Identification of ABC Transporter Genes in Gonad Tissue of Two Mediterranean Sea Urchin Species: Black, Arbacia lixula L., and Rocky, Paracentrotus lividus L.

Abstract

Multixenobiotic resistance (MXR) represents an important cellular detoxification mechanism in aquatic organisms as it provides them robustness toward natural and man-made contaminants. Several ABC transporters have major roles in the MXR phenotype - P-gp/ABCB1, MRP1-3/ABCC1-3 and BCRP/ABCG2. In this study, we identified the presence of ABC transporters involved in the MXR mechanism of Arbacia lixula and Paracentrotus lividus. AlABCB1/P-gp, AlABCC3/MRP3, AlABCC9/SUR-like and AlABCG-like transcripts were identified in A. lixula; and PlABCC1/P-gp, PlABCC3/MRP3, PlABCC5/MRP5, and PlABCC9/SUR-like transcripts in P. lividus. For each of the new partial sequences, we performed detailed phylogenetic and identity analysis as a first step toward full characterization and understanding of the ecotoxicological role of these ABC transporters.

Full text

1 23
Bulletin of Environmental
Contamination and Toxicology
ISSN 0007-4861
Volume 91
Number 4
Bull Environ Contam Toxicol (2013)
91:415-419
DOI 10.1007/s00128-013-1021-8
Identification of ABC Transporter Genes in
Gonad Tissue of Two Mediterranean Sea
Urchin Species: Black, Arbacia lixula L.,
and Rocky, Paracentrotus lividus L.
Ivana Bošnjak, Roko Zaja, Roberta
Sauerborn Klobučar, Lidija Šver, Jasna
Franekić & Tvrtko Smital

1 23
Your article is protected by copyright and all
rights are held exclusively by Springer Science
+Business Media New York. This e-offprint is
for personal use only and shall not be self-
archived in electronic repositories. If you wish
to self-archive your article, please use the
accepted manuscript version for posting on
your own website. You may further deposit
the accepted manuscript version in any
repository, provided it is only made publicly
available 12 months after official publication
or later and provided acknowledgement is
given to the original source of publication
and a link is inserted to the published article
on Springer's website. The link must be
accompanied by the following text: "The final
publication is available at link.springer.com”.

Identification of ABC Transporter Genes in Gonad Tissue of Two
Mediterranean Sea Urchin Species: Black, Arbacia lixula L.,
and Rocky, Paracentrotus lividus L.
Ivana Bos
ˇnjak •Roko Zaja •Roberta Sauerborn Klob-
uc
ˇar •Lidija S
ˇver •Jasna Franekic
´•
Tvrtko Smital
Received: 6 March 2013 / Accepted: 24 May 2013 / Published online: 7 June 2013
ÓSpringer Science+Business Media New York 2013
Abstract Multixenobiotic resistance (MXR) represents an
important cellular detoxification mechanism in aquatic
organisms as it provides them robustness toward natural
and man-made contaminants. Several ABC transporters
have major roles in the MXR phenotype – P-gp/ABCB1,
MRP1–3/ABCC1–3 and BCRP/ABCG2. In this study, we
identified the presence of ABC transporters involved in
the MXR mechanism of Arbacia lixula and Paracentrotus
lividus.AlABCB1/P-gp, AlABCC3/MRP3, AlABCC9/
SUR-like and AlABCG-like transcripts were identified in
A. lixula; and PlABCC1/P-gp, PlABCC3/MRP3, PlABCC5/
MRP5, and PlABCC9/SUR-like transcripts in P. lividus. For
each of the new partial sequences, we performed detailed
phylogenetic and identity analysis as a first step toward full
characterization and understanding of the ecotoxicological
role of these ABC transporters.
Keywords ABC transporters MXR mechanism 
Arbacia lixula Paracentrotus lividus
Organisms are constantly exposed to a vast variety of sub-
stances present in their surrounding aquatic environment,
including natural and anthropogenic contaminants. In order
to survive, aquatic organisms use a highly efficient cellular
protection system mediated by complementary activity of
the efflux transport proteins and detoxification enzymes
(Goldstone et al. 2006; Epel et al. 2008). Efflux transporters
are members of the large ATP binding cassette (ABC)
transporter superfamily and have the ability to actively efflux
various endogenous and exogenous substrates, including
xenobiotics, across cell membranes against their concen-
tration gradients (Szaka
´cs et al. 2008). Numerous studies
indicated that similar ABC transporters represent integral
parts of the cellular detoxification machinery for aquatic
organisms living in contaminated environments, mediating
the so-called multixenobiotic resistance (MXR) mechanism
(Kurelec 1992; Bard 2000). Key ABC efflux transport-
ers involved in the MXR mechanism are: P-glycoprotein
(MDR1/ABCB1/P-gp); multidrug resistance-associated pro-
teins 1–3 (MRP1–3/ABCC1–3); and the breast cancer resis-
tance protein (BCRP/ABCG2) (Szaka
´cs et al. 2008). The
MXR mechanism has also an important role in resistance
of very sensitive early stage embryos (Hamdoun and Epel
2007).
Sea urchins represent an ecologically relevant animal
group and a valuable model frequently used for assessing
toxicity of contaminants (Cesar et al. 2004; Bos
ˇnjak et al.
2009). A fully sequenced genome of Strongylocentrotus
purpuratus is available, and characterization of chemical
defense genes and related activities were reported for this
species (Goldstone et al. 2006; Sea Urchin Genome
Electronic supplementary material The online version of this
article (doi:10.1007/s00128-013-1021-8) contains supplementary
material, which is available to authorized users.
I. Bos
ˇnjak (&)L. S
ˇver J. Franekic
´
Laboratory for Biology and Microbial Genetics, Department of
Biochemical Engineering, Faculty of Food Technology and
Biotechnology, University of Zagreb, Pierottijeva 6,
10000 Zagreb, Croatia
e-mail: ibosnjak@pbf.hr
R. Zaja T. Smital
Laboratory for Molecular Ecotoxicology, Division for Marine
and Environmental Research, Rud
¯er Bos
ˇkovic
´Institute,
Bijenic
ˇka cesta 54, 10000 Zagreb, Croatia
R. S. Klobuc
ˇar
Laboratory for Ichtyopathology - biological materials,
Division of Materials Chemistry, Rud
¯er Bos
ˇkovic
´Institute,
Bijenic
ˇka cesta 54, 10000 Zagreb, Croatia
123
Bull Environ Contam Toxicol (2013) 91:415–419
DOI 10.1007/s00128-013-1021-8
Author's personal copy

Sequencing Consortium 2006). Among defense genes, there
are 48 annotated ABC transporter, including orthologues,
involved in the MXR mechanism – P-gp (ABCB1), MRP
(ABCC), BCRP-like (ABCG) efflux transporters, and also
the sulfonylurea receptor (ABCC9/SUR) from the ABCC
subfamily (Goldstone et al. 2006). In humans, SUR receptor
is responsible for mediating closure of the ATP-sensitive
potassium channel, and thereby stimulates insulin release in
the b-cell plasma membrane (Panten et al. 1996). But in S.
purpuratus genome, the SUR receptor is reported to be also
involved in the MXR mechanism (Goldstone et al. 2006).
The main goal of this study was the identification of various
ABC transporters in two Mediterranean sea urchin species:
black, Arbacia lixula and rocky, Paracentrotus lividus.
Targeted tissue for detection of ABC transporter mRNA
transcripts was gonad tissue for locating ABC transporter
proteins that are present in egg cells, which would contribute
to the MXR mechanism mediated protection of future
embryos. The main aim of the study was identification of all
possible ABC transporters involved in MXR activity.
Materials and Methods
Adult sea urchins – A. lixula and P. lividus, were collected in
a coastal region (1–5 m depth) at two locations: Crikvenica
harbor (Crikvenica, Croatia, 45°1001100N14°4104400E)
located at the northern part and Marijan Peninsula (Split,
Croatia, 43°3001300N16°2403000E) located at the southern
part of the Adriatic coast. Both chosen sampling locations are
in areas of excellent sea water quality. Adult animals were
transported in tanks to laboratory where they were either
dissected immediately for collection of gonad tissue sam-
ples, or kept for 1–3 days in flow-through thanks (18 ±2°C)
until dissection. Only mature female gonad tissue samples
were collected. Samples were obtained in the spring (April)
when both species are at the peak of the reproduction cycle.
Primer pairs (Table 1) were designed based on the
highly conserved regions of Homo sapiens and S. purpu-
ratus Abcb1,Abcc1,Abcc3,Abcc5,Abcc9 and Abcg2 gene
sequences. All primers were obtained from Sigma to
Aldrich (St. Louis, MO, USA).
Total RNA was isolated from *30 mg of gonad tissue
pooled from 5 to 8 A. lixula and P. lividus females, respec-
tively. RNA was immediately placed into RNA later Sta-
bilization Reagent (Applied Biosystems, Foster City, CA,
USA) and kept at 4°C until RNA extraction was performed
with the RNeasy mini kit (Qiagen, Hilden, Germany)
according to the manufacturer’s instructions. cDNA was
synthesized from 4 lg of RNA using H Minus M-MulV
reverse transcriptase (Fermentas, Burlington, Canada).
ABC transporter orthologs were amplified in the PCR
reactions using either a Biometra thermal personal cycler
(Go
¨ttingen, Germany) or Mastercycler Personal (Hamburg,
Germany). PCR was performed for 35 cycles at 94°C (30 s),
55°C (30 s) and 72°C (2 min) or in a touchdown mode (from
60 to 45°C). Aliquots of each reaction were resolved by
electrophoresis on 1.2 % agarose gel in tris–acetate-EDTA
(TAE) buffer. The gels were stained with ethidium bromide,
and PCR products visualized under UV light. The expected
products were gel purified (MiniElute PCR Purification Kit
(Qiagen, Germany), cloned into the pGEM-T vector (Pro-
mega, Madison, WI, USA) and sequenced using an ABI
PRISM
Ò
3100-Avant Genetic Analyzer (Rud
¯er Bos
ˇkovic
´
Institute DNA Service, Zagreb, Croatia) using standard cycle
sequencing protocols.
Obtained partial cDNA sequences were analyzed using
the National Center for Biotechnology Information (NCBI,
Bethesda, MD, USA) basic alignment search tool (tblastx
and protein blast). Multiple sequence alignments and
determinations of identity rates between amino acid
sequences of ABC transporters from different species were
performed using BioEdit software and Clustal X version
2.0 implemented in the MEGA 5 software, with default
parameters. MEGA 5 software was also used to perform
phylogenetic analysis (Neighbor-Joining (NJ) analysis).
Reliabilities of phylogenetic relationships were evaluated
using a non-parametric bootstrap analysis with 1,000 rep-
licates for NJ analysis. Bootstrap values exceeding 70 were
considered well supported.
Results and Discussion
Both A. lixula and P. lividus are frequently used as model
organisms in ecotoxicological studies (Cesar et al. 2004;
Table 1 Primer sequences used in PCR to detect the primary
ABCB1, ABCC1, ABCC3, ABCC5, ABCC9 and ABCG gene
sequences in the gonad tissue of A. lixula and P. lividus
ABC
subfamily
Primer
name (ID)
Primer sequence (50–30)
ABCB1 259 F: ATGCCATTGCCTTCTGGTATGG
260 R: CTGCTGCCGACCAGAGCCAG
ABCC1 263 F: CTCCGTTTCTGAGATCGGCT
264 R: AAGTCTCTTCAGCTGACGGGA
ABCC3 017-C3 F: GCACCATCAGAGCATATCAAT
018-C3 R: CGCTGACCAACACTGAGGTT
ABCC5 275 F: TTCTCWMRWGAYATKGATGAA
276 R: CCHACRATBCCDAYYTTCT
ABCC9 019-C9 F: ATGAGATTCTTTGACACCAC
020-C9 R: GAAGAGAGAAAGTGTAAGCGA
ABCG2 266 F: TTGAGTCCAGGCTCAGACCA
267 R: GTGCTATGATGGGCGAGATG
Fforward primer sequence, Rreverse primer sequence
416 Bull Environ Contam Toxicol (2013) 91:415–419
123
Author's personal copy

Arslan and Parlak 2007). Their rapid development and
transparent embryo and larval stages enable monitoring of
any morphological abnormalities and/or the developmental
arrest caused by exposure to toxic compounds. A low spec-
ificity for substrates, a typical feature of ABC efflux trans-
porters as key components of the MXR mechanism, certainly
represents an enormous advantage for aquatic organisms
(Epel et al. 2008). However, in highly complex mixtures of
pollutants, certain compounds may act as inhibitors of ABC
transporters and cause the chemosensitization and/or over-
saturation of ABC transporter efflux (Smital et al. 2004;Epel
et al. 2008). In an attempt to develop ecologically relevant
and technically feasible high throughput screening methods
for identification of potential environmental MXR inhibitors
(chemosensitizers), sea urchin embryos represent a promis-
ing model system. An embryotoxicity test utilizing the cell
cycle arrest as an end-point caused by the enhanced accu-
mulation of inorganic compounds (e.g. mercuric chloride,
tributyl tin) due to the inhibition of the ABCC/MRP-like
transport has already been established for both A. lixula and
P. lividus embryos (Bos
ˇnjak et al. 2011).
ABC transporters are present but not active in sea urchin
eggs, and their activation during fertilization is needed for
protection during embryonic development (Hamdoun et al.
2004; Shipp and Hamdoun 2012). Therefore, by sampling
only mature female gonad tissue, we focused on identifi-
cation of ABC transporters present in egg cells. Specific
pairs of primers (Table 1) generated fragments of desired
ABC transporter amplicons. Cloning, sequencing and
finally identification resulted with 8 partial ABC trans-
porter sequences. Respective translated amino acid
sequences of these partial PCR products showed a high
degree of identity with P-gp, MRP3, MRP5, SUR-like and
ABCG2/BCRP-like proteins, respectively, from various
other organisms, and this homology was confirmed with
NCBI Blast2 protein database query (data not shown). All
of the obtained sequence data were registered at the Gen-
Bank (Table 2).
Relationships of eight identified A. lixula and P. lividus
partial ABC transporter sequences with ABC transporter
orthologs from human, mouse, chicken, fish, frog, fruit fly,
mussel and purple sea urchin species are shown in the
presented phylogenetic trees (Fig. 1a–c). GenBank acces-
sion numbers of sequences of all compared orthologs are
shown in Table S1 I–III and all of the obtained identities
are shown in Fig. S1a–c. Identity of the PlABCB1
sequence is 77 % congruent with the egg permeability
glycoprotein from S. purpuratus (Fig. S1a) – the main
protein from the ABCB subfamily involved in efflux of a
broad range of hydrophobic xenobiotics (Hamdoun et al.
2004). Identity of the AlABCB1 sequence is 41 % con-
gruent with the ABCB4 from S. purpuratus and 21 %–
27 % with ABCB1, ABCB4 and ABCB11 proteins from
various orthologs, respectively (Fig. S1a). The ABCB4
member is also similar to mammalian P-gp/ABCB1
member (Szaka
´cs et al. 2008). The phylogenetic tree shows
clustering of partial AlABCB-like and PlABCB1 with
respective ABCB1 and ABCB4 orthologs from S. purpu-
ratus and with ABCB1 orthologs from mussels (Fig. 1a).
The identified AlABCC3 sequence is 85 % identical with
partial PlABCC3 sequence, and 54 % congruent with the
ABCC3A protein from S. purpuratus (Fig. S1b). Identities
of PlABCC3 sequence are 57 % congruent with ABCC3A
protein from S. purpuratus. Overall, both of these
sequences were more identical with MRP proteins than
with SUR proteins from various orthologs (Fig. S1b). In
mammalian species, MRP3 is involved in the efflux of
organic and inorganic anions that are direct products of
phase I and II metabolism and present in the form of glu-
tathione, glucuronic or sulphate water soluble conjugates
(Cole and Deeley 2006). Therefore, this transporter most
likely has an important role in the MXR mechanism in sea
urchins.
Identities of the AlABCC9 sequence are 60 % congruent
with the partial PlABCC9 sequence and 32 % with the
ABCC9 protein from S. purpuratus. Identities of the
PlABCC9 sequence are 47 % congruent with the ABCC9
protein from S. purpuratus. Overall, both of these
sequences showed more identity with SUR proteins than
with MRP proteins from various orthologs (Fig. S1b). In S.
purpuratus, a high expression of ABCC9 mRNA was
determined during the first 58 h of development (Shipp and
Hamdoun 2012). It is more likely that this transporter acts
as a part of the MRP-like rather than SUR-like efflux
activity in sea urchins (Goldstone et al. 2006). The partial
PlABCC5 sequence was the shortest of all, and was 16 %
congruent with the ABCC5 protein from H. sapiens and
9 %–17 % with SUR and MRP proteins from various
orthologs (Fig. S1b). The phylogenetic tree shows clus-
tering of partial AlABCC3, PlABCC3 and PlABCC5
sequences within the MRP protein group, and partial
AlABCC9 and PlABCC9 sequences with the SUR protein
group (Fig. 1b). The last identified ABC transporter was an
ABCG/BCRP-like ortholog obtained from A. lixula gonad
tissue. Identities of the AlABCG-like sequence are 56 %
congruent with ABCG11 from S. purpuratus and 28 %–
34 % with other protein members of the ABCG subfamily
(Fig. S1c). The phylogenetic tree shows clustering of the
partial AlABCG-like protein with ABCG11 ortholog from
S. purpuratus (Fig. 1c). The identified ortholog has higher
similarity (56 %) with the ABCG11 from S. purpuratus
than with the ABCG2 (29 %) member.
Although the same primer pairs were used in PCR
reactions for detection of ABC transporters in both sea
urchin species, the ABCG-like partial sequence was
detected only in A. lixula, and the ABCC5-like partial
Bull Environ Contam Toxicol (2013) 91:415–419 417
123
Author's personal copy

Table 2 Summary of the obtained ABC transporter gene sequences from A. lixula and P. lividus
ABC
subfamily
Sea urchin
species
Gene Text abbreviation
code
Length of cloned fragment GenBank
accession no.
Nucleotide
(bp)
Amino acid
(a.a.)
ABCB A. lixula ABCB1/P-gp AlABCB1 528 176 HM134891
P. lividus ABCB1/P-gp PlABCB1 449 149 HM134889
ABCC A. lixula ABCC3/MRP3 AlABCC3 689 229 HM439620
A. lixula ABCC9/SUR-like AlABCC9 620 206 HM439621
P. lividus ABCC3/MRP3 PlABCC3 666 222 HM439622
P. lividus ABCC5/MRP5-like PlABCC5 508 169 HM134890
P. lividus ABCC9/SUR-like PlABCC9 703 234 HM439623
ABCG A. lixula ABCG-like AlABCG 749 249 HM134892
Fig. 1 Phylogenetic tree based on multiple alignments (Clustal X) of
different ABC transporter subtype sequences from various vertebrates
and invertebrates. aABCB, bABCC, cABCG. Tree was inferred by
the NJ method implemented in MEGA software. Bootstrap support
values for the NJ tree are shown at the nodes (out of 1,000 replicates).
The accession numbers retrieved in this study for ABCB and ABCC
transporters are listed in Table S1 I–III
418 Bull Environ Contam Toxicol (2013) 91:415–419
123
Author's personal copy

sequence was detected only in P. lividus. Some ABC efflux
transporters could be identified only in one species, pos-
sibly because of some differences in expression of ABC
transporters in otherwise closely related sea urchin species.
The ABCC1 sequence was not detected in gonad tissue of
either sea urchin species which could also indicate that this
transporter is not expressed. Further research is needed in
order to clarify these results.
The presented identification of ABCB1, ABCC3, ABCC9
and ABCG-like partial sequences in A. lixula and ABCB1,
ABCC3, ABCC5 and ABCC9 partial sequences in P. lividus
represents the first and necessary step in characterization of
ABC transporters in these two urchin species. There is no
doubt, however, that a full understanding of the role and
ecological relevance of ABC efflux transporters in these
species can be obtained only by identification and sub-
sequent in-depth molecular characterization of individual
proteins. Therefore, we are directing our research efforts
toward completion of the characterization of all proteins
potentially involved in the MXR defense in Mediterranean
sea urchins.
Acknowledgments This work has been supported by the Ministry
of Science, Education and Sports of the Republic of Croatia, Project
Nos. 058-0582261-2246 and 098-0982934-2745.
References
Arslan O, Parlak H (2007) Embryotoxic effects of nonylphenol and
octylphenol in sea urchin Arbacia lixula. Ecotoxicology 16:439–444
Bard SM (2000) Multixenobiotic resistance as a cellular defense
mechanism in aquatic organisms. Aquat Toxicol 48:357–389
Bos
ˇnjak I, Uhlinger KR, Heim W, Smital T, Franekic
´C
ˇolic
´J, Coale
K, Epel D, Hamdoun A (2009) Multidrug efflux transporters
limit accumulation of inorganic, but not organic, mercury in sea
urchin embryos. Environ Sci Technol 43:8374–8380
Bos
ˇnjak I, S
ˇegvic
´T, Smital T, Franekic
´J, Mladineo I (2011) Sea
urchin embryotoxicity test for environmental contaminants –
potential role of the MRP proteins. Water Air Soil Pollut 217:
627–636
Cesar A, Marı
´n A, Marı
´n-Guirao L, Vita R (2004) Amphipod and sea
urchin tests to assess the toxicity of Mediterranean sediments:
the case of Portma
´n Bay. Sci Mar 68:205–213
Cole SP, Deeley RG (2006) Transport of glutathione and glutathione
conjugates by MRP1. Trends Pharmacol Sci 27:438–446
Epel D, Luckenbach T, Stevenson CN, MacManus-Spencer LA,
Hamdoun A, Smital T (2008) Efflux transporters: newly
appreciated roles in protection against pollutants. Environ Sci
Technol 42:3914–3920
Goldstone JV, Hamdoun A, Cole BJ, Howard-Ashby M, Nebert DW,
Scally M, Dean M, Epel D, Hahn ME, Stegeman JJ (2006) The
chemical defensome: environmental sensing and response genes in
the Strongylocentrotus purpuratus genome. Dev Biol 300:366–384
Hamdoun A, Epel D (2007) Embryo stability and vulnerability in an
always changing world. Proc Natl Acad Sci USA 104:1745–1750
Hamdoun AM, Cherr GN, Roepke TA, Epel D (2004) Activation of
multidrug efflux transporter activity at fertilization in sea urchin
embryos (Strongylocentrotus purpuratus). Dev Biol 276:452–462
Kurelec B (1992) The multixenobiotic resistance mechanism in
aquatic organisms. Crit Rev Toxicol 22:23–43
Panten U, Schwanstecher M, Schwanstecher C (1996) Sulfonylurea
receptors and mechanism of sulfonylurea action. Exp Clin
Endocrinol Diabetes 104:1–9
Sea Urchin Genome Sequencing Consortium (2006) The genome of the
sea urchin Strongylocentrotus purpuratus. Science 314:941–952
Shipp LE, Hamdoun A (2012) ATP-binding cassette (ABC) trans-
porter expression and localization in sea urchin development.
Dev Dyn 241:1111–1124
Smital T, Luckenbach T, Sauerborn R, Hamdoun AM, Vega RL, Epel
D (2004) Emerging contaminants – pesticides, PPCPs, microbial
degradation products and natural substances as inhibitors of
multixenobiotic defense in aquatic organisms. Mutat Res 552:
101–117
Szaka
´cs G, Va
´radi A, O
¨zvegy-Laczka C, Sarkadi B (2008) The role of ABC
transporters in drug absorption, distribution, metabolism, excretion
and toxicity (ADME–Tox). Drug Discov Today 13:379–393
Bull Environ Contam Toxicol (2013) 91:415–419 419
123
Author's personal copy