalutacea
DQ873631), Wagner and Fischer (2002:Inonotus weirii),
Well s e t al. (2004:Eichleriella leveilleana: AY509553), and
Wu et al. (2004:Antrodia variiformis AY3 3 3827, Fomitopsis
pinicola AY333810). The taxa were selected according to
BLAST searches in GenBank in order to generate a
representative dataset of Agaricomycotina with continuous
parenthesomes including members of the Auriculariales,
Dacrymycetales, Hymenochaetales, certain Phallomycetidae,
and Sebacinales, because the new taxon also showed this
septal ultrastructure (see below). The sequences were aligned
over a length of 441 positions with the default options of
MEGA4 (Tamura et al. 2007) without manual editing.
Distance measures were calculated and a tree was con-
structed using the neighbor-joining method implemented in
MEGA4. Branch support was calculated on the basis of
1,000 replicates in bootstrap analyses using the default
options of MEGA4. A maximum parsimony analysis with a
reduced taxon sampling was also performed with the default
settings of MEGA4 (data not shown).
Results
White gelatinous pycnidia were discovered at waysides of an
intervened Quercus forest in a cloud forest area in Panama.
Light microscopy of the pycnidia revealed the presence of
clamps at all hyphal septa (Figs. 1,2). All attempts to
cultivate the fungus failed. In spite of repeated collection
trips to the same area every year since the first discovery in
2005, the species has not been encountered again. Details
of the conidiogenesis indicated by light microscopy could
not be clarified by TEM, but the ultrastructure of septal
pores and cell walls could be revealed (Fig. 3).
A 604-bp fragment of the nuc LSU rDNA was generated
and deposited at GenBank (accession number HQ914244).
Sequencing reactions based on the primer ITS1f yielded
noisy signals and double peaks that could not be interpreted
but based on the ITS4 primer was successful (TTTGAGGT
CAGGTTCGAATAAGATTGTCCCGGAGAGGAC
GACTGTAAGCCTCGGCCAGCGCAAAGTCTACGATG
CAAAGAAAACTATCACACCGCGACGACCCCG
CACGGGAGCCCAAGGCTAATGCATTTCAAGGC
GAGCCAACGACGGCAGCACCCAAATCCACCGA
CATGAAACCGCGCGAACGGTCCAAGGGTGAGA
GATTAACGTGACACTCAAACAGGCGTGCCCTGCG
GAATACCGCAGGGCGCAAGGTGCGTTCAAAGATTC
GATGATTCACTGAATTCTGCAATTCACATTACA
TATCGCAATTCGCTGCGTTCTTCATCGATGCGA
GAGCCAAGAGATCCGTTGCTGAAAGTTGTATTTTTT
CAATTACGAAAAGCAAAGTAACATCCAAAACTAAG
TAGACAATGAAAAAAGCAGGGCCACGAACGT
GACCCGCAGAGTGCACAGGTGTCGAATGGAC
GATCCGCTCGAGCGTGCAAGCCTCGCGGCGCA
CAGCCAGAGCGGACCGTACGGAAAAACCCGG
TAAGGGGCCTTCATAATGGATCTTTCC
CAAGGTCCCCCTACGAAACCCTGGTACCAATTT
TAACTTCTTTAATTGAACCAAA). A BLAST search with
the unedited ITS sequence obtained with primer ITS4 (not
accepted by GenBank) in GenBank showed the highest scores
andidentities of more than 80% with the sequences of
Bourdotia sp. (DQ200925) and Exidiopsis sp. (AY509549),
both members of the Auriculariales. A BLAST search with
562 Mycol Progress (2012) 11:561–568
Author's personal copy

the nuc LSU rDNA sequence retrieved ambiguous results
by mixing up Polyporales with Auriculariales. In the
neighbor-joining analysis based on nuc LSU rDNA
sequences, the new taxon seems to form a novel lineage
in the Auriculariales (Fig. 4). Within the Auriculariales,
however, no statistically supported sister group relation-
ships could be resolved. A similar tree topology was
retrieved from a maximum parsimony analysis based on a
reduced taxon sampling, with a bootstrap support of 79%
for the Auriculariales in the consensus tree, but without
resolving the relationships of the new taxon within the
Auriculariales (data not shown).
