Content uploaded by Markus Heitzer
Author content
All content in this area was uploaded by Markus Heitzer on Aug 21, 2015
Content may be subject to copyright.
Planta (2009) 229:873–883
DOI 10.1007/s00425-008-0879-x
123
ORIGINAL ARTICLE
Strategies to facilitate transgene expression in Chlamydomonas
reinhardtii
Alke Eichler-Stahlberg · Wolfram Weisheit ·
Ovidiu Ruecker · Markus Heitzer
Received: 12 October 2008 / Accepted: 17 December 2008 / Published online: 7 January 2009
© Springer-Verlag 2009
Abstract The unicellular green alga Chlamydomonas
reinhardtii has been identiWed as a promising organism for
the production of recombinant proteins. While during the
last years important improvements have been developed for
the production of proteins within the chloroplast, the
expression levels of transgenes from the nuclear genome
were too low to be of biotechnological importance. In this
study, we integrated endogenous intronic sequences into
the expression cassette to enhance the expression of trans-
genes in the nucleus. The insertion of one or more copies of
intron sequences from the Chlamydomonas RBCS2 gene
resulted in increased expression levels of a Renilla-lucifer-
ase gene used as a reporter. Although any of the three
RBCS2 introns alone had a positive eVect on expression,
their integration in their physiological number and order
created an over-proportional stimulating eVect observed in
all transformants. The secretion of the luciferase protein
into the medium was achieved by using the export sequence
of the Chlamydomonas ARS2 gene in a cell wall deWcient
strain and Renilla-luciferase could be successfully concen-
trated with the help of attached C-terminal protein tags.
Similarly, a codon adapted gene variant for human erythro-
poietin (crEpo) was expressed as a protein of commercial
relevance. Extracellular erythropoietin produced in Chla-
mydomonas showed a molecular mass of 33 kDa probably
resulting from post-translational modiWcations. Both, the
increased expression levels of transgenes by integration of
introns and the isolation of recombinant proteins from the
culture medium are important steps towards an extended
biotechnological use of this alga.
Keywords Chlamydomonas reinhardtii · Erythropoietin ·
Gene expression · Intron · luciferase · Secretion
Introduction
Being a model system for photosynthesis and Xagellar
function the eukaryotic unicellular green alga Chlamydo-
monas reinhardtii has recently also gained interest as an
organism of biotechnological relevance (Leon-Banares
et al. 2004). Simple salt based media, fast vegetative
growth and high cell densities are the basis for a cost eVec-
tive cultivation and are—along with well characterized
genetics—a major argument for a future industrial use of
this alga (Franklin and MayWeld 2004). Beside the extrac-
tion of natural components (e.g. carotenoids) and the
production of hydrogen using (sun)light as energy source
(Melis 2007), the expression of recombinant proteins has
been identiWed as one possible biotechnological goal
(Fuhrmann 2004).
In theory, transgenes can be expressed from any of the
three algal genomes (nucleus, chloroplast, mitochondria)
(Rochaix 2002), but only protein production within the sin-
gle large chloroplast of Chlamydomonas has been brought
to commercial relevance yet (Franklin and MayWeld 2005).
Electronic supplementary material The online version of this
article (doi:10.1007/s00425-008-0879-x) contains supplementary
material, which is available to authorized users.
A. Eichler-Stahlberg · W. Weisheit · O. Ruecker · M. Heitzer
Center of Excellence for Fluorescent Bioanalysis,
University of Regensburg, Josef-Engert-Str. 9,
93053 Regensburg, Germany
Present Address:
M. Heitzer (&)
Geneart AG, Josef-Engert-Str. 11,
93053 Regensburg, Germany
e-mail: Heitzer_Markus@web.de
874 Planta (2009) 229:873–883
123
The molecular biology of the chloroplast allows a directed
manipulation of its genome, since foreign DNA can be
integrated by homologous recombination (Heifetz 2000).
Moreover, mechanisms for transcriptional or post-trans-
criptional gene silencing are completely absent, which
results in a reliable and constant level of recombinant
protein over the time. However, comprising a prokaryotic like
gene expression system, enzymes for the post-translational
modiWcation of proteins such as formation of disulWde
bonds or glycosylation are not found inside the chloroplast.
Nevertheless it has been shown, that a large single chain
antibody against herpes simplex virus glycoprotein D was
expressed and assembled correctly to form fully functional
dimers (MayWeld et al. 2003). Since then expression
eYciencies were further optimized and the chloroplast of
Chlamydomonas was reported to be a considerable alter-
native for the industrial production of antibodies and other
recombinant proteins (MayWeld and Franklin 2005;
MayWeld et al. 2007).
Since most extracellular proteins need a correct post-
translational processing for proper folding or enzymatic
activity, these proteins will not always be produced func-
tionally inside plastids. In this case, transgene expression
from the nuclear genome of C. reinhardtii oVers the possi-
bility to direct recombinant proteins to the organelles of the
classical secretory pathway containing all enzymes respon-
sible for post-translational modiWcations (Griesbeck et al.
2006). A subsequent secretion into the culture medium
additionally allows the puriWcation of the recombinant pro-
tein product from the culture supernatant rather than from a
whole cell extract, which simpliWes downstream process-
ing. Alternatively, proteins can be targeted and attached
to the cell membrane, where antigenic epitopes were shown
to induce an immune response when added as an edible
vaccine to Wsh food (Sayre et al. 2001).
Although important improvements have been developed,
e.g. codon adaptation of transgenes and construction of
suitable expression vectors (Fuhrmann et al. 1999; Heitzer
and Zschoernig 2007), gene expression from the nucleus of
Chlamydomonas is still too ineVective for industrial appli-
cations and needs to be optimized. It has been reported, that
inclusion of endogenous intron sequences within the
transgene led to increased transformation rates as a result of
elevated amounts of selection marker protein for Chla-
mydomonas reinhardtii and its close multi-cellular relative
Volvox carteri. When testing the gene encoding nitrate
reductase (NITA) as a metabolic marker for Volvox, the
insertion of NITA intron 1 or introns 9 and 10 within the
cDNA resulted in a ten times higher number of transfor-
mants compared to cDNA without any introns (Gruber
et al. 1996). Similarly, a mutant variant of the Chlamydo-
monas gene for acetolactate synthase for the selection
against sulfometuron methyl yielded only resistant transfor-
mants if all physiological introns where present within the
coding region (Kovar et al. 2002). Since transformation
eYciencies of the bacterial derived selection marker genes
ble and aph7⬘⬘ could also be increased two to tenfold upon
the artiWcial insertion of one copy of intron 1 from the
Chlamydomonas RBCS2 gene (Rubisco small subunit 2),
endogenous intron sequences seem to exert a generally
positive eVect on nuclear gene expression (Lumbreras et al.
