Content uploaded by Wenqing Huang
Author content
All content in this area was uploaded by Wenqing Huang on Dec 16, 2013
Content may be subject to copyright.
R E S E A R C H Open Access
P268S in NOD2 associates with susceptibility to
Parkinson’s disease in Chinese population
Qilin Ma
1†
, Xingkai An
1†
, Zhiming Li
2†
, Huanjing Zhang
2
, Wenqing Huang
2
, Liangliang Cai
2
, Peng Hu
2
,
Qing Lin
1,2*
and Chi-Meng Tzeng
2*
Abstract
Background: The cause of almost all cases of Parkinson’s disease (PD) remains unknown. Recent years have seen
an explosion in the rate of discovery of genetic defects linked to PD. Different racial and geographical populations
may have different distributions of genetic variants.
Methods: In the current study, we screened the following genetic variants, including some rare mutations and
single nucleotide polymorphisms (SNPs), in a pedigree and cases-controls. To best of our knowledge, we first
screened these variants known to be associated with neurodegeneration disease, E46K (rs104893875) in SNCA,
A1442P in LRRK2, IVS9 in PARK2, A350V in SLC41A1, P268S (rs2066842), R702W (rs2066844), G908R (rs2066845), 1007fs
(rs2066847) in NOD2 and G2385R (rs34778348) in LRRK2 from southern China population. Genotyping was
performed by jointly using primers overlapping polymerase chain reaction (PCR) site-directed mutagenesis,
restriction fragment length polymorphism (RFLP), and capillary electrophoresis (CE).
Results: We didn’t discover above 9 variants in the family members of the pedigree. Furthermore, of 237 patients
with sporadic Parkinson’s disease and 190 controls, no heterozygosity or homozygosity were found from E46K,
A1442P, A350V, R702W, G908R, or 1007fs but heterozygosity onto G2385R, IVS9, and P268S. No significant difference
between cases and controls was found in both allele frequency (P= 0.572) and genotype frequency (P= 0.348) of
IVS9. However, significant differences in genotype frequency (P= 0.009) of G2385R were consistent with prior
observation. Eight patients with Parkinson’s disease (2 women and 6 men are over the age of 50 years at onset of
PD) carried the P268S heterozygous variation in NOD2. There was no heterozygosity or homozygosity of P268S in
the controls. Genotype frequency of P268S (P= 0.0450) had significant differences.
Conclusions: Our results suggested that the P268S variant in NOD2 might be a risk factor for susceptibility to
sporadic Parkinson’s disease in Chinese populations. It also implied that the inflammatory response may play a role
in PD.
Keywords: Parkinson’s disease, Variants, P268S
Background
Parkinson’s disease (PD) is a complex neurodegenerative
disease caused by a variety of factors. The incidence in the
population over the age of 65 is about 1.8% [1]. The major
clinical features of PD include resting tremor, bradykinesia
and rigidity [2]. The pathological features of PD include pro-
gressive loss of dopaminergic neurons from the substantia
nigra pars compacta and the presence of intercellular Lewy
bodies in surviving neurons [3]. The cause of PD is unclear,
but it is generally considered to be associated with the im-
pairment in degradation of ubiquitin proteasome system
(UPS), mitochondrial dysfunction, and oxidative stress [4-6].
We hypothesize that genetic and environmental factors and
aging together lead to the development of PD. In this study,
we investigated five genes, including SNCA,LRRK2,PA RK2,
SLC41A1,andNOD2, all of which might be involved in the
cytological mechanisms of neurodegeneration disease aiming
to identify genetic variants associated with sporadic PD in
Chinese patients and understand the genetic etiology of PD.
* Correspondence: linqing2005602@aliyun.com;cmtzeng@xmu.edu.cn
†
Equal contributors
1
Department of Neurology, The First Affiliated Hospital of Xiamen University,
Xiamen, Fujian 361003, China
2
School of Pharmaceutical Sciences, Xiamen University, Xiamen, Fujian
361005, China
© 2013 Ma et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative
Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work is properly cited.
Ma et al. Behavioral and Brain Functions 2013, 9:19
http://www.behavioralandbrainfunctions.com/content/9/1/19
The first gene to be identified as associated with PD was
SNCA (PARK1/4 ), which encodes α-synuclein. The major
mutations in SNCA include A53T, A30P, and E46K [7-9].
Although these mutations account for less than 1% of the
cases, patients carrying these mutations have obviously
clinical phenotypes [8]. The A53T and A30P mutations
have been found in Chinese patients with sporadic PD
[10]. However, the association of E46K with sporadic PD
has not been reported in Chinese patients.
LRRK2 (PARK8) encodes a large protein containing
five functional domains, involved in a number of
physiological functions, including substrate binding,
protein phosphorylation and protein interactions [11].
The most common mutation G2019 of LRRK2 in
European populations presents less than 0.1% in Asian
individuals [12]. The G2385R was at a significantly
higher frequency in Asian patients than in controls
[13]. One of the purposes of this study is to re-
validate this variant in southern China. In addition,
Yue Huang found A1442P in pedigrees of the Austra-
lian patients and considered it pathogenic, because it
is conserved across many species and a substitution of
Ala with Pro can change the secondary structure of
proteins [14]. However, A1442P has not been further
confirmed from a large number of cases and other
populations.