Porpopycnis R. Kirschner, gen. nov.
Pycnidia superficialia, conica, rostrata, hyalina vel pallide
colorata, gelatinosa, unilocularia, ex hyphis fibulatis com-
posita. Paries pycnidii ex variis stratis hyphis intricatis
compositus. Cellulae conidiogenae annellidicae. Conidia
unicellularia, in massa mucosa.
Typus generis:Porpopycnis lubae R. Kirschner, in opere
ipso.
Etymology: From Greek, porpe = clamp, and pycnos =
compact (referring to the pycnidia).
Pycnidia superficial, conical, rostrate, hyaline or brightly
coloured, gelatinous, unilocular, composed of fibulate hyphae.
Pycnidial wall composed of several layers of interwoven
hyphae. Conidiogenous cells annellidic. Conidia 1-celled,
simple, produced in slimy mass.
Porpopycnis lubae R. Kirschner, sp. nov. (Figs. 1,2,3)
Pycnidia alba viventia, flavida sicca, 680–2,000×600–
720 μm, ostiolo apicali obtuso, non fimbriato. Paries
pycnidii 72–132 μm latus. Conidiophora a tota superficie
interna parietis pycnidii oriunda, raro ramosa, fibulata,
1–2-septata, 65–140×2–3μm. Cellulae conidiogenae
cylindricae, leniter undulatae, 43–75 ×2–3μm. Conidia
hyalina, in massa mucosa alba, unicellularia, laevia, tenuitu-
nicata, obovoidea vel pyriformia, sine appendicibus, (11–)12–
14(−15)×(7–)8–9(−10) μm, ad basim 2–3μmlata.
Holotypus: Panamá, Chiriquí Province, Boquete Distr.,
Bajo Mono, trail in secondary forest, ca. 1,600 m a.s.l., on
strongly decayed wood, 14 September 2005, R. Kirschner
et al. 2745 (M).
Isotypus: Permanent slide, PMA.
Additional specimen: Costa Rica, Prov. Heredia, La
Selva, primary forest, 40 m a.s.l., on rotting “white”wood,
14 December 1993, L. Kisimova-Horovitz LKH-101-IV=
FO-44766 (not seen, but illustration and description by L.
Kisimova-Horovitz, copies deposited at M and USJ).
Etymology: Derived from the nickname “Luba”cordially
dedicated to Liuba Kisimova-Horovitz (deceased on 29.
March 2011) because of her personality and merits in
neotropical mycology (e.g. Kisimova-Horovitz et al. 1997,
2000; see “Discussion”). She discovered this fungus for
the first time during her mycological survey of lower
Agaricomycotina and their anamorphs in Costa Rica. In
November 2000, she presented a description and drawing
in the legendary “drawing class”at Prof. Oberwinkler’s
laboratory, University of Tübingen, Germany. Unfortunately,
the specimen from Costa Rica could not be traced in her
collection nor in the collections of TUB and USJ during
preparation of this manuscript. A copy of her drawing and
description was, however, deposited at M and USJ. Though
her drawing has the quality of a “para-iconotype”,wedo
not designate it formally in case that the specimen will
be re-discovered.
Pycnidia superficial, conical with elongated neck when
mature, when fresh gelatinous, with a shiny mucoid droplet
of conidia at the apex, white, yellow-orange when dried,
680–2,000×600–720 μm, with a single locule. Ostiole
apical on the rostrate apex, single, obtuse, not fimbriate.
Lateral pycnidial wall 72–132 μm thick, composed of
several layers of irregularly interwoven, hyaline, smooth, 1-
to 1.5-μm-wide hyphae with mainly longitudinal orienta-
tion. Dolipore septa of hyphae with continuous parenthe-
somes. Conidiophores arising from 1.5 to 2 μm wide,
slightly thick-walled, anastomosing hyphae at the base and
along the inner pycnidial wall, rarely branched and then
only at the base, 1- to 2-septate, 65–140×2–3μm.
