No full-text available
To read the full-text of this research,
you can request a copy directly from the authors.
Both Apolipoprotein E and A-I Genes are Present in a Nonmammalian Vertebrate and are Highly Expressed during Embryonic Development
Abstract
Apolipoprotein E (apoE) is associated with several classes of plasma lipoproteins and mediates uptake of lipoproteins through
its ability to interact with specific cell surface receptors. Besides its role in cardiovascular diseases, accumulating evidence
has suggested that apoE could play a role in neurodegenerative diseases, such as Alzheimer disease. In vertebrates, apoA-I
is the major protein of high-density lipoprotein. ApoA-I may play an important role in regulating the cholesterol content
of peripheral tissues through the reverse cholesterol transport pathway. We have isolated cDNA clones that code for apoE and
apoA-I from a zebrafish embryo library. Analysis of the deduced amino acid sequences showed the presence of a region enriched
in basic amino acids in zebrafish apoE similar to the lipoprotein receptor-binding region of human apoE. We demonstrated by
whole-mount in situ hybridization that apoE and apoA-I genes are highly expressed in the yolk syncytial layer, an extraembryonic structure implicated in embryonic and larval nutrition.
ApoE transcripts were also observed in the deep cell layer during blastula stage, in numerous ectodermal derivatives after
gastrulation, and after 3 days of development in a limited number of cells both in brain and in the eyes. Our data indicate
that apoE can be found in a nonmammalian vertebrate and that the duplication events, from which apoE and apoA-I genes arose, occurred before the divergence of the tetrapod and teleost ancestors. Zebrafish can be used as a simple and
useful model for studying the role of apolipoproteins in embryonic and larval nutrition and of apoE in brain morphogenesis
and regeneration.
... Highly expressed genes are considered to be of potential biological importance and appear to be multifunctional, and hence, any dysfunction in such a gene will most likely have a large impact on the development of abilities during the postnatal and juvenile period. [55][56][57][58][59][60][61][62][63] Phenotypes derived from mutational studies of these genes can contribute to more knowledge regarding the functions of hippocampus. ...
... 68,69 Previous gene expression studies on postnatal development in mouse hippocampus have mainly focused on the response to a specific exposure, for example, ethanol, iron, and nicotine exposure, [75][76][77][78][79] or a specific gene expressed during postnatal development and/or in the context of a specific neurological disease or disorder. 25,62,65,66,[80][81][82][83][84][85] The study by Mody et al 86 focused on genes differentially expressed between different time points during postnatal development (<30 PD) in mouse hippocampus, but did not include any analysis of genes highly expressed over several time points nor relating the results to phenotypic data. Similarly, the study by Iacono et al 87 focused on genes differentially expressed during different PDs in mouse hippocampus, with the added dimension of studying single-cell RNA-seq data from various hippocampal cell types but did not include any analysis of highly expressed genes nor mpO indicates mammalian phenotype ontology; UHEG, unique highly expressed genes. ...
... As previously described highly expressed genes appear to be multifunctional and that is also shown in the results here. [55][56][57][58][59][60][61][62][63] A mutation in as many as 151 of these genes can lead to a fatal outcome primarily before or shortly after birth. Hence, the abnormal phenotype of their alleles suggests that they are involved in proper embryo development and infant survival. ...
The hippocampus has been shown to have a major role in learning and memory, but also to participate in the regulation of emotions. However, its specific role(s) in memory is still unclear. Hippocampal damage or dysfunction mainly results in memory issues, especially in the declarative memory but, in animal studies, has also shown to lead to hyperactivity and difficulty in inhibiting responses previously taught. The brain structure is affected in neuropathological disorders, such as Alzheimer’s, epilepsy, and schizophrenia, and also by depression and stress. The hippocampus structure is far from mature at birth and undergoes substantial development throughout infant and juvenile life. The aim of this study was to survey genes highly expressed throughout the postnatal period in mouse hippocampus and which have also been linked to an abnormal phenotype through mutational studies to achieve a greater understanding about hippocampal functions during postnatal development. Publicly available gene expression data from C57BL/6 mouse hippocampus was analyzed; from a total of 5 time points (at postnatal day 1, 10, 15, 21, and 30), 547 genes highly expressed in all of these time points were selected for analysis. Highly expressed genes are considered to be of potential biological importance and appear to be multifunctional, and hence any dysfunction in such a gene will most likely have a large impact on the development of abilities during the postnatal and juvenile period. Phenotypic annotation data downloaded from Mouse Genomic Informatics database were analyzed for these genes, and the results showed that many of them are important for proper embryo development and infant survival, proper growth, and increase in body size, as well as for voluntary movement functions, motor coordination, and balance. The results also indicated an association with seizures that have primarily been characterized by uncontrolled motor activity and the development of proper grooming abilities. The complete list of genes and their phenotypic annotation data have been compiled in a file for easy access.
... However, there is a limited number of transgenic fish developed for studying ApoEb expression in vivo, with zebrafish being the only one (Ham et al., 2014;Peri and Nusslein-Volhard, 2008), and no data found on medaka fish. Currently, whole mount in-situ hybridization technique has been the most reliable method used for studying ApoE expression pattern in the fish model (Yasuda et al., 2017;Babin et al., 1997;Otis et al., 2015). ...
... Apolipoprotein E (ApoE) has been related to several classes of plasma lipoproteins. It mediates the uptake of lipoprotein via the interaction with specific cell surface receptors (Babin et al., 1997). Besides playing a role in cardiovascular disease, there is increasing evidence that ApoE may involve in neurodegenerative disorder such as Alzheimer's disease (Mahley, 2016a). ...
... By looking into evolutionary distance of ApoEb gene, it is further believed that Japanese medaka shares a common ancestor with striped beakfish, as corresponding to the high percentage of similarity and identity. The ApoEa and ApoEb found in teleost might have undergone sub-functionalization, as recent studies in zebrafish of ApoE gene using whole-mount in situ hybridization showing that ApoEa was mainly localized in the yolk syncytial layer and intestine while ApoEb was found to be widespread (Babin et al., 1997, ), not only in yolk syncytial layer and intestine but also in tail bud, apical ectodermal ridge, head, mouth, nose orifices, fin buds, pharynx, gill arches, periderm, retina, and swim bladder (Otis et al., 2015). ...
Radiotherapy has been known as one of the effective treatments for a brain tumor, yet a relatively high dose of radiation is more likely to cause harmful side effects especially in a developing brain. Clinical studies reveal that neurons damage and inflammatory responses tend to happen after radiotherapy, in which microglia has been considered to be significantly involved after the treatment. Microglia are immunocompetent cells in the brain. They ubiquitously exist in the neural parenchyma and constantly surveying their microenvironment for pathogens and apoptotic neurons under normal brain condition. Upon a brain injury, they change their morphology from ramified (resting state) to amoeboid (activated state), migrating toward the apoptotic cells and actively release Apolipoprotein (Apo) E as to increase their efficiency in clearing the dead neuronal cells which are high in cholesterol. Substantial activation of microglia has been suggested to eventually cause chronic brain inflammation. To better understand the radiation effects towards ApoEb-expressing microglia in a developing brain, we developed a pApoEb-Kaede transgenic medaka and used it for radiation effects analysis. In this transgenic medaka, we incorporate Kaede fluorescent gene that can photoconvert from green to red after being exposed to UV. We observed two activation phases of ApoEb-expressing microglia at 48 hrs and 96 hrs respectively after 10 Gy γ-ray irradiation at 3 dpf (stage 28). This finding was further supported by the emerging of newly activated microglia with Kaede green at 80 hrs after irradiation, as all the first activated ApoEb-expressing microglia had been fully photoconverted to red color at 50 hrs time point. Statistical analysis results of cytokine expression (proinflammatory: IL-1β, TNF-α; anti-inflammatory: IL-10, TGF-β1) reveal that IL-1β might be a key mediator, especially from 24 hrs onward after irradiation. The radiation effects analysis suggests that this pApoEb-Kaede transgenic medaka can serve as a useful model for future investigations in identifying and studying the mechanisms whereby ApoEb-expressing microglia are involved after brain radiotherapy.
... However, certain apolipoproteins are also required for normal embryonic or ontogenic development and tissue regeneration [13][14][15]. Till date only few reports have been published on the structures of ApoE from fish, such as zebrafish [16], rainbowtrout [17], turbot [18], pufferfish [4], and spotted barbel [19]. ...
... Comparative analysis of Eb-apoE aa sequence that of other vertebrates revealed that Eb-apoE showed higher levels of identity with their corresponding orthologs from teleosts than from mammals. For instance, zebrafish ApoE and ApoA-I showed 27.5% and 25% identities to human [16]. In rainbow trout and spotted barbel ApoEs showed 28% and 26% sequence identity with human ApoE, respectively [17,19]. ...
... In addition, fish specific apolipoprotein gene, apo-14, was first transcribed in gastrula embryos in Gibel carp [51] and in neurula embryos in grouper [15] and maintained a relatively stable expression level during the following embryogenic stages. Similarly in grouper apoC-I also showed a similar expression pattern with the grouper apo-14 gene [52] whereas the expression of zebrafish apoE gene started at the blastula stage and was very strong in the yolk syncytial layer from this very early development stage until larval development [16]. The transcripts of fish apolipoproteins were at a very high level during embryonic and early larval development in the YSL suggested that lipoprotein-secreting tissue which is playing an essential role in the transport of yolk nutrients to the developing embryo [15,16,18,51,52]. ...
Apolipoproteins is the protein components of plasma that bind to lipids to form lipoprotein particles and have been shown to play an important role in lipid transport and uptake. In the present study, a full-length cDNA for apolipoprotein E, named ApoE, was cloned from the kelp grouper, Epinephelus bruneus (Eb-apoE). This cDNA sequence is 1619 base pairs (bp) length and 825 bp open reading frame (ORF) that encodes for a polypeptide of 245 amino acid (aa) residues. The predicted molecular weight and theoretical isoelectric point of Eb-apoE deduced aa sequence polypeptide were 31 kDa and 4.6, respectively. Pair wise alignments showed Eb-apoE highest identity (93.8%) with fish Oplegnathus fasciatus whereas lowest identity (17.5%) with insect Apis mellifera. Eb-apoE contains several apolipoproteins domains which is found several fish and vertebrates. RT-PCR analysis reveals that Eb-apoE is expressed in all tissues examined with a preferential expression in the liver, kidney, and intestine. While lowest expression was shown in spleen, gills, heart. This expression results suggested that Eb-apoE possibly involved an immune response during infection or immunostimulants.
... The residues 61, 112 and 158 important for the structural conformation of apoE2, apoE3 apoE4 in humans are indicated by an asterisk. The lipoprotein receptorbinding region is boxed and residues 142-147 inside related with heparin binding are underlined (Babin et al., 1997;Durliat et al., 2000;Frieden, 2015). The five apoE conserved sequence motifs (E1 to E5) are underlined . ...
... Both paralogs differed mainly in the length of the repeat 11. The identification of the five apoE conserved sequence motifs (E1 to E5) (Babin et al., 1997;Durliat et al., 2000) revealed that E1 was located within 33-codon block, the E2 was the most conserved motif between paralogs and E5 was enriched in basic amino acids compatible with the lipoprotein receptor-binding region (Fig. 1). Out of the three residues that influence protein structure and lipoprotein binding in humans (61, 112, and 158), only the position 61 was highly conserved in all teleosts. ...
... The E1 and E2 motifs spanned the 33-common block that included the residue 61 involved in protein structure and lipoprotein binding preference (Dong and Weisgraber, 1996;McIntosh et al., 2012). Moreover, the E5 motif was enriched in basic amino acids, as occurs in the lipoprotein receptor-binding region of human apoE (Babin et al., 1997;Durliat et al., 2000;Frieden, 2015). The conservation of all these motifs indicates that apoE paralogs in sole maintain the capacity of interacting with their specific receptors. ...
The apolipoprotein E (ApoE) is a key component of several lipoproteins involved in lipid homeostasis. In this study, two cDNA sequences encoding ApoE (referred to as apoEa and apoEb) were characterized in the flatfish Solea senegalensis. The predicted peptides contained conserved structural blocks related with their capacity for lipid binding and lipoprotein receptor interaction. At genomic level, both genes contained five exons and four introns and they were organized into two tandem arrays with apoA-IV gene copies. The phylogenetic analysis clearly separated them into two well-supported clusters that matched with their organization in the genome of teleosts. Whole-mount in situ hybridization located the apoEa signal in the yolk syncytial layer (YSL) of lecitothrophic larval stages (0dph) and in the anterior intestine of exotrophic larvae and benthic fish. In the case of apoEb, hybridization signals were located in the YSL, tail bud, eyes and mouth at 0dph and in the otic vesicle, hindbrain, eyes, pharynx, mouth, heart and intestine at 1dph. In exotrophic larvae, apoEb was ubiquitously expressed in several tissues such as taste buds, brain, mouth, nostril, gills, intestine, liver and around the neuromasts and eyes. Quantification of mRNA levels in pools of whole larvae confirmed distinct expression patterns with a significant reduction of apoEa and an increase of apoEb mRNA levels throughout larval development. Moreover, only apoEa transcripts increased in response to food supply suggesting that this paralog mostly participates in the absorption and transport of dietary lipids and the apoEb in the redistribution of endogenous lipids as well as in neural tissue regeneration.
... The different classes of plasma lipoproteins and their apolipoproteins have been characterized in a detailed manner in a number of fish species, in particular in trout. 11,12,13) By using standard molecular cloning methods, the full or partial molecular characterization has been performed for different fish apolipoproteins, including apolipoprotein A-I (apoA-I), apoE, apoC-II, apoB, and vitellogenin, 14,15,16,17,18,19,20) lipoprotein lipase, 21) and vitellogenin receptor. 22) Sequence data available in sequence databases, i.e., zebrafish and fugu dbESTs, enable a rapid molecular characterization and gene expression studies, in particular during development, of the proteins implicated in the intravascular metabolism of plasma lipoproteins ( Fig. 4 and Table 3). ...
... 36 Teleost fish and mammals have a common ancestor in the primordial bony fish, living approximately 400 million years ago. 29) The presence of both apoE and apoA-I in zebrafish 16,30) and trout, 14,16) with a repeat pattern similar to those in the corresponding mammalian proteins, strongly suggest that the duplication events from which APOE and APOA-I arose, occurred before the divergence of the tetrapod and teleost ancestors. Zebrafish is a potent model system for the analysis of vertebrate lipid and lipoprotein metabolism from a molecular standpoint. ...