The most common cause of young-onset sporadic PD
is autosomal recessive PARK2 mutation [15]. The E3
ubiquitin ligase, parkin, which is encoded by PARK2, can
specifically degrade UPS through tagging ubiquitin on
protein [16]. Exon deletion, insertion, and point muta-
tions in PARK2 have been found in different ethnic
groups [17]. In 2009, Yih-Ru Wu screened 506 Taiwan
sporadic patients with age of onset below 50 years for
PARK2 gene mutation and identified a novel IVS9 inser-
tion (c.1084intron
+
) [18]. The c.1084intron
+
was due to
a G > A polymorphism at position −6 of a cryptic splice
acceptor site within IVS9.
In recent years, genome-wide association studies
(GWAS) have identified a number of new susceptibility
loci associated with PD in different ethnic groups. Of
these loci, the most striking locus is PARK16, which is lo-
cated in 1q23 and contains 5 genes (SLC45A3,NUCKS1,
RAB7L1,SLC41A1, and PM20D1) [19]. SLC41A1 en-
codes a 56 kDa Mg
2+
transporter consisting of 513 amino
acids, it has been proposed that PD might be associated
with lack of Ca
2+
and Mg
2+
in the brain [20]. In 2010,
Arianna Tucci sequenced PARK16 in 182 patients with
PD in the United Kingdom and found A350V in
SLC41A1, but failed to detect it in a large series of
ethnicity-matched controls (n = 483) [19]. To inspect
whether this coding mutations may or may not be the
disease-causing mutation, we aim to screen A350V in
Chinese Han populations.
Several obtained findings suggest that inflammation
also contributes to the pathogenesis of PD [21-23]. It
has been reported that the G174C variant in the IL-6
promoter may influence the risk for developing PD, par-
ticularly regarding early age of onset PD [24]. Recent
studies revealed that NF-κB-mediated inflammation
might also play an important role in the pathogenesis of
PD [25,26]. NOD (nucleotide-binding oligomerization
domain) proteins, i.e. NOD1 (a product of CARD4 gene)
and NOD2 (encoded by NOD2), are intracellular signal-
ing molecules that recognize bacterial components, me-
diate the activation of NF-κB and induce or enhance
apoptosis [27]. In 2007, Monika Bialecka et al. screened
308 Portland patients for 3 variants (R702W, G908R,
and 1007fs) in NOD2 which were associated with
Crohn’s disease (CD) in Europeans. They found that
NOD2 might be associated with susceptibility to PD
[28]. Although inflammatory response has long been
considered as one of the factors for PD development, it
has not yet been reported that R702W, G908R, 1007fs
and P268S in NOD2 is associated with Chinese PD
patients.
In this study, we screened 237 patients with sporadic PD
and 190 controls for the 9 variants, E46K (rs104893875),
G2385R (rs34778348), A1442P, IVS9, A350V, R702W
(rs2066844), G908R (rs2066845), 1007fs (rs2066847) and
P268S (rs2066842), in 5 genes which are possibly found to
be associated with Chinese PD patients, including SNC A,
LRRK2,PARK2,SLC41A1,andNOD2.Thesevariantsin-
cluded both rare mutations (e.g. E46K and A1442P) and
SNPs, so we also screened them in a pedigree with two PD
cases. In this way, we aimed to provide references for the
study of disease-causing or susceptibility gene for PD. In
addition, using the overlap extension polymerase chain reac-
tion (PCR)-based site-directed mutagenesis, we constructed
wild-type and homozygous mutant plasmids for these vari-
ants, which were used as controls to determine variants in
this study.
Material and methods
Study subjects
A total of 237 sporadic patients with PD (94 women and
143 men) and a pedigree with two PD cases were recruited
from Xiamen First Hospital, Fujian Province, China. The
average age of enrollment was 60.3 ± 11.3, ranging from 25
to 83 years. Their average age of onset was 56.4 ± 10.8 years,
rangingfrom23to80years.Ofthesepatients,51(21.5%)
had early-onset PD (EOPD), defined as the age at onset <50
years; 186 (78.5%) cases had late-onset PD (LOPD), with age
of onset ≥50 years. Patients were independently diagnosed
by two neurologists. Diagnostic criteria were taken from the
United Kingdom PD Brain Bank [29]. The severity of the
disease was determined using the Unified Parkinson’sDis-
ease Rating Scale (UPDRS). The control group consisted of
Ma et al. Behavioral and Brain Functions 2013, 9:19 Page 2 of 8
http://www.behavioralandbrainfunctions.com/content/9/1/19
190 individuals (75 women and 115 men), with an average
age of 51.7 ± 9.8 years (ranging from 23 to 80 years). The
cases and controls were matched with respect to age, gen-
der, and place of residence. This study was approved by the
Xiamen First Hospital Ethics Committee. Informed consent
was obtained from all participants.
Genomic DNA extraction
Five milliliters of peripheral blood with ethylene diamine
tetraacetic acid (EDTA) anticoagulant was collected from
each participant. Genomic DNA was extracted using the
MagCore Genomic DNA Whole Blood Kit and HF-16 ex-
tractor (Cat. No. MGB400-04, RBC Bioscience Taiwan)
according to the manufacturer’s instructions and stored all
samples at −20°C before use.
PCR amplification
Primers (Table 1) were designed using the software Pri-
mer Premier 5 according to the change of restriction
sites, caused by the mutation. Primers were synthesized
by Sangon Biotech (Shanghai, China).
Restriction endonuclease analysis
Target variants were detected using the PCR-RFLP
(restriction fragment length polymorphism) method.