Conidiogenous cells cylindrical, slightly undulate, with
inconspicuous apical annellations rarely visible with the
light microscope, 43–75×2–3μm. Conidia hyaline or white
in mucoid mass, one-celled, smooth, thin-walled, obovoid
to pyriform, sometimes somewhat asymmetrical, without
appendages, (11–)12–14(−15)× (7–)8–9(−10) μm (n= 30),
narrowing to a 2- to 3-μm-wide base. Conidia in some
cases containing a conspicuous large droplet, cell walls
multilayered as seen by TEM.
Fig. 1 Fresh pycnidia of Porpopycnis lubae on rotten wood (RoKi
2745). Scale bar 5mm
Mycol Progress (2012) 11:561–568 563
Author's personal copy

Discussion
Conidiogenesis
The mode of conidiogenesis of the new species is hardly
discernible with the light microscope. Conidia were found
attached on the conidiogenous cell only in a terminal position,
not in a lateral position. In other species, conidia have been
found to be attached laterally on the conidiogenous cells when
seen with the light microscope, which, in a more detailed
analysis, were revealed to be caused by sympodial conidio-
genesis. The absence of pores or scars indicate that the
conidiogenesis is neither sympodial nor tretic. Apical wall-
tickening indicating a replacement wall building mechanism
was not found. Though annellations were found only rarely,
annellidic conidiogenesis is probably the predominant mode
of conidium production. Conidiogenesis could not be clarified
with TEM based on dried material because of the collapse of
the conidiogenous cells during drying. In other basidiomyce-
tous anamorphs, such as in members of Leucogloea R.
Kirschner (anamorphic Helicogloea Pat.) and the anamorph
of Exidia saccharina (Alb. & Schwein.) Fr., annellidic
conidiogenesis was not visible with the light microscopy,
but could be shown with TEM (Kirschner 2004,2010). The
conidiogenesis in Proceropycnis M. Villarreal et al. could not
be clarified with light microscopy either, but was assumed to
be a modified annellidic development based on TEM
(Oberwinkler et al. 2006).
Fig. 2 Cellular structures of
Porpopycnis lubae (RoKi
2745). aSketches of pycnidia
on the substrate, scale bar
1 mm. bPycnidia in longitudi-
nal section, scale bar 1 mm. c
Longitudinal section through
pycnidial wall from inner (left)
to outer (right), scale bar
10 μm. dConidiophores, scale
bar 20 μm. eTwo conidioge-
nous cells, the left one with
developing conidium, the right
one with apical annellations,
scale bar 10 μm. fConidia,
scale bar 10 μm
564 Mycol Progress (2012) 11:561–568
Author's personal copy

Morphologically similar genera
The majority of pycnidial coelomycetes produce pigmented
conidiomata, whereas comparatively few genera are char-
acterized by white or brightly colored cornute or rostrate
pycnidia (Sutton 1980). The shape, color, and size of the
pycnidia of Porpopycnis lubae are superficially similar to
those of Eleutheromyces subulatus (Tode) Fuckel which,
however, differs by its phialidic conidiogenesis, lack of
clamps, and its fungicolous habitat. Except for the rust
fungi, only few basidiomycetes forming almost closed
conidiomata are known. Hyalopycnis Höhn. (anamorphic
Heterogastridium Oberw. & R. Bauer) is characterized by
pycnidia with hyphae forming a layer and being curved
outwards at the apex (Matsushima 1995). Conidiogenesis in
Hyalopycnis occurs by conidiogenous cells almost com-
pletely emptying their cytoplasm into a single conidium
(Bandoni and Oberwinkler 1981; Oberwinkler et al. 1990).