... 36 Teleost fish and mammals have a common ancestor in the primordial bony fish, living approximately 400 million years ago. 29) The presence of both apoE and apoA-I in zebrafish 16,30) and trout, 14,16) with a repeat pattern similar to those in the corresponding mammalian proteins, strongly suggest that the duplication events from which APOE and APOA-I arose, occurred before the divergence of the tetrapod and teleost ancestors. Zebrafish is a potent model system for the analysis of vertebrate lipid and lipoprotein metabolism from a molecular standpoint. ...
Fish species have recently become powerful model systems for analysis of vertebrate development and human disease. High throughput gene and expressed sequence tag (EST) mapping projects in fish are now facilitating our understanding of the relationship between vertebrates genomes and will help identify roles for human genes from fish mutations. Mutant screens in zebrafish are performed routinely, resulting in sizable collections of mutations causing a variety of developmental and physiological defects including digestive organ and lipid processing. Fish gene maps showed duplicated chromosome segments and blocks of numerous conserved syntenies between fish and human. The function of putatively orthologous and paralogous genes can, nonetheless, be different. In the context of the current revolution linking genes and pathways to integrative physiology, numerous fields, including fish physiology, are being redefined. Fish species are useful animal models for studying lipid metabolism and transport. The task of linking genes to function improve our knowledge of the molecular basis of lipid and lipoprotein metabolism in fish, and support the existence of related lipid processing mechanisms in mammals and teleosts.
... In our study, the amino acid sequences of C. carpio ApoA-Ibs showed low homology with their mammalian counterparts (26% identity; Figure 1). A similar phenomenon was also detected for Takifugu rubripes ApoA-I (21% identity) [12], Danio rerio ApoA-I (25.6% identity) [33], Oncorhynchus mykiss ApoA-I.1 and ApoA-I.2 (28% identity) [28] and Cyprinus carpio ApoA-I (27% identity) [18]. ...
... (28% identity) [28] and Cyprinus carpio ApoA-I (27% identity) [18]. Expression patterns of apoA-I have been reported in several fish species [13][14][15][16][17]25,33], but studies on temporal and spatial expression patterns of apoA-I were not performed in common carp. The expression pattern of apoA-Ib in embryonic development of common carp ( Figure 3A) was similar to that of zebrafish [33] and turbot [34]. ...
... Expression patterns of apoA-I have been reported in several fish species [13][14][15][16][17]25,33], but studies on temporal and spatial expression patterns of apoA-I were not performed in common carp. The expression pattern of apoA-Ib in embryonic development of common carp ( Figure 3A) was similar to that of zebrafish [33] and turbot [34]. The high expression level before hatching may indicate that C. carpio apoA-Ib is more likely to be related to the transference of structural lipids than to lipids used for energy purposes at the early development stages [33,34]. ...
Apolipoprotein A-I (ApoA-I) is functionally involved in the transportation and metabolism of lipids in vertebrates. In this study, two isoforms of apoA-Ib in common carp (Cyprinus carpio L.) were characterized. Sequence comparison and phylogenetic analysis showed that C. carpio ApoA-Ib is relatively conserved within cyprinid fishes. During embryonic development, C. carpio apoA-Ib was first expressed at the stage of multi-cells, and the highest mRNA level was observed at the stage of optic vesicle. A ubiquitous expression pattern was detected in various tissues with extreme predominance in the liver. Significantly different expression levels were observed between light and heavy body weight groups and also in the compensatory growth test. Seventeen and eight single-nucleotide polymorphisms (SNPs) were identified in matured mRNA of the C. carpio apoA-Ib.1 and apoA-Ib.2, respectively. Two of these SNPs (apoA-Ib.2-g.183A>T and apoA-Ib.2-g.1753C>T) were significantly associated with body weight and body length in two populations of common carp. These results indicate that apoA-Ib may play an important role in the modulation of growth and development in common carp.
... In zebrafish, the ApoE gene has two paralogs -ApoEa (NCBI gene ID: 553587) and ApoEb (NCBI gene ID: 30314) [22][23][24]. Despite of its less than 30% identity with the mouse or human ApoE ( Supplementary Fig. 1A), ApoEb, but not ApoEa, contains a conservative region encoding amino acid sequences similar to the lipoprotein receptor-binding region (LRR) of human ApoE [25], and its protein sequence satisfies the common structural features depicted for potential amphipathic helices characteristic of plasma apolipoprotein [26]. A previous study also found that ApoEa expression gradually reduced during fish development, while ApoEb increased [27]. ...
... Zebrafish ApoEb gene is expressed in a species-specific manner [22,24,37], and its specific function and mechanism research is still lacking. Several studies had chartered zebrafish ApoEb protein has similar functional domains to mammalian ApoE protein and their high homology [25,26]. Hereinafter in this study, we supposed zebrafish ApoEb functioned as the ApoE gene in mammals, and the ApoEb mutant fish line adds to the set of zebrafish models of lipid abnormalities including ApoC2 mutant zebrafish and others [18]. ...
Background and aims
ApoEb is a zebrafish homologous to mammalian ApoE, whose deficiency would lead to lipid metabolism disorders (LMDs) like atherosclerosis. We attempted to knock out the zebrafish ApoEb, then establish a zebrafish model with LMD.
Methods
ApoEb was knocked out using the CRISPR/Cas9 system, and the accumulation of lipids was confirmed by Oil Red O staining, confocal imaging, and lipid measurements. The lipid-lowering effects of simvastatin (SIM), ezetimibe (EZE) and Xuezhikang (XZK), an extract derived from red yeast rice, were evaluated through in vivo imaging in zebrafish larvae.
Results
In the ApoEb mutant, significant vascular lipid deposition occurred, and lipid measurement performed in the whole-body homogenate of larvae and adult plasma showed significantly increased lipid levels. SIM, EZE and XZK apparently relieved hyperlipidemia in ApoEb mutants, and XZK had a significant inhibitory effect on the recruitment of neutrophils and macrophages.
Conclusions
In this study, an LMD model has been established in ApoEb mutant zebrafish. We suggest that this versatile model could be applied in studying hypercholesterolemia and related vascular pathology in the context of early atherosclerosis, as well as the physiological function of ApoE.
... Yolk proteins and lipids are deposited into oocytes by way of vitellogenin, a high-density lipoprotein synthesized by the maternal liver [238] that is then proteolytically cleaved to generate phosvitin and lipovitellin, and stored in the yolk for later use as nutrients by the developing embryo and larva [222]. Ultrastructural, immunocytochemical, biochemical and genetic studies demonstrate that the teleost YSL plays an active role in yolk resorption, aiding nutrient uptake and transport to embryonic and larval tissues [88,221,222,227,[239][240][241][242][243][244][245][246][247][248][249][250][251][252][253][254][255][256], a function that is reminiscent of the yolk sac endoderm and placenta of higher vertebrates [257,258]. The YSL exports free amino acids [219] and manufactures several enzymes involved in early metabolism and nutrition-related functions, such as creatine metabolism [250], steroidogenesis [251], iron transport [242,243] and lipid metabolism [243][244][245][246][247]249]. ...
... The YSL exports free amino acids [219] and manufactures several enzymes involved in early metabolism and nutrition-related functions, such as creatine metabolism [250], steroidogenesis [251], iron transport [242,243] and lipid metabolism [243][244][245][246][247]249]. It also synthesizes lipoproteins, which are macromolecular protein-containing complexes that serve the function of packaging and transporting yolk lipids [222,227,241]. Studies in zebrafish show that during embryogenesis, yolk lipids undergo lipolysis and re-esterification and are then packaged into lipoproteins in the endoplasmic reticulum of the YSL. ...
Teleost eggs have evolved a highly derived early developmental pattern within vertebrates as a result of the meroblastic cleavage pattern, giving rise to a polar stratified architecture containing a large acellular yolk and a small cellular blastoderm on top. Besides the acellular yolk, the teleost-specific yolk syncytial layer (YSL) and the superficial epithelial enveloping layer are recognized as extraembryonic structures that play critical roles throughout embryonic development. They provide enriched microenvironments in which molecular feedback loops, cellular interactions and mechanical signals emerge to sculpt, among other things, embryonic patterning along the dorsoventral and left–right axes, mesendodermal specification and the execution of morphogenetic movements in the early embryo and during organogenesis. An emerging concept points to a critical role of extraembryonic structures in reinforcing early genetic and morphogenetic programmes in reciprocal coordination with the embryonic blastoderm, providing the necessary boundary conditions for development to proceed. In addition, the role of the enveloping cell layer in providing mechanical, osmotic and immunological protection during early stages of development, and the autonomous nutritional support provided by the yolk and YSL, have probably been key aspects that have enabled the massive radiation of teleosts to colonize every ecological niche on the Earth.
This article is part of the theme issue ‘Extraembryonic tissues: exploring concepts, definitions and functions across the animal kingdom’.
... In zebra sh, the ApoE gene has two paralogs -ApoEa (NCBI gene ID: 553587) and ApoEb (NCBI gene ID: 30314) [20][21][22]. Despite of its less than 30% identity with mouse or human ApoE (Fig. S1A), ApoEb, but not ApoEa, contains a conserved sequences encoding amino acid sequence similar to the lipoprotein receptor-binding region (LRR) of human ApoE [23], and its protein sequences satisfy the common structural features depicted for potential amphipathic helices characteristic of plasma apolipoprotein [24]. Previous study also has found that ApoEa expression gradually reduced during sh development, while ApoEb increased [25]. ...
... Zebra sh ApoEb gene expressed in a species-speci c manner [22,35,20], and its speci c function and mechanism research is still lacking. Several studies had chartered zebra sh ApoEb protein has similar functional domains to mammalian ApoE protein and their high homology [24,23]. Hereinafter in this study, we supposed zebra sh ApoEb functioned as the ApoE gene in mammals, and the ApoEb mutant sh line adds to the set of zebra sh models of lipid abnormalities including ApoC2 mutant zebra sh and others [18]. ...
Background and aims: ApoEb is a zebrafish homologous to mammalian ApoE, whose deficiency would lead to lipid metabolism disorders (LMDs) like atherosclerosis. We attempted to knock out the zebrafish ApoEb, then establish a zebrafish model with LMD.
Methods: ApoEb was knocked out using CRISPR/Cas9 system, and the accumulation of lipids were confirmed by Oil Red O staining, confocal imaging, and lipid measurements. The lipid-lowering effects of simvastatin (SIM), ezetimibe (EZE) and Xuezhikang (XZK), an extract derived from red yeast rice, were evaluated through in vivo imaging in zebrafish larvae.
Results: In ApoEb mutant, significant vascular lipid deposition occurred, and lipid measurement performed in whole-body homogenate of larvae and adult plasma showed significantly increased lipid levels. SIM, EZE and XZK apparently relieved the hyperlipidemia in ApoEb mutants, and XZK had a significant inhibitory effect on the recruitment of neutrophils and macrophages.
Conclusions: In this study, a LMD model has been established in ApoEb mutant zebrafish. We suggest that this versatile model could be applied in studying hypercholesterolemia and related vascular pathology in the context of early atherosclerosis as well as the physiological function of ApoE.
... β secretase gene orthologues in zebrafish include bace1 (Moussavi Nik et al., 2012), and bace2 . The MAPT gene, encoding tau protein, has two identified orthologues in zebrafish, mapta and maptb (Chen et al., 2009), whereas APOE has two coorthologues, apoea and apoeb (Babin et al., 1997). Because APP executes such essential functions as synapse formation, neural plasticity, anterograde neuronal transport and inorganic ions (Priller et al., 2006;Rogers et al., 2008;Satpute-Krishnan et al., 2006;Turner et al., 2003), APP zebrafish knock-down embryos display impaired neural networks, especially in the hindbrain, effectively recovering by Aβ treatment (Luna et al., 2013). ...
... However, knocking-out each orthologue individually may provide a better 'granularity' for studies linking individual genes to complex CNS disorders (Lieschke and Currie, 2007). For instance, the sequential knockout of selected zebrafish genes, such as slc2a, app, mapt and apoe orthologues, generates distinct neuroanatomical phenotypes of HD-and AD-like states (Babin et al., 1997;Chen et al., 2009;Lechermeier et al., 2019;Musa et al., 2001), improving our understanding of both common and disease-specific mechanisms of neurodegeneration. Inserting human disease-related genes into zebrafish genome (e.g. ...
Neurodegeneration is a major cause of Alzheimer's, Parkinson's, Huntington's, multiple and amyotrophic lateral sclerosis, pontocerebellar hypoplasia, dementia and other brain disorders. Their complex pathogenesis commonly includes genetic and neurochemical deficits, misfolded protein toxicity, demyelination, apoptosis and mitochondrial dysfunctions. Albeit differing in specific underlying mechanisms, neurodegenerative disorders typically display evolutionarily conserved mechanisms across taxa. Here, we review the role of zebrafish models in recapitulating major human and rodent neurodegenerative conditions, demonstrating this species as a highly relevant experimental model for research on neurodegenerative diseases, and discussing how these fish models can further clarify the underlying genetic, neurochemical, neuroanatomical and behavioral pathogenic mechanisms.
... Important to note is that the LDL receptor binding domain in zebrafish apoE is highly conserved. It was shown that apolipoprotein E (apoE) as well as A-I (apoA-I) genes are present in zebrafish and that the deduced amino acid sequences of zebrafish apoE and apoA-I have an identity of 27.5% and 25.6% respectively to the human orthologs [19,20]. Furthermore, human apoB has three zebrafish orthologs: apoBa, apoBb1 and apoBb2 with an identity of 51.6%, 42.5%, and 27.5%, respectively. ...
... To our knowledge no competition studies have been performed using the LDL receptor of zebrafish origin and human and zebrafish apoE-containing lipoproteins. It therefore cannot be excluded that binding of the injected human lipoproteins to zebrafish lipoprotein receptors and/or subsequent intracellular processing differs from endogenous zebrafish lipoproteins [19,21]. ...
Background and aims
Scavenger receptors form a superfamily of membrane-bound receptors that bind and internalize different types of ligands, including pro-atherogenic oxidized low-density lipoproteins (oxLDLs). In vitro studies have indicated a role for the liver sinusoidal endothelial cell receptors stabilin 1 (stab1) and 2 (stab2) in oxLDL clearance. In this study, we evaluated the potential role of stab1 and stab2 in lipoprotein uptake in zebrafish, an upcoming model for studying cholesterol metabolism and atherosclerosis.