The digestion reaction and restriction enzyme digestion
conditions were taken from the manuals included with
the restriction enzymes purchased from the New England
BioLab (United States). Then 20 μl of digestion products
were loaded on 2% agarose gel containing ethidium brom-
ide, electrophoresed under 100 V for 30 min in 1× TAE,
and imaged using the gel imager. Digestion results of
homozygous mutants, heterozygous mutants, and wild-
type are shown in Table 1.
DNA sequencing
Based on the results from PCR-RFLP and site-directed
mutagenesis, the target fragments were re-amplified
using PCR. PCR products were purified using a DNA gel
purification kit, sequenced using the dideoxy four-color
fluorescence method on an automatic sequencer (ABI,
U.S.), and compared using GenBank data to confirm the
mutation sites.
Capillary electrophoresis (CE)
In this study, we initially established the test method
using CE to detect gene polymorphisms for PD. Briefly,
based on the susceptibility gene polymorphisms of PD
identified from PCR-RFLP, restriction fragments were
detected using capillary electrophoresis (BIOptics
Table 1 Primer sequences, PCR conditions and restriction digestion predictions
Polymorphism Primer sequences (5′→3′) Annealing
temperature (°C)
Restriction
enzyme
Amplified products
length (bp)
Restriction products
length (bp)
E46K F: TGATGTGGGAACAAAGGGGA 58 BsaJI 747 46E allele: 287,460
R: GTGTTTCCTGAAATGCACTCTGA 46K allele: 747
A1442P F: GAGACTAAACTGCTGCTTGC 58 Hhal 801 1442A allele: 671,130
R: GTAATCTCGTATGGCAGGGA 1442P allele: 801
A350V F: TCAGTGGTCTTTGCGTCATT 58 MwoI 302 350A allele: 94,208
R: CTGTCCTTTTACTCTGCTCCC 350V allele: 302
P268S F: AGCCCATTGTCTGGTTAGGT 58 BamHI 309 268P allele: 309
R: ACAGTGTCCGCATCGTCAT 268S allele: 225,84
R702W F: AGATCACAGCAGCCTTCC 63 MspI 185 702R allele: 20, 35, 54, 76
R: CACGCTCTTGGCCTCACC 702W allele: 20, 35, 130
G908R F: CCCAGCTCCTCCCTCTTC 63 Hin6I 380 908G allele: 380
R: AAGTCTGTAATGTAAAGCCAC 908R allele: 242, 138
1007fs F:
GGCAGAAGCCCTCCTGCAGGGCC
58 ApaI 151 Wild type allele: 151
R: CCTCAAAATTCTGCCATTCC 1007f allele: 130, 21
IVS9* F:
ACTCCTGCGCTTGATTTAGGCAAT
58 Xhol 775 Wild type allele: 318,457
R:
TTGGAATTTAGCTGTTCCTTCGGG
IVS9 G →A allele: 775
G2385R F:
AGACACTGCTCTCTATATTGCTAAG
58 AccI 261 2385G:261
R: CTGAAAAGATGGTGCTGAGAAG 2385R:77,184
*: IVS9: Intervening sequence 9, PARK2.
Ma et al. Behavioral and Brain Functions 2013, 9:19 Page 3 of 8
http://www.behavioralandbrainfunctions.com/content/9/1/19
Qsep100 dna-CE, Taiwan), which used a molten molding
silica capillary column with an inner diameter of 75 μl
and column length of 150 mm and Mops-Tris buffer of
pH 7.55. Then 0.5 μl of sample was electrically injected
in 4kV × 15 s at 25°C, electrophoresed at a constant volt-
age of 8 Kv, and detected for the laser-induced ethidium
bromide emission wavelength at 590 nm. The gel elec-
trophoresis profiles were compared to determine the
genotypes.
Statistical analysis
SPSS 18.0 (Statistical Package for the Social Sciences,
version 18.0 for Windows) was used for statistical ana-
lysis. Allele and genotype frequencies were compared
between cases and controls using the Fisher’s exact test.
To avoid multiple easily false, false discovery rate was
used to correct p values. Odds ratios and 95% confi-
dence intervals were calculated. A two-sided Pvalue
≤0.05 was considered statistically significant. Power was
calculated by Power and Sample Size Calculations Ver-
sion 3.0, 2009.
Results
Pedigree
Figure 1 shows the pedigree (2 generations) of the family
that we studied. The age of PD onset for the affected in-
dividuals 3 and 4 in the kindred is 45 and 40, respect-
ively. We failed to discover any mutations of the 9
genetic variants, including rare mutations E46K and
A1442P originally found in the kindred. It may be
caused by low family members to detect the association.
Further studies using a larger Chinese pedigree with PD
patients are required to determine this.
Case–control study
We analyzed 9 variants, E46K, G2385R, A1442P, IVS9,
A350V, P268S, R702W, G908R, and 1007fs in 237 spor-
adic patients with PD and 190 controls using the PCR-
RFLP and CE. All the genotypic and allelic distributions
analyzed in this study were in accordance with the
Hardy–Weinberg equilibrium. No heterozygosity or
homozygosity of E46K, A1442P, A350V, R702W, G908R,
or 1007fs was found. Heterozygosity of G2385R, IVS9,
and P268S were found in the case groups and controls
(Figure 2). The genotype frequency, allele frequency,
odds ratios, and confidence interval of these variants are
shown in Table 2.