1998; Berthold et al. 2002). Lumbreras et al. showed
further, that the expression enhancing eVect of RBCS2
intron 1 was dependent on its position within the ble coding
region and that it could be increased by a second copy of
this intron.
In this study, a detailed approach was used to analyse the
inXuence of diVerent intron sequences and their position
upon the expression of the reporter gene Renilla-luciferase
(Fuhrmann et al. 2004) from the nuclear genome of Chla-
mydomonas reinhardtii. To estimate the suitability of this
alga as a system for extracellular protein production,
recombinant gene products were targeted to the culture
medium and isolated using protein tags. The human gene
for erythropoietin (Jacobs et al. 1985)—a small hormone
exhibiting two disulWde bonds and speciWc N- and O-glyco-
sylation at four positions in its mature form (Cheetham
et al. 1998)—was chosen as an example for a protein of
pharmaceutical interest.
Materials and methods
Construction of plasmids
With plasmid pRbcRL(Hsp196) (Fuhrmann et al. 2004) as
a template, the crluc gene for Renilla-luciferase was ampli-
Wed with oligonucleotides Rluc(Pst)fw (AAACTGCAGG
CCAGCAAGGTGTACGACCCCGA) and T3 (ATTAAC
CCTCACTAAAGGGA) by recombinant PCR. The prod-
uct was digested with PstI (underlined) and BamHI and
inserted back into pRbcRL(Hsp196)/XhoI/BamHI together
with a DNA fragment encoding the signal peptide of the
Chlamydomonas arylsulfatase gene ARS2, which was also
ampliWed by PCR with oligonucleotides Ars1 (AAACTCG
AGATGGGTGCCCTCGCGGTGTTC) and Ars2 (AAA
CTGCAGGTCGGCCGCATGCGCAACCGA) from plasmid
pJD55 (Davies et al. 1992) and cut with XhoI and PstI, to
create plasmid pxx20. Then, the ARS2-crluc gene was
excised with XhoI and BamHI and inserted into pHsp70A/
RbscS2-Chlamy. The resulting plasmid was fused to
plasmid pUC-Arg7-lox-B by Cre/lox-mediated site-speciWc
recombination to yield the tandem expression plasmid
pAES12 (Heitzer and Zschoernig 2007).
In the following, the sequences of intron 1, 2 or 3 from
the RBCS2 gene of C. reinhardtii (Goldschmidt-Clermont
Planta (2009) 229:873–883 875
123
and Rahire 1986) were inserted into a NruI and/or a SnaBI
restriction site within the luciferase coding region (S1 and
Fig. 1). Therefore, the intron sequences were ampliWed
from C. reinhardtii genomic DNA via PCR with a proof-
reading DNA-polymerase (VentR; New England Biolabs,
Beverly, MA, USA) and a speciWc pair of primers (S1).
After phosphorylation, the PCR products were directly
inserted into plasmid pxx20 digested with NruI or SnaBI.
The resulting expression cassettes were—as above for
pAES12—transferred to plasmid pHsp70A/RbscS2-
Chlamy and fused to pUC-Arg7-lox-B to give plasmids
pAES13-14 and pAES20-23, respectively. To create
pAES15 and pAES16 a double stranded oligonucleotide
linker encoding a hexa-histidine- (Janknecht et al. 1991) or
strepII-tag (Voss and Skerra 1997) was inserted into a
maintained SnaBI restriction site directly downstream of
intron 3 (S1) before the transfer to pHsp70A/RbscS2-
Chlamy and the subsequent plasmid-fusion.
Synthesis of crEpo
The amino acid sequence of human erythropoietin
(GenBank P01588) without the leader peptide (amino acids
1–27) was translated to the nuclear codon usage of Chla-
mydomonas reinhardtii resulting in the artiWcial gene crEpo
(GenBank EU940697). The leader peptide of Chlamydo-
monas arylsulfatase gene ARS2 and a C-terminal hexa-
histidine-tag were added and the complete ARS2-crEpo-his6
gene was synthesized from overlapping HPLC-puriWed
oligonucleotides (Fuhrmann et al. 2005). To allow the inser-
tion of RBCS2 intron 2 the synthetic gene was artiWcially
divided into two exons (crEpo1 and crEpo2) by recombi-
nant PCR using the Expand-High Fidelity-PCR-system
(Roche, Mannheim, Germany) with oligonucleotides Ep1fw1
(AAACTCGAGATGGGTGCCCTCGCGGTGTTC) together
with Ep1rev7 (TTTGGATCCGGTCTCTTCACCGCC
TCGCTCAGCAGGGC) and Ep2fw1 (AAAGAAGAC
AAGCAGGTGCTCCGCGGCCAAGCCC) together with
Ep2rev8 (TTTGGATCCTTAATGGTGGTGATGGTGG
TG). Products were ligated into vector pGEM-T (Promega,
Madison, WI, USA) to yield pGEM-Epo1 and pGEM-Epo2.
For subsequent cloning, the above mentioned oligonucleotides
carried recognition sites for XhoI (Ep1fw1, underlined),
BsaI and BamHI (Ep1rev7), BbsI (Ep2fw1) and BamHI
(Ep2rev8). BsaI and BbsI cut outside their recognition
sequence and create four base overhangs. In this case, these
overhangs were designed to be complementary to the Wrst
(Ep1rev7, bold) or last (Ep2fw1) bases of RBCS2 intron 2
Fig. 1 Schematic drawings of luciferase constructs and average
expression levels. The export sequence for secretion of the ARS2 gene
(A) was attached to a codon adapted gene variant encoding the lucifer-
ase of Renilla reniformis (crluc). DiVerent combinations of intron 1, 2
and 3 of the Rubisco small subunit gene of Chlamydomonas (RBCS2)
were inserted into an NruI and a SnaBI restriction site within the cod-
ing region. The expression of all genes was mediated by the constitu-
tive chimeric HSP70A/RBCS2 promoter and the 3⬘ untranslated region
of the RBCS2 gene. In plasmids pAES15 and pAES16 a C-terminal
protein-tag (hexa-histidine-tag, strepII-tag) was added for protein
puriWcation. The average luciferase activity calculated from all lumi-
nescent transformants for each plasmid is given on the right. For com-
parison, the activity for pAES12 was set to 100% (right). A 63 bp o
f
ARS2 encoding the signal peptide, ARS2 arylsulfatase 2 (GenBan
k
AF333184), HSP70A 70 kDa heat shock protein (M76725), In1, In2,
In3 intron 1, 2, 3 of RBCS2, RBCS2 Rubisco small subunit 2 (X04472),
UTR untranslated region of RBCS2. The positions of open reading
frames (start, stop), important restrictions sites (NruI, SnaBI) and
protein tags (hexa-histidine-tag, strepII-tag) are marked
876 Planta (2009) 229:873–883
123
to allow gapless insertion of the intron sequence between
the two exons.
Plasmid pHsp70A/RbscS2-Chlamy already contains a
copy of RBCS2 intron1 within the 5⬘ untranslated region of
the promoter upstream of the start ATG. To insert RBCS2
intron 3, the plasmid was digested with BamHI and Wlled
with Klenow fragment. Intron 3 was ampliWed from
pAES14 with oligonucleotides rbcS2I3-5⬘ (CGTAAGTCT
GGCGAGAGCCCG) and rbcS2I3-3⬘ (TCTGCGGGCGCA
CGGGAAATG) applying VentR-DNA-Polymerase (New
England Biolabs, Beverly, MA, USA) and ligated directly
into the reWlled BamHI restriction site after phosphoryla-
tion. In the resulting pxx343, the intron 3 sequence lies
downstream of the stop codon followed by a restored
BamHI-site (a 3⬘-BamHI-site was not restored).
RBCS2 intron 2 was also obtained by recombinant PCR
from plasmid pAES14 using the Expand-High Fidelity-
PCR-system (Roche) with oligonucleotides BbsI-rbcS2I2fw
(AAAGAAGACAAGTGAGCTTGCGGGGTTGCGAGC)
and BsaI-rbcS2I2rev (AAAGGATCCGGTCTCACTGC
AAGCAAGGGGATGAAGGG) and ligated into vector
pGEM-T to obtain pGEM-In2. Recombinant restriction sites
for BbsI, BamHI and BsaI were introduced for cloning
(underlined), overhangs created upon digestion with BbsI
and BsaI are bold.
A fragment containing the complete crEpo1 was
excised from pGEM-Epo1 with XhoI and BamHI and
inserted into pxx343 cut with the same enzymes. The
resulting plasmid pEpo3 was incubated with BamHI and
BsaI to allow the insertion of intron 2 from pGEM-In2
double digested with BamHI and BbsI via the complemen-
tary overhangs to yield pEpo4. Similarly, the second part
of crEpo, excised from pGEM-Epo2 with BamHI and
BbsI, was inserted into pEpo4 cut with BamHI and BsaI.
Finally, the fusion of the resulting plasmid pEpo5 to pUC-
Arg7-lox-B yielded a large tandem expression vector
(pEpo6) for crEpo and the selection marker ARG7 (Heitzer
and Zschoernig 2007).
Growth of algae and transformation
The cell wall defective and arginine auxotrophic Chla-
mydomonas reinhardtii strain cw15arg¡ was used for all
transformations according to the glass bead method (Kindle
1990). Algae were cultivated at 25°C under constant illumi-
nation in Tris–acetate–phosphate (TAP) medium with or
without the addition of 100 mg/l arginine (Harris 1989).
For transformation, 7.5 £107 cells were agitated in the
presence of 1.5 g plasmid linearized with EcoRV and
incubated on TAP-agar plates without arginine. After
8 days on selective medium, arginine prototrophic trans-
formants were transferred to transparent 96-well-plates
containing 200 l TAP per well or 24-well-plates with 2 ml
TAP per well. For larger scale cultures, 50 ml or 250 ml
TAP-medium was grown as above but with gentle shaking.
Measurement of luminescence
To detect Renilla-luciferase expression in transformants, 50 l
algal cultures (logarithmic growth phase, OD800nm = 0.9–1.1)
diluted with 150 l TAP-medium were tested in 96-well-plates
on a PolarStar Optima microplate luminometer (BMG
Labtech, Jena, Germany). As substrate, coelenterazine
(0.1 mM in 10% ethanol; PJK, Kleinblittersdorf, Germany)
was automatically injected to a Wnal concentration of 5 M
and light emission was detected for 25 s at the highest
ampliWcation.
To monitor the total luciferase activity of a culture
(logarithmic growth phase, OD800nm = 0.9–1.1), 50 l
TAP-medium containing 0.5% Triton X-100 was added to
a 50 l culture aliquot and incubated for 2 min at room
temperature for cell lysis. After centrifugation (2 min,
1,000£g) the complete supernatant (green, 100 l) was
diluted with 100 l TAP and used for activity determina-
tion. Similarly, cells pelleted from 50 l algal cultures were
mixed with 100 l TAP-medium containing 0.25% Triton
X-100 to detected luciferase within or attached to the cells.
As a control, plasmid pRbcRL(Hsp196) was transformed to
obtain Chlamydomonas strains expressing Renilla-luciferase
within the cytosol (Fuhrmann et al. 2004).
Antibody production and immunodetection
Plasmid pCrLuc is a pET16b-derivate (Novagen, Madison,
WI, USA) containing the entire crluc gene for Renilla-
luciferase inserted into the XhoI and BamHI site adding an
N-terminal deca-histidine-tag to the luciferase polypeptide
chain (Fuhrmann et al. 2004). After transfer into Esche-
richia coli strain BL21(DE3) (Invitrogen, Carlsbad, CA,
USA), luciferase expression from pCrLuc was induced by
supplementing the culture with 1 mM isopropyl--D-1-thio-
galactopyranoside (IPTG) and the total soluble protein was
subjected to aYnity chromatography on Ni–NTA–agarose
according to the manufacturer (Qiagen, Hilden, Germany).
The bound luciferase protein was eluted by raising the
imidazole concentration to 250 mM. For the production of
polyclonal antibodies in rabbits, 2 mg puriWed protein dia-
lysed against 50 mM Na–phosphate buVer pH 8.0 with
100 mM NaCl was transferred to Davids Biotechnologie
(Regensburg, Germany).
For immunodetection, protein extracts were separated on
10 or 12% SDS polyacrylamide gels and transferred to nitro-
cellulose membranes (Amersham Bioscience, Uppsala,
Sweden) using the semi-dry blotting method. The above
mentioned anti-luciferase-antibody was used in a 1:1,000
dilution for detection of Renilla-luciferase after blocking of
Planta (2009) 229:873–883 877
123
the membrane with 7% milk powder in PBS containing 0.5%
Tween-20. As a secondary antibody a diluted (1:2,000) anti-
rabbit IgG-antibody-alkaline phosphatase conjugate (Sigma-
Aldrich, St Louis, MO, USA) was employed and detection
was completed by a chromogenic reaction using nitro-
blue-tetrazolium (NBT) and 5-bromo-4-chloro-3-indolyl
phosphate (BCIP). Equally, detection of erythropoietin was
performed, except that membranes were blocked with 1%
BSA in PBS with 0.5% Tween-20 and a commercial poly-
clonal antibody raised against recombinant human erythro-
poietin (R&D Systems, Minneapolis, MN, USA) was used.
AYnity chromatography of tagged luciferase
and erythropoietin
Luciferase protein was isolated from the medium of 500 ml-
cultures raised from C. reinhardtii cells transformed with
pAES15 (hexa-histidine-tag) or pAES16 (strepII-tag) har-
vested at an OD800 nm between 1.0 and 1.5. After centrifuga-
tion (5 min, 25°C, 1,000£g) supernatants were lyophilised,
resuspended in 50 ml distilled water and separated by
aYnity chromatography on Ni–NTA–agarose (Qiagen,
Hilden, Germany) or Strep–Tactin–Sepharose (IBA GmbH,
Göttingen, Germany) at 4°C according to the instructions of
the manufacturers. In detail, Ni–NTA–agarose columns were
washed with 5 mM imidazole and tagged protein was eluted
with 250 mM imidazole in 2 ml-fractions; strepII-tagged
luciferase was detached from the Strep–Tactin resin using
2.5 mM D-desthiobiotin in 6.5 ml-fractions. For immunode-
tection, protein from 200 l of each chromatography frac-
tion was precipitated with methanol/chloroform (Wessel and
Flugge 1984) and resuspended directly in 20 l SDS poly-
acrylamide sample buVer. Ten or Wfty microliter of each
fraction was analysed in luciferase assays in parallel.
One litre culture medium (4 £250 ml culture) of a
C. reinhardtii strain transformed with pEpo6 was used for
the puriWcation of erythropoietin provided with a C-terminal
hexa-histidine-tag (OD800nm = 1.0–1.6). As for luciferase, the
supernatant was lyophilised, resuspended in 100 ml distilled
water and applied to a Ni–NTA–agarose column. In this
case, the aYnity resin was washed with 60 mM imidazole
and eluted with 1 M imidazole. Chromatography fractions
were dialysed against distilled water at 4°C, lyophilised
again and Wnally resuspended in 100 l SDS polyacrylamide
sample buVer for subsequent immunodetection.
Results
Extracellular expression of Renilla-luciferase
The leader peptide of the Chlamydomonas reinhardtii
ARS2 gene encoding the extracellular enzyme arylsulfatase
(de Hostos et al. 1989) was chosen to target transgenic
proteins to the culture medium. The sequence of the
N-terminal 21 amino acid export signal was placed directly
upstream of crluc (Fuhrmann et al. 2004), a Renilla-luciferase
gene which was codon optimized for the expression from
the Chlamydomonas nuclear genome (Fig. 1, pAES12). As
strain cw15arg¡ possesses only a rudimentary cell wall
(de Hostos et al. 1988), it was used in all expression
experiments to allow an eYcient export of proteins out of
the cells into the medium. Luminescence measurements
of ten randomly chosen luciferase expressing transfor-
mants revealed, that approximately 65% of the total
luciferase activity was found in the culture supernatant
compared to only 10% for intracellular targeted luciferase
without a signal peptide (Fig. 2a). Analysis of luciferase
protein by immunoblotting conWrmed the protein export
(Fig. 2b).
InXuence of intron sequences on luciferase expression
When using a longer fragment (287 bp) of the ARS2 gene
encoding the export signal peptide and containing the Wrst
genomic intron, slightly enhanced levels of luciferase activ-
ity could be detected in positive transformants compared to
the above mentioned approach (not shown). As a similar
positive stimulation was reported for the integration of
introns on the expression of two selection markers in Chla-
mydomonas (Lumbreras et al. 1998; Berthold et al. 2002), a
set of expression plasmids was constructed to analyse the
eVect in detail (Fig. 1).
Pre-existing NruI and SnaBI sites within the synthetic
crluc gene were selected for the integration of intron
sequences. The three intron sequences of the Chlamydo-
monas gene for the ribulose-1,5-bisphosphate carboxylase/
oxygenase small subunit RBCS2 were chosen (Goldschmidt-
Clermont and Rahire 1986), as the expression cassette
of plasmid pAES12 already comprised promoter, intron 1
and 3⬘ untranslated region (UTR) of the RBCS2 gene.
Figure 1 displays number and positions of the diVerent
introns within the luciferase expression cassette of the six
plasmids constructed (pAES13 to 14, pAES20 to 23). For
co-transformation of cw15arg¡ cells, each expression cas-
sette was arranged on a tandem expression vector together
with the selection marker ARG7 (Heitzer and Zschoernig
2007). For all constructs, 48 arginine auxotrophic transfor-
mants were analysed for luciferase activity and the average
luciferase level was determined (Fig. 1). The comparison
with algae transformed with plasmid pAES12 showed, that
the integration of one additional intron sequence generally
led to an increase in the average luciferase activity (Fig. 1,
pAES21 to 23). The sequence of intron 3 was the most
eVective resulting in an almost twofold improvement,
whereas intron 1 and 2 had a less pronounced inXuence.
878 Planta (2009) 229:873–883
123
The insertion of a third intron furthermore enhanced crluc
expression (pAES13, 14 and 20) by approximately the
same extent, with the exception of plasmid pAES14, where
a fourfold increase was observed (449%). In pAES14 all
three introns of the RBCS2 gene were present in single copy
and positioned in their physiological order, which seemed
to form a synergistic eVect. The correct splicing of all
inserted introns was checked by Western analysis, where
only secreted luciferase protein of the correct size was
detectable (Fig. 3b). As expected, the extent of luciferase
export was also unaVected by the additional intron
sequences and ranged from 60 to 75% of the total luciferase
activity (Fig. 3a).
For a detailed analysis, all luciferase expressing transfor-
mants were classiWed into diVerent groups of luciferase
activity according to their individual expression level. As
integration of foreign DNA into the nuclear genome of
C. reinhardtii occurs via non-homologous recombination,
levels of transgene expression usually cover a broad range
depending on the chromosomal position of transgene inser-
tion (Schroda et al. 2002). Figure 4 shows that the expres-
sion of luciferase formed a similar distribution for each
genetic construct transformed. The insertion of one or two
additional introns resulted in a shifting of this distribution
to higher activity values (Fig. 4b, d), reXecting the diVerent
eYciencies of the three sequences (Fig. 4a, c).
Fig. 2 Extracellular expression of luciferase. a After transformation
with pAES12, the luciferase activity of ten luminescent transformants
was measured in pelleted cells (black) and supernatant (grey, equal to
activity in culture medium) to determine the luciferase export rate.
Strains transformed with plasmid pRbcRL(Hsp196) enabling intracel-
lular luciferase expression were used as a control (pRbc). For compar-
ison, the total activity of each construct was set to 100%. b Analysis of
luciferase produced in Chlamydomonas from plasmid pAES12
(extracellular expression) and pRbcRL(Hsp196) (pRbc, intracellular
expression). Two millilitre algal cultures (logarithmic growth phase,
5£106cells/ml) were separated into cell- and medium fraction by
centrifugation. After precipitation of the total protein of the medium
fraction with methanol/chloroform and resuspension in sample buVer,
corresponding volumes were separated on a 10% SDS-gel and incu-
bated with a polyclonal anti-luciferase antibody after electroblotting.
The untransformed strain cw15arg¡ (C) was treated equally as a
control
Fig. 3 Expression of luciferase from genes containing multiple
introns. a Similarly to Fig. 2a, the export rate was determined for
strains generated by transformation with plasmids pEAS13, pAES14
and pAES20–pAES23. For each construct, the luciferase activity of ten
independent luciferase expressing transformants was analyzed in the
supernatant (grey) and the cell pellet (black). The total activity of each
construct was set to 100%. b Western analysis of Chlamydomonas
strains transformed with diVerent expression plasmids (pAES 13,
pAES14 and pAES20–pAES23) using a polyclonal anti-luciferase
antibody. For comparison, transformants with a similar luciferase
activity level were chosen (not applicable for pAES13). The integra-
tion of one or two intron sequences into random sites of the coding
region of crluc had no eVect on protein size
Planta (2009) 229:873–883 879
123
AYnity chromatography of extracellular luciferase
containing protein tags
Two plasmids, pAES15 and pAES16, were produced for
the isolation of secreted luciferase by providing the coding
sequence with short protein tags at the C-terminus. Plasmid
pAES15 encoded an additional hexa-histidine-tag (Janknecht
et al. 1991) downstream of the third intron, pAES16 a so
called strepII-tag (Voss and Skerra 1997) in the same posi-
tion (Fig. 1). For each construct, the supernatant of a
500 ml-culture of a transformant exposing a high luciferase
level was subjected to aYnity chromatography on the cor-
responding resin. In both cases an enrichment of luciferase
protein was observed (Fig. 5): histidine-tagged luciferase
eYciently bound to Ni–NTA–agarose and elution resulted
in a Wvefold enrichment (Fig. 5a, c). A comparable result
was achieved using the strepII-tag and a Strep–Tactin
column (not shown).
Extracellular expression of human erythropoietin
The human glycoprotein erythropoietin (Epo) was chosen
to test the production and export of a protein of biotechno-
logical signiWcance in Chlamydomonas. Therefore, the cod-
ing sequence of the Epo gene was adapted according to the
nuclear bias of Chlamydomonas reinhardtii and the result-
ing gene crEpo (GenBank EU940697) was synthesised
from overlapping oligonucleotides. The human export pep-
tide (amino acids 1–27) was replaced by the arylsulfatase
leader peptide and a C-terminal hexa-histidine-tag was
Fig. 4 Distribution of expression activities. According to their
individual luciferase activity all luminescent transformants of each
plasmid were divided into diVerent groups of certain activity levels
(e.g. <10,000 units, 10,000–25,000 units, etc.), the total number of
transformants for each plasmid was set to 100%. As integration of
transgenes occurred by non-homologous recombination events in
Chlamydomonas, expression levels of transformants vary compliant
with the transcriptional status of the integration locus. Diagrams
a–d illustrate the eVect of intron integration among the diVerent
constructs. Note that uneven activity intervals were only chosen for an
adequate presentation
880 Planta (2009) 229:873–883
123
added for puriWcation. The coding sequence was inter-
rupted artiWcially by the insertion of RBCS2 intron 2 in a
position similarly to the consensus splicing sequence of
C. reinhardtii (Fig. 6a). Intron 3 was placed directly after
the stop TAA of crEpo and as for the expression of lucifer-
ase the strong HSP70A/RBCS2 tandem promoter containing
intron1 of the RBCS2 gene was used for transcription. After
co-transformation of cw15arg¡ cells together with the ARG7
selection marker, transformants growing without the addi-
tion of arginine were tested for the presence of the erythro-
poietin expression cassette by genomic PCR (not shown)
and Western analysis: out of 28 transformants containing
the crEpo gene, 24 displayed a single signal around 33 kDa
after detection with an antibody raised against recombinant
human erythropoietin (Fig. 6b) and proved the correct
production of the protein. As expected, the erythropoietin
protein was successfully secreted into the culture medium
(Fig. 6b). Due to its C-terminal histidine-tag, the crEpo
gene product could partly be isolated from the supernatant
by aYnity chromatography (Fig. 6c).
Discussion
Secretion of luciferase
To eYciently use Chlamydomonas as an organism for the
production of recombinant proteins, the export of the prod-
uct protein into the culture medium would be favourable.
The secretory pathway provides all possibilities of post-
translational modiWcation of the eukaryotic cell and Wnally
facilitates the isolation of the protein from the algal
medium. Sayre et al. (2001) employed the signal peptide of
an extracellular arylsulfatase of Chlamydomonas (ARS2) to
target antigens to the algal periplasm. We used the same
amino acid sequence to mediate the export of Renilla-lucif-
erase to the exterior of cell wall defect algae. In these cells
the signal sequence successfully directed approximately
65% of the total luciferase activity (and approx. 60% of
erythropoietin judged from the Western blot signals) to the
culture supernatant, the rest probably remained within the
cell organelles or stayed attached to the remnants of the cell
wall. In comparison, only 10% of activity was found in the
culture supernatant upon omission of this sequence. de
Hostos et al. (1988) reported, that upon induction 90% of
the arylsulfatase activity is found in the medium.
Integration of introns
Although in most cases introns are not encoding a protein
sequence, it was proposed that an important part of the
genetic information essential for an eukaryotic cell is main-
tained within introns (Mattick 1994). Introns take part in
genome wide processes like exon shuZing (Liu and
Grigoriev 2004) or aVect the expression of distinct genes by
alternative splicing (Lareau et al. 2004) or by regulation of
transcription (Palmiter et al. 1991; Liu et al. 1995). As for
other organisms including plants (Chapman et al. 1991;
Koziel et al. 1996), an enhanced expression of transgenes
containing intron sequences has been observed for Chla-
mydomonas reinhardtii (Lumbreras et al. 1998; Berthold
et al. 2002).
To test if this positive eVect can generally be used for
transgene expression in Chlamydomonas, the crluc gene
encoding the luciferase of Renilla reniformis was employed
as a model gene to analyse and quantify the inXuence of
introns within the expression cassette. As the artiWcial pro-
moter driving the expression of Renilla-luciferase already
contained one copy of intron 1 of the RBCS2 gene of Chla-
mydomonas, the two other introns of this gene were utilized
for this study. The insertion of one or two additional copies
of RBCS2 intron 1, 2 or 3 into two randomly chosen posi-
tions of crluc resulted in an increased level of average lucif-
erase activity in all cases. In a previous study it was shown,
that the position of an intron within the transgene is crucial
Fig. 5 AYnity chromatography of protein tagged luciferase from
culture supernatants. The culture medium of Chlamydomonas cells
transformed with pAES15 (hexa-histidine-tag) was lyophilized, resus-
pended in 1/10 volume distilled water and applied to Ni–NTA–agarose
(pAES15). After a washing step bound protein was eluted with
250 mM imidazole (pAES15, 2 ml-fractions). a Luciferase activity o
f
the diVerent fractions of the Ni–NTA chromatography. Ten microliter
of each fraction were monitored for luminescence and normalized to
the activity of the resuspended lyophilisate (L, set to 100%). b Western
analysis for the fractions of the Ni–NTA chromatography shown in (a).
Two-hundred microliters of each fraction was precipitated, resus-
pended in sample buVer and separated on a 10% SDS-gel. For detection,
the anti-luciferase antibody was used. L resuspended lyophilisate,
D
Xow through, W washing fraction, E1–E4 elution fraction 1–4
Planta (2009) 229:873–883 881
123
for the extend of its eVect: the inXuence of RBCS2 intron 1
was strongly dependent on the promoter variant used and
maximal near the 5⬘ end of the ble coding region (Lumbreras
et al. 1998). When inserted 743 bp downstream of the
start codon of crluc, RBCS2 intron 3 caused the greatest
increase in expression, although it was shown that intron 1
is harbouring a transcriptional enhancer sequence (Lumbreras
et al. 1998). As the sequence of intron 3 is highly con-
served in the two RBCS genes of Chlamydomonas and
displays a direct sequence repeat, it was argued to “be
involved in the expression or regulation of the genes”
before (Goldschmidt-Clermont and Rahire 1986). How-
ever, no further tests to elucidate the precise activity of
intron 3, e.g. integration in reverse orientation or outside
the coding region, were performed. An analysis of all lumi-
nescent transformants generated, revealed, that the intron
eVects are not solely reXected by the average expression
levels, but are also visible in diVerent groups of expression
eYcacy resulting from diVerent transcriptional conditions
at the random genomic integration sites. Therefore, the pos-
itive eVects raising the expression level are not restricted to
certain transformants, but generally active, independent
from the chromosomal position of the inserted expression
cassette.
The incorporation of a third intron sequence upstream of
the stop codon had only an additive eVect, except for the
combination in pAES14 containing introns (1 + 2 + 3):
when a single copy of each intron was present in their
physiological order and in their approximate physiological
position a more than fourfold increase in expression was
detected. In concert with promoter and 3⬘ untranslated
region of the RBCS2 gene present in all constructs, this
arrangement mimics the composition of a wildtype Chla-
mydomonas gene to the maximum, creating a favourable
pattern for transgene expression. Although it has been
shown, that cDNA can be successfully expressed from the
nuclear genome of Chlamydomonas, our results demon-
strate a positive eVect of intronic sequences within the
expression cassette (Fischer and Rochaix 2001). The mech-
anism how the introns increase transgene expression needs to
be further investigated, but it might act on the transcriptional
or post-transcriptional level. An activation on the transcrip-
tional level would be reXected by increased amounts of de
novo synthesized RNA as a result of a direct stimulation of
the initiation of RNA-polymerase II—as reported before
for RBCS2 intron1 (Lumbreras et al. 1998)—or as an
indirect eVect by the prevention of gene silencing. In
Chlamydomonas it was shown, that foreign transgenes
are eYciently recognized and silenced (Schroda 2006).
Alternatively, a positive inXuence on the post-transcriptional
level may include an enhanced RNA maturation initiated
by the additional splicing event (Bentley 2005).
Fig. 6 Expression of erythropoietin in Chlamydomonas. The human
gene for erythropoietin was artiWcially divided into two exons and
adapted to the nuclear codon usage of Chlamydomonas reinhardtii.
a Schematic illustration of the expression cassette in plasmid pEpo6.
The two exons of crEpo were interrupted by intron 2 (In2) of the
R
BCS2 gene. Intron 1 (In1) and 3 (In3) were positioned within the
untranslated regions. The ARS2 signal peptide (A) and a C-terminal
hexa-histidine-tag were added for extracellular targeting and puriWca-
tion. A 63 bp of ARS2 encoding the signal peptide, ARS2 arylsulfatase
2 (GenBank AF333184), HSP70A 70 kDa heat shock protein
(M76725), In1, In2, In3 intron 1, 2, 3 of RBCS2, RBCS2 Rubisco small
subunit 2 (X04472), UTR untranslated region of RBCS2. The positions
of open reading frame (start, stop) and histidine-tag are marked.
bLocalisation of erythropoietin expressed from plasmid pEpo6. An
aliquot of a culture (total) was divided into medium and cell pellet by
centrifugation. After protein precipitation of the medium fraction cor-
responding volumes of medium (med.) and cells (cells) were applied
on a 12% SDS-gel and analysed with a commercial anti-erythropoietin
antibody. A culture of untransformed strain cw15arg¡ was treated
equally as a control. c AYnity chromatography of recombinant eryth-
ropoietin from the culture medium of a strain transformed with pEpo6
using Ni–NTA–agarose. The diVerent elution fractions were dialysed
against distilled water, lyophilized and resuspended in sample buVer.
After gel electrophoresis (12% SDS-gel) and electroblotting the eryth-
ropoietin protein was detected using an anti-erythropoietin antibody.
L resuspended lyophilisate, D Xow through, W washing fraction,
E1–E4 elution fraction 1–4
882 Planta (2009) 229:873–883
123
Although the diVerent introns were artiWcially intro-
duced into the crluc genes, the correct splicing of all intron
sequences could be conWrmed by the aYnity chromatogra-
phy of the correct protein product via protein tags and
analysis by activity assays. In Western analysis using
polyclonal antibodies only one distinct signal was detected
for each expression cassette, excluding early termination
of translation or read through over additional sequences
caused by unspliced introns.
Extracellular expression of erythropoietin
For crluc, both integration sites were chosen coincidently
without considering the physiological splicing sites of
the Chlamydomonas RBCS2 gene. For the crEpo gene, a
motif close to the wildtype sequence of intron 2 was used
(CG/GTGAG…GCAG/GT). The third intron within the
expression cassette of crEpo was integrated directly down-
stream of the stop codon, and thus its correct splicing could
not be tested with the methods used. However, the positioning
after the stop facilitated the construction of the expression
vector, which could serve as a general platform for the
expression of transgenes of a similar size: as intron 1 and 3
were integrated within the 5⬘ and 3⬘ untranslated region,
this part of the expression cassette remains constant and
only the sequence of intron 2 has to be placed into the
coding region of a desired transgene. For transgenes with
longer ORFs (>1 kb), the incorporation of multiple introns
is conceivable.
The analysis of the exported erythropoietin protein by
immunoblotting showed an increased molecular weight: the
calculated signal for an unmodiWed protein is 19 kDa,
instead a single band was visible at 33 kDa, which is close
to the size of the physiological human protein [34 kDa,
Jelkmann 1992] and of recombinant erythropoietin
expressed in tobacco cells [30 kDa, Matsumoto et al. 1995]
and plants [32.5 kDa, (Cheon et al. 2004)]. For the func-
tionality of many extracellular proteins including erythro-
poietin, a correct glycosylation is essential. Although for
Chlamydomonas the O-glycosylation at hydroxyproline
residues of cell-wall proteins is well characterized, only
little is known about O-glycosylation at serine/threonine
or N-glycosylation (Bollig et al. 2007). Since there are
substantial diVerences in the O- and N-glycosylation patterns
of recombinant proteins in plant and animal cells (Saint-
Jore-Dupas et al. 2007), a detailed analysis of the secreted
erythropoietin, e.g. by mass spectroscopy is indispensable.
Accordingly, the proper folding and the correct formation
of the two disulWde bonds essential for the biological func-
tion of erythropoietin have to be examined in the next steps.
The attachment of protein tags (hexa-histidine and strepII)
to Renilla-luciferase and erythropoietin for isolation proved
to be a simple and fast way to accumulate recombinant
proteins from the culture medium of the algae and provides
a method to concentrate protein to analyse its post-trans-
criptional modiWcation and physiological activity. How-
ever, in this study even expression yields from transgenes
containing multiple introns were too low to collect enough
protein for further analysis starting from a 1 l culture (with
approx. 100 g/l recombinant erythropoietin in the super-
natant or 0.03% of the dry weight, only roughly estimated
using the detection limit of the commercial anti-erythropoi-
etin antibody). Matsumoto et al. (1995) expressed recombi-
nant human erythropoietin in tobacco cells and reported a
yield of 0.0026% of the total extractable protein. Erythro-
poietin expression in leafs of whole tobacco and Arabidop-
sis plants was more pronounced, but caused retarded
vegetative growth and male sterility (Cheon et al. 2004).
No such changes in morphology or growth rate were found
for Chlamydomonas strains expressing erythropoietin (not
shown).
The results of this study emphasized, that Chlamydo-
monas reinhardtii should be considered as an alternative
organism for the expression of extracellular recombinant
proteins in the future. Although expression levels have to
be enhanced further to create a platform of commercial
interest and to fully proWt from the low costs and the high
cell densities already established for the cultivation of this
alga (Walter et al. 2003), the new data obtained from the
analysis of puriWed recombinant proteins will reveal their
post-translational modiWcations and will be equally crucial
for future biotechnological applications of Chlamydo-
monas.
Acknowledgments We wish to thank Regina Groebner-Fererra for
perfect technical assistance and Amparo Hausherr for the puriWcation
of luciferase from E. coli. This work has been Wnancially supported in
parts by the Bavarian Ministry of Economic AVairs, Infrastructure,
Transport and Technology, the Bavarian Ministry of Environment,
Public Health and Consumer Protection and the German Federal
Ministry of Education and Research including an ExistSeed grant and
a BioChance grant together with the Entelechon GmbH.
References
Bentley DL (2005) Rules of engagement: co-transcriptional recruit-
ment of pre-mRNA processing factors. Curr Opin Cell Biol
17:251–256
Berthold P, Schmitt R, Mages W (2002) An engineered Streptomyces
hygroscopicus aph 7⬘⬘ gene mediates dominant resistance against
hygromycin B in Chlamydomonas reinhardtii. Protist 153:401–412
Bollig K, Lamshoft M, Schweimer K, Marner FJ, Budzikiewicz H,
WaVenschmidt S (2007) Structural analysis of linear hydroxypro-
line-bound O-glycans of Chlamydomonas reinhardtii—conserva-
tion of the inner core in Chlamydomonas and land plants.
Carbohydr Res 342:2557–2566
Chapman BS, Thayer RM, Vincent KA, Haigwood NL (1991) EVect
of intron A from human cytomegalovirus (Towne) immediate-early
gene on heterologous expression in mammalian cells. Nucleic
Acids Res 19:3979–3986
Planta (2009) 229:873–883 883
123
Cheetham JC, Smith DM, Aoki KH, Stevenson JL, HoeVel TJ, Syed
RS, Egrie J, Harvey TS (1998) NMR structure of human erythro-
poietin and a comparison with its receptor bound conformation.
Nat Struct Biol 5:861–866
Cheon BY, Kim HJ, Oh KH, Bahn SC, Ahn JH, Choi JW, Ok SH, Bae
JM, Shin JS (2004) Overexpression of human erythropoietin
(EPO) aVects plant morphologies: retarded vegetative growth in
tobacco and male sterility in tobacco and Arabidopsis. Transgenic
Res 13:541–549
Davies JP, Weeks DP, Grossman AR (1992) Expression of the arylsul-
fatase gene from the beta 2-tubulin promoter in Chlamydomonas
reinhardtii. Nucleic Acids Res 20:2959–2965
de Hostos EL, Togasaki RK, Grossman A (1988) PuriWcation and
biosynthesis of a derepressible periplasmic arylsulfatase from
Chlamydomonas reinhardtii. J Cell Biol 106:29–37
de Hostos EL, Schilling J, Grossman AR (1989) Structure and expres-
sion of the gene encoding the periplasmic arylsulfatase of Chla-
mydomonas reinhardtii. Mol Gen Genet 218:229–239
Fischer N, Rochaix JD (2001) The Xanking regions of PsaD drive eY-
cient gene expression in the nucleus of the green alga Chlamydo-
monas reinhardtii. Mol Genet Genomics 265:888–894
Franklin SE, MayWeld SP (2004) Prospects for molecular farming in
the green alga Chlamydomonas. Curr Opin Plant Biol 7:159–165
Franklin SE, MayWeld SP (2005) Recent developments in the produc-
tion of human therapeutic proteins in eukaryotic algae. Expert
Opin Biol Ther 5:225–235
Fuhrmann M (2004) Production of antigens in Chlamydomonas
reinhardtii: green microalgae as a novel source of recombinant
proteins. Methods Mol Med 94:191–195
Fuhrmann M, Oertel W, Hegemann P (1999) A synthetic gene coding
for the green Xuorescent protein (GFP) is a versatile reporter in
Chlamydomonas reinhardtii. Plant J 19:353–361
Fuhrmann M, Hausherr A, Ferbitz L, Schodl T, Heitzer M, Hegemann
P (2004) Monitoring dynamic expression of nuclear genes in
Chlamydomonas reinhardtii by using a synthetic luciferase
reporter gene. Plant Mol Biol 55:869–881
Fuhrmann M, Oertel W, Berthold P, Hegemann P (2005) Removal of
mismatched bases from synthetic genes by enzymatic mismatch
cleavage. Nucleic Acids Res 33:e58
Goldschmidt-Clermont M, Rahire M (1986) Sequence, evolution and
diVerential expression of the two genes encoding variant small
subunits of ribulose bisphosphate carboxylase/oxygenase in
Chlamydomonas reinhardtii. J Mol Biol 191:421–432
Griesbeck C, Kobl I, Heitzer M (2006) Chlamydomonas reinhardtii: a
protein expression system for pharmaceutical and biotechnologi-
cal proteins. Mol Biotechnol 34:213–223
Gruber H, Kirzinger SH, Schmitt R (1996) Expression of the Volvox
gene encoding nitrate reductase: mutation-dependent activation
of cryptic splice sites and intron-enhanced gene expression from
a cDNA. Plant Mol Biol 31:1–12
Harris EH (1989) The Chlamydomonas sourcebook: a comprehensive
guide to biology and laboratory use. Academic Press, San Diego
Heifetz PB (2000) Genetic engineering of the chloroplast. Biochimie
82:655–666
Heitzer M, Zschoernig B (2007) Construction of modular tandem
expression vectors for the green alga Chlamydomonas reinhardtii
using the Cre/lox-system. Biotechniques 43:324, 326, 328
(passim)
Jacobs K, Shoemaker C, Rudersdorf R, Neill SD, Kaufman RJ, Mufson
A, Seehra J, Jones SS, Hewick R, Fritsch EF et al (1985) Isolation
and characterization of genomic and cDNA clones of human
erythropoietin. Nature 313:806–810
Janknecht R, de MartynoV G, Lou J, Hipskind RA, Nordheim A,
Stunnenberg HG (1991) Rapid and eYcient puriWcation of native
histidine-tagged protein expressed by recombinant vaccinia virus.
Proc Natl Acad Sci USA 88:8972–8976
Jelkmann W (1992) Erythropoietin: structure, control of production,
and function. Physiol Rev 72:449–489
Kindle KL (1990) High-frequency nuclear transformation of Chla-
mydomonas reinhardtii. Proc Natl Acad Sci USA 87:1228–1232
Kovar JL, Zhang J, Funke RP, Weeks DP (2002) Molecular analysis of
the acetolactate synthase gene of Chlamydomonas reinhardtii and
development of a genetically engineered gene as a dominant
selectable marker for genetic transformation. Plant J 29:109–117
Koziel MG, Carozzi NB, Desai N (1996) Optimizing expression of
transgenes with an emphasis on post-transcriptional events. Plant
Mol Biol 32:393–405
Lareau LF, Green RE, Bhatnagar RS, Brenner SE (2004) The evolving
roles of alternative splicing. Curr Opin Struct Biol 14:273–282
Leon-Banares R, Gonzalez-Ballester D, Galvan A, Fernandez E (2004)
Transgenic microalgae as green cell-factories. Trends Biotechnol
22:45–52
Liu M, Grigoriev A (2004) Protein domains correlate strongly with
exons in multiple eukaryotic genomes—evidence of exon shuZing?
Trends Genet 20:399–403
Liu K, Sandgren EP, Palmiter RD, Stein A (1995) Rat growth hormone
gene introns stimulate nucleosome alignment in vitro and in trans-
genic mice. Proc Natl Acad Sci USA 92:7724–7728
Lumbreras V, Stevens DR, Purton S (1998) EYcient foreign gene
expression in Chlamydomonas reinhardtii mediated by an
endogenous intron. Plant J 14:441–447
Matsumoto S, Ikura K, Ueda M, Sasaki R (1995) Characterization of a
human glycoprotein (erythropoietin) produced in cultured tobacco
cells. Plant Mol Biol 27:1163–1172
Mattick JS (1994) Introns: evolution and function. Curr Opin Genet
Dev 4:823–831
MayWeld SP, Franklin SE (2005) Expression of human antibodies in
eukaryotic micro-algae. Vaccine 23:1828–1832
MayWeld SP, Franklin SE, Lerner RA (2003) Expression and assembly
of a fully active antibody in algae. Proc Natl Acad Sci USA
100:438–442
MayWeld SP, Manuell AL, Chen S, Wu J, Tran M, Siefker D, Muto M,
Marin-Navarro J (2007) Chlamydomonas reinhardtii chloroplasts
as protein factories. Curr Opin Biotechnol 18:126–133
Melis A (2007) Photosynthetic H2 metabolism in Chlamydomonas
reinhardtii (unicellular green algae). Planta 226:1075–1086
Palmiter RD, Sandgren EP, Avarbock MR, Allen DD, Brinster RL
(1991) Heterologous introns can enhance expression of trans-
genes in mice. Proc Natl Acad Sci USA 88:478–482
Rochaix JD (2002) The three genomes of Chlamydomonas. Photosynth
Res 73:285–293
Saint-Jore-Dupas C, Faye L, Gomord V (2007) From planta to pharma
with glycosylation in the toolbox. Trends Biotechnol 25:317–323
Sayre RT, Wagner RE, Siripornadulsil S, Farias C (2001) Transgenic
algae for delivering antigens to an animal. US patent number
7,410,637
Schroda M (2006) RNA silencing in Chlamydomonas: mechanisms
and tools. Curr Genet 49:69–84
Schroda M, Beck CF, Vallon O (2002) Sequence elements within an
HSP70 promoter counteract transcriptional transgene silencing in
Chlamydomonas. Plant J 31:445–455
Voss S, Skerra A (1997) Mutagenesis of a Xexible loop in streptavidin
leads to higher aYnity for the Strep-tag II peptide and improved
performance in recombinant protein puriWcation. Protein Eng
10:975–982
Walter C, Steinau T, Gerbsch N, Buchholz R (2003) Monoseptic
cultivation of phototrophic microorganisms–development and
scale-up of a photobioreactor system with thermal sterilization.
Biomol Eng 20:261–271
Wessel D, Flugge UI (1984) A method for the quantitative recovery of
protein in dilute solution in the presence of detergents and lipids.
Anal Biochem 138:141–143