Methods
Lipoproteins were injected in the duct of Cuvier of wild-type (ABTL) or stab1 and stab2 mutant (stab1−/−stab2−/−) zebrafish larvae at 3 days post-fertilization. To examine the effect of stabilin deficiency on lipoprotein and cholesterol metabolism, zebrafish larvae were challenged with a high cholesterol diet (HCD; 4% w/w) for 10 days.
Results
Lipoprotein injections showed impaired uptake of both LDL and oxLDL into the vessel wall of caudal veins of stab1−/−stab2−/− zebrafish, which was paralleled by redistribution to tissue macrophages. Total body cholesterol levels did not differ between HCD-fed stab1−/−stab2−/− and ABTL zebrafish. However, stab1−/−stab2−/− larvae exhibited 1.4-fold higher mRNA expression levels of ldlra involved in (modified) LDL uptake, whereas the expression levels of scavenger receptors scarb1 and cd36 were significantly decreased.
Conclusions
We have shown that stabilins 1 and 2 have an important scavenging function for apolipoprotein B-containing lipoproteins in zebrafish and that combined deficiency of these two proteins strongly upregulates the clearance of lipoproteins by macrophages within the caudal vein. Our current study highlights the use of zebrafish as model to study lipoprotein metabolism and liver sinusoidal endothelial cell function.
... A point of particular interest is that mice deficient in Apoe demonstrated deficits in olfactory functionality (Nathan et al., 2004). A gene homologous to mammalian Apoe with low amino acid sequence identity (27.5%) has been identified in zebrafish (Babin et al., 1997;Durliat et al., 2000). Functionally, there has been an observed expression in the yolk syncytial layer, brain, and eyes during development (Babin et al., 1997). ...
... A gene homologous to mammalian Apoe with low amino acid sequence identity (27.5%) has been identified in zebrafish (Babin et al., 1997;Durliat et al., 2000). Functionally, there has been an observed expression in the yolk syncytial layer, brain, and eyes during development (Babin et al., 1997). There has also been marked expression during morphogenesis and regeneration of fins (monnot et al., 1999). ...
Olfactory dysfunction may be caused by many factors, including physical damage and genetic abnormalities, but is also an accessible early stage symptom of several neurodegenerative diseases. Not only is the olfactory system subject to the specific histological abnormalities, but patients also lose the capacities to detect, identify, and discriminate between odors. In addition to olfactory deficits, motor dysfunction is another prominent manifestation of these conditions. Various approaches have engineered zebrafish (Danio rerio) models for neurodegenerative diseases. Despite encouraging results, there remains a great deal of potential in testing the models using established methods of olfactory and motion assessment. This chapter discusses current zebrafish models and suggests olfactory and motor endpoints for Parkinson’s, Alzheimer’s, Huntington’s disease, multiple system atrophy, and amyotrophic lateral sclerosis.
... For example, workers exposed to cadmium exhibit significantly increased incidences of dyslipidemia (Zhou et al., 2016). The metabolisms of lipid and lipoprotein are remarkably similar between zebrafish and humans, and thus zebrafish have been used as an emerging model for dyslipidemia and related diseases (Babin et al., 1997;Fang et al., 2014;Vasyutina et al., 2022). Previous studies have shown that exposure to the environmental pollutant bisphenol A can lead to lipid accumulation in zebrafish larvae (Simons et al., 2022). ...
Ethylhexyl salicylate (EHS) is an organic UV filter commonly used in sunscreens to protect people from the UV radiation. The widespread use of EHS will enter the aquatic environment along with human activities. EHS readily accumulates in adipose tissue as a lipophilic compound, but its toxic effects on lipid metabolism and cardiovascular system of aquatic organisms have not been studied. This study investigated the effects of EHS on lipid metabolism and cardiovascular development during zebrafish embryogenesis. The results showed that EHS caused defects such as pericardial edema, cardiovascular dysplasia, lipid deposition, ischemia, and apoptosis in zebrafish embryos. In addition, qPCR and whole-mount in situ hybridization (WISH) results indicated that EHS treatment significantly altered the expression of genes related to cardiovascular development, lipid metabolism, erythropoiesis, and apoptosis. The hypolipidemic drug rosiglitazone was able to alleviate the cardiovascular defects caused by EHS, indicating that EHS affected cardiovascular development by disrupting lipid metabolism. In addition, severe ischemia caused by cardiovascular abnormalities and apoptosis were observed in the EHS-treated embryos, which was likely to be the main cause of embryonic mortality. In conclusion, this study shows that EHS has toxic effects on lipid metabolism and cardiovascular formation. Our findings provide new evidence for assessing UV filter EHS toxicity and contribute to raising awareness of the safety risks of EHS.
... The β secretase gene orthologues in zebrafish include bace1 [235] and bace2 [236]. The MAPT gene, encoding tau protein, has two associated orthologues in zebrafish, mapta and maptb [237], while APOE has two co-orthologues, apoea and apoeb [238]. Combined with next-generation sequencing techniques, it has revolutionized the discovery of new mutations and new candidate genes for various diseases [40], especially those involved in clinical AD and other neurodegenerative disorders [239][240][241]. ...
Over the past century, advances in biotechnology, biochemistry, and pharmacognosy have spotlighted flavonoids, polyphenolic secondary metabolites that have the ability to modulate many pathways involved in various biological mechanisms, including those involved in neuronal plasticity, learning, and memory. Moreover, flavonoids are known to impact the biological processes involved in developing neurodegenerative diseases, namely oxidative stress, neuroinflam-mation, and mitochondrial dysfunction. Thus, several flavonoids could be used as adjuvants to prevent and counteract neurodegenerative disorders such as Alzheimer's and Parkinson's diseases. Zebrafish is an interesting model organism that can offer new opportunities to study the beneficial effects of flavonoids on neurodegenerative diseases. Indeed, the high genome homology of 70% to humans, the brain organization largely similar to the human brain as well as the similar neuroana-tomical and neurochemical processes, and the high neurogenic activity maintained in the adult brain makes zebrafish a valuable model for the study of human neurodegenerative diseases and deciphering the impact of flavonoids on those disorders.
... XmaI-FP: ctgcagcccgggtcatgcaggagttgggtgag, XbaI-RP: ggccgctctagatcacagcatccggtttctcc. The apoeb probe was described previously [20,60]. The mpeg1 probe was a gift from Professor Zilong Wen of Hong Kong University of Science and Technology. ...
Microglia are tissue-resident macrophages that carry out immune functions in the brain. The deficiency or dysfunction of microglia has been implicated in many neurodegenerative disorders. DOCK8, a member of the DOCK family, functions as a guanine nucleotide exchange factor and plays key roles in immune regulation and neurological diseases. The functions of DOCK8 in microglia development are not fully understood. Here, we generated zebrafish dock8 mutants by CRISPR/Cas9 genome editing and showed that dock8 mutations attenuate microglia colonization in the zebrafish midbrain at early larvae stages. In vivo time-lapse imaging revealed that the motility of macrophages was reduced in the dock8 mutant. We further found that cdc42/cdc42l , which encode the small GTPase activated by Dock8, also regulate microglia colonization in zebrafish. Collectively, our study suggests that the Dock8-Cdc42 pathway is required for microglia colonization in zebrafish larvae.
... For example, studies on the startle response of zebrafish larva to acoustic stimuli have revealed that donepezil exposure increases startle response while decreasing habituation, a response similar to that observed in rodents . Babin et al. (1997) have shown that apoA-I and apoE genes involved in AD are abundantly expressed in zebrafish and can be used to explore the influence of apolipoproteins in embryonic and larval nutrition, as well as the role of apoE in neuroregeneration and morphogenesis. Transgenic zebrafish expressing fluorescently labelled TAU swiftly recapitulated key pathological characteristics of tauopathies, including human TAU protein conformational changes and phosphorylation, tangle formation, and neuronal and biobehavioural disturbances, and apoptosis and was used in both time-lapse microscopy imaging and drug development against AD. ...
Tumor angiogenesis is the most crucial step in the progression of all types of cancers. Preexisted blood vessel vascularizes into new one through sprouting or intussusceptive (splitting) mechanism. This process would facilitate the growth in the size of tumors regulated by VEGF (vascular endothelial growth factor), leading to metastasis, which ultimately increases the severity of cancer. So, it is very important to suppress tumor angiogenesis before the situation gets worse in a cancer patient. A wide variety of in vitro and in vivo models have been used to study the process of tumor angiogenesis and metastasis of cancer. It has helped us to discover new drugs and to find novel therapies for cancer, including anti-angiogenic therapy. Mainly angiogenesis is traditionally modeled in rodents and chick embryo, but of late zebrafish is emerging as the preferred model due its several advantages over the other animals. Zebrafish (Danio rerio) serves as the ideal model to study the various cancers, since it is possible to induce tumor growth or suppression easily, when compared to the other animal models. Also, tumor xenograft model has been studied in zebrafish extensively using many human cancer cell lines. So, in this chapter, we have reviewed some literatures that appreciate zebrafish model to study tumor angiogenesis.KeywordsZebrafishAngiogenesisVEGFTumorXenograftAnti-angiogenic therapy
... The apolipoprotein genes apoa1a and apoba are comparatively well-characterized in early zebrafish development (Otis and Farber, 2016;Otis et al., 2019;Thierer et al., 2019;Templehof et al., 2021) and have been shown to be responsive to feeding status (Cruz- Garcia and Schlegel, 2014) and contaminants including BPA and PFOS as well as their replacement compounds BPS and F-53B (Sant et al., 2017;Shi et al., 2019;Martínez et al., 2020). Gene expression of apoba is, similarly to apoa1a (Babin et al., 1997), strongly induced in the yolk syncytial layer at 2 dpf (Thierer et al., 2019;Templehof et al., 2021). Following the transition to exogenous feeding, aboba becomes restricted to liver (Thierer et al., 2019;Templehof et al., 2021) while apoa1a is expressed in endosomes and lysosomes in the liver and intestine (Otis and Farber, 2016;Otis et al., 2019). ...
Single-use plastic production is higher now than ever before. Much of this plastic is released into aquatic environments, where it is eventually weathered into smaller nanoscale plastics. In addition to potential direct biological effects, nanoplastics may also modulate the biological effects of hydrophobic persistent organic legacy contaminants (POPs) that absorb to their surfaces. In this study, we test the hypothesis that developmental exposure (0–7 dpf) of zebrafish to the emerging contaminant polystyrene (PS) nanoplastics (⌀100 nm; 2.5 or 25 ppb), or to environmental levels of the legacy contaminant and flame retardant 2,2′,4,4′-Tetrabromodiphenyl ether (BDE-47; 10 ppt), disrupt organismal energy metabolism. We also test the hypothesis that co-exposure leads to increased metabolic disruption. The uptake of nanoplastics in developing zebrafish was validated using fluorescence microscopy. To address metabolic consequences at the organismal and molecular level, metabolic phenotyping assays and metabolic gene expression analysis were used. Both PS and BDE-47 affected organismal metabolism alone and in combination. Individually, PS and BDE-47 exposure increased feeding and oxygen consumption rates. PS exposure also elicited complex effects on locomotor behaviour with increased long-distance and decreased short-distance movements. Co-exposure of PS and BDE-47 significantly increased feeding and oxygen consumption rates compared to control and individual compounds alone, suggesting additive or synergistic effects on energy balance, which was further supported by reduced neutral lipid reserves. Conversely, molecular gene expression data pointed to a negative interaction, as co-exposure of high PS generally abolished the induction of gene expression in response to BDE-47. Our results demonstrate that co-exposure to emerging nanoplastic contaminants and legacy contaminants results in cumulative metabolic disruption in early development in a fish model relevant to eco- and human toxicology.
... Although lipid and protein contents of lipoproteins can be variable depending on species (e.g. human, animal), disease state, nutrition, and genetics (John Chapman, 1986;Levy et al., 2000;German et al., 2006;Hegele, 2009;Dron & Hegele, 2016), apolipoproteins are functionally classified as either water insoluble and non-exchangeable (ApoB family) or water soluble and exchangeable (ApoA, ApoC, and ApoE families) (Babin et al., 1997;Curtiss et al., 2006;Phillips, 2013). Whereas non-exchangeable apolipoproteins remain on the same lipoprotein particle from biosynthesis to degradation, exchangeable apolipoproteins (ApoA, ApoC and ApoE families of lipoproteins) are able to interact with a number of lipid-bearing structures and molecules (e.g. ...
Native nanostructured lipoproteins such as low- and high-density lipoproteins (LDL and HDL) are powerful tools for the targeted delivery of drugs and imaging agents. While the cellular recognition of well-known HDL-based carriers occurs via interactions with an HDL receptor, the selective delivery and uptake of LDL particles by target cells are more complex. The most well-known mode of LDL-based delivery is via the interaction between apolipoprotein B (Apo-B) – the main protein of LDL – and the low-density lipoprotein receptor (LDLR). LDLR is expressed in the liver, adipocytes, and macrophages, and thus selectively delivers LDL carriers to these cells and tissues. Moreover, the elevated expression of LDLR in tumor cells indicates a role for LDL in the targeted delivery of chemotherapy drugs. In addition, chronic inflammation associated with hypercholesterolemia (i.e., high levels of endogenous LDL) can be abated by LDL carriers, which outcompete the deleterious oxidized LDL for uptake by macrophages. In this case, synthetic LDL nanocarriers act as ‘eat-me’ signals and exploit mechanisms of native LDL uptake for targeted drug delivery and imaging. Lastly, recent studies have shown that the delivery of LDL-based nanocarriers to macrophages via fluid-phase pinocytosis is a promising tool for atherosclerosis imaging. Hence, the present review summarizes the use of natural and synthetic LDL-based carriers for drug delivery and imaging and discusses various mechanisms of targeting.
... Gene expression of APOE, BMP4, BMP7, CKM, GATM, and TFEB reflect challenges in feed conversion At 0 dph, we uncovered high APOE transcript levels. The encoded apolipoprotein E is involved in the vertebrate lipid metabolism, where it is crucial for the internalization of plasma lipoproteins into the cell (Mahley 1988;Babin et al. 1997). Fish egg yolk contains high amounts of lipoproteins (Wiegand 1996). ...