The distribution of G2385R heterozygosity in LRRK2
was significantly different between cases and controls
(10.1% vs. 2.1%, P= 0.009). The intron IVS9 heterozy-
gous variant in PARK2 was found in both the case group
(12.7%) and the control group (7.9%). Although this vari-
ant had a higher frequency in the case group than the
control group, the difference was not statistically signifi-
cant (P= 0.348).
Although only 8 out of 237 patients were found to
carry the P268S heterozygous variant in NOD2, all these
patients (2 women and 6 men) had age at onset of over
50 years. Since no controls were found to carry this vari-
ant, the difference between cases and controls was
slightly significant (P= 0.0450). These results suggest
that the variant P268S in NOD2 might be associated
with late-onset PD and is one of the risk factors for
sporadic PD in Chinese Han populations.
Discussion
Gene polymorphism is a risk factor of PD, and it shows
different distributions in different ethnic groups and
geographies. Although GWAS have identified a number
of susceptibility genes and relevant variants associated
with PD in different populations, few of them have been
analyzed in other populations. To best of out knowledge,
we first screened 8 variants that have been associated
with neurodegeneration, E46K, A1442P, A350V, IVS9,
P268S, R702W, G908R, and 1007fs in Chinese popula-
tions, and further verified the presence of the high-
frequency variant G2385R in southern China.
In case–control study, both PD patients and controls
carried the heterozygous G2385R mutation, and the
genotype difference was slightly significant. This is con-
sistent with the results of a previous study of 600
Chinese PD patients and 334 controls [30]. This variant
was initially reported by Xingkai An. in 2008 among PD
patients in Sichuan area [30]. However, we did not find
E46K, A1442P, or A350V variants in patients with PD
and in controls. All of them indicated following
phenomenon: the ancestry effect; familial PD results
from rare, highly penetrant pathogenic mutation (e.g.
12
34
Figure 1 Pedigree of Parkinson’s disease (PD). Circle, woman;
square, man; filled square, affected.
Ma et al. Behavioral and Brain Functions 2013, 9:19 Page 4 of 8
http://www.behavioralandbrainfunctions.com/content/9/1/19
E46K, A1442P); multiple variants of low penetrant (e.g.
A350V) contribute to the risk of PD and are involved in
the etiology of PD.
Interestingly, none of homozygosity of these variants
was found in either the case or control groups [31,32]. It
was reported that heterozygosity of autosomal recessive
genes was very important in the initiation and develop-
ment of PD. For example, it has been found that patients
with PD who carry heterozygous PARK2 and PINK1 mu-
tations have an age of onset between that of wild-type
individuals and patients with homozygous mutations
[33,34]. Heterozygous mutation carriers indeed show
preclinical changes at the metabolic, structural, or func-
tional levels that are detectable by modern techniques of
neuroimaging and electrophysiology. Heterozygosity for
putative recessive mutations could lead to disease expression
by at least three mechanisms which are haploinsuffciency,
dominant-negative effect and novel gain-of-function [35].
Taken together, heterozygous mutations in putative
recessive genes seem to increase the susceptibility to
develop PD.
The new insertion mutation, c.1084intron
+
in PARK2,
introduces two new amino acids and a TAA stop codon,
resulting in reduced levels of parkin protein [36]. This
insertion mutation may be associated with the -6G > A
polymorphism of intron 9 in PARK2. One case–control
study found IVS9G > A to be a risk factor of PD in
Taiwan. A functional study of IVS9G > A by Guey-Jen
Lee-Chen showed that the shear efficiency of -6A was
slower than that of -6G at the protein level [37]. 12.7%
PD patients and 7.9% controls carried the heterozygous
IVS9 mutation, but the allele difference and genotype
difference were not statistically significant. This result is
consistent with the results of a previous study of 506
patients and 508 controls in Taiwan [18]. Further
investigation into the association between IVS9G > A
and PD need, through larger sample size from various
populations.
Inflammation is one of the suspected theories of PD.
The activation of NF-κB and microglial cells around
dopaminergic neurons have been analyzed in patients
with PD [38]. In 2007, Monika Bialecka reported that
three variants (R702W, G908R, and L1007fsinsC) of
NOD2 encoding NOD2, a protein that can activate the
apoptosis response, were significantly associated with
PD in a Polish population [28]. It has been demonstrated
that these three variants are not associated with CD in
Chinese Han, Korean, and Japanese populations [39-42].
Similarly, these three common SNPs (R702W, G908R,
and 1007fs) were not detected in our cohort. However, a
novel variant P268S was observed, which has also been
discovered to be associated with CD in Chinese popula-
tion [43]. Although linkage disequilibrium was observed
between P268S and the other three SNPs in NOD2, only
P268S of the four variants was slightly significant in our
study, which was consistent with recent study suggesting
that P268S instead of 1007fs, G908R, R702W was a risk
factor of Chinese Crohn’s disease population. It
ace
bdf
Figure 2 Capillary electrophoresis (CE) results of restriction fragments of 3 variants. a,c,eand b,d,fare the electropherograms and gel-
views of IVS9, P268S, and G2385R after restriction digestion, respectively. The green arrows indicate markers (20 bp, 1000 bp) and black arrows
indicate the restriction fragments. Restriction fragment sizes are shown in the Table 1: No mutation (wild-type/negative control), 2: Negative
results in the control group, 3: Positive results (heterozygote) in the case group, 4: Homozygous mutation (homozygote/positive control). Because
the signals are too strong for IVS9-4, P268S-1, P268S-2, G2385R-1, and G2385-2, 10 times markers are used to enhance the signal.