The pycnidia of Proceropycnis M. Villarreal et al. have
walls composed of a predominantly single layer of hyphae
similar to those of Hyalopycnis, but clamps are absent
(Oberwinkler et al. 2006). Hyalopycnis and Proceropycnis
additionally differ from Porpopycnis lubae by simple septal
pores and systematic affinities to the Pucciniomycotina
(Oberwinkler et al. 1990,2006), whereas the dolipore with
parenthesomes indicates relatedness of Porpopycnis lubae
with the Agaricomycotina. DNA sequences and teleomor-
phic relationships within the Basidiomycota are unknown
in the few known genera of pycnidial coelomycetes with
clamped hyphae, Ellula Nag Raj, Fibulocoela Nag Raj, and
Pycnovellomyces R.F. Castañeda. These monotypic genera
differ by stromatic, erumpent pycnidia with several or
irregular locules and particularly by their appendaged
conidia (Nag Raj 1993).
Phylogenetic relationship
Certain anamorphs can be recognized as belonging to
Auriculariales because of the presence of a retrorse
projection of the clamp (Kirschner and Chen 2004;
Fig. 3 Ultrastructural character-
istics of Porpopycnis lubae
(RoKi 2745). aMedian section
through a dolipore with contin-
uous parenthesomes, scale bar
0.1 μm. bConidium with a large
droplet, scale bar 2μm. cBase
of conidium from (b) apparently
still attached to the apex of a
collapsed conidiogenous cell,
scale bar 0.5 μm. dBase of a
detached conidium showing the
multilayered cell wall, scale bar
0.5 μm
Mycol Progress (2012) 11:561–568 565
Author's personal copy

Kirschner et al. 2010). This characteristic could not be
found in Porpopycnis lubae. The placement of this taxon in
the Auriculariales is based on the hypothesis derived from
DNA analysis. Because only few sequences of other DNA
regions, such as elongation factor or RPB2 genes, are
available for Auriculariales, LSU rDNA and ITS sequencing
were used for inferring a hypothetical phylogenetic place-
ment. If sequences of other regions become available in the
future, a better resolution might be obtained within the basal
Agaricomycotina. The dolipore with continuous parenthe-
somes does not indicate a close phylogenetic relationship
with very basal Agaricomycotina (Tremellales and related
orders, characterized by cupulate parenthesomes) nor
with higher Agaricomycotina having perforate parenthe-
somes, but with members of lower Agaricomycotina (except
Tremellales) having continuous parenthesomes (Wells 1994).
The discovery of the new taxon adds for the first time a
pycnidial anamorph to the known anamorphic diversity of
Fig. 4 Unrooted neighbor-
joining tree inferred from partial
nuc LSU rDNA sequences of
selected Agaricomycotina show-
ing the placement of Porpopycnis
lubae in the Auriculariales (up-
permost clade)
566 Mycol Progress (2012) 11:561–568
Author's personal copy

Auriculariales. The most widespread type of anamorph in
Auriculariales is that of micronematous conidiophores
producing allantoid conidia. This anamorph is usually
derived from germinating basidiospores still attached to
basidiomata or dispersed onto media in Petri dishes (Brefeld
1888; Kisimova-Horovitz et al. 1997,2000;Möller1895;
Neuhoff 1935,1936; Pilát 1957). Its role in nature, however,
has not been studied. Recently, bulbilliferous, sporodochial,
and synnematous anamorphs were found to be related to
Auriculariales by field collection and subsequent investigation
in the laboratory (Kirschner 2010; Kirschner and Chen 2004;
Kirschner et al. 2010). The newly found coelomycete seems
to represent a hitherto unknown lineage within or closely
related to Auriculariales.
Ecology
The specimens from Costa Rica and Panama were collected
on strongly rotten wood. Though this habitat indicates a
general saprobic capability, attempts to cultivate Porpopycnis
lubae failed even when woodchips embedded into water agar
were offered as substrate. If the pycnidia function as
spermatogonia, mycelial growth could have been expected
after transfer of whole pycnidia to media. Conidiomata of
Auriculariales have not been discovered on conventional
agar media, but only in nature or on comparatively natural
media (autoclaved parts of plant organs placed into agar),
such as the synnematous anamorph of Exidia saccharina,the
sporodochial Helicomyxa everhartioides R. Kirschner &
Chee J. Chen, and the bulbilliferous Ovipoculum album
Zhu L. Yang & R. Kirschner (Kirschner 2010;Kirschner
and Chen 2004; Kirschner et al. 2010). In Helicomyxa
everhartioides, which is closely related to the Hyaloriaceae
within the Auriculariales, cultivation on natural media was
possible only in the presence of another fungus. The nature of
this trophic dependence is not at all clear. Possibly, the specific
requirements of the new species were not sufficiently
considered during the cultivation experiment.
Conclusions
Lower Agaricomycotina (i.e., mainly Auriculariales, Dacry-
mycetales, Sebacinales, Tremellales and related groups)
show a high diversity of anamorphs with different types of
conidiomata, conidiophores, and conidiogenesis. These
diverse structures are assumed to have diverse functions
in the life-cycle and ecology of these basidiomycetes,
different from those of the teleomorph. Some aspects, such
as conidiogenesis and exact phylogenetic position, could
only be partially clarified in the new example presented
here, because technical equipment for preserving the fungus
was very restricted during the time of collection in the
tropics. The fungus could not be re-collected later, when better
equipment was available. We hope that describing this species
might inspire future field collection in tropical regions and
further research in order to elucidate the diversity and
biological role of basidiomycetous anamorphs.
Acknowledgements We are particularly grateful to Liuba Kisimova-
Horovitz for allowing us to publish the new taxon based on a later
collection and to the directors of the collections of TUB and USJ for
trying to find the original specimen from Costa Rica. Gerhard Kost is
acknowledged for suggesting the epithet of the new species. Technical
assistance was kindly provided by Tanja Trampe in cryotome sectioning,
Marion Stöhr and Susanne Münzner in TEM, and Jascha Weisenborn in
processing sequencing of the ITS DNA. The Autoridad Nacional del
Ambiente (ANAM) is thanked for collection and export permits in
Panama and the German Academic Exchange Service (DAAD) for
financial support.
References
Bandoni RJ, Oberwinkler F (1981) Hyalopycnis blepharistoma:a
pycnidial basidiomycete. Can J Bot 59:1613–1620
Binder M, Hibbett DS (2002) Higher-level phylogenetic relationships
of Homobasidiomycetes (mushroom-forming fungi) inferred
from four rDNA regions. Mol Phylogenet Evol 22:76–90
Brefeld O (1888) Basidiomyceten. II. Protobasidiomyceten. Unters
Gesammtgeb Mykol 7:1–178
Giachini AJ, Hosaka K, Nouhra ER, Spatafora J, Trappe JM (2010)
Phylogenetic relationships of the Gomphales based on nuc-25S-
rDNA, mit-12S-rDNA, and mit-atp6-DNA combined sequences.
Fungal Biol 114:224–234
Kim KM, Yoon YG, Jung HS (2005) Evaluation of the monophyly of
Fomitopsis using parsimony and MCMC methods. Mycologia
97:812–822
Kirschner R (2004) Sporodochial anamorphs of species of Helicogloea.
In: Agerer R, Piepenbring M, Blanz P (eds) Frontiers in
basidiomycote mycology. IHW, Eching, Germany, pp 165–178
Kirschner R (2009) Cercosporella and Ramularia. Mycologia 101:110–119
Kirschner R (2010) The synnematous anamorph of Exidia saccharina
(Auriculariales, Basidiomycota): morphology, conidiogenesis and
association with bark beetles. Pol Bot J 55:335–342
Kirschner R, Chen C-J (2004) Helicomyxa everhartioides, a new
helicosporous sporodochial hyphomycete from Taiwan with
relationships to the Hyaloriaceae (Auriculariales, Basidiomycota).
Stud Mycol 50:337–342
Kirschner R, Chen C-J (2008) The Ovulariopsis anamorph of
Phyllactinia bauhiniae var. cassiae: first record outside India
and morphological characterization. Sydowia 60:57–67
Kirschner R, Oberwinkler F (2009) Supplementary notes on Basidio-
pycnis hyalina (Basidiomycota, Atractiellales) and its anamorph.
Mycotaxon 109:29–38
Kirschner R, Yang Z-L, Zhao Q, Feng B (2010) Ovipoculum album,a
new anamorph with gelatinous cupulate bulbilliferous conidiomata
from China and with affinities to the Auriculariales (Basidiomy-
cota). Fungal Divers 43:55–65
Kisimova-Horovitz L, Oberwinkler F, Gómez PLD (1997) Basidiomi-
cetos resupinados de Costa Rica. Exidiaceae (Tremellales). Rev
Biol Trop 45:1325–1347
Kisimova-Horovitz L, Oberwinkler F, Gómez PLD (2000) Basidiomice-
tos resupinados de Costa Rica. Myxariaceae s. Jülich, Sebacinaceae
Wells & Oberw., y Tremellodendropsidaceae Jülich. Rev Biol Trop
48:519–538
Mycol Progress (2012) 11:561–568 567
Author's personal copy

Larsson KH, Larsson E, Koljalg U (2004) High phylogenetic diversity
among corticioid homobasidiomycetes. Mycol Res 108:983–
1002
Matsushima T (1995) Matsushima Mycological Memoirs No. 8.
Published by the author, Kobe, Japan
Möller A (1895) Protobasidiomyceten. Botanische Mittheilungen aus
den Tropen 8:1–179 & 6 plates. Jena
Nag Raj TR (1993) Coelomycetous anamorphs with appendage-bearing
conidia. Mycologue Publications, Waterloo, Ontario, Canada
Neuhoff W (1935) Die Pilze Mitteleuropas. Band IIa. Die Gallertpilze.
1. & 2. Lieferung:1–28. von Dr. Werner Klinkhardt, Leipzig,
Germany
Neuhoff W (1936) Die Pilze Mitteleuropas. Band IIa. Die Gallertpilze. 3.
& 4. Lieferung:29–48. von Dr. Werner Klinkhardt, Leipzig, Germany
Oberwinkler F, Bauer R, Bandoni RJ (1990) Heterogastridiales: a new
order of Basidiomycetes. Mycologia 82:48–58
Oberwinkler F, Kirschner R, Arenal F, Villarreal M, Rubio V, Begerow
D, Bauer R (2006) Two new pycnidial members of the
Atractiellales: Basidiopycnis hyalina and Proceropycnis pinicola.
Mycologia 98:627–649
Pilát A (1957) Übersicht der europäischen Auriculariales und
Tremellales unter besonderer Berücksichtigung der tschechoslo-
wakischen Arten. Sborn Nar Muz v Praze, Rada B, Prir Vedy
13:115–210
Sutton BC (1980) The Coelomycetes. CAB International, Wallingford,
UK
Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: Molecular
Evolutionary Genetics Analysis (MEGA) software version 4.0.
Mol Biol Evol 24:1596–1599
Wagner T, Fischer M (2002) Proceedings towards a natural classification of
the worldwide taxa Phellinus s.l. and Inonotus s.l., and phylogenetic
relationships of allied genera. Mycologia 94:998–1016
Weiß M, Oberwinkler F (2001) Phylogenetic relationships in Auricular-
iales and related groups –hypotheses derived from nuclear
ribosomal DNA sequences. Mycol Res 105:403–415
Wells K (1994) Jelly fungi, then and now! Mycologia 86:18–48
Wells K, Bandoni RJ, Lim S-R, Berbee ML (2004) Observations on
some species of Myxarium and reconsideration of the Auricular-
iaceae and Hyaloriaceae (Auriculariales). In: Agerer R, Piepenbr-
ing M, Blanz P (eds) Frontiers in basidiomycote mycology. IHW,
Eching, Germany, pp 237–248
Wu S-H, Yu Z-H, Dai Y-C, Chen C-T, Su C-H, Chen L-C, Hsu W-C,
Hwang G-Y (2004) Taiwanofungus, a polypore new genus.
Fungal Sci 19:109–116
568 Mycol Progress (2012) 11:561–568
Author's personal copy