Content uploaded by Øystein Evensen
Author content
All content in this area was uploaded by Øystein Evensen
Content may be subject to copyright.
Available via license: CC BY 4.0
Content may be subject to copyright.
Stress-Induced Reversion to Virulence of Infectious
Pancreatic Necrosis Virus in Naı
¨ve Fry of Atlantic Salmon
(
Salmo salar
L.)
Koestan Gadan
1.
, Ane Sandtrø
1.
, Inderjit S. Marjara
1
, Nina Santi
2
, Hetron M. Munang’andu
1
,
Øystein Evensen
1
*
1Norwegian School of Veterinary Science, Oslo, Norway, 2Aqua Gen AS, Trondheim, Norway
Abstract
We have studied stress-induced reversion to virulence of infectious pancreatic necrosis virus (IPNV) in persistently infected
Atlantic salmon (Salmo salar L.) fry. Naı
¨ve fry were persistently infected with a virulent strain (T
217
A
221
of major structural
virus protein 2, VP2) or a low virulent (T
217
T
221
) variant of IPNV. The fry were infected prior to immunocompetence as
documented by lack of recombination activating gene-1, T-cell receptor and B-cell receptor mRNA expression at time of
challenge. The fish were followed over 6 months and monitored monthly for presence of virus and viral genome mutations.
No mutation was identified in the TA or TT group over the 6 months period post infection. Six months post infection TA and
TT infected groups were subject to daily stress for 7 days and then sampled weekly for an additional period of 28 days post
stress. Stress-responses were documented by down-regulation of mRNA expression of IFN-a1 and concomitant increase of
replication levels of T
217
T
221
infected fish at day 1 post stress. By 28 days post stress a T221A reversion was found in 3 of 6
fish in the T
217
T
221
infected group. Sequencing of reverted isolates showed single nucleotide peaks on chromatograms for
residue 221 for all three isolates and no mix of TA and TT strains. Replication fitness of reverted (TA) and non-reverted (TT)
variants was studied in vitro under an antiviral state induced by recombinant IFN-a1. The T
217
A
221
reverted variant replicated
to levels 23-fold higher than the T
217
T
221
strain in IFN-a1 treated cells. Finally, reverted TA strains were virulent when tested
in an in vivo trial in susceptible salmon fry. In conclusion, these results indicate that stress plays a key role in viral replication
in vivo and can facilitate conditions that will allow reversion from attenuated virus variants of IPNV.
Citation: Gadan K, Sandtrø A, Marjara IS, Santi N, Munang’andu HM, et al. (2013) Stress-Induced Reversion to Virulence of Infectious Pancreatic Necrosis Virus in
Naı
¨ve Fry of Atlantic Salmon (Salmo salar L.). PLoS ONE 8(2): e54656. doi:10.1371/journal.pone.0054656
Editor: Pierre Boudinot, INRA, France
Received May 29, 2012; Accepted December 17, 2012; Published February 19, 2013
Copyright: ß2013 Gadan et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: Funding was received from the Research Council of Norway (project number 172508) and the European Union under the 6th Framework program
(project number 501984). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: Ane Sandtrø is currently affiliated with PHARMAQ which is a biologics company developing vaccines for aquaculture fish. The topics
included in the paper has no direct economic implication to the work that Ane Sandtrø is currently doing. Nina Santi is employed with AquaGen AS which is a
breeding company for Atlantic salmon. This does not alter the authors’ adherence to all the PLOS ONE policies on sharing data and materials.
* E-mail: oystein.evensen@nvh.no
.These authors contributed equally to this work.
Introduction
Infectious pancreatic necrosis virus (IPNV) is the causative agent
of the infectious pancreatic necrosis (IPN) in salmonid fish, belongs
to the family Birnaviridae and is the type strain of the genus
Aquabirnaviruses [1]. IPN was previously regarded as a disease
mainly of first-feeding fry, but the disease situation has changed
over the past two decades, and outbreaks amongst post-smolt
Atlantic salmon (Salmo salar L.) 6–10 weeks following transfer to
sea-water have become a major threat to the economy of the fish
farming industry [1,2]. Transfer of young salmon to salt water is a
particularly stressful stage in the production cycle, as smoltification
involves a complex change in physiology, morphology, biochem-
istry and behaviour; preparing the fish for the transition from fresh
water to marine life. IPN in post-smolts after sea transfer is
considered a stress-mediated reactivation of an asymptomatic
IPNV-infection as most IPNV infected fish become life-long
carriers of the virus [2,3]. Carrier fish shed virus in their faeces,
however, titres fluctuate over time and increase during periods of
stress [2]. IPNV is found in macrophage populations in the
hematopoietic tissue of the kidney of persistently infected fish and
IPNV can multiply in adherent leucocytes isolated from carriers,
although it does not produce lytic infections [3]. Viruses residing in
leucocytes can alter their function, for instance by disturbing the
release of cytokines, antibodies or other molecules made by
immune cells [4]. There are indications of reduced immune
response in leucocytes isolated from carrier fish, and of increased
virus replication upon stimulation of resting leucocytes [5]. There
is no correlation between the presence of virus and the level of
anti-IPNV antibodies in persistently infected fish [6,7]. Strong Mx
induction is observed in acute IPNV infection in post-smolt, but
not in asymptomatic carriers, although the latter have the ability to
respond with an Mx expression in response to poly I:C injection
[6]. Further, epidemiological studies have identified transport
stress as a risk factor for IPN outbreaks [7,8] which aligns with the
observation that IPN can be induced in covertly infected post-
smolts by exposure to environmental stress under experimental
conditions [9]. This supports the general notion that IPN
PLOS ONE | www.plosone.org 1 February 2013 | Volume 8 | Issue 2 | e54656
outbreaks in sea water result from reactivation of a persistent
infection.
The mortality of acute IPN outbreaks varies considerably, partly
due to strain variation in virulence [10]. Amino acid residues 217,
221 and 247 were identified as important for virulence in a
previous study of field strains of IPNV [10]. Later studies have
shown that positions 217 and 221 are key in determining the
virulence of serotype Sp strains [11]. Virulent strains have a
combination of Thr and Ala in positions 217 and 221, respectively
(T
217
A
221
) while strains of intermediate virulence carry P
217
A
221
.
Strains with a T
217
T
221
and P
217
T
221
combination are avirulent
[11]. Residues 217 and 221 of VP2 also influence the in vitro
growth characteristics of IPNV Sp strains. In particular, an A221T
substitution is involved in adaptation to CHSE-214 cells [10].
Attenuated viruses replicate faster and produce larger plaques in
CHSE cells. IPNV causes persistent infection [12,13] and in one
previous study we showed that attenuated virus variants (T
217
T
221
)
can occur late during infection in fish originally infected with a
virulent strain (T
217
A
221
) [14]. In yet another study we showed
that virulent strains (T
217
A
221
) do not establish a persistent
infection as efficiently as avirulent strains (T
217
T
221
) [11]. Indeed,
VP2 residue 221 seems to be a ‘‘hot spot’’ for adaptive mutation of
the IPNV Sp genome, singularly affecting the virulence and
persistence characteristics of the virus in vivo, as well as the growth
characteristics in cell culture. In light of these observations, one
issue that remains unaddressed in the literature is the possibility for
reversion to virulence in vivo for IPNV strains.
On this basis we established a persistent infection with IPNV in
fry of Atlantic salmon using one high (T
217
A
221
) and one low
virulent (T
217
T
221
) strain. Naı
¨ve fry were infected prior to
immunocompetence (0.15 g size). The fish were followed for
6 months post challenge and then exposed to acute stress over a
period of 1 week. We found IFN-a1 and Mx gene expression
levels were down-regulated and the replication level in T
217
T
221
infected fish was up 8-fold at day 1 after stress and by 28 days post
stress we found a reversion to a virulent wild-type (T
217
A
221
). The
reverted variants showed higher replication levels at individual fish
level. When tested for virulence in vivo, the reverted variants had
attained their virulence profile. Further to this, we found that the
T
217
A
221
variant replicated under high IFN-a1 and Mx expression
levels in vivo. And more so, in vitro the wild-type showed higher
resistance to pre-treatment of cell cultures with rIFN-a1in
contrast to the less fit T
217
T
221
strain where virus replication was
completely blocked.
Materials and Methods
Cells used for culturing
Rainbow trout gonad (RTG-2) cells (ATCC CCL-55) and
Chinook salmon embryo (CHSE-214) cells (ATCC CRL-1681)
were grown at 20uC in L-15 medium (Sigma Aldrich) supple-
mented with 10% fetal bovine serum (FBS, Medprobe), 1% L-
glutamin (Sigma Aldrich), and 50 mgml
21
gentamicin (Sigma
Aldrich). The TO cell line (macrophage cell line), originating from
salmon head kidney leukocytes [15] were grown at 20uCin
HMEM (Eagle’s MEM with Hanks’ BSS) supplemented with L-
glutamine, MEM non-essential amino acids, gentamicin sulphate
and 10% fetal bovine serum (FBS).
Construction of cDNA clones
Generation of full-length cDNA clones of the entire coding and
non-coding regions of NVI-015 RNA segment A and B was
performed according to procedures described by Yao and
Vakharia [16]. The recombinant IPNV Sp strains rNVI-15TA
was generated as described in previous studies [10,11]. Briefly,
combining transcripts of pUC19NVI15A plus pU19NVI115B
resulted in the recovery of the viral progeny designated as rNVI-
15TA which has similar residues (T
217
A
221
) to the parent IPNV
strain NVI-015. Once the genetically engineered virus strain was
made, it was propagated on RTG-2 monolayers and the
supernatants were harvested following low centrifugation and
sterile filtration (0.22 mm). RNA extraction using the QIAamp
viral mini kit (Qiagen) was carried out following the manufactur-
er’s recommendation. Complete nucleotide sequences of segment
A and B were determined as before [10]. The chromatograms
were analyzed to ensure that the generated clones had the correct
residues at positions 217, 221 and 247.
Plaque purification assay
To generate an additional mutant virus in residue 221 of VP2,
we took advantage of previously observed attenuation character-
istics of the (T
217
A
221
) strains of IPNV where attenuation is seen in
CHSE-214 following passage in culture [11,14]. In brief, progeny
viruses designated rNVI-15-TT representing one amino acid
substitution of A221T of the parent strain rNVI-15-TA, were
obtained after the recombinant strain and passaged on CHSE-214
cells. Mutations are seen already at 3–4 passages in culture and the
virus passage up to the tenth passage, after which the isolate was
plaque purified by inoculating RTG-2 monolayers on six well
plates with 10-fold dilution (10
23
to 10
28
) of cell culture
supernatants. After 1 hr adsorption at room temperature the
inoculum was removed and the cells were overlaid with 0.8%
SeaPlaque Agarose (BioWhittaker) in L-15 medium containing 5%
FBS and 1% L-glutamine. The cells were incubated at 15uC for
4 days and plaques formed by cytopathic effect (CPE) were
removed from the wells using a punch biopsy equipment. Fifteen
plaques were subsequently inoculated on RTG-2 monolayers and
incubated at 15uC until full CPE was observed. The supernatant
was harvested after low centrifugation and sterile filtration
(0.22 mm). RNA was extracted using the QIAamp Viral RNA
mini kit following the manufacturer’s recommendations. Complete
nucleotide sequences of segment A and B of each virus was
determined as described before [10,14,17]. The chromatographs
were checked to ensure a ‘‘clean’’ ACC codon encoding T
221
was
used in the study. No other mutations were found in the entire
genome of the virus. Prior to challenge the isolates were
propagated by one passage in RTG-2 cells. The cell culture
supernatant was obtained after a brief centrifugation, and the
infectious titer was determined by end point dilution on RTG-2
cells grown in 96 well plates. Fifty ml of 10-fold dilutions (10
21
to
10
28
) of cell culture supernatants were inoculated in six parallel
wells per dilution. The TCID
50
was estimated by the method of
Ka¨rber [18].
Establishing persistent infection of Atlantic salmon fry
The challenge was conducted at VESO Vikan’s research
facility, Namsos, Norway. A total of 770 Atlantic salmon (Salmo
salar L.) fry of the AquaGen strain hatched at the VESO Vikan
hatchery were included in the experiment at the time when the fry
started to feed (Micro 015, Ewos). At arrival to the research
facilities, 20 fish were sampled for measurement of average weight
(0.15 g). The rest of the fish were divided into 3 tanks, each of 250
fry. After an acclimatization period of one week, the fry were
starved one day before challenge. Fish were challenged by
immersion with IPNV at a dose of 5610
4
TCID
50
/ml in a total
volume of 4 liters per tank. One tank was challenged with rNVI-
15TA (TA group), one tank was challenged with rNVI-15TT
(TT), and one control (ctlr) tank was mock-infected by adding cell
Stress-Induced Reversion of IPNV
PLOS ONE | www.plosone.org 2 February 2013 | Volume 8 | Issue 2 | e54656
culture medium. The water was aerated during the challenge.
After a period of 3 hours the water volume was reduced to 2 liters
and normal flow was resumed. Mortality was recorded on a daily
basis, and dead fish were collected each day and frozen at 270uC.
Sampling of ten fish from each tank was performed at ten days
post challenge, and after this first sampling, five fish were sampled
from each tank once a month, up until 6 months post challenge.
Stress challenge of IPNV carrier fish and uninfected
controls
At six months post challenge, the remaining fish in each of the
tanks were divided into two parallels; A and B; each parallel
including 3 tanks and with approximately 50 fish in each tank. Fish
in tanks 1B (TA-group), 2B (TT-group) and 3B (uninfected
controls) were subject to three stressful events during a period of
7 days. The stress was imposed by reducing water level to
approximately Kof the normal water level. In addition, fish were
chased for 15 minutes with a net, at a moderate speed. Fish in
parallels 1A, 2A, and 3A (corresponding to the same groups as
above) were not subject to any stress treatment (non-stressed).
Before splitting the fish in two parallel tanks, 5 fish were
sampled from each group and frozen at270uC, kidney was
dissected from six fish in each group and stored in RNAlaterH
(Qiagen). After the stress treatment, samples were collected once
per week for the four following weeks (7 days apart, days 1–28 post
stress). At these samplings, twelve fish were collected from each
group and six of them were frozen at 270uC while the kidney was
dissected from the other six fish and stored in RNAlaterH.
Virus re-isolation from persistently infected fish
Fry samples stored at 270uC were homogenized in phosphate
buffered saline (PBS) (1:5, weight/volume) using a stomacher.
100 ml of this homogenate was transferred to RLT buffer
containing 2-mercaptoethanol (RNeasy Mini kit, Qiagen) and
stored at 270uC. The rest of the homogenate was diluted 1:2 in L-
15 medium supplemented with15 L-glutamine and 50 mgml
21
(without FBS). After low centrifuging for 10 minutes, samples were
inoculated onto RTG-2 cells grown in 24 well plates in final
dilutions of 1 and 0.1%, and incubated for a week at 15uC. The
cell culture medium after first passage was used to infect new
monolayers followed by incubation for another week. Samples
were considered negative when no CPE was observed after the
second passage. RNA was isolated from fish homogenates for all
negative samples using the RNeasy Mini kit (Qiagen) in
accordance with the supplier’s protocol. Qiagen’s OneStep RT-
PCR kit was used according to the manufacturer’s instructions,
with 0.5 mg RNA and 15 pmol each of primers IPNVF and
IPNVR (Table 1) in a total reaction volume of 25 ml. The cycling
conditions were 60uC for 30 min., 95uC for 15 min., followed by
45 cycles at 94uC for 45 s, 57uC for 45 s, 72uC for 1 min., and
finally 72uC for 10 min. The PCR products were visualized by
agarose gel electrophoresis. Three controls were included for each
RT-PCR run: one positive and one negative tissue sample, and
one negative control in which water was substituted for RNA.
Sequencing
RNA was isolated from second passage by the Viral kit (Qiagen)
and RT-PCR was performed to amplify a 400-bp IPNV-specific
DNA fragment using Qiagen’s OneStep RT-PCR kit according to
the manufacturer’s instructions, with 0,5 mg RNA and 15 pmol
each of primers ASP500F and ASP1689R (Table 1) in a total
reaction volume of 25 ml. The cycling conditions were 50uC for
30 min., 95uC for 15 min., followed by 40 cycles at 94uC for 45 s,
57uC for 45 s, 72uC for 2 min.15 s, and finally 72uC for 10 min.
The PCR products were visualized by agarose gel electrophoresis.
To purify the PCR-product fragments from agarose gel, the
Quantum Prep Freeze N Squeeze DNA Gel Extraction Spin
Column (BIO-RAD) was used according to the manufacturer’s
instructions. The recovered PCR-product was sequenced by a
commercial sequencing service (Eurofins MWG operon) using
primer ASp500F (Table 1). The sequence data were analyzed
using PC/Gene (Intelligenetics) software.
Expression of immune-related genes
To assess the stress effect on the immune response, real-time
RT-PCR was carried out on kidney samples for a defined set of
genes that included IFN-a1. mRNA expression of RAG-1, IgM,
and TcR was evaluated at time of challenge (0.2 g size) and at 1 g
and 2 g size. Elongation factor 1awas used as the reference genes
for all gene tested. Expression of the viral polymerase (VP1) was
used to document and assess IPNV replication at different time
points (see below). In small fry (,1 g) whole fish were examined as
it is impossible to dissect kidney tissue at this size. For larger fish
(.1 g) kidney tissue were sampled on RNAlater and homogenized
by metal beads (2.0 mm) in 700 RTL buffer containing 2-
mercaptoethanol by mix-miller. RNA was isolated from all
samples using the RNeasy Mini kit in accordance with the
supplier’s protocol (Qiagen).
The RNA concentration was measured using a ND-1000
Spectrophotometer (NanoDrop Technologies, Wilmington, DE,
USA). 600 ng of total RNA was used for the production of cDNA,
utilizing the Superscript III Reverse Transcriptase (Invitrogen)
according to protocol for random hexamer primed cDNA
synthesis. The samples were denatured at 65uC for 5 min, before
the remaining components were added. The RT-step was
performed at 50uC for 1 h, and finally the reaction was terminated
by heating to 70uC for 15 min. Real-time PCR was run on the
LightCycler 2.0 instrument using LightCyclerHFastStart DNA
Master PLUS SYBR Green I (Roche Diagnostics).
All real-time PCR runs were performed in duplicate and each
real-time PCR master mix contained 5 ml water, 0.5 ml of each
primer, 2 ml enzyme mix and 2 ml template. PCR conditions
comprised of an initial incubation at 95uC for 10 min to activate
hot-start polymerase followed by 40 cycles of 95uC for 10 s,
annealing for 10 s and extension at 72uC. Primer sequences and
other experimental conditions used for real-time PCR amplifica-
tion are shown in Table 1. Melting curve analysis was performed
to assess the specificity of PCR products, and all products were
additionally tested by agarose gel electrophoresis to confirm the
correct size of each product. Data analyses were performed using
the LightCycler software version 4.0. The crossing points (Cp) was
determined by use of the maximum second derivative function on
the LightCyclerHSoftware, and analyses of relative gene-
expression, (elongation factor-1a; EGF-1a), were done with
efficiency correction using external standards.
Circulating antibodies
96-well microtiter plates were coated with 0.1 ml per well of a
polyclonal rabbit anti-IPNV [19] onto 96 micro-titer plates
(Immunoplates, Nunc Maxisorb, Denmark) at a dilution of
1:5000. The coated plates were incubated overnight at 4uC. This
was followed by three washing steps using 0.3 ml PBS/T (0.05%)
per well. 0.2 ml of 5% dry milk in PBS/T was added to each well
and the plates were left for incubation at room temperature for
two hours. After washing, 0.1 ml of plaque purified TA variant of
IPNV was added to each well. The virus was grown on RTG-2
cells, harvested when full CPE was observed, sterile filtered
Stress-Induced Reversion of IPNV
PLOS ONE | www.plosone.org 3 February 2013 | Volume 8 | Issue 2 | e54656
(0.22 mm) and diluted to a concentration of 1.0610
5
TCID
50
/ml in
1% dry milk. After washing 0.l ml of the diluted plasma controls,
blank (1% dry milk PBS/T), IPNV positive control sera and
dilutions of the test sera were added to the wells on the plate. The
test sera were diluted at 1:50. Six wells for each control were used
per plate. The plates were incubated at 4uC overnight. After
washing 0.1 ml of a mouse monoclonal (IgG) anti-rainbow trout
IgM [19] diluted at 1:5000 in 1% dry milk was added to each well.
The plates were left for incubation for 2 hrs at room temperature.
This was followed by washing and adding 0.1 ml of horseradish
peroxidase (HRP) conjugated anti-mouse IgG (Bio-Rad, USA)
diluted 1:5000 in 1% dry milk. After incubation and washing,
0.1 ml substrate solution (O-Phenylenediamine dihydrochloride
tablets produced by DAKO, dissolved in distilled water mixed
with 30% H
2
O
2
) was added to each well. Color development was
stopped by adding 0.05 ml H
2
SO
4
per plate. Results were read by
using a spectrophotometer ELISA reader (TECAN, Genios) at a
wavelength of 492 nm.
Protein concentration quantification
The Quick start Bradford protein Assay and 1X dye bovine
serum albumin (BSA) were used to determine the concentration of
serum samples according to the manufacturer’s instructions (Bio-
RAD). Samples were diluted 10 and 20 folds to measure the
protein concentration.
Virulence testing of in vivo reverted strains
The reverted T
217
A
22
isolates (3 isolates) and one isolate of the
non-reverted variant, T
217
T
221
, all reisolated from fish at
7 months post challenge, were tested for their in vivo virulence in
Atlantic salmon fry (0.5–0.8 g size). The titers were determined as
described above. A total of 1500 fish of wild salmon fry originating
from the river Rauma in Norway were used in the experiment.
The eggs came from brood fish kept in the living gene bank
(Haukvik) for more than 10 years. The eggs were hatched at
VESO Vikan’s hatchery, and transferred to the research station
when ready for start-feeding. Fish were divided into 15 tanks each
of 100 fry in triplicates tanks (T221T) 1610
5
TCID
50
/ml,
(T221A
1
)1610
4
TCID
50
/ml, (T221A
2
), 2610
5
TCID
50
/ml,
and (T221A
3
)1610
5
TCID
50
/ml. After one week of acclimati-
zation the fry were starved one day prior to challenge, performed
by administering a dose as mentioned above in a total volume of 2
liters per tank. There was no water exchange for 3 hours
(oxygenation directly into the tanks) after which normal water
flow resumed. All challenge materials were diluted to a total
volume of 10 ml in cell culture medium. In the control tanks only
cell culture media was added. Mortality was recorded on a daily
basis and dead fish were collected each day and frozen at 270uC.
They were analyzed by re-isolation of virus and sequenced using
the methods described above.
In vitro replication fitness
TO cells were seeded in 24-well plates and cultured until
confluent. Cells were treated with 2.5 mg/ml rIFN-a1 and left for
24 h after which parallel wells were infected with rNVI-015-TA
and rNVI-015-TT IPNV strains at MOI 1. Parallel TO cell
cultures not pretreated with rIFN-a1 and infected with the same
recombinant virus strains were included as controls. At 8, 24, 36,
Table 1. Primer used by RT-PCR.
Gene Name Direction Sequence (5–3)
Length of
amplicon(bp)
Annealing
temp.
Elongation factor 1 alfa (Elgfa) Elgf1aFwd GCTGTGCGTGACATGAGG 88 60
Rev ACTTTGTGACCTTGCCGC
Interferon alfa IFNa-1 IFNa-1 Fwd TGGGAGGAGATATCACAAAGC 163 60
Rev TCCCAGGTGACAGATTTCAT
Mx protein Mx Fwd TGCAACCACAGAGGCTTTGAA 78 60
Rev GGCTTGGTCAGGATGCCTAAT
IgM heavy chain membrane bound
form IgM
IgM Fwd TCTGGGTTGCATTGCCACTG 121 60
Rev GTAGCTTCCACTGGTTTGGAC
Recombination activating gene-1 RAG-1 Fwd CCTAACACCTCTAGGCTTGAC 103 60
Rev GCTTCCCTGTTTACTCGC
T cell receptor alpha chain TCAC Fwd GCCTGGCTACAGATTTCAGC 107 66
Rev GGCAACCTGGCTGTAGTAAGC
VP1 LVP1mPCR507 Fwd CTGGTCCAGAAACCCTAAGAC 506 60
RVP1mPCR1014 Rev GTGTGTATCTCTCCCCTTTTGG
RT-PCR primers
Infectious pancreatic necrosis virus, A
segment
IPNV1F Fwd ATCTGCGGAGTAGACATCAAAG 223 59
IPNV2R Rev TGCAGTTCTTCGTCCATCCC
Infectious pancreatic necrosis virus, A
segment
A-Sp500F Fwd CAAGGATGGTATTCACCG 1189 59
A-Sp1689R Rev AGCCTGTTCTTGAGGGCTC
This table shows primer sequences for genes tested by quantitivate real-time RT-PCR for mRNA expression. The primers used for RT-PCR for detection of IPNV genome
in kidney are given in the two last rows of the table.
doi:10.1371/journal.pone.0054656.t001
Stress-Induced Reversion of IPNV
PLOS ONE | www.plosone.org 4 February 2013 | Volume 8 | Issue 2 | e54656
48, and 60 h post infection, infected wells were harvested and virus
replication was assessed by real-time RT-PCR using VP1 and VP2
specific primers. The data was expressed as the mean fold change
in gene expression 6standard error of different dilutions of
interferon treated groups relative to non-treated control groups
after normalization with b-actin.
Modeling
Structural analysis of the VP2 capsid and generating of the 2D
and 3D structures was done by superimposing the Norwegian
IPNV Sp strain NVI-015 (GenBank accession nos. AY379740)
[20] on the template generated by Coulibaly et al. [21] (PDB
Accession code 3IDE) using the SWISS MODEL workspace [22].
All manipulations aimed at determining the location of residues
217, 221 and 247 on the generated crystal structures were carried
out in PyMOL v99.
Statistical analysis
All statistical analyses were performed with the help of
GraphPad Prism 5.0 (GraphPad software Inc., USA). One-way
ANOVA and Student’s t-test was used to calculate differences in
viral replication levels and gene expression levels as indicated for
each experiment. The significant level for rejection of Ho was set to
p,0.05.
Results
TA and TT variants of IPNV establish persistent infection
in fry
With the purpose to establish a persistent infection in fry and to
obtain a high number of surviving fish we used a challenge dose
lower than what is used in standard challenge experiments [10].
The cumulative mortality by 31 days was 12% for the TA infected
fish while for TT infected fish, cumulative mortality reached 4%
(Fig. 1). By one month post challenge the mortality leveled off in
both groups, with a small increase by months 3 and 4 post challenge
(cumulative mortalities during these 2 months were 10% in both
groups). By month 5 post challenge and beyond, no fish died.
TA and TT persistence does not result in genome
variation
In order to document the infection prevalence in the two groups
and persistence of infection we collected fry every month (every
30 days) from month 1–6 post infection. Five fish from each of the
TA and TT infected fish were examined at each time point
(n = 30, total per group) using cell culture (RTG-2 cells) and RT-
PCR. Overall IPN virus was reisolated by culture and detected by
RT-PCR in 29 of 30 fish in the TA group and in 30 of 30 fish
examined in the TT group (Table 2). All fish in both groups were
positive by culture 6 months post challenge. Fish that were found
negative by cell culture were subsequently examined by RT-PCR
(Table 2). These results showed that difference in mortality did not
result in differences in virus prevalence for the two groups.
With the purpose to detect any mutations on the hypervariable
region (HVR) of the VP2 protein (amino acid positions 180–360),
RNA isolated from kidney samples from each of the five fish from
each group at all sampling points was amplified by RT-PCR using
primers A-Sp500F and A-Sp1689R (Table 1). PCR-products were
purified by gel electrophoresis and sequenced. We found no
mutation at nucleotide level on the VP2-HVRs (amino acid
positions 199–319) in any of the groups up to 6 months post
challenge. The results for the TA and TT group at 6 months post
challenge are shown in Fig. 2A–B. Since automated sequencing
methods typically select the most prevalent nucleotide we also
performed a detailed analysis of the chromatograms after
sequencing with the purpose to detect any double peaks. We
had a particular focus on the TT infected group, since this virus
strain originated from serial passages in cell culture followed by
plaque purification. Again we found no complexity of the
sequences of viral genomes from either of the two groups (TA-
or TT-infected fish) over the persistence period, i.e. the
chromatograms appear with one peak in codons encoding
positions 217 and 221 of VP2 (as shown in Fig. 2A–B). We have
also pinpointed position 247 of VP2 since this residue was found to
vary with strain virulence in a previous study [10] and thus
positions 217, 221 and 247 are indicated to show the purity of the
chromatograms in TA and TT infected fish at 6 months post
challenge (Fig. 2A–B).
As there is a general understanding that immune responses will
result in selection of mutated variants [23] we examined the
immune status of the infected fry at time of infection (0.15 g size)
by analyzing the mRNA expression of RAG-1, T cell receptor
(TCR) and IgM (BCR) by real-time PCR. The finding was that all
fry examined exhibited no indication of mRNA gene expression of
TCR, RAG-1 or BCR at time of challenge (Fig. 3A–C) in line with
the understanding that Atlantic salmon fry below 1 g are not
immunocompetent. Larger fry from the same batch of fish (1.5
and 2 g) were included to document development of immuno-
competence (Fig. 3A–C) and a significant increase in IgM and
RAG-1 was found in 1 g fry while TCR showed significant
upregulation by 2 g size (Fig. 3C). Further we also included
analysis of antibody responses by a standard ELISA method to the
corresponding infection strains of the virus in the two groups and
found no indication of an antibody response in the persistently
infected fish at end of experiment (7 months post challenge)
(Fig. 4). We are thus inclined to interpret this as an indication that
the fish were immunotolerant to the challenge virus.
Stress results in down-regulation of IFN-a1 expression
and increased virus replication
We hypothesized that dampening the innate responses during a
persistent infection through artificially imposed stress (cortisol
responses) will result in increased viral replication and thus
contribute to increased diversity/mutations of the virus popula-
tion. One parallel tank from each challenge group (TA or TT) was
subjected to stressful treatment daily over a period of 7 days
(defined as stress-period) and samplings described below were
Figure 1. Mortality following primary challenge. The mortality in
groups of naı
¨ve fry challenged with a low dose the virulent TA variant of
IPNV shows a cumulative mortality of 12% while fish in the TT group
has a cumulative mortality of 4%.
doi:10.1371/journal.pone.0054656.g001
Stress-Induced Reversion of IPNV
PLOS ONE | www.plosone.org 5 February 2013 | Volume 8 | Issue 2 | e54656
done at the first day after the stress period was over, referred to as
day 1. Fish were monitored for an additional 28 days after the
stress period with weekly sampling. Uninfected control fish were
subjected to the same treatment while one group from each of the
challenged fish and the uninfected controls were kept as non-
stressed controls.
The biological effects of stress are not easily assessed in an
objective manner in fingerlings of Atlantic salmon since blood
samples cannot easily be withdrawn from such small fish. We
therefore used infection prevalence, viral replication levels and also
assessed expression of innate genes as an indication of stress. Firstly
we measured virus prevalence by cell culture and RT-PCR. We
collected 6 fish weekly (after the stress period) for each of the virus
groups (TA and TT) and from stressed and non-stressed fish
(controls) over a 28 day period. The infection prevalence had
declined by 28 days in non-stressed fish irrespective of challenge
strain giving 4/6 virus-positive in the TA-group (1 culture positive)
and 3/6 in the TT-group (2 culture positive; Table 3). This was in
contrast to the stressed groups where all fish were found virus
positive by a combination of cell culture and RT-PCR, 5/6 culture
positive in the TA-group and 6/6 in the TT group. The difference
between virus positives in stressed and non-stressed groups is
however not significant (Table 3).
Virus replication was measured by real-time PCR using primers
specific for segment B (Table 1) and measured as relative
expression in the stressed groups relative to non-stressed controls.
There was a marked increase of virus replication by Day 1 for both
challenge groups, 19-fold for the TA group (p = 0.049) and 58 fold
for the TT-group (p = 0.045). IFN-a1 mRNA expression were
assessed by real-time RT-PCR (Table 1). We compared stressed
fish to non-stressed controls for both infected and uninfected
groups and we also compared the two infected groups to each
other, all at Day 1. Six fish were analyzed in each group (TA, TT,
and uninfected) and for each treatment, stressed and non-stressed
(36 fish total). In the stressed fish, down-regulation of IFN-a1
Table 2. Virus detection by cell culture and RT-PCR at persistent period (6 months).
Strains 1 month 2 months 3 months 4 months 5 months 6 months
CC RT-PCR CC RT-PCR CC RT-PCR CC RT-PCR CC RT-PCR CC RT-PCR
TA 5/5 Nd 3/5 2/2 0/5 4/5 2/5 3/3 2/5 3/3 5/5 Nd
TT 5/5 Nd 4/5 0/1 0/5 5/5 2/5 3/3 1/5 4/4 5/5 Nd
Result of reisolation by cell culture (CC) or detection of virus genome by reverse transcriptase PCR (RT-PCR). Numbers indicate positive/examined for the two methods.
When all fish in one group were positive by cell culture they were not examined by RT-PCR. When fish were negative for cell culture, they were subsequently examined
by RT-PCR. Strains indicate IPNV strains used for challenge and time points are time post challenge. Nd-not done.
doi:10.1371/journal.pone.0054656.t002
Figure 2. Chromatogram of TA- and TT-infected fish 6 months post challenge. Detail from chromatogram TA (A) and TT-infected (B) fish
(6 months post challenge) from the hypervariable region of VP2. The chromatograms show no mutation for amino acid residues 217, 221 and 247 of
VP2. Further there are no double-peaks for these positions. Details of sequencing methods are given in Materials and methods.
doi:10.1371/journal.pone.0054656.g002
Stress-Induced Reversion of IPNV
PLOS ONE | www.plosone.org 6 February 2013 | Volume 8 | Issue 2 | e54656
mRNA expression was significant for both TA (Fig. 5A) and TT-
infected groups (Fig. 5B) as well as for the uninfected fish (Fig. 5C).
Reversion to virulence occurs at the end of the stress
period
Re-isolation of virus and genome variation was assessed by
sequencing re-isolated virus or PCR products obtained directly
from kidney from 6 fish from each challenge group (TA and TT)
at days 1, 14 and 28 post stress in stressed and non-stressed groups
(24 fish total). For the TT-group we found no changes by day 1 or
day 14 (24 fish, non-stressed and stressed examined in total at
these time points, Fig. 6A–B). By Day 28 there was a non-
synonymous mutation in the stressed group in 3 out of 6 fish giving
a T221A (VP2) mutation for all three fish (Fig. 7A–C). This
resulted in a motif typical of a virulent T
217
A
221
variant of IPNV.
In the non-stressed group TT-infected fish, no mutation was found
by Day 28 (Fig. S1). In the TA-infected group (12 fish examined),
in both stressed and non-stressed individuals, no mutation was
found.
An interesting finding was that the chromatograms for the 3
mutated strains (T221A) were found without any double peaks or
mixes of nucleotides in the positions encoding residue 221 of VP2
(Fig. 7A–C). This was unexpected and it motivated us to compare
the virus replication level in kidney samples of reverted and non-
reverted fish of the TT group by isolating viral RNA directly from
tissue specimens. We examined virus replication by estimating the
expression of segment B of IPNV (encoding VP1; as described
above) by real-time PCR and we found a 1680-fold up-regulation
of virus load by day 28 in TA-reverted relative to the TT-non
reverted fish (Fig. 8) pointing towards highly contrasting replica-
tion capacities for the two strains. We therefore consider it likely
that the ‘‘purity’’ and lack of double-peaks of the chromatograms
for the reverted isolates is due to the clonal expansion of the
T221A variants which results in an exclusion of the TT variant.
TA strains are less sensitive to an IFN-a1 induced antiviral
state than TT variants in vitro
The findings reported above are indicative of the TA-variant
replicate to higher levels which results in an exclusion of the lesser
fit TT-variant of IPNV. Further, in light of recent publications
showing that IPNV has the ability to reduce/block IFNa-induced
responses in vitro [24,25] we examined replication differences
between TA and TT strains under IFNa-1 influence. We therefore
performed an in vitro study with the purpose to explore the
possibility that TA and TT strains differ in their sensitivity to IFN-
a1 induced antiviral responses. This could possibly shed light on
the differences observed in vivo. We did this by comparing
replication levels of TA and TT strains in macrophage cell line
from salmon (TO cells; [15]). We induced an antiviral state in the
cells by pretreating them with recombinant IFN-a1 [26] 24 hours
prior to infection also including untreated parallels. Interestingly,
we found that the TA strain had 23-fold higher replication level
than the TT strain at peak expression time (48 h post infection;
Fig. 9) indicating a difference in sensitivity to the antiviral state
induced by rIFN-a1 treatment. It should be noted that the
replication of both virus strains was markedly reduced compared
to untreated controls (15-20) fold lower for both strains compared
to non-IFNa-1 treated cells, not shown).
Reverted T221A variants are virulent to fry of salmon
Since no mortality was observed in the TA-reverted fish post
stress we decided to determine if the reverted strains were virulent
to susceptible fry of Atlantic salmon. The three virus strains
isolated from TA-reverted fish (originally infected with the TT
strain) were used to challenge fry at time of start feeding and a
parallel group of fry was challenged with the TT isolate. The
Figure 3. The mRNA expression of IgM, RAG-1 and TCR. The mRNA expression at different sizes of Atlantic salmon fry is indicated, showing no
expression at 0.15 g size with significant increase by 1.5 g for IgM and RAG-1 while TCR is significantly upregulated by 2 g. p,0.001, n = 6; One-way
Anova.
doi:10.1371/journal.pone.0054656.g003
Figure 4. Antibody measurement in TA and TT-infected fish.
ELISA results (7 months post challenge) in TA- and TT-infected fish
tested against TA antigen coat. Pos ctrl are positive controls (TA) and
neg ctrl are naı
¨ve fish. Blank is background without primary antibodies
added. n = 3. As serum is difficult to withdraw from so small fish, we
confirmed the protein concentration in the vials used and they were
found comparable at 1:50 dilution protein concentrations between 0.75
to1.75mg/ml.Thepositivecontrolfishsamplehadaprotein
concentration around 1.6 mg/ml at the same dilution. Samples were
adjusted to equal concentrations.
doi:10.1371/journal.pone.0054656.g004
Stress-Induced Reversion of IPNV
PLOS ONE | www.plosone.org 7 February 2013 | Volume 8 | Issue 2 | e54656
cumulative mortality at end of challenge was close to 30% and
0.7% for the TA- and TT-infected fish, respectively (Fig. 10),
showing that the reverted strains had recovered their virulent
traits. The third TA strain gave lower mortality (average 9%)
because of lower titer in the challenge inoculum (as a result of a too
high dilution was used at time of challenge). IPNV was also re-
isolated from challenged fish and their genome amplified by RT-
PCR for sequencing (segment A). The obtained sequences from re-
isolated virus were identical to the isolates used for challenge, both
for TA and TT strains (not shown).
Structural analysis of the VP2-HVRs
Positions 217, 221 and 247 were associated with virulence in
field strains of IPNV in a previous study [10] and pinned down to
residues 217 and 221 using reverse genetics [11]. To gain a better
understanding on the structural properties influencing virulence of
Sp strain NVI015, we analyzed the structural layout and impact of
mutational changes on residues influencing the virulence motif.
Structural analysis of the VP2 subviral particle (SVP) shows that
residue 217 and 221 are located on loop P
BC
on the P-domain of
the hypervariable region (HVR) of the VP2 capsid (Figure 11A).
Although 217 and 221 are four residues apart, the structural fold
on the backbone molecule brings these residues in close proximity
as shown on the 3D structure that these residues are located next
to each other (Figure 11B). This suggest that these residues
complement each other’s activity making them function as a single
motif. Structural layout of individual residues shows that threonine
both at 217 and 221 projects outwardly giving its hydrogen bonds
for potential binding to cell receptors. On the contrary, an alanine
at 221 projects its hydrogen bond inwardly towards the inner core
of the capsid protein leaving the non-reactive end to project
towards the outer surface of the protein capsid (Figure 11C). Put
together, two threonines at 217 and 221 having their hydrogen
bonds projecting outwardly towards each other (Figure 11D)
suggests that the T
217
T
221
motif has a higher binding potential
than the T
217
A
221
motif that has an alanine at 221 (Figure 11C).
Hence, a T221A mutation suggests that it could influence the
hydrophobicity property of the virulence motif.
Discussion
In this study we show that attenuated IPNV virus strains
establish a persistent infection and revert to virulence following
stress exposure of Atlantic salmon fry. Stress lowers the expression
of IFNa, which seem to reduce the anti-viral state and allows for
increased replication levels of IPNV. The reverted variant,
T
217
A
221
, has superior replication capacity which leads to a
purifying selection and a complete dominance over the T
217
T
221
variant in vivo. Concordant with in vivo findings, the T
217
A
221
variant replicates under high levels of IFNain vitro and was partly
resistant to rIFN-a1 induced antiviral responses. This could
provide an explanation for what appears as a competitive
exclusion in vivo.
As pointed out by Betts and Russell [27] that threonines are
quite common on protein functional sites and it is likely that the
strategic location of threonine at 217 and 221 is indicative of its
functional involvement in binding to host cell receptors. Besides,
threonine has been reported to have variable binding abilities and
intracellular threonines can be phosphorylated while in extracel-
lular environments they can be O-glycosylated enabling their
attachment to different receptors [27]. On the other hand, it has
been shown that alanine is a less reactive residue with its side
Table 3. Virus detection by cell culture and RT-PCR post stress.
Strain/treatment 1 day post stress 14 days post stress 28 days post stress
CC RT-PCR CC RT-PCR CC RT-PCR
TA/non-stressed 6/6 0 6/6 0 1/6 3/5
TA/stressed 6/6 0 6/6 0 5/6 1/1
TT/non-stressed 6/6 0 3/6 3/3 2/6 1/4
TT/stressed 5/6 1/1 4/6 2/2 6/6 0
Number of fish found positive by cell culture (cc) and reverse transcriptase PCR (RT-PCR) at different time points after the stress period was completed for the TA and TT
infected groups. Fish negative by cell culture were subsequently examined by RT-PCR. Results for non-stressed controls and stressed groups are given and show that
stress results in higher number of virus positive fish by cell culture at 28 days post stress. N = 6 per group.
doi:10.1371/journal.pone.0054656.t003
Figure 5. Expression of IFN-a1 mRNA in TA-, TT-infected and control fish. IFN-a1 mRNA expression in TA (A) and TT (B) infected, non-
stressed and stressed fish is shown. IFNa-1 expression in uninfected fish after stress exposure is also shown (C). Stress down-regulates expression of
IFN-a1 in infected fish and also in uninfected controls. P values are indicated, one-sided T-test (+SEM; n = 5 to 6 fish per group).
doi:10.1371/journal.pone.0054656.g005
Stress-Induced Reversion of IPNV
PLOS ONE | www.plosone.org 8 February 2013 | Volume 8 | Issue 2 | e54656
Figure 6. Chromatogram of TT-infected fish 1 and 14 days post stress. Details from chromatogram of TT-infected fish at 1 day (A) and
14 days (B) post stress. Area indicated is from the hypervariable region of VP2. The chromatograms show that amino acid positions 217, 221 and 247
remain unchanged. Further there are no double-peaks in codons of any of these residues.
doi:10.1371/journal.pone.0054656.g006
Figure 7. Chromatograms for TT-reverted fish at 28 days post stress. Details from chromatogram of three TT-infected fish at 28 days post
stress. Codons encoding amino acid residues 217, 221 and 247 are detailed and show reversion at amino acid residue 221. Noticeably, there are no
double-peaks in codons of any of these residues.
doi:10.1371/journal.pone.0054656.g007
Stress-Induced Reversion of IPNV
PLOS ONE | www.plosone.org 9 February 2013 | Volume 8 | Issue 2 | e54656
chains being less likely to attach to cell receptors and has the
tendency to project inwardly towards the inner core of the protein
[27,28] which is in line with our observation on A221 (Fig. 11). Put
together, these observations suggest that the T
217
T
221
motif is
likely to have a higher binding ability than T
217
A
221
to cell
receptors. However, how the apparently weaker T
217
A
221
with less
binding potential is translated into higher replication capacity,
1680 times higher than the T
217
T
221
, is not clear. Bauer et al [29]
reported a similar observation that substituting an alanine for
valine at position 296 on the VP1 capsid of polyomavirus reduced
the binding avidity of the virus. Site directed mutagenesis showed
that introducing A296 showed full virulence while V296 that had a
higher binding avidity and reduced virulence [29,30]. In their
observation, Bauer et al [29] noted that too strong an avidity for a
receptor could inhibit virus escape from infected cells resulting in
less efficient release of virus from bound receptors. To enhance
virus release, viruses like influenza depend on enzymes like
neuraminidase which is a receptor-destroying-enzyme used to aid
virus release and facilitate its spread to other cells as a way of
enhancing virulence [31,32]. Therefore, small changes in receptor
avidity, for viruses such as polyomavirus and IPNV that do not
have receptor-destroying enzymes could have a significant effect
on virus release from bound cell-receptors. Hence, in the present
study a T
217
T
221
motif with high binding potential entails reduced
efficiency in the release of virus bound to cell receptors
subsequently leading to persistent infections due to failure or slow
release of virus. This phenomenon supports our earlier findings in
which we documented that a threonine at 221 was linked to IPNV
persistent infections [11]. On the contrary, it is likely that a
mutation from a threonine to an alanine, which is less reactive, at
221 reduces the binding avidity leading to efficient release of the
virus which may enhance its spread and increase in replication
capacity. Hence, stress induced mutation from T221A could have
reduced the strong binding avidity of the T217T221 motif to a low
binding motif. Put together, the high replication capacity and
ability of the reverted T
217
A
221
variant to produce higher
mortality (30%) than the T
217
T
221
variants (0.7%), could explain
factors leading to recrudescence from persistent infections to active
infections seen under field conditions. IPN is often stress associated
especially in postmolts in which outbreaks occur soon after transfer
to seawater [7,33]. However, there is need for detailed studies
aimed at identifying and characterizing the IPNV cell-receptor in
order to enhance our understanding of the process of virus entry
and release, and to fully elucidate how these polymorphisms play
an important role in disease progression.
Yet another aspect is the possibility that an alanine at position
221 represents improved translation efficiency developed as an
adaptation to the host. It is known that codon usage can impact
translation efficiency and this is seen particularly for proteins that
appear abundantly in the virion, typically structural proteins [34].
Translation efficiency can also relate to GC content of the host
genome and RNA folding processes [35,36]. The possibility of the
tRNA population is biased towards tRNA-Ala over tRNA-Thr
should also be considered but to the knowledge of the authors,
little is known about these factors in Atlantic salmon.
No mutation was found by sequencing in persistently infected
fish over a period of 6 months. The initial challenge was
performed in fry at a physiological state where no recombination
of TCR or BCR genes had occurred, i.e. infection was carried out
prior to immunocompetence had developed and in line with these
findings no antibody responses were detected in persistently
infected fish at 7 months post challenge. The general understand-
ing is that persistence typically occurs as a result of changes in
Figure 8. Viral replication in TA-reverted and non-reverted TT
infected fish. Relative viral expression at 28 days post stress in three
TA-reverted versus three non-reverted fish of the group originally
infected with the TT-strain. Relative replication levels in the TA-reverted
fish are 1680-times higher than in the TT-individuals. P-value, one-sided
T-test; n = 3, log
2
values.
doi:10.1371/journal.pone.0054656.g008
Figure 9. Recombinant IFN-a1 effect on viral replication of TA
and TT infected TO cells. Viral replication levels (VP1 expression) at
different time post infection (hours post infection; hpi) of TO cells,
pretreated (24 h) with recombinant IFN-a1. The TA strain shows earlier
increase of replication levels (24 hpi) and peak at 48 hpi at 23-fold
higher replication levels than the TT-strain at this time point. N = 3–4
replicates per time point.
doi:10.1371/journal.pone.0054656.g009
Figure 10. Cumulative mortality induced by reverted virus
strains. The cumulative mortality in the fish groups challenged with
the TA-reverted strains reached close to 30% while the TT-challenged
fish were not different from non-infected controls. Mortality leveled off
at day 26 post challenge. Three parallel tanks for each challenge group,
plus non-challenged controls (not shown).
doi:10.1371/journal.pone.0054656.g010
Stress-Induced Reversion of IPNV
PLOS ONE | www.plosone.org 10 February 2013 | Volume 8 | Issue 2 | e54656
antigenic epitopes induced by adaptive immune responses while in
the absence of immune pressure there should be less variation [37–
39]. The observed lack of genomic variability for both TA and TT
infected groups concurs with the observation that infected fish had
no circulating antibodies, i.e. lack of selective pressure. Our
interpretation has been that fish are immunotolerant to the virus
as suggested earlier for IPNV infected fish [40]. However
immunotolerance is a highly specific, adaptive immune response
and innate responses will still contribute to keep the virus
replication in check. Hanada and coworkers [41] discuss the
possibility that replication frequency contribute more importantly
to genetic variability than replication error per se since the error
rate is more or less constant for most viruses. The observation that
the TT variant revert to wild-type after stress-induced modulation
of the innate immune responses is interesting, particularly since
this can be linked to increased replication frequency.
Another factor that possibly contributes to the dominance of TA
over TT is the lesser sensitivity to IFN-a1 induced antiviral
responses. The inhibitory activity of Mx on IPNV replication has
been documented earlier [42] however differences between strains
of IPNV were not explored. Here we showed that the replication
capacity of the TA strain was higher than the TT variant, peaking
at 23-fold higher by 48 h post infection still much lower than what
was seen for cell cultures not pretreated with IFNa-1.
The T
217
T
221
strain was made by serial passage in cell culture
(CHSE) resulting in mutation at position 221 of VP2 followed by
plaque purification [11,27]. In vivo stress caused increased virus
replication and mutation to T
217
A
221
. Reversion to wild-type is a
known phenomenon for many viruses. In our study one cannot
exclude the possibility that the plaque purified variant used for
challenge of the TT group also contained a minority of clones of a
TA variant and thus the TA found in the stressed TT group would
merely represent a purifying selection of clones that were already
present at the time of challenge. We do however consider this less
likely based on the fact that the persistent infection was established
through challenge of naı
¨ve fish. The general experience is that
experimental challenge of susceptible fry will favor the most fit
variant and thus it is highly likely that a TA variant present at low
number in for example a TT biased population would take
dominance over the less fit variant. Further the fish were followed
over a period of 6 months prior to stress-exposure and not one
single isolate sequenced in the TT group showed any indication of
nucleotide diversity at the codon encoding residue 221 of VP2.
Sequencing of PCR products represents a selection step where the
more prevalent variants would be favored. However, it is currently
a standard method used for sequencing of viruses, particularly
when combined with examination of chromatograms [23].
Concluding, we show here for the first time that attenuated
virus variants of IPNV can revert to virulence in vivo and that stress
plays a key role in facilitating increased viral replication with
subsequent mutation and reversion to a virulent form.
Supporting Information
Figure S1 Chromatograms for TT infected, non-stressed
groups. Non-stressed fish originally infected with the TT strain
showed no mutation in position encoding residue 221 of VP2.
Example from two individual fish examined at this time point.
(TIF)
Author Contributions
Conceived and designed the experiments: NS OE. Performed the
experiments: KG AS. Analyzed the data: KG AS ISM OE HMM.
Contributed reagents/materials/analysis tools: KG AS IS NS HMM.
Wrote the paper: OE KG ISM HMM.
References
1. Evensen O, Santi N (2008) Infectious pancreatic necrosis virus. In: Mahy BWJ,
van Regenmortel MVH, editors. In encyclopedia of virology 3rd virology edn.
Elsevier: Oxford. pp. 83–89.
2. Bootland LM, Dobos P, Stevenson RMW (1991) The IPNV carrier state and
demonstration of vertical transmission in experimentally infected broo k trout.
Dis Auat Org 10: 13–21.
3. Johansen LH, Sommer AI (1995) Multiplication of infectious pancreatic necrosis
virus (IPNV) in head kidney and blood leukocytes isolated from Atlantic salmon,
Salmo salar L. J Fish Dis 18: 147–156.
4. Verani A, Gras G, Pancino G (2005) Macrophages and HIV-1: dangerous
liaisons. Mol Immunol 42: 195–212.
5. Knott RM, Munro ALS (1986) The persistence of infectious pancreatic necrosis
virus in Atlantic Salmon. Vet Immunol Immunopathol 12: 359–364.
Figure 11. Crystal structure of the VP2 subviral particle (SVP).
A) Shows the P, S and B domains of the VP2-SVP while spheres
represent locations of residues 217 (red), 221 (blue) and 247 (green).
Note that all three residues are located on the VP2-HVRs of the P-
domain. Residues 217 and A221 are close to each other on loop P
BC
which is the outermost loop of the VP2-HVRs while T247 is on the apex
of loop P
DE
.B) Displays positions 217, 221 and 247 on the 3D SVP. Note
that positions 217 and 221 are next to each other. C) 2D cartoon of the
T
217
A
221
motif with an alanine at 221 projecting its hydrogen bond (red)
inwardly towards the inner core of the capsid protein (green) while the
non-reactive end projects outwardly towards T217. D) 2D cartoon of
the T
217
T
221
motif. Note the curving of loopP
BC
bringing positions 217
and 221 close to each other. Note also the two threonines projecting
out their hydrogen bonds (red) outwardly and are proximal to each
other.
doi:10.1371/journal.pone.0054656.g011
Stress-Induced Reversion of IPNV
PLOS ONE | www.plosone.org 11 February 2013 | Volume 8 | Issue 2 | e54656
6. Lockhart K, Bowden TJ, Ellis AE (2004) Poly I: C-induced Mx responses in
Atlantic salmon parr, post-smolts and growers. Fish Shellfish Immunol 17: 245–
254.
7. Jarp J, Gjevre AG, Olsen AB, Bruheim T (1995) Risk factors for furunculosis,
infectious pancreatic necrosis and mortality in post-smolt of Atlantic salmon,
Salmo salar L. J Fish Dis 18: 67–78.
8. Murray AG, Busby CD, Bruno DW (2003) Infectious pancreatic necrosis virus in
Scottish Atlantic salmon farms, 1996–2001. Emerg Infect Dis 9: 455–460.
9. Taksdal T, Ramstad A, Stangeland K, Dannevig BH (1998) Induction of
infectious pancreatic necrosis (IPN) in covertly infected Atlantic salmon, Salmo
salar L., post smolts by stress exposure, by injection of IPN virus (IPNV) and by
cohabitation. J Fish Dis 21: 193–204.
10. Santi N, Vakharia VN, Evensen O (2004) Identification of putative motifs
involved in the virulence of infectious pancreatic necrosis virus. Virology 322:
31–40.
11. Song H, Santi N, Evensen O, Vakharia VN (2005) Molecular determinants of
infectious pancreatic necrosis virus virulence and cell culture adaptation. J Virol
79: 10289–10299. 79/16/10289 [pii]; doi:10.1128/JVI.79.16.10289-
10299.2005.
12. Hedrick RP, Leong JC, Fryer JL (1978) Persistent infections in salmonid fish cells
with infectious pancreatic necrosis virus (IPNV). J Fish Dis 1: 297–308.
13. Mangunwiryo H, Agius C (1988) Studies on the carrier state of infectious
pancreatic necrosis virus infections in rainbow trout, Salmo gairdneri Richardson.
J Fish Dis 11: 125–132.
14. Santi N, Sandtro A, Sindre H, Song HC, Hong JR, et al. (2005) Infectious
pancreatic necrosis virus induces apoptosis in vitro and in vivo independent of
VP5 expression. Virology 342: 13–25.
15. Wergeland HI, Jakobsen RA (2001) A salmonid cell line (TO) for production of
infectious salmon anaemia virus (ISAV). Dis Aquat Organ 44: 183–190.
16. Yao K, Vakharia VN (1998) Generation of infectious pancreatic necrosis virus
from cloned cDNA. J Virol 72: 8913–8920.
17. Santi N, Song H, Vakharia VN, Evensen O (2005) Infectious pancreatic necrosis
virus VP5 is dispensable for virulence and persistence. J Virol 79: 9206–9216.
18. Ka¨ rber G (1931) Beitrag zur kollekti ven Behandlung Pharmakologischer
Reihenversuche. Archiv Experimen Pathol Pharmakol 162: 761–772.
19. Thuvander A, Fossum C, Lorenzen N (1990) Monoclonal antibodies to salmonid
immunoglobulin – Characterization and applicability in immunoassays. Dev
Comp Immunol 14: 415–423.
20. Coulibaly F, Chevalier C, Gutsche I, Pous J, Navaza J, et al. (2005) The
birnavirus crystal structure reveals structural relationships among icosahedral
viruses. Cell 120: 761–772.
21. Coulibaly F, Chevalier C, Delmas B, Rey FA (2010) Crystal structure of an
aquabirnavirus particle: Insights into antigenic diversity and virulence
determinism. J Virol 84: 1792–1799.
22. Arnold K, Bordoli L, Kopp J, Schwede T (2006) The SWISS-MODEL
workspace: a web-based environment for protein structure homology modelling.
Bioinformatics 22: 195–201.
23. Fishman SL, Factor SH, Balestrieri C, Fan XF, DiBisceglie AM, et al. (2009)
Mutations in the hepatitis C virus core gene are associated with advanced liver
disease and hepatocellular carcinoma. Clin Cancer Res 15: 3205–3213.
24. Collet B, Munro ES, Gahlawat S, Acosta F, Garcia J, et al. (2007) Infectious
pancreatic necrosis virus suppresses type I interferon signalling in rainbow trout
gonad cell line but not in Atlantic salmon macrophages. Fish Shellfish Immunol
22: 44–56.
25. Skjesol A, Aamo T, Hegseth MN, Robertsen B, Jorgensen JB (2009) The
interplay between infectious pancreatic necrosis virus (IPNV) and the IFN
system: IFN signaling is inhibited by IPNV infection. Virus Res 143: 53–60.
26. Xu C, Guo TC, Mutoloki S, Haugland O, Marjara IS, et al. (2010) Alpha
interferon and not gamma interferon inhibits salmonid alphavirus subtype 3
replication in vitro. J Virol 84: 8903–8912.
27. Betts MJ, Russell RB (2003) Amino acid prpoerties and consequences of
substitutions. In: Barnes MR and Gray IC, editors Bioinformatics for Genetists
John Wiley and Son Ltd 289–316.
28. Lodish H, Berk AZSL, Matsudaira P, Baltimore D, Darnell J (2000) Protein
Structure and Function. In: Molecular Cell Biology, 4th Edition W H Freeman,
New York.
29. Bauer PH, Bronson RT, Fung SC, Freund R, Stehle T, et al. (1995) Genetic and
structural-analysis of a virulence determinant in polyomavirus VP1. J Virol 69:
7925–7931.
30. Freund R, Garcea RL, Sahli R, Benjamin TL (1991) A single amino acid
substitution in polyomavirus VP1 correlates with plaque size and hemaggluti-
nation behavior. J Virol 65: 350–355.
31. Liu CG, Eichelberger MC, Compans RW, Air GM (1995) Influenza type A
virus neuraminidase does not play a role in viral entry, replication, assembly, or
budding. J Virol 69: 1099–1106.
32. Palese P, Tobita K, Ueda M, Compans RW (1974) Characterization of
temperature sensitive influenza virus mutants defective in neuraminidase.
Virology 61: 397–410.
33. Roberts RJ, Pearson MD (2005) Infectious pancrea tic necrosis in Atlantic
salmon, Salmo salar L. J Fish Dis 28: 383–390.
34. Bahir I, Fromer M, Prat Y, Linial M (2009) Viral adaptation to host: a
proteome-based analysis of codon usage and amino acid preferences. Mol Syst
Biol 5: 311. msb200971 [pii]. doi:10.1038/msb.2009.71.
35. Brower-Sinning R, Carter DM, Crevar CJ, Ghedin E, Ross TM, et al. (2009)
The role of RNA folding free energy in the evolution of the polymerase genes of
the influenza A virus. Genome Biol 10: R18. gb-2009-10-2-r18 [pii].
doi:10.1186/gb-2009-10-2-r18.
36. Kudla G, Murray AW, Tollervey D, Plotkin JB (2009) Coding-sequence
determinants of gene expression in Escherichia coli. Science 324: 255–258. 324/
5924/255 [pii]. doi:10.1126/science.1170160.
37. Grimm D, Staeheli P, Hufbauer M, Koerner I, Martinez-Sobrido L, et al. (2007)
Replication fitness determines high virulence of influenza A virus in mice
carrying functional Mx1 resistance gene. Proc Natl Acad Sci U S A 104: 6806–
6811.
38. Moreno-Gonzalez E, Meneu-Diaz JC, Garcia G, Romero CJ, Segurola CL, et
al. (2003) Simultaneous liver-kidney transplant for combined renal and hepatic
end-stage disease. Transplant Proc 35: 1863–1865.
39. Schvoerer E, Thumann C, Soulier E, Royer C, Fafi-Kremer S, et al. (2006)
Recurrence of hepatitis C virus (HCV) infection after liver transplantation for
HCV-related disease: host factors and viral factors implicated in the occurrence
and the severity of HCV recurrence. Pathol Biol 54: 556–560.
40. Sadasiv EC (1995) Immunological and pathological responses of salm onids to
infectious pancreatic necrosis virus (IPNV). Annu Review Fish Dis 5: 209–223.
41. Hanada K, Suzuki Y, Gojobori T (2004) A large variation in the rates of
synonymous substitution for RNA viruses and its relationship to a diversity of
viral infection and transmission modes. Mol Biol Evol 21: 1074–1080.
42. Larsen R, Rokenes TP, Robertsen B (2004) Inhibition of infectious pancreatic
necrosis virus replication by Atlantic salmon Mx1 protein. J Virol 78: 7938–
7944.
Stress-Induced Reversion of IPNV
PLOS ONE | www.plosone.org 12 February 2013 | Volume 8 | Issue 2 | e54656