Ma et al. Behavioral and Brain Functions 2013, 9:19 Page 5 of 8
http://www.behavioralandbrainfunctions.com/content/9/1/19
indicated that P268S may be one of risk factors for PD
in Chinese individuals, or the P268S variant may be in
linkage disequilibrium with another causal rare variant
on NOD2 gene. The frequencies of minor allele 1007fs,
G908R, R702W and P268S variants are much lower in
Asians compare to Caucasians populations. In this study,
genotype frequency of P268S (P= 0.0450) had slightly
significant differences. The sample size has to be very
large or odds ratio has to be very high to have enough
power for detection effect of very rare variants.
NOD2 is a member of the Apaf-1 superfamily of apop-
tosis regulators that is expressed in monocytes and
involved in the activation of NF-κB, by bacterial compo-
nent muramyl dipeptide (MDP) [44]. Functional studies
revealed that both normal and P268S NOD2 induced
similar levels of NF-κB activation in response to MDP
[45] and the G908R, R702W, and L1007fsinsC variants
in the presence and absence of P268S are defective in
their ability to respond to bacterial lipopolysaccharides
and peptidoglycan, whereas P268S alone exhibited wild-
type activity [46]. Thus, P268S was confirmed as the
haplotype background of these three variants but has no
influence on functions of the CD-associated variants of
NOD2 [47]. Notably, above results from NF-κB activa-
tion assay using human embryonic kidney (HEK) 293
cell lines, but the function activity of NOD2 in
neurodegeneration field remain unclear. Additionally,
Crane et al. found that carriage of the P268S variant was
associated with greater disease activity and inversely as-
sociated with ulcerative colitis spondylarthritis [48]. We
regarded the P268S of NOD2 behaving as a common
factor of PD and CD. Crohn’s disease is a chronic in-
flammatory disorder of the gastrointestinal tract, which
is thought to result from the effect of environmental
factors in a genetically predisposed host [49]. A wealth
of new information has emerged to suggest that
inflammation-derived oxidative stress and cytokine
dependent toxicity may contribute to nigrostriatal path-
way degeneration and hasten progression of disease in
humans with idiopathic PD. Both them suggest that
inflammation may play a role connecting between PD
and CD.
Table 2 Genotype and allele frequencies of G2385R, P268S, and IVS9 in cases and controls
Genotype PD patients, n = 237 Control, n = 190 Odds ratio
(95% CI)*
p value** Power
§
No. % No. %
G2385R(G > A)
GG 213 89.9 186 97.9 1
GA 24 10.1 4 2.1 5.24 0.009 0.8973
(1.79-15.38)
AA 0 0 0 0 ——
G 450 94.9 376 98.9 1
A 24 5.1 4 1.1 5.01 0.090 0.8803
(1.72-14.58)
P268S(C > T)
CC 229 96.6 190 100 1
CT 8 3.4 0 0 —0.045 NA
TT 0 0 0 0 ——
C 466 98.3 380 100 1
T 8 1.7 0 0 ——
IVS9(G > A)
GG 207 87.3 175 92.1 1
GA 30 12.7 15 7.9 1.7 0.348 0.2987
(0.88-3.24)
AA 0 0 0 0 ——
G 444 365 96.1 1
A 30 6.3 15 3.9 1.64 0.572 0.2865
(0.87-3.10)
*: Odds ratios (OR) and 95% confidence intervals (95% CI) were calculated by comparison to the common allele frequencies and genotype frequencies.
**: Fisher exact test and false discovery rate were used to calculate and correct the p values, respectively. Two sided Pvalue ≤0.05 was considered
statistically significant.
§
: Power was calculated by Power and Sample Size Calculations Version 3.0, 2009. NA: not available.
Ma et al. Behavioral and Brain Functions 2013, 9:19 Page 6 of 8
http://www.behavioralandbrainfunctions.com/content/9/1/19
Conclusions
We analyzed the genetic loci associated with PD in the
sporadic and family PD patients using PCR-RFLP and
found P268S might be a risk factor of sporadic PD in the
Chinese population. As it is the first study on NOD2
P268S in PD patients, the results should be treated with
caution, as one cannot completely exclude that they are
false positive. Further studies required to verify the asso-
ciation between P268S and susceptibility to sporadic
Parkinson’s disease in large sample size, and explore the
NOD2 functions involved in neurodegenerative diseases.
Abbreviations
PD: Parkinson’s disease; SNPs: Single nucleotide polymorphisms;
UPS: Ubiquitin proteasome system; PCR: Polymerase chain reaction;
RFLP: Restriction fragment length polymorphism; CE: Capillary
electrophoresis; GWAS: Genome-wide association studies; CD: Crohn’s
disease; NOD: Nucleotide-binding and oligomerization domain; EOPD: Early-
onset PD; LOPD: Late-onset PD; UPDRS: Unified parkinson’s disease rating
scale; EDTA: Ethylene diamine tetraacetic acid; SPSS: Statistical package for
the social sciences; OR: Odds ratios; CI: Confidence intervals; MDP: Muramyl
dipeptide; NFAT: Nuclear factor of activated T-cells.
Competing interests
The authors declare that they have no competing interests.
Authors’contributions
QLM, XKA, and QL collected the blood samples from PD patients and
controls, extracted genomic DNA, and searched relevant literature. ZML
performed PCR, RFLP, and CE analysis and built positive and negative control
plasmids. HJZ and LLC designed the primers for PCR, cloning, and site-
directed mutagenesis and performed sequence alignment. WQH and PH
participated in statistical analysis and the production of tables. CMT designed
all the experiments and drafted the manuscript. All authors read and
approved the final manuscript.
Authors’information
QLM: MD, chief physician of the Department of Neurology of the First
Affiliated Hospital of Xiamen University; senior visiting scholar at Harvard
Medical School, Center of Neurological Diseases; Member of the World
Stroke Organization (WSO). XKA: Resident of the Department of Neurology of
Xiamen First Hospital; part of the team that first revealed the association of
G2385R and the LRRK2 gene with PD in Chinese Han populations. QL: MD,
associate-chief physician of the Department of Neurology of the he First
Affiliated Hospital of Xiamen University. ZML: Master student, School of
Pharmaceutical Sciences Xiamen University; participated in several projects
on screening the disease genes for PD of Chinese Han population. CMT: PhD
in Physical Biochemistry, Nuclear Science, National Tsing-Hua University,
Postdoctoral Fellow in Biochemistry, Stanford University School of Medicine,
School of Pharmaceutical Sciences; Executive Director Professor of Center for
Translational Medicine, Xiamen University.
Acknowledgements
We would like to thank all the patients and control subjects who
participated in this study. We would like to thank Professor Chi-Meng Tzeng
for his guidance and the members of our laboratory, Huiming Ye, Xiaonan
Lv, Yi Li, and Mingjie Lei for their help. This study was supported by Fujian
Province Natural Science Foundation Association of glucocerebrosidase gene
mutations with Parkinson’s disease in Chinese Han patients (No. 2009D001),
Fujian Province Health Department Youth Research Projects Association of
glutamate transporter gene and patients with Parkinson’s disease (No. 2009-2
-72) and Fujian Province Science and Technology Department Key Project of
The Screening of Susceptibility Gene in Parkinson’s Disease and The Platform
Establishment of Molecular Diagnosis (No. 2012D062).
Received: 14 November 2012 Accepted: 1 May 2013
Published: 7 May 2013
References
1. Zhang ZX, Roman GC, Hong Z, Wu CB, Qu QM, Huang JB, Zhou B, Geng ZP,
Wu JX, Wen HB, et al:Parkinson’s disease in China: prevalence in Beijing,
Xian, and Shanghai. Lancet 2005, 365(9459):595–597.
2. Fahn S: Description of Parkinson’s disease as a clinical syndrome. Ann N Y
Acad Sci 2003, 991:1–14.
3. Forno LS: Neuropathology of Parkinson’s disease. J Neuropathol Exp Neurol
1996, 55(3):259–272.
4. Dauer W, Przedborski S: Parkinson’s disease: mechanisms and models.
Neuron 2003, 39(6):889–909.
5. Dawson TM, Dawson VL: Molecular pathways of neurodegeneration in
Parkinson’s disease. Science 2003, 302(5646):819–822.
6. Cookson MR: The biochemistry of Parkinson’s disease. Annu Rev Biochem
2005, 74:29–52.
7. Polymeropoulos MH, Lavedan C, Leroy E, Ide SE, Dehejia A, Dutra A, Pike B,
Root H, Rubenstein J, Boyer R, et al:Mutation in the alpha-synuclein gene
identified in families with Parkinson’s disease. Science 1997,
276(5321):2045–2047.
8. Zarranz JJ, Alegre J, Gomez-Esteban JC, Lezcano E, Ros R, Ampuero I, Vidal L,
Hoenicka J, Rodriguez O, Atares B, et al:The new mutation, E46K, of alpha-
synuclein causes Parkinson and Lewy body dementia. Ann Neurol 2004,
55(2):164–173.
9. Kruger R, Kuhn W, Muller T, Woitalla D, Graeber M, Kosel S, Przuntek H,
Epplen JT, Schols L, Riess O: Ala30Pro mutation in the gene encoding
alpha-synuclein in Parkinson’s disease. Nat Genet 1998, 18(2):106–108.
10. Chan DK, Mellick G, Cai H, Wang XL, Ng PW, Pang CP, Woo J, Kay R: The
alpha-synuclein gene and Parkinson disease in a Chinese population.
Arch Neurol 2000, 57(4):501–503.
11. Mata IF, Wedemeyer WJ, Farrer MJ, Taylor JP, Gallo KA: LRRK2 in Parkinson’s
disease: protein domains and functional insights. Trends Neurosci 2006,
29(5):286–293.
12. Tan EK, Shen H, Tan LC, Farrer M, Yew K, Chua E, Jamora RD, Puvan K,
Puong KY, Zhao Y, et al:The G2019S LRRK2 mutation is uncommon in an
Asian cohort of Parkinson’s disease patients. Neurosci Lett 2005,
384(3):327–329.
13. Funayama M, Li Y, Tomiyama H, Yoshino H, Imamichi Y, Yamamoto M,
Murata M, Toda T, Mizuno Y, Hattori N: Leucine-rich repeat kinase 2
G2385R variant is a risk factor for Parkinson disease in Asian population.
Neuroreport 2007, 18(3):273–275.
14. Huang Y, Halliday GM, Vandebona H, Mellick GD, Mastaglia F, Stevens J,
Kwok J, Garlepp M, Silburn PA, Horne MK, et al:Prevalence and clinical
features of common LRRK2 mutations in Australians with Parkinson’s
disease. Mov Disord 2007, 22(7):982–989.
15. Lucking CB, Durr A, Bonifati V, Vaughan J, Michele G, Gasser T, Harhangi BS,
Meco G, Denefle P, Wood NW, et al:Association between early-onset
Parkinson’s disease and mutations in the parkin gene. N Engl J Med 2000,
342(21):1560–1567.
16. Shimura H, Hattori N, Kubo S, Mizuno Y, Asakawa S, Minoshima S, Shimizu
N, Iwai K, Chiba T, Tanaka K, et al:Familial Parkinson disease gene
product, parkin, is a ubiquitin-protein ligase. Nat Genet 2000,
25(3):302–305.
17. Mata IF, Lockhart PJ, Farrer MJ: Parkin genetics: one model for Parkinson’s
disease. Hum Mol Genet 2004, 13:R127–R133. Spec No 1.
18. Wu YR, Wu CH, Chao CY, Kuan CC, Zhang WL, Wang CK, Chang CY, Chang
YC, Lee-Chen GJ, Chen CM: Genetic analysis of Parkin in early onset
Parkinson’s disease (PD): Novel intron 9 g > a single nucleotide
polymorphism and risk of Taiwanese PD. Am J Med Genet B Neuropsychiatr
Genet 2010, 153B(1):229–234.
19. Tucci A, Nalls MA, Houlden H, Revesz T, Singleton AB, Wood NW, Hardy J,
Paisan-Ruiz C: Genetic variability at the PARK16 locus. Eur J Hum Genet
2010, 18(12):1356–1359.
20. Kolisek M, Launay P, Beck A, Sponder G, Serafini N, Brenkus M, Froschauer
EM, Martens H, Fleig A, Schweigel M: SLC41A1 is a novel mammalian Mg2
+ carrier. J Biol Chem 2008, 283(23):16235–16247.
21. Wyss-Coray T, Mucke L: Inflammation in neurodegenerative disease–a
double-edged sword. Neuron 2002, 35(3):419–432.
22. McGeer PL, McGeer EG: Inflammation and neurodegeneration in
Parkinson’s disease. Parkinsonism Relat Disord 2004, 10(Suppl 1):S3–S7.
23. Kim YS, Joh TH: Microglia, major player in the brain inflammation: their
roles in the pathogenesis of Parkinson’s disease. Exp Mol Med 2006,
38(4):333–347.
Ma et al. Behavioral and Brain Functions 2013, 9:19 Page 7 of 8
http://www.behavioralandbrainfunctions.com/content/9/1/19
24. Hakansson A, Westberg L, Nilsson S, Buervenich S, Carmine A, Holmberg B,
Sydow O, Olson L, Johnels B, Eriksson E, et al:Interaction of
polymorphisms in the genes encoding interleukin-6 and estrogen
receptor beta on the susceptibility to Parkinson’s disease. Am J Med
Genet B Neuropsychiatr Genet 2005, 133B(1):88–92.
25. Kaltschmidt B, Heinrich M, Kaltschmidt C: Stimulus-dependent activation
of NF-kappaB specifies apoptosis or neuroprotection in cerebellar
granule cells. Neuromolecular Med 2002, 2(3):299–309.
26. Hirsch EC, Hunot S: Neuroinflammation in Parkinson’s disease: a target for
neuroprotection? Lancet Neurol 2009, 8(4):382–397.
27. Inohara N, Nunez G: NODs: intracellular proteins involved in inflammation
and apoptosis. Nat Rev Immunol 2003, 3(5):371–382.
28. Bialecka M, Kurzawski M, Klodowska-Duda G, Opala G, Juzwiak S, Kurzawski
G, Tan EK, Drozdzik M: CARD15 variants in patients with sporadic
Parkinson’s disease. Neurosci Res 2007, 57(3):473–476.
29. Hughes AJ, Daniel SE, Kilford L, Lees AJ: Accuracy of clinical diagnosis of
idiopathic Parkinson’s disease: a clinico-pathological study of 100 cases.
J Neurol Neurosurg Psychiatry 1992, 55(3):181–184.
30. An XK, Peng R, Li T, Burgunder JM, Wu Y, Chen WJ, Zhang JH, Wang YC, Xu
YM, Gou YR, et al:LRRK2 Gly2385Arg variant is a risk factor of Parkinson’s
disease among Han-Chinese from mainland China. Eur J Neurol 2008,
15(3):301–305.
31. Abou-Sleiman PM, Muqit MM, McDonald NQ, Yang YX, Gandhi S, Healy DG,
Harvey K, Harvey RJ, Deas E, Bhatia K, et al:A heterozygous effect for
PINK1 mutations in Parkinson’s disease? Ann Neurol 2006, 60(4):414–419.
32. Klein C: Implications of genetics on the diagnosis and care of patients
with Parkinson disease. Arch Neurol 2006, 63(3):328–334.
33. Hedrich K, Marder K, Harris J, Kann M, Lynch T, Meija-Santana H, Pramstaller
PP, Schwinger E, Bressman SB, Fahn S, et al:Evaluation of 50 probands
with early-onset Parkinson’s disease for Parkin mutations. Neurology 2002,
58(8):1239–1246.
34. Sun M, Latourelle JC, Wooten GF, Lew MF, Klein C, Shill HA, Golbe LI, Mark
MH, Racette BA, Perlmutter JS, et al:Influence of heterozygosity for parkin
mutation on onset age in familial Parkinson disease: the GenePD study.
Arch Neurol 2006, 63(6):826–832.
35. Klein C, Lohmann-Hedrich K, Rogaeva E, Schlossmacher MG, Lang AE:
Deciphering the role of heterozygous mutations in genes associated
with parkinsonism. Lancet Neurol 2007, 6(7):652–662.
36. Matsuda N, Kitami T, Suzuki T, Mizuno Y, Hattori N, Tanaka K: Diverse effects
of pathogenic mutations of Parkin that catalyze multiple
monoubiquitylation in vitro. J Biol Chem 2006, 281(6):3204–3209.
37. Wan-Ling Zhang C-HW, Tsu-Wei W, Lee-Chen G-J: Functional Analysis of
Parkin Gene Intron 9 g > a SNP. Bio Formosa 2010, 45(1):31–38.
38. Hunot S, Brugg B, Ricard D, Michel PP, Muriel MP, Ruberg M, Faucheux BA,
Agid Y, Hirsch EC: Nuclear translocation of NF-kappaB is increased in
dopaminergic neurons of patients with parkinson disease. Proc Natl Acad
Sci USA 1997, 94(14):7531–7536.
39. Gao M, Cao Q, Luo LH, Wu ML, Hu WL, Hu WL, Si JM: [NOD2/CARD15 gene
polymorphisms and susceptibility to Crohn’s disease in Chinese Han
population]. Zhonghua Nei Ke Za Zhi 2005, 44(3):210–212.
40. Croucher PJ, Mascheretti S, Hampe J, Huse K, Frenzel H, Stoll M, Lu T,
Nikolaus S, Yang SK, Krawczak M, et al:Haplotype structure and
association to Crohn’s disease of CARD15 mutations in two ethnically
divergent populations. Eur J Hum Genet 2003, 11(1):6–16.
41. Yamazaki K, Takazoe M, Tanaka T, Kazumori T, Nakamura Y: Absence of
mutation in the NOD2/CARD15 gene among 483 Japanese patients with
Crohn’s disease. J Hum Genet 2002, 47(9):469–472.
42. Leong RW, Armuzzi A, Ahmad T, Wong ML, Tse P, Jewell DP, Sung JJ:
NOD2/CARD15 gene polymorphisms and Crohn’s disease in the Chinese
population. Aliment Pharmacol Ther 2003, 17(12):1465–1470.
43. Lv C, Yang X, Zhang Y, Zhao X, Chen Z, Long J, Zhong C, Zhi J, Yao G, Jiang
B, et al:Confirmation of three inflammatory bowel disease susceptibility
loci in a Chinese cohort. Int J Colorectal Dis 2012, 27(11):1465–1472.
44. Ogura Y, Inohara N, Benito A, Chen FF, Yamaoka S, Nunez G: Nod2, a
Nod1/Apaf-1 family member that is restricted to monocytes and
activates NF-kappaB. J Biol Chem 2001, 276(7):4812–4818.
45. Inohara N, Ogura Y, Fontalba A, Gutierrez O, Pons F, Crespo J, Fukase K,
Inamura S, Kusumoto S, Hashimoto M, et al:Host recognition of bacterial
muramyl dipeptide mediated through NOD2. Implications for Crohn’s
disease. J Biol Chem 2003, 278(8):5509–5512.
46. Bonen DK, Ogura Y, Nicolae DL, Inohara N, Saab L, Tanabe T, Chen FF,
Foster SJ, Duerr RH, Brant SR, et al:Crohn’s disease-associated NOD2
variants share a signaling defect in response to lipopolysaccharide and
peptidoglycan. Gastroenterology 2003, 124(1):140–146.
47. Chamaillard M, Philpott D, Girardin SE, Zouali H, Lesage S, Chareyre F, Bui
TH, Giovannini M, Zaehringer U, Penard-Lacronique V, et al:Gene-
environment interaction modulated by allelic heterogeneity in
inflammatory diseases. Proc Natl Acad Sci USA 2003, 100(6):3455–3460.
48. Crane AM, Bradbury L, Van Heel DA, McGovern DP, Brophy S, Rubin L,
Siminovitch KA, Wordsworth BP, Calin A, Brown MA: Role of NOD2 variants
in spondylarthritis. Arthritis Rheum 2002, 46(6):1629–1633.
49. Ogura Y, Bonen DK, Inohara N, Nicolae DL, Chen FF, Ramos R, Britton H,
Moran T, Karaliuskas R, Duerr RH, et al:A frameshift mutation in NOD2
associated with susceptibility to Crohn’s disease. Nature 2001,
411(6837):603–606.
doi:10.1186/1744-9081-9-19
Cite this article as: Ma et al.:P268S in NOD2 associates with
susceptibility to Parkinson’s disease in Chinese population. Behavioral
and Brain Functions 2013 9:19.
Submit your next manuscript to BioMed Central
and take full advantage of:
• Convenient online submission
• Thorough peer review
• No space constraints or color figure charges
• Immediate publication on acceptance
• Inclusion in PubMed, CAS, Scopus and Google Scholar
• Research which is freely available for redistribution
Submit your manuscript at
www.biomedcentral.com/submit
Ma et al. Behavioral and Brain Functions 2013, 9:19 Page 8 of 8
http://www.behavioralandbrainfunctions.com/content/9/1/19