There are still numerous difficulties in the successful farming of pikeperch in the anthropogenic environment of various aquaculture systems, especially during early developmental steps in the hatchery. To investigate the physiological processes involved on the molecular level, we determined the basal expression patterns of 21 genes involved in stress and immune responses and early ontogenesis of pikeperch between 0 and 175 days post hatch (dph). Their transcription patterns most likely reflect the challenges of growth and feed conversion. The gene coding for apolipoprotein A (APOE) was strongly expressed at 0 dph, indicating its importance for yolk sac utilization. Genes encoding bone morphogenetic proteins 4 and 7 (BMP4, BMP7), creatine kinase M (CKM), and SRY-box transcription factor 9 (SOX9) were highly abundant during the peak phases of morphological changes and acclimatization processes at 4–18 dph. The high expression of genes coding for peroxisome proliferator-activated receptors alpha and delta (PPARA, PPARD) at 121 and 175 dph, respectively, suggests their importance during this strong growth phase of juvenile stages. As an alternative experimental model to replace further in vivo investigations of ontogenetically important processes, we initiated the first approach towards a long-lasting primary cell culture from whole pikeperch embryos. The present study provides a set of possible biomarkers to support the monitoring of pikeperch farming and provides a first basis for the establishment of a suitable cell model of this emerging aquaculture species.
... These biological pathways detected in patients with KFS are consistent with the results of a previous comparative proteomics study by iTRAQ that explored the differential serum protein abundance levels of nine patients with CS who had TBX6 haploinsufficiency and nine healthy controls (45 Apolipoprotein is plasma lipoprotein that is synthesized mainly in the liver (and partially in the small intestine) and transports lipids and stabilizes lipoproteins (50). APOE and APOA1 were shown to be highly abundant in the embryonic yolk syncytial layer and distributed in the form of cell clusters along the spinal cord, an extraembryonic structure implicated in embryonic and larval nutrition (51). It has been demonstrated that APOE was up-regulated by bone morphogenetic protein-2 in the murine mesenchymal progenitor cell and APOE −/− mice had significantly reduced levels of the osteoblastic (RUNX2 and Osterix) and lipoblastic (PPARγ and CEBPα) indicators (52)(53)(54). ...
Background:
Klippel-Feil syndrome (KFS) represents the rare and complex deformity characterized by congenital defects in the formation or segmentation of the cervical vertebrae. There is a wide gap in understanding the detailed mechanisms of KFS because of its rarity, heterogeneity, small pedigrees, and the broad spectrum of anomalies.
Methods:
We recruited eight patients of Chinese Han ethnicity with KFS, five patients with congenital scoliosis (CS) who presented with congenital fusion of the thoracic or lumbar spine and without known syndrome or cervical deformity, and seven healthy controls. Proteomic analysis by data-independent acquisition (DIA) was performed to identify the differential proteome among the three matched groups and the data were analyzed by bioinformatics tools including Gene Ontology (GO) categories and Ingenuity Pathway Analysis (IPA) database, to explore differentially abundant proteins (DAPs) and canonical pathways involved in the pathogenesis of KFS.
Results:
A total of 49 DAPs were detected between KFS patients and the controls, and moreover, 192 DAPs were identified between patients with KFS and patients with CS. Fifteen DAPs that were common in both comparisons were considered as candidate biomarkers for KFS, including membrane primary amine oxidase, noelin, galectin-3-binding protein, cadherin-5, glyceraldehyde-3-phosphate dehydrogenase, peroxiredoxin-1, CD109 antigen, and eight immunoglobulins. Furthermore, the same significant canonical pathways of LXR/RXR activation and FXR/RXR activation were observed in both comparisons. Seven of DAPs were apolipoproteins related to these pathways that are involved in lipid metabolism.
Conclusions:
This study provides the first proteomic profile for understanding the pathogenesis and identifying predictive biomarkers of KFS. We detected 15 DAPs that were common in both comparisons as candidate predictive biomarkers of KFS. The lipid metabolism-related canonical pathways of LXR/RXR and FXR/RXR activation together with seven differentially abundant apolipoproteins may play significant roles in the etiology of KFS and provide possible pathogenesis correlation between KFS and CS.
... ApoE serves as a ligand for the clearance of triglyceride-rich ApoB-containing lipoproteins by binding to membrane lipoprotein receptors in the LDL receptor family. [46][47][48][49] ApoE has many genetic variants affecting health and disease. 50,51 The most common isoform, ApoE3 has a Cys at codon 112 and Arg at codon 158. ...
The current coronavirus disease 2019 (COVID‐19) pandemic presents a global challenge for managing acutely ill patients and complications from viral infection. Systemic inflammation accompanied by a “cytokine storm,” hemostasis alterations and severe vasculitis have all been reported to occur with COVID‐19, and emerging evidence suggests that dysregulation of lipid transport may contribute to some of these complications. Here, we aim to summarize the current understanding of the potential mechanisms related to COVID‐19 dyslipidemia and propose possible adjunctive type therapeutic approaches that modulate lipids and lipoproteins. Specifically, we hypothesize that changes in the quantity and composition of high‐density lipoprotein (HDL) that occurs with COVID‐19 can significantly decrease the anti‐inflammatory and anti‐oxidative functions of HDL and could contribute to pulmonary inflammation. Furthermore, we propose that lipoproteins with oxidized phospholipids and fatty acids could lead to virus‐associated organ damage via overactivation of innate immune scavenger receptors. Restoring lipoprotein function with ApoA‐I raising agents or blocking relevant scavenger receptors with neutralizing antibodies could, therefore, be of value in the treatment of COVID‐19. Finally, we discuss the role of omega‐3 fatty acids transported by lipoproteins in generating specialized proresolving mediators and how together with anti‐inflammatory drugs, they could decrease inflammation and thrombotic complications associated with COVID‐19.
... Reverse cholesterol transport (RCT) is the process by which intracellular cholesterol from extra-hepatic tissues is transported, in HDL particles in the circulation, to the liver, from where the cholesterol is excreted in the feces (Fig. 1). Across a various range of organisms, the RCT pathway has been reported to be conserved, which underscores its physiological importance [25,[32][33][34][35]. The process of RCT includes multiple steps and thus is mediated by several transport mediators and biochemical molecules. ...
Lipids are hydrophobic and amphiphilic molecules involved in diverse functions such as membrane structure, energy metabolism, immunity, and signaling. However, altered intra-cellular lipid levels or composition can lead to metabolic and inflammatory dysfunction, as well as lipotoxicity. Thus, intra-cellular lipid homeostasis is tightly regulated by multiple mechanisms. Since most peripheral cells do not catabolize cholesterol, efflux (extra-cellular transport) of cholesterol is vital for lipid homeostasis. Defective efflux contributes to atherosclerotic plaque development, impaired β-cell insulin secretion, and neuropathology. Of these, defective lipid efflux in macrophages in the arterial walls leading to foam cell and atherosclerotic plaque formation has been the most well studied, likely because a leading global cause of death is cardiovascular disease. Circulating high density lipoprotein particles play critical roles as acceptors of effluxed cellular lipids, suggesting their importance in disease etiology. We review here mechanisms and pathways that modulate lipid efflux, the role of lipid efflux in disease etiology, and therapeutic options aimed at modulating this critical process.
... Lipids, along with other cytoplasmic components, are initially stored in the yolk and transported to the animal pole upon fertilization to form the blastodisc. The embryo body and yolk are separated by the yolk syncytial layer (YSL), wherein many crucial genes for lipid transport and lipoprotein production are expressed [33,34]. It is well established that the YSL is responsible for the processing and delivery of yolk lipids to the embryo body; however, a key question remains as to how this lipid remodeling process affects lipid compositions in the embryo body at deep structural levels. ...
Lipids exert substantial influences on vertebrate embryogenesis, but their metabolic dynamics at detailed structural levels remains elusive, primarily owing to the lack of a tool capable of resolving their huge structural diversity. Herein, we present the first large-scale and spatiotemporal monitoring of unsaturated lipids with C=C specificity in single developing zebrafish embryos enabled by photochemical derivatization and tandem mass spectrometry (MS). The lipid isomer composition was found extremely stable in yolk throughout embryogenesis, while notable differences in ratios of C=C location (e.g., PC 16:0_16:1 (7) vs. 16:0_16:1 (9)) and fatty acyl composition isomers (e.g., PC 16:1_18:1 vs. 16:0_18:2) were unveiled between blastomeres and yolk from zygote to 4 h post fertilization (hpf). From 24 hpf onwards, lipid isomer compositions in embryo head and tail evolved distinctively with development, suggesting a meticulously regulated lipid remodeling essential for cell division and differentiation. This work has laid the foundation for functional studies of structurally defined lipids in vertebrate embryology.
... In zebrafish the expression of apoeb gene is very strong in the yolk syntitial layer (YSL) from blastula stage until larval development. Between the first and the third days of development, a new domain of apoeb gene expression appears in the head region, in the facial ectoderm, and in some cells of the retina and brain (Babin et al. 1997). atp6v1g1 encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles (Finbow et al. 1997). ...
Transcription regulation during vertebrate embryonic development is tightly regulated by cis-regulatory elements and respective transcription factor complexes, which bind to them. The interaction of these elements, followed by the recruitment of the RNA polymerase II machinery, leads to transcription initiation, which is one of the major regulatory steps in gene expression regulation. In this thesis I study three aspects of cis regulatory function in the zebrafish embryo: 1. Non-coding genomic sequences, in some cases with extreme evolutionary conservation, were shown to harbour enhancer function. After the completion of several mammalian and vertebrate genomes, phylogenetic footprinting became frequently used methods for cis-regulatory element identification. I present the identification of conserved noncoding sequences in the pax2 locus and their in vivo test for enhancer activity in transient transgenic zebrafish embryos. 2. Conserved non-protein coding sequences working as enhancers were significantly enriched in and or around developmental regulators and/or transcription factor genes. In the second part of this thesis I present the application of a combined global and local alignment tool, which could identify higher number of conserved noncoding elements with enhancer activity, then any of the previous methods. Two thirds of the identified elements were shuffled during evolution. Although the majority of these shuffled conserved elements were still assigned to gene classes of transcription factors and developmental regulators, there were high enrichment in genes belonging to the extracellular regions and behavioural Gene Ontology classes. 3. The assignment of identified enhancers to their target gene promoters is often problematic, because of the potentially very large sequence distances separating them. Furthermore, based on recent results, promoters show an unexpected diversity. As promoter-enhancer interaction is mediated through multiprotein complexes, the composition of these complexes is likely dependent on the properties of the cis-regulatory elements involved and may result in interaction specificities. To investigate whether the DNA sequence of core promoters and enhancers define the specificity of their interaction, we have performed a high throughout screen, where 20 core promoters and 13 enhancers were used to generate 260 combinations. Data analysis after the automated image acquisition and processing revealed that enhancer function is clearly promoter-specific.
... Seminal plasma of Ovopel-induced males was characterized by the higher abundance of APOA1, APOE, clusterin (CLU), and FABP. These proteins are multifunctional and, in addition to their function mentioned above in innate immunity in fish, are involved, among others, in lipid transport and metabolism, aiding modification of lipid distribution of the sperm plasma membrane and steroidogenesis during spermatogenesis, spermiation, and sperm maturation [33][34][35][36][37]. These proteins were also distinguished in our previous study, as more abundant in seminal plasma compared with blood plasma [38], which supports their important function within the male reproductive tract in carp. ...
Hormonal stimulation in common carp is a routine practice to enhance sperm production and control gamete maturation. This study aimed to compare the proteome of carp seminal plasma between control and Ovopel-induced males using two-dimensional differential in-gel electrophoresis. Ovopel induction increased sperm volume, total sperm count, seminal plasma osmolality, and pH and decreased seminal plasma protein concentration. In total, 36 spots were identified (23 up- and 13 downregulated), corresponding to 23 proteins differentially abundant in seminal plasma after Ovopel induction (p < .05; fold change 1.2). The majority of proteins were associated with the immune and stress responses including the transport protein (hephaestin), antiproteases (fetuin, α2-macroglobulin, TIMP2), complement components (C3, complement factor B/C2A), regulator of the coagulation cascade (plasminogen), modulators of the innate immune response, such as intelectin, ApoA and ApoE, and the cathepsin/cystatin system, and stress response (enolase1). In addition, hormonal stimulation seems to be related to the proteins involved in lipid metabolism, signal transduction, and tissue remodeling. Our results suggest that hormonal stimulation is not just concomitant with the hydration of testis but also induces the synthesis and secretion of seminal plasma proteins involved in sperm maturation and protection against stress induced by administration of the exogenous hormone. Significance: It is well known that hormonal stimulation of male fish induces the final maturation of spermatozoa. However, molecular and biochemical basis underlying hormone-induced changes in semen is unknown at present. This study for the first time reveals, using proteomic approach, that hormonal stimulation in addition to hydration of testis is accompanied by significant changes in seminal plasma proteins related mainly to immune and stress response, lipid metabolism, signal transduction and tissue remodeling. These changes are associated with gene expression and synthesis and secretion of seminal plasma proteins by reproductive tissues. Overall, our results provide a framework for understanding the molecular mechanism responsible for hormonal stimulation in the reproductive tract of fish males.
... A major role of YSL in teleost development is on the transport of nutrients from yolk to embryonic cells and tissues. Transcripts of genes related to lipid metabolism and transportation [53][54][55][56][57][58] , are expressed in YSL during early development to facilitate the hydrolysis and transport of yolk lipids. When these genes are disrupted, embryos show reduced yolk consumption, delayed embryonic growth and failure in lipid absorption 58,59 . ...
The front-end desaturases (Fads) are rate-limiting enzymes responsible for production of long-chain polyunsaturated fatty acids (LC-PUFA). The full spectrum of the transcriptional regulation of fads is still incomplete, as cloning of fads promoter is limited to a few species. Here, we described the cloning and characterisation of the zebrafish fads2 promoter. Using 5'-deletion and mutation analysis on this promoter, we identified a specific region containing the sterol regulatory element (SRE) which is responsible for the activation of the fads2 promoter. In tandem, two conserved CCAAT boxes were also present adjacent to the SRE and mutation of either of these binding sites attenuates the transcriptional activation of the fads2 promoter. An in vivo analysis employing GFP reporter gene in transiently transfected zebrafish embryos showed that this 1754 bp upstream region of the fads2 gene specifically directs GFP expression in the yolk syncytial layer (YSL) region. This indicates a role for LC-PUFA in the transport of yolk lipids through this tissue layer. In conclusion, besides identifying novel core elements for transcriptional activation in zebrafish fads2 promoter, we also reveal a potential role for fads2 or LC-PUFA in YSL during development.
... Particularly, genes involved in lipid and lipoprotein metabolism are frequently expressed early in embryonic development where they can be critical for early metabolic processes, proper embryonic development and/or viability (Willnow et al., 2007). These mechanisms are well conserved among vertebrates and zebrafish express most of the classes of apolipoprotein and enzymes for cholesterol metabolism (Babin et al., 1997;Imai et al., 2012). ...
The augmented exposure of both environment and human being to electromagnetic waves and the concomitant lack of an unequivocal knowledge about biological consequences of these radiations, raised public interest on electromagnetic pollution. In this context, the present study aims to evaluate the biological effects on zebrafish (ZF) embryos of 100 MHz radiofrequency electromagnetic field (RF-EMF) exposure through a multidisciplinary protocol.
Because of the shared synteny between human and ZF genomes that validated its use in biomedical research, toxicology and developmental biology studies, ZF was here selected as experimental model and a measurement protocol and biological analyses have been set up to clearly discriminate between RF-EMF biological and thermal effects.
The results showed that a 100 MHz EMF was able to affect ZF embryonic development, from 24 to 72 h post fertilization (hpf) in all the analyzed pathways. Particularly, at the 48 hpf stage, a reduced growth, an increased transcription of oxidative stress genes, the onset of apoptotic/autophagic processes and a modification in cholesterol metabolism were detected. ZF embryos faced stress induced by EMF radiation by triggering detoxification mechanisms and at 72 hpf they partially recovered from stress reaching the hatching time in a comparable way respect to the control group.
Data here obtained showed unequivocally the in vivo effects of RF-EMF on an animal model, excluding thermal outcomes and thus represents the starting point for more comprehensive studies on dose response effects of electromagnetic fields radiations consequences.
... Known to inhibit bacterial colonization in fish M, F, PM 0.25, 0.29, 0.18 [51,52] P80429 Serotransferrin-2 Role in stimulating cell proliferation. Known to inhibit bacterial colonization in fish PM, PF 0.21, 0.21 [51,52] P32759 α-1-antitrypsin homolog Identified in carp perimeningeal fluid M, F, PM, PF 0.14, 0.09, 0.19, 0.09 [53,54] Q8JFG3 Tumor necrosis factor Important mediator in resistance against parasitic, bacterial and viral infections M, F, PM, PF 0.13, 0.13, 0.13, 0.14 [55] O42363 Apolipoprotein A-I Participates in the reverse transport of cholesterol from tissues to the liver F, PM, PF 0.13, 0.13, 0.13 [56] Q92079 Serotransferrin Role in stimulating cell proliferation. Known to inhibit bacterial colonization in fish M, F, PM, PF 0.11, 0.13, 0.11, 0.07 [51,52] P98093 Complement C3 Central role in the activation of the complement system M, F, PM, PF 0.05, 0.07, 0.07, 0.07 [57] Q9PVW7 Complement component C8 beta chain Play a key role in the innate and adaptive immune response M, F, PM, PF 0.06, 0.06, 0.06, 0.06 [58] Q3B7P7 Ubiquitin-60S ribosomal protein L40 Ubiquitin A-52 residue ribosomal protein M, F, PM, PFQ9W686 Semaphorin-3ab Influence pathway choice of extending motor axons along development M, F, PM, PF 0.04, 0.04, 0.04, 0.04 [59] Growth P48802 Fibroblast growth factor 3 Regulation of cell proliferation, differentiation and embryonic development PF 0.13 [60] P85857 Growth/differentiation factor 6-A Growth factor that controls proliferation and cellular differentiation in the retina PM 0.08 [61] Brain regulation/development P24257 Protein Wnt-1 Involved in neurogenesis F 0.09 [62] P47793 Protein Wnt-4a Probable brain developmental protein M, PF, F 0.09, 0.09, 0.09 [63]' P43446 Protein Wnt-10a Signalling molecule important in CNS development M, PF 0.07, 0.07 [64] Q0P3W2 Olfactomedin-like protein 3B Secreted scaffold protein with essential role in dorsoventral patterning in early development PF 0.08 [65] O57472 Chordin Developmental protein, dorsalizing factor, somitogenesis M, F, PM, PF 0.03, 0.03, 0.03, 0.04 [66] Q1LVF0 Laminin subunit gamma-1 Mediate attachment, migration and organization of cells into tissues in embryonic development M, PF, PM 0.02, 0.02, 0.03 [67] Others Q6NWB6 Unique cartilage matrixassociated protein Control of osteogenic differentiation M 0.24 [68] B9TQX1 Unique cartilage matrixassociated protein Control of osteogenic differentiation PF 0.23 [69] B0JZP3 Protein THEM6 Thioesterase superfamily member 6 M, F, PM, PF 0.16, 0.16, 0.22, 0.16 [70] ( Continued) Investigation of the parental care condition in A. gigas is challenging. ...
Parental investment in Arapaima gigas includes nest building and guarding, followed by a care provision when a cephalic fluid is released from the parents’ head to the offspring. This fluid has presumably important functions for the offspring but so far its composition has not been characterised. In this study the proteome and peptidome of the cephalic secretion was studied in parental and non-parental fish using capillary electrophoresis coupled to mass spectrometry (CE-MS) and GeLC-MS/MS analyses. Multiple comparisons revealed 28 peptides were significantly different between males and parental males (PC-males), 126 between females and parental females (PC-females), 51 between males and females and 9 between PC-males and PC-females. Identification revealed peptides were produced in the inner ear (pcdh15b), eyes (tetraspanin and ppp2r3a), central nervous system (otud4, ribeye a, tjp1b and syn1) among others. A total of 422 proteins were also identified and gene ontology analysis revealed 28 secreted extracellular proteins. From these, 2 hormones (prolactin and stanniocalcin) and 12 proteins associated to immunological processes (serotransferrin, α-1-antitrypsin homolog, apolipoprotein A-I, and others) were identified. This study provides novel biochemical data on the lateral line fluid which will enable future hypotheses-driven experiments to better understand the physiological roles of the lateral line in chemical communication.
... High expression of apolipoproteins in embryogenesis would be helpful for transporting material, such as lipid. Therefore, it is reasonable to speculate APOC1, the smallest member of apolipoprotein family, may have an important role in embryogenesis, in addition to the well-documented expression of other lipoproteins (APOE and APOA1) in embryonic development [35] that, potentially, may be associated with bone forming. One publication confirmed our ratiocination. ...
Congenital scoliosis (CS) is a three-dimensional deformity of the spine affecting quality of life. We have demonstrated TBX6 haploinsufficiency is the most important contributor to CS. However, the pathophysiology at the protein level remains unclear. Therefore, this study was to explore the differential proteome in serum of CS patients with TBX6 haploinsufficiency. Sera from nine CS patients with TBX6 haploinsufficiency and nine age- and gender-matched healthy controls were collected and analysed by isobaric tagged relative and absolute quantification (iTRAQ) labelling coupled with mass spectrometry (MS). In total, 277 proteins were detected and 20 proteins were designated as differentially expressed proteins, which were submitted to subsequent bioinformatics analysis. Gene Ontology classification analysis showed the biological process was primarily related to ‘cellular process’, molecular function ‘structural molecule activity’ and cellular component ‘extracellular region’. IPA analysis revealed ‘LXR/RXR activation’ was the top pathway, which is a crucial pathway in lipid metabolism. Hierarchical clustering analysis generated two clusters. In summary, this study is the first proteomic research to delineate the total and differential serum proteins in TBX6 haploinsufficiency-caused CS. The proteins discovered in this experiment may serve as potential biomarkers for CS, and lipid metabolism might play important roles in the pathogenesis of CS.
... Thus, zebrafish possesses the genes appa and appb that evolved from an ancestral gene that was orthologous to human APP (Musa, Lehrach, & Russo, 2001). Similarly, apoea and apoeb are related to human APOE (Babin et al., 1997;Woods et al., 2005) and mapta and maptb are related to human MAPT (tau) (M. Chen, Martins, & Lardelli, 2009). ...
Alzheimer’s disease is a major and increasing burden on families, communities, and national health budgets. Despite intensive and extended research there is still widespread debate about its cause(s) and no effective treatments exist. Familial (inherited, mainly early onset) and sporadic (mainly late onset) forms of the disease exist and it is uncertain to what extent they are related. Transgenic mouse models have dominated the investigation of this disease but their validity can be questioned. Numerous alternative models exist that can provide valuable information on the molecular and cellular basis of Alzheimer’s disease. In this chapter we review the various invertebrate, nonmammalian vertebrate, and mammalian models and how these have been used to investigate this disease. We examine the strengths and weaknesses of these various model systems. Of course, animal models never completely reflect the true nature of a human disease but progress in understanding and finding preventative and ameliorative treatments for Alzheimer’s disease is hindered by the lack of a convincing hypothesis for the cause of this complex condition.
... Despite the high species diversity, all known APOE homologues exhibit the LDL receptor binding domain, which consists of seven or eight basic amino acid residues. APOE from mammals, fish and reptiles shows up to 30 % similarity at the amino acid level (Babin et al., 1997, Duggan and Callard, 2001, Durliat et al., 2000. ...
Apolipoprotein E (APOE) is a member of the vertebrate protein family of exchangeable apolipoproteins that is characterized by amphipathic α-helices encoded by multiple nucleotide tandem repeats. Its equivalent in flying insects − apolipophorin-III − shares structural and functional commonalities with APOE, suggesting the possibility of an evolutionary relationship between the proteins. In contrast to all other known species, human APOE is functionally polymorphic and possesses three major allelic variants (ε4, ε3 and ε2). The present review examines the current knowledge on APOE gene structure, phylogeny and APOE protein topology as well as its human isoforms. The ε4 allele is associated with an increased age-related disease risk but is also the ancestral form. Despite increased mortality in the elderly, ε4 has not become extinct and is the second-most common allele worldwide after ε3. APOE ε4, moreover, shows a non-random geographical distribution, and similarly, the ε2 allele is not homogenously distributed among ethnic populations. This likely suggests the existence of selective forces that are driving the evolution of human APOE isoforms, which may include differential interactions with dietary factors. To that effect, micronutrients such as vitamin D and carotenoids or dietary macronutrient composition are elucidated with respect to APOE evolution.
... Sporadic AD accounts for more than 95% of all AD cases ( Newman, Verdile, Martins & Lardelli, 2011), and is linked to the apolipoprotein E ε4 allele (ApoE4) ( Selkoe, 2001). The zebrafish orthologue of this gene is apoE ( Babin, Thisse, Durliat, Andre, Akimenko & Thisse, 1997). Early-onset familial AD ...
Despite high prevalence of neuropsychiatric disorders, their etiology and molecular mechanisms remain poorly understood. The zebrafish (Danio rerio) is increasingly utilized as a powerful animal model in neuropharmacology research and in-vivo drug screening. Collectively, this makes zebrafish a useful tool for drug discovery and the identification of disordered molecular pathways. Here, we discuss zebrafish models of selected human neuropsychiatric disorders and drug-induced phenotypes. Covering a broad range of brain disorders (from anxiety and psychoses to neurodegeneration), we also summarize recent developments in zebrafish genetics and small molecule screening, which markedly enhance the disease modeling and the discovery of novel drug targets.
... During the first four days of development, zebrafish embryos are lecithotrophic and rely on the yolk syncytial layer (YSL) to transport yolk nutrients to the developing embryos [16]. Previous studies showed that apolipoproteins and microsomal triglyceride transfer protein are expressed in YSL [17][18][19]. Furthermore, defective lipoprotein assembly during embryogenesis resulted in an unabsorbed yolk phenotype [19,20] suggesting that yolk lipids were assembled into lipoproteins at YSL for the delivery to the developing embryos. Since Soats play a role in cholesterol esterification and in turn lipoprotein assembly, it is reasonable to hypothesize that they might be responsible for converting yolk cholesterol and fatty acyl groups into CEs, and in turn contribute to the transportation of yolk lipids to the zebrafish embryo. ...
To elucidate whether Sterol O-acyltransferase (Soat) mediates the absorption and transportation of yolk lipids to the developing embryo, zebrafish soat1 and soat2 were cloned and studied. In the adult zebrafish, soat1 was detected ubiquitously while soat2 mRNA was detected specifically in the liver, intestine, brain and testis. Whole mount in situ hybridization demonstrated that both soat1 and soat2 expressed in the yolk syncytial layer, hatching gland and developing cardiovascular as well as digestive systems, suggesting that Soats may play important roles in the lipid trafficking and utilization during embryonic development. The enzymatic activity of zebrafish Soat2 was confirmed by Oil Red O staining in the HEK293 cells overexpressing this gene, and could be quenched by Soat2 inhibitor Pyripyropene A (PPPA). The zebrafish embryos injected with PPPA or morpholino oligo against soat2 in the yolk showed significantly larger yolk when compared with wild-type embryos, especially at 72 hpf, indicating a slower rate of yolk consumption. Our result indicated that zebrafish Soat2 is catalytically active in synthesizing cholesteryl esters and contributes to the yolk cholesterol trafficking during zebrafish embryogenesis.
... Vldl apoproteins include apolipoprotein E (Apo E), which bears the receptor recognition domain. Studies in turbot, zebrafish and other teleosts have revealed that the YSL expresses many genes important for lipid metabolism and lipoprotein production (Babin et al., 1997;Poupard et al., 2000;Miyares et al., 2014;Cunha et al., 2015) including, as examples, genes encoding most acyl-CoA synthetases, FABPs, cholesterol transporter (Abca 1b), essential apolipoproteins (e.g. Apo E), and a key enzyme that load lipids into lipoproteins (microsomal triglyceride transfer protein, Mtp). ...
The production of fertile eggs with the capacity to develop into larvae and subsequently into marketable fish is centrally important to the aquaculture industry. This entails not only the programmed production of large numbers of eggs, but also high quality eggs with the potential to support normal development and high survival of offspring to juvenile and later stages of development and growth. Numerous studies highlight the maternal contributions to the development of embryos, including transcripts that regulate cell division and determine oocyte polarity, pattern development during early and late embryonic stages and the transition from maternal to zygotic gene expression and translation. Since most fish embryos develop independently within an enclosed egg envelope, they rely on compounds deposited within the oocytes during their various stages of development. In addition to regulatory nucleic acids (maternal DNA and RNA), these include proteins and other compounds that contribute to the structure and function of the egg envelope and the bulk molecular cargo that will be used as a source of cellular energy and structural components for formation of embryos and larvae. These latter components notably include yolk lipids and proteins deposited during oocyte growth and water acquired at the same time and during cytoplasmic maturation. In this review we highlight recent advances made in revealing the transcripts deposited within the oocyte that contribute to the structural and morphological development of the embryo, and to the regulation of gene expression and translation during oocyte development. Significant advances have been made in revealing the molecular mechanisms of lipid accumulation and metabolism within the oocyte, the intricacies of yolk protein formation via endocytosis of multiple yolk precursor proteins by multiple oocyte receptors, and the complex machinery supporting massive accumulation of water by maturing oocytes of many species. Additionally, many advances have been made in our understanding of the endocrine regulation of all of these processes during oogenesis. We provide here an overview of recent advances in our knowledge on these various aspects of oogenesis and identify several gaps in our knowledge for future studies.
Egg specific gravity is of relevance for fish recruitment since the ability to float influences egg and larvae development, dispersal and connectivity between fishing grounds. Using zootechnics, histological approaches, optical and electronic transmission microscopy, this study describes the morphogenetic mechanism of adhesion of the oil-drop covering layer (OCL) to the oil droplet (OD) in embryos of Merluccius merluccius under physical conditions reflecting the marine environment. The herein described primordial (p)OCL is a substructure of the inner yolk syncytial layer which contains egg organella aimed to mobilize lipidic reserves from the oil drop (OD) towards the embryo blood. It is shown that the timely OD-OCL assembly is a critical morphogenetic process for embryo and larvae survival. Such assembly depends on egg buoyance because of its influence on the embryo capacity to rotate within the perivitelline space. Therefore, oil droplet adhesion (ODA) eggs are capable to complete their development while oil droplet non-adhesion eggs (ODNA) dye soon after hatching. We show that gravity-dependent egg buoyance categories exhibit different ODA/ODNA ratios (0–77%) and that relationship diminishes under incubation systems such as sprayers, that do not assure a dynamic seawater surface mixing to avoid egg desiccation. As an adaptive trait, egg gravity strongly depends on oceanic properties such as current dynamics, turbulence, oxygen, rainfall, and salinity, whose rapid changes would likely challenge the sustainability of fisheries recruitment.
Zebrafish are widely considered an excellent vertebrate model for studying the pathogenesis of human diseases because of their transparency of embryonic development, easy breeding, high similarity with human genes, and easy gene manipulation. Previous studies have shown that zebrafish as a model organism provides an ideal operating platform for clarifying the pathological and molecular mechanisms of neurodegenerative diseases and related human diseases. This review mainly summarizes the achievements and prospects of zebrafish used as model organisms in the research of neurodegenerative diseases and other human diseases related to the nervous system in recent years. In the future study of human disease mechanisms, the application of the zebrafish model will continue to provide a valuable operating platform and technical support for investigating and finding better prevention and treatment of these diseases, which has broad application prospects and practical significance.
Graphical Abstract
Zebrafish models used in neurodegenerative diseases and other diseases related to the nervous system
Numerous epidemiological studies have reported the association between high serum cholesterol and high mortality rates due to ischemic heart disease. In addition, high mortality rates were also shown in those with low cholesterol levels, just as in those with high cholesterol levels. It has been reported that the increased mortality observed in those with low cholesterol is due to causes other than ischemic heart diseases, and cancer is one of the leading causes of the increasing number of deaths due to low serum cholesterol levels. Relatively little is known about the role of cholesterol in the carcinogenesis and prevention of cancer. The roles of cholesterol in cancer development, progression, and tumor microenvironment are still controversial. Numerous studies reported a close relationship between cancer and serum cholesterol levels or statin use, while others did not show any association. Mutational status and expression levels of all genes in different types of cancers, including genes involved in cholesterol metabolism, were studied, and the role of cholesterol in carcinogenesis was demonstrated. The compelling evidence from these epidemiological studies is the leading cause of uncertainty and controversy regarding the role of cholesterol in cancer. Therefore, the effect of cholesterol on carcinogenesis, immunity, immune cells, and tumor microenvironment gains importance to find explanatory answers to these contradictory findings reported in the literature regarding the relationship between cancer and cholesterol. For this purpose, this review is aimed to summarize the effect of cholesterol on all these processes.
Alzheimer’s disease (AD) has become increasingly prevalent in the elderly population across the world. It’s pathophysiological markers such as overproduction along with the accumulation of amyloid beta (Aβ) plaques and neurofibrillary tangles (NFT) are posing a serious challenge to novel drug development processes. A model which simulates the human neurodegenerative mechanism will be beneficial for rapid screening of potential drug candidates. Due to the comparable neurological network with humans, zebrafish has emerged as a promising AD model. This model has been thoroughly validated through research in aspects of neuronal pathways analogous to the human brain. The cholinergic, glutamatergic, and GABAergic pathways, which play a role in the manifested behavior of the zebrafish, are well defined. There are several behavioral models in both adult zebrafish and larvae to establish various aspects of cognitive impairment including spatial memory, associative memory, anxiety, and other such features that are manifested in AD. The zebrafish model eliminates the shortcomings of previously recognized mammalian models, in terms of expense, extensive assessment durations, and the complexity of imaging the brain to test the efficacy of therapeutic interventions. This review highlights the various models that analyze the changes in the normal behavioral patterns of the zebrafish when exposed to AD inducing agents. The mechanistic pathway adopted by drugs and novel therapeutic strategies can be explored via these behavioral models and their efficacy to slow the progression of AD can be evaluated.
Zebrafish was introduced as a vertebrate model organism with enormous application in neuroscience to improve our understanding of brain development, homeostasis, dysfunctions, and genetic and behavioural phenotypes. The neuroscience research community is showing increasing interest in zebrafish as a complementary vertebrate model because it shares physiological and morphological characteristics with mammals and has a diverse repertoire of behaviours. Zebrafish has proven its potential as a model organism in recapitulating the genotypes and phenotypes of a wide range of human neurological disorders. It is a suitable preclinical model organism for studying a multitude of neurological conditions since adult zebrafish, larvae, and even embryos are acquiescent to pharmacological, experimental, and genetic manipulation. The utility of zebrafish as a model organism to examine the neurophysiological and pathological processes underlying major neurological disorders is discussed in depth.KeywordsZebrafishNeurogenesisNeurodegenerative diseasesMultiple sclerosisEpilepsySpinal cord injuryGlioma
Lipid nanoparticles (LNPs) are the leading non‐viral technology for the delivery of exogenous RNA to target cells in vivo. As systemic delivery platforms, these technologies are exemplified by Onpattro®, an approved LNP‐based RNA interference (RNAi) therapy, administered intravenously and targeted to parenchymal liver cells. The discovery of systemically administered LNP technologies capable of preferential RNA delivery beyond hepatocytes has, however, proven more challenging. Here, preceded by comprehensive mechanistic understanding of in vivo nanoparticle biodistribution and bodily clearance, we rationally design an LNP‐based mRNA delivery platform to preferentially target the hepatic reticuloendothelial system (RES). Evaluated in embryonic zebrafish, validated in mice and directly compared to LNP‐mRNA systems based on the lipid composition of Onpattro®, RES‐targeted LNPs significantly enhance mRNA expression both globally within the liver and specifically within hepatic RES cell types. Hepatic RES targeting requires just a single lipid change within the formulation of Onpattro® to switch LNP surface charge from neutral to anionic. This technology not only provides new opportunities to treat liver‐specific and systemic diseases in which RES cell types play a key role but, more importantly, exemplifies that rational design of advanced RNA therapies must be preceded by a robust understanding of the dominant nano‐bio interactions involved. This article is protected by copyright. All rights reserved
Aberrant lipid metabolism, especially dyslipidemia, has gained attention since it is closely related to various health disorders. Evidence that wild bitter melon (WBM), a natural herbal food, plays a regulatory function in lipid synthesis and accumulation has accumulated. In our study, we isolated 3β,7β,25-trihydroxycucurbita-5,23-dien-19-al (TCD) fraction of WBM leaf extract and established a dyslipidemia model to validate the effects of TCD on human adipocytes and zebrafish. After being treated with WBM, hypertrophy was inhibited in adipocytes, and lipid accumulation was diminished in zebrafish livers. In addition, lipogenic markers, including peroxisome-proliferator-activated receptor α (PPARα) and fatty acid synthase (FASN), significantly decreased when zebrafish were given WBM extract after they were given a high-fat diet. These findings explored the role of WBM in lipid metabolism and provided new insights into the pharmaceutic application of TCD in dyslipidemia.
The prevalence of neurodegenerative diseases is increasing globally, with an imperative need to identify and expand the availability of pharmaceutical treatment strategies. Alzheimer's disease is the most common neurodegenerative disease for which there is no cure or has limited treatments. Rodent models are primarily used in Alzheimer's disease research to investigate causes, pathology, molecular mechanisms, and pharmaceutical therapies. However, there is a lack of a comprehensive understanding of Alzheimer's disease causes, pathogenesis, and optimal treatments due in part to some limitations of using rodents, including higher economic cost, which can influence sample size and ultimately statistical power. It is necessary to expand our animal model toolbox to provide alternative strategies in Alzheimer's disease research. The zebrafish application in neurodegenerative disease research and neuropharmacology is greatly expanding due to several vital strengths spanning lower economic costs, the smaller size of the organism, a sequenced characterized genome, and well described anatomical structures. These characteristics are coupled to the conserved molecular function and disease pathways in humans. The existence of orthologs for genes associated with Alzheimer's disease in zebrafish is also confirmed. While wild-type zebrafish appear to lack some of the neuropathological features of Alzheimer's disease, the advent of genetic editing technologies has expanded evaluation of the amyloid and neurofibrillary tangle hypotheses using the zebrafish and exploration of pharmaceutical molecular targets. An overview of how genetic editing technologies are being used with the zebrafish to create models to investigate the causes, pathology, molecular mechanisms, and pharmaceutical targets of Alzheimer's disease is detailed.
(195 words)
In plasma, thyroid hormone (TH) is bound to several TH distributor proteins (THDPs), constituting a TH delivery/distribution network. Extensive studies of THDPs from tetrapods has proposed an evolutionary scenario concerning structural and functional changes in THDPs, especially for transthyretin (TTR). When assessing, in an evolutionary context, the roles of THDPs as a component constituting part of the vertebrate thyroid system, the data from fish THDPs are critical. In this review the phylogenetic distributions, spatiotemporal expression patterns and binding properties of THDPs in fish are described, and the question of whether the evolutionary hypotheses proposed in tetrapod THDPs can be applied to fish THDPs is assessed. The phylogenetic distributions of THDPs are highly variable among fish groups. Analysis in this review reveals that the evolutionary hypotheses proposed in tetrapod THDPs cannot be applied to fish THDPs, and that the role of plasma lipoproteins as THDPs grows in importance in fish groups. In primitive fish, zinc is an import factor in TH binding to TTR, and high zinc content may facilitate the acquisition of high TH binding activity during the early evolution of TTR. Finally, the possible roles of THDPs in the vertebrate thyroid system are discussed.
Most neurodegenerative diseases are currently incurable, with large social and economic impacts. Recently, there has been renewed interest in investigating natural products in the modern drug discovery paradigm as novel, bioactive small molecules. Moreover, the discovery of potential therapies for neurological disorders is challenging and involves developing optimized animal models for drug screening. In contemporary biomedicine, the growing need to develop experimental models to obtain a detailed understanding of malady conditions and to portray pioneering treatments has resulted in the application of zebrafish to close the gap between in vitro and in vivo assays. Zebrafish in pharmacogenetics and neuropharmacology are rapidly becoming a widely used organism. Brain function, dysfunction, genetic, and pharmacological modulation considerations are enhanced by both larval and adult zebrafish. Bioassay-guided identification of natural products using zebrafish presents as an attractive strategy for generating new lead compounds. Here, we see evidence that the zebrafish's central nervous system is suitable for modeling human neurological disease and we review and evaluate natural product research using zebrafish as a vertebrate model platform to systematically identify bioactive natural products. Finally, we review recently developed zebrafish models of neurological disorders that have the potential to be applied in this field of research.
Toxicological impact of TiO2 nanoparticles to the environment and human health has been extensively studied in last few decades, however, the mechanistic details are still undiscovered. This study evaluates the impact of industrially prepared TiO2 nanoparticles on the biological system using Zebrafish embryo as an in vivo model. Industrial synthesis of TiO2 nanoparticles was mimicked at lab scale using High energy ball milling (HEBM) method by milling bulk TiO2 particles for 5h, 10h, and 15h at ambient environment. The physiochemical properties were characterized by standard methods like Field emission scanning electron microscopy (FESEM), Dynamic light scattering (DLS), X-ray diffraction (XRD) and UV-Visible spectroscopy. In vivo cytotoxicity was assessed on zebrafish embryos by evaluation of their mortality rate and hatching rate. Experimental and computational analysis of reactive oxygen species (ROS) induction, apoptosis, and neutral lipid alteration was done to study the effects on the cellular level of Zebrafish larvae. The analysis depicted the change in size and surface charge of TiO2 nanoparticles with respect to increasing in milling time. In silico investigations revealed significant role of ROS quenching and altered neutral lipid accumulation functionalised by molecular interaction of respective metabolic proteins in cytotoxicity of TiO2 nanoparticles with Zebrafish embryos. The results revealed the hidden effect of industrially synthesized TiO2 nanoparticle exposure on alteration of lipid accumulation and ROS in developing Zebrafish embryos. Moreover, the assessment provided a detail mechanistic analysis of in vivo cytotoxicity at molecular level.
The fish has a strong innate immune system, and antimicrobial peptides play a major role in fish innate immunity, providing potential defence against broad spectrum of fish pathogens. Apolipoproteins,that are abundant proteins of plasma, playing important role in lipid transport and metabolism, also have potential antimicrobial activity. The present review describes the classes, structural details and important biological functions of apolipoproteins reported in both mammals and fish with an emphasis on their roles in host defence. The role of fish apolipoprotein A-I, a major component of high-density lipoproteins (HDL), is described in great detail using different infection models along with its bactericidal and immunomodulatory activities in various fish species against wide range of fish pathogens.Further, role of some novel fish-specific apolipoproteins, including the mammalian ones, have also been defined with a special focus on the molecules described in Indian carp species. As the understanding on major apolipoproteins is limited in fish species, this review might serve as a foundation to explore further their functional diversity in Indian fish species.
One of the most important functions of plasma proteins in vertebrates is their participation in osmotic homeostasis in the organism. Modern concepts about plasma proteins and their capillary filtration are based on a model of large monomeric proteins that are able to penetrate the interstitial space. At the same time, it was revealed that a considerable amount of oligomeric complexes are present in the low-molecular-weight (LM) protein fraction in the extracellular fluids of fishes. The functions of these complexes are unknown. In the present study, we investigated the LM-fraction proteins in the plasma and interstitial fluid (IF) of redfins of the genus Tribolodon. This fish alternatively spends parts of its life cycle in saline and fresh waters. We identified the protein Wap65, serpins and apolipoproteins in this fraction. By combining the methods of 2D–E under native and denaturing conditions with MALDI, we demonstrated that only apolipoproteins formed complexes. We showed that serum apolipoproteins (АроА-I, Аро-14) were present in the form of homooligomeric complexes that were dissociated with the release of monomeric forms of proteins in the course of capillary filtration to IF. Dissociation of homooligomers is not directly correlated with the change in salinity but is correlated with seasonal dynamics. We found that there was a significant decrease in the total protein concentration in IF relative to plasma. Therefore, we suggested that dissociation of homooligomeric complexes from various apolipoproteins supports the iso-osmoticity of extracellular fluids relative to capillary wall stabilization through a fluid medium in fish.
A lambda Insertion type cDNA cloning vector, Lambda ZAP, has been constructed. In E. coli a phagemid, pBluescript SK(−), contained within the vector, can be excised by 11 or M13 helper phage. The excision process
elimlnates the need to subclone DNA inserts from the lambda phage into a plasmid by restriction digestion and ligation. This
is possible because Lambda ZAP incorporates the signals for both initiation and termination of DNA synthesis from the 11 bacteriophage
origin of replication (1). Six of 21 restriction sites In the excised pBluescript SK polylinker, contained within the NH2-portion of the lacZ gene, are unique in lambda ZAP. Coding sequences inserted into these restriction sites, in the appropriate reading frame,
can be expressed from the lacZ promoter as fusion proteins. The features of this vector significantly increase the rate at which clones can be isolated
and analyzed.
The lambda ZAP vector was tested by the preparation of a chicken liver cDNA Hbrary and the isolatlon of actin clones by screening
with oligonucleotide probes. Putative actin clones were excised from the lambda vector and Identified by DNA sequencing. The
ability of lambda ZAP to serve as a vector for the construction of cDNA expression libraries was determined by detecting fusion
proteins from clones containing glucocerbrosidase cDNA's using rabbit IgG anti-glucocerbrosidase antibodies.
In mammals, the apolipoprotein (apo) A-I gene is expressed predominantly in liver and intestine, while in avian species it is expressed in all tissues. Although liver and intestine are the major sites of chicken apoA-I mRNA synthesis, there are appreciable amounts of apoA-I mRNA in kidney, ovary/testes, brain, lung, skeletal, and heart muscle. In this study, the nucleotide sequences of the chicken apoA-I gene and its 5' flanking region, as well as the sequences involved in the expression of this gene, have been determined. The gene spans 1.5 kilobases and contains 4 exons and 3 introns, closely resembling the mammalian apoA-I gene. To determine the sequences involved in the expression of the chicken apoA-I gene, plasmid constructs containing serial deletions of the 5' flanking region of the chicken apoA-I gene fused to the bacterial chloramphenicol acetyltransferase (CAT) gene were transfected in human hepatoma (HepG2), colon carcinoma (Caco2), epithelial (Hela), mouse embryonal fibroblast (NIH3T3) cells, and quail myoblasts (QMLA29). The shortest deletion construct, containing 60 bp of the 5' upstream region, was sufficient for maximal transcriptional activity in all cell lines tested. This region contains a short sequence (nucleotides -60 to -54) that is highly conserved in birds and mammals, and an Sp1 binding site. Although the sequence between nucleotides -232 and -101 of the 5' region of the chicken apoA-I gene is partially homologous to the hepatic cell-specific enhancer of the mammalian apoA-I gene (located between nucleotides -222 and -110 upstream of the human apoA-I gene transcription start site), this chicken sequence is transcriptionally inactive in HepG2 cells. These results suggest that differences in the cis-acting regulatory elements of the apoA-I gene play a fundamental role in determining the differences in the tissue-specific expression of this gene in avian and mammalian species.
Screening for genes overexpressed in trout aflatoxin B1-induced hepatocellular carcinomas resulted in the isolation of cDNA sequences of two apolipoprotein A-Is, apoA-I-1 and apoA-I-2. The levels of apoA-I-1 and -2 mRNAs of liver and tumor were quite different. ApoA-I-1 mRNA was the major species in liver, while apoA-I-1 and -2 mRNAs were present at similar levels in several tumors. This elevated level of apoA-I-2 mRNA was observed in seven different tumors, suggesting that the overexpression of apoA-I-2 was a general feature of aflatoxin B1-induced liver tumors. Hybridization to genomic DNA demonstrated that trout has two different apoA-I genes which is in contrast to other vertebrates which have one gene coding for apoA-I. Liver apoA-I-1 and -2 cDNA clones specified the same amino acid sequence as the tumor apoA-I-1 and -2 cDNA clones. Analysis of the cDNA-derived amino acid sequences showed that trout apoA-I-1 and -2, like human apoA-I, consist largely of multiple 22 amino acid repeats having the potential to generate an amphipathic alpha-helix. The similarity of the repeat pattern in trout and human apoA-Is suggests that all the internal repeats in these sequences arose before the fish-mammal split, some 400 million years ago.
The 5'-flanking regions of the two low density lipoprotein (LDL) receptor genes in Xenopus laevis contain three repeat sequences that are virtually identical to the repeats that mediate sterol-regulated transcription of the human LDL receptor gene. Like their human counterparts, Xenopus repeats 1 and 3, but not repeat 2, bind the transcription factor Sp1 and thus probably function as positive transcription elements. Xenopus repeat 2, like human repeat 2, contains all of the nucleotides that are required for sterol regulation. Administration of sterols repressed Xenopus LDL receptor mRNA in cultured A6 kidney cells and in the liver of intact frogs. In frogs this repression was associated with a 2-fold increase in plasma LDL levels. Xenopus LDL contains a protein corresponding in size to human apoB-100, a ligand for the LDL receptor. We found no evidence that frog plasma contains B-48, nor did we observe a clear-cut protein corresponding to apoE. We conclude that the structural gene for the LDL receptor has been under sterol-mediated regulation at least since the time of amphibian development more than 350 million years ago.
We have examined the apolipoprotein content of the lipoproteins of several marine mammals by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Their apolipoprotein (apo) B-100, apoB-48, and apoA-I migrated to virtually the same position as the comparable human apolipoproteins. In cetaceans (bottlenose dolphins and killer whales), the molecular mass of the apoE was identical to that of human apoE (35 kDa). In contrast, in the lipoproteins of pinnipeds (harbor seals, sea lions, and walrus) there was no protein comparable in size to human apoE; however, there were two proteins in the 40- to 44-kDa range. The protein with the higher apparent molecular weight (44 kDa) was apoA-IV, as determined by NH2-terminal amino acid sequencing. Sequencing of the NH2-terminal 15 amino acids of the lower molecular weight protein (40-42 kDa) revealed no obvious homology with human apoE. However, a human apoE-specific monoclonal antibody, 1D7, bound to the 40- to 42-kDa protein, allowing us to identify that protein as apoE. Sequencing of sea lion apoE cDNA clones demonstrated that sea lion apoE is 311 amino acids in length, 12 residues longer than human apoE. All 12 additional residues are located in the NH2-terminal 31 amino acids, a region that has extremely low homology with the NH2-terminal portion of human apoE. The remainder of the sea lion apoE sequence is 74% homologous to human apoE. The sea lion apoE cDNA was expressed in Chinese hamster ovary (CHO) cells as well as CHO ldlD cells, a cell line that is deficient in O-glycosylation of proteins. The size of the sea lion apoE secreted by these two cell lines, compared with the apoE in sea lion plasma, indicated that the predominant form of apoE in sea lion plasma must be posttranslationally modified. Thus, our studies have demonstrated that the higher apparent molecular weight of pinniped (sea lion) apoE is due to a longer polypeptide chain as well as posttranslational modification of the protein.
Various strategies have been developed by metazoans for the transport of exogenous or endogenous lipids towards different tissues, where they are stored or oxi- dized. In all cases, this transport involves macromolecular protein-containing complexes: lipoproteins. For example, in direct relation with their open circulatory system and the differentiation of a lipid storage tissue, the fat body, insects have developed a system built around the lipopro- tein lipophorin, which circulates in the hemolymph, shuttling between the fat body cells producing it and the parenchymal cells to which it has direct access (1). A complex system has evolved in vertebrates in the con- text of a closed circulatory system, at the same time as the capacity of storing triglycerides in adipose tissue. As a result of an adequate assembling of different constituents in the blood, there are several lipoprotein classes that as- sure lipid transport. They can be classified according to hydrated density, ultracentrifugation flotation velocity (Si), electrophoretic mobility on agarose or, more re- cently, apolipoprotein composition. Different classes are thus distinguished by order of density and decreasing size: chylomicrons, VLDL (very low density lipopro- teins), IDL (intermediate density lipoproteins), LDL (low density lipoproteins) and HDL (high density lipopro- teins). The same class of lipoproteins defined by its den- sity may be composed of particles with different apo- lipoprotein compositions, thereby determining a different metabolic destiny. In the plasma, each lipoprotein is sub- jected to permanent changes by interactions with tissues and also with particles of different sizes and origins, which may or may not result in enzymatic transfers of lipids or apolipoproteins. From a functional standpoint, mammalian plasma lipoproteins are integrated into two transport systems, ex- ogenous and endogenous. In the former, lipoproteins (chylomicrons, VLDL) are large particles with low densi- ties. They are vectors for large quantities of nonpolar lipids, primarily triglycerides. They transport long-chain fatty acids to the well-developed adipose tissue, where they will be stored, or to other tissues where they will be oxidized. Since the circulatory system is closed, a prelimi- nary step of triglyceride hydrolysis by a lipoprotein lipase (LPL) attached to the cell membrane of endothelial cells precedes the transfer of fatty acids to cells which will uti- lize them. This exogenous system is also used to transfer
A lambda insertion type cDNA cloning vector, Lambda ZAP, has been constructed. In E. coli a phagemid, pBluescript SK(-), contained within the vector, can be excised by f1 or M13 helper phage. The excision process eliminates the need to subclone DNA inserts from the lambda phage into a plasmid by restriction digestion and ligation. This is possible because Lambda ZAP incorporates the signals for both initiation and termination of DNA synthesis from the f1 bacteriophage origin of replication (1). Six of 21 restriction sites in the excised pBluescript SK polylinker, contained within the NH2-portion of the lacZ gene, are unique in lambda ZAP. Coding sequences inserted into these restriction sites, in the appropriate reading frame, can be expressed from the lacZ promoter as fusion proteins. The features of this vector significantly increase the rate at which clones can be isolated and analyzed. The lambda ZAP vector was tested by the preparation of a chicken liver cDNA library and the isolation of actin clones by screening with oligonucleotide probes. Putative actin clones were excised from the lambda vector and identified by DNA sequencing. The ability of lambda ZAP to serve as a vector for the construction of cDNA expression libraries was determined by detecting fusion proteins from clones containing glucocerbrosidase cDNA's using rabbit IgG anti-glucocerbrosidase antibodies.
We have determined the nucleotide sequence of the rat apolipoprotein (apo-) A-IV gene and analyzed its structural and evolutionary relationships to the human apolipoprotein A-I, E, and C-III genes. The rat A-IV gene is 2.4 kilobases in size and consists of three exons (142, 126, and 1157 base pairs) interrupted by two introns (277 and 673 base pairs). The 5'-nontranslated region and most of the signal peptide are encoded by the first exon. Thus, the apo-A-IV gene lacks an intron in the 5'-nontranslated region of its mRNA in contrast to all other known apolipoprotein genes. Sequences coding for amphipathic docosapeptides span both the second and third exons of the rat A-IV gene. We demonstrate that this is also true for the human apolipoprotein genes. This gene family seems to have evolved by the duplication of an ancestral minigene that resulted in the formation of two exons. Thereafter, evolution of these sequences was dominated by intraexonic amplification of repeating units coding for amphipathic peptides. Sequence divergence of these repeats resulted in the functional differentiation of the apolipoproteins. However, conservation of the fundamental amphipathic pattern allowed members of this protein family to retain their lipid-binding properties.
In this review, we have presented our current knowledge of the biosynthesis, structure, and evolution of the apolipoprotein multigene family. The structure-function relationships of a number of apolipoproteins have also been examined from an evolutionary perspective. We mention a number of problems that need to be explored further.
The plasma protein apolipoprotein (apo) E is an important determinant of lipid transport and metabolism in mammals. In the present study, immunocytochemistry has been used to identify apo E in specific cells of the central and peripheral nervous systems of the rat. Light microscopic examination revealed that all astrocytes, including specialized astrocytic cells (Bergmann glia of the cerebellum, tanycytes of the third ventricle, pituicytes of the neurohypophysis, and Müller cells of the retina), possessed significant concentrations of apo E. In all of the major subdivisions of the central nervous system, the perinuclear region of astrocytic cells, as well as their cell processes that end on basement membranes at either the pial surface or along blood vessels, were found to be rich in apo E. Extracellular apo E was present along many of these same surfaces. The impression that apo E is secreted by astrocytic cells was confirmed by electron microscopic immunocytochemical studies, which demonstrated the presence of apo E in the Golgi apparatus. Apo E was not present in neurons, oligodendroglia, microglia, ependymal cells, and choroidal cells. In the peripheral nervous system, apo E was present within the glia surrounding sensory and motor neurons; satellite cells of the dorsal root ganglia and superior cervical sympathetic ganglion as well as the enteric glia of the intestinal ganglia were reactive. Apo E was also present within the non-myelinating Schwann cells but not within the myelinating Schwann cells of peripheral nerves. These results suggest that apo E has an important, previously unsuspected role in the physiology of nervous tissue.
Plasma cholesterol concentrations from White Carneau (WC) and Show Racer (SR) pigeons consuming a cholesterol-free grain diet averaged about 300 mg/dl, approximately 200 mg/dl as high density lipoproteins (HDL) and the remainder as low density lipoproteins (LDL). Consumption of a cholesterol-containing diet increased plasma cholesterol concentrations in both breeds to greater than 2000 mg/dl. Approximately one-half of this increase was as LDL with the remainder as beta-migrating very low density lipoproteins (beta-VLDL). There was little change in HDL concentration. LDL from cholesterol-fed animals had a greater net negative charge than control LDL, and was larger (Mr = 10 X 10(6) vs 3.2 X 10(60)) due to an increase in the number of cholesteryl ester molecules per particle. The principal apoprotein of LDL was apoB-100 with smaller amounts of apoA-I and several minor unidentified apoproteins. beta-VLDL was cholesteryl ester-rich, could be separated into two size populations by gel chromatography, and contained apoB-100 as its principal apoprotein. Apoprotein E was not detected in any of the plasma lipoproteins. HDL from control and cholesterol-fed animals was composed of a single class of particles with virtually identical composition resembling HDL2. The major apoprotein of HDL was apoA-I. There were no consistent quantitative or qualitative differences in the lipoproteins of the two breeds of pigeons that could help to explain the susceptibility to atherosclerosis of the WC or the resistance of the SR.
Apolipoprotein expression was examined in the postimplantation mouse embryo. Antibodies directed against murine Apolipoprotein AI and human low-density lipoprotein (LDL) particles specifically immunoprecipitated metabolically labelled radioactive apolipoproteins from the culture supernatant of 10.5 days post coitum (days p.c.) yolk sac visceral endoderm cultured in vitro. No evidence for apolipoprotein expression by other embryonic or extraembryonic tissues at this stage was obtained. Immunohistochemical staining at sectioned 10.5 days p.c. embryos with anti-Apolipoprotein AI antibodies revealed specific localization of immunoreactive material in the yolk sac visceral endoderm. We conclude that the yolk sac visceral endoderm is a source of lipoproteins during postimplantation embryonic development.
Apart from exhibiting the presence of lipoprotein [a] in its plasma, another interest of the European hedgehog in lipoprotein research lies in the quantitative prominence of a complex spectrum of high density lipoproteins (HDL) and very high density lipoproteins (VHDL) as cholesterol transporters in plasma (Laplaud, P. M. et al. 1989. Biochim. Biophys. Acta. 1005: 143-156). We, therefore, initiated studies in the field of reverse cholesterol transport in the hedgehog. As a first step, we characterized apolipoprotein A-I (apoA-I), the main protein component of hedgehog HDL and VHDL. Proteolytic cleavage of apoA-I (M(r) approx. 27 kDa) using two different enzymes resulted in two sets of peptides that were subsequently purified by high performance liquid chromatography, and that allowed us determination of the complete protein sequence. Hedgehog apoA-I thus consists of 241 amino acid residues and exhibits an overall 58% homology to its human counterpart, i.e., the lowest value observed to date among mammalian species. However, it retained the general organization common to all known apoA-Is, i.e., a series of amphipathic helical segments punctuated by proline residues. Circular dichroism experiments indicated a helical content of approx. 45%, increasing to approx. 58% in the presence of lecithin unilamellar liposomes. Apart from other differences, amino acid composition analysis shows that hedgehog apoA-I contains four isoleucine residues, while this amino acid is totally absent from the corresponding protein in higher mammals. Polyclonal antibodies raised against hedgehog apoA-I failed to detect any cross-reactivity between the animal and human proteins, although comparative prediction of the respective antigenic structures using the Hopp-Woods algorithm indicated that several potentially antigenic sites may occur in similar regions of the protein. Finally, hedgehog apoA-I was shown to be able to activate lecithin:cholesterol acyl transferase, although it was 4 to 5 times less efficient in this respect than the human protein.
The zebrafish hlx-1 gene belongs to the H2.0 subfamily of homeobox genes and is closely related to the mouse Dbx gene with respect to both homeodomain homology (96.7%) and neural expression during embryogenesis. Analysis of hlx-1 expression by in situ hybridization reveals several particularly interesting features. In late gastrula embryos, hlx-1 transcripts are detected within a circular area in the region of the presumptive rostral brain. Subsequently, the expression domain becomes restricted to the hypoblast and undergoes dynamic changes involving conversion into a longitudinal stripe which elongates and retracts following a temporal sequence. The site of transient hlx-1 expression along the ventral midline of the rostral neurectoderm, which in part corresponds to the prechordal plate, suggests a role in the determination of head mesoderm as well as in patterning of the rostral brain. As the midline stripe gradually disappears, the hlx-1 gene becomes regionally expressed within the diencephalon and at a specific dorsoventral level along the hindbrain and spinal cord. In the hindbrain, expression is initiated in dorsoventrally restricted transversal stripes which correlate with the segmental pattern of rhombomeres. The stripes fuse into bilateral columns that are later converted to two series of paired transversal stripes at the rhombomere borders. This pattern is consistent with the proposed subdivision of hindbrain segments into rhombomere centers separated by border regions.
A computer program package called MEGA has been developed for estimating evolutionary distances, reconstructing phylogenetic trees and computing basic statistical quantities from molecular data. It is written in C++ and is intended to be used on IBM and IBM-compatible personal computers. In this program, various methods for estimating evolutionary distances from nucleotide and amino acid sequence data, three different methods of phylogenetic inference (UPGMA, neighbor-joining and maximum parsimony) and two statistical tests of topological differences are included. For the maximum parsimony method, new algorithms of branch-and-bound and heuristic searches are implemented. In addition, MEGA computes statistical quantities such as nucleotide and amino acid frequencies, transition/transversion biases, codon frequencies (codon usage tables), and the number of variable sites in specified segments in nucleotide and amino acid sequences. Advanced on-screen sequence data and phylogenetic-tree editors facilitate publication-quality outputs with a wide range of printers. Integrated and interactive designs, on-line context-sensitive helps, and a text-file editor make MEGA easy to use.
We have investigated the synthesis and transport of apoE, the major apolipoprotein of the central nervous system, in the retina of the living rabbit. Four hours after the injection of [35S]methionine/cysteine into the vitreous, 44% of [35S]Met/Cys-labeled apoE is in soluble and membrane-enclosed retinal fractions, while 50% is in the vitreous. A significant amount of intact [35S]Met/Cys-labeled apoE is rapidly transported into the optic nerve and its terminals in the lateral geniculate and superior colliculus within 3-6 h in two distinguishable vesicular compartments. Müller glia in cell culture also synthesize and secrete apoE. Taken together, these results suggest that apoE is synthesized by Müller glia and secreted into the vitreous. ApoE is also internalized by retinal ganglion cells and/or synthesized by these cells and rapidly transported into the optic nerve and brain as an intact molecule. We discuss the possible roles of retinal apoE in neuronal dynamics.
The recently-developed statistical method known as the "bootstrap" can be used to place confidence intervals on phylogenies. It involves resampling points from one's own data, with replacement, to create a series of bootstrap samples of the same size as the original data. Each of these is analyzed, and the variation among the resulting estimates taken to indicate the size of the error involved in making estimates from the original data. In the case of phylogenies, it is argued that the proper method of resampling is to keep all of the original species while sampling characters with replacement, under the assumption that the characters have been independently drawn by the systematist and have evolved independently. Majority-rule consensus trees can be used to construct a phylogeny showing all of the inferred monophyletic groups that occurred in a majority of the bootstrap samples. If a group shows up 95% of the time or more, the evidence for it is taken to be statistically significant. Existing computer programs can be used to analyze different bootstrap samples by using weights on the characters, the weight of a character being how many times it was drawn in bootstrap sampling. When all characters are perfectly compatible, as envisioned by Hennig, bootstrap sampling becomes unnecessary; the bootstrap method would show significant evidence for a group if it is defined by three or more characters.
In trout embryo (Salmo gairdneri), lipids (largely triglycerids) are the principal endogenous reserves for the supply of metabolic energy. During the embryonic development, a rapid succession of events initiates a system allowing their mobilization and their transfer to the embryo. Just before the vitelline vascular network develops, the periblast begins to form very low density lipoproteins (VLDL) concentrated by periblastic Golgi stacks. This synthesis and the transfer to the blood accelerate. Rapidly after the installation of yolk vascular network, the hepatic portal system settles and the liver makes endogenous VLDL assuring the control of lipaemia. Yolk and embryonic glycogen occurs as β particles. It corresponds to oocyte glycogen which remained partly in the yolk sac and partly distributed among the embryonic cells during organogenesis. We have shown the presence of glycogen β particles in embryonic cells, especially hepatic and intestinal cells. This embryonic glycogen is used for the energy needs of embryo until the establishment of yolk vascular network, when it disappears. After this stage, the metabolic requirements are satisfied by the VLDL transferred to embryo. The yolk glycogen, particularly abundant in the periblastic mitochondrial zone, is metabolized by the periblast which enters a phase of intense activity just before the installation of the vascular network.
1.1. Data on 2, 3-diphosphoglycerate, P50, the Bohr Effect Factor and TB of a variety of mammalian species was summarized and two discrete clusters of species were found, a low DPG group and a high DPG group.2.2. The low DPG group tended to have high P50, moderate Bohr Effect Factor and high TB. and consisted of mammals that expended energy in short bursts; i.e. sprinters, dashers or pouncers.3.3. The high DPG group had a wider range of P50, Bohr Effect Factor and TB than the former group and consisted of mammals that were endurance runners, divers, burrowers, hibernators, altitude adapted or required high tissue O2 delivery over extended periods of time for other reasons.4.4. The P50 and Bohr Effect Factor differences were probably the result of structural differences in hemoglobin rather than differences in arterial PCO2, pH or body size, and the TB differences probably reflected a need for preheating vs gradual warm-up as related to running.5.5. Differences between the groups may be explained functionally in terms of the mode by which a species shifted its O2-hemoglobin dissociation during exercise or hypoxia; i.e. whether H+ dependent or DPG dependent.
The recently-developed statistical method known as the "bootstrap" can be used to place confidence intervals on phylogenies. It involves resampling points from one's own data, with replacement, to create a series of bootstrap samples of the same size as the original data. Each of these is analyzed, and the variation among the resulting estimates taken to indicate the size of the error involved in making estimates from the original data, In the case of phylogenies, it is argued that the proper method of resampling is to keep all of the original species while sampling characters with replacement, under the assumption that the characters have been independently drawn by the systematist and have evolved independently. Majority-rule consensus trees can be used to construct a phylogeny showing all of the inferred monophyletic groups that occurred in a majority of the bootstrap samples. If a group shows up 95% of the time or more, the evidence for it is taken to be statistically significant. Existing computer programs can be used to analyze different bootstrap samples by using weights on the characters, the weight of a character being how many times it was drawn in bootstrap sampling. When all characters are perfectly compatible, as envisioned by Hennig, bootstrap sampling becomes unnecessary; the bootstrap method would show significant evidence for a group if it is defined by three or more characters.
Inheritance of specific apolipoprotein E (apoE) alleles determines, in large part, the risk and mean age of onset of late-onset
familial and sporadic Alzheimer disease. The mechanism by which the apoE isoforms differentially contribute to disease expression
is, however, unknown. Isoform-specific differences have been identified in the binding of apoE to the microtubule-associated
protein tau, which forms the paired helical filament and neurofibrillary tangles, and to amyloid beta peptide, a major component
of the neuritic plaque. These and other isoform-specific interactions of apoE give rise to testable hypotheses for the mechanism(s)
of pathogenesis of Alzheimer disease. An unresolved issue of increasing importance is the relationship between the structural
pathological lesions and the cellular pathogenesis responsible for the clinical disease phenotype, progressive dementia. The
identification of apoE in the cytoplasm of human neurons and the characterization of isoform-specific binding of apoE to the
microtubule-associated proteins tau and MAP-2 present the possibility that apoE may affect microtubule function in the Alzheimer
brain.
We describe a series of stages for development of the embryo of the zebrafish, Danio (Brachydanio) rerio. We define seven broad periods of embryogenesis—the zygote, cleavage, blastula, gastrula, segmentation, pharyngula, and hatching periods. These divisions highlight the changing spectrum of major developmental processes that occur during the first 3 days after fertilization, and we review some of what is known about morphogenesis and other significant events that occur during each of the periods. Stages subdivide the periods. Stages are named, not numbered as in most other series, providing for flexibility and continued evolution of the staging series as we learn more about development in this species. The stages, and their names, are based on morphological features, generally readily identified by examination of the live embryo with the dissecting stereomicroscope. The descriptions also fully utilize the optical transparancy of the live embryo, which provides for visibility of even very deep structures when the embryo is examined with the compound microscope and Nomarski interference contrast illumination. Photomicrographs and composite camera lucida line drawings characterize the stages pictorially. Other figures chart the development of distinctive characters used as staging aid signposts. ©1995 Wiley-Liss, Inc.
The primary structure of Beijing duck apolipoprotein A-1 was determined by sequencing peptide fragments derived from tryptic and endoproteinase Asp-N digestion of the protein, and alignment with homologous chicken apo A-1. All of the peptide fragments were isolated by high-pressure liquid chromatography (HPLC) with a Vydac C18 column using a trifluoroacetic acid (TFA) buffer system. The N-terminus of the protein was determined to be aspartic acid by directly sequencing 52 residues of the intact protein. The C-terminus was alanine. The protein contains 240 amino acid residues. By analysis of the whole protein and its tryptic peptides, a six amino acid (Arg-Tyr-Phe-Trp-Gln-His) prosegment was determined. No cross-reactivity between duck and human apo A-1 with a goat antiserum against human apo A-1 was found. Sequence analysis of apo A-1 of other species indicates that amino acid substitutions in rat are more extensive than in other mammals. Isoleucine residues in apo A-1 are inversely correlated to the homology of human to other species, except dog.
Recent evidence indicates that apolipoprotein E (ApoE) plays a central role in the hippocampal response to injury. The co-ordinated expression of ApoE and its receptor, the ApoE/ApoB [low density lipoprotein (LDL)] receptor, appears to regulate the transport of cholesterol and phospholipids during the early and intermediate phases of the reinnervation process. During dendritic remodeling and synaptogenesis, neurons progressively repress the synthesis of cholesterol in favor of cholesterol internalization through the ApoE/LDL receptor pathway. The discovery that the ϵ4 allele is strongly linked to both sporadic and familial lateonset Alzheimer's disease (AD) raises the possibility that a dysfunction of the lipid-transport system associated with compensatory sprouting and synaptic remodeling could be central to the AD process. The role of ApoE in the CNS is particularly important in relation to the function of the cholinergic system, which relies to a certain extent on the integrity of phospholipid homeostasis in neurons. Recent evidence suggests that the ϵ4 allele has a direct impact on cholinergic function in AD.
1.1. Human serum apolipoprotein A-I contains a prominent 11-residue sequence periodicity.2.2. Similar 11-residue segments occur in the other sequenced human apolipoproteins, C-I, C-III, and A-II.3.3. Computer analyses of the sequences support the hypothesis that they evolved from a common ancestor.4.4. An evolutionary history of these proteins is proposed.5.5. The estimated rate of change of these proteins indicates that all four types will be found throughout the vertebrates and that related proteins will also be found in invertebrates.
In contrast to the vitellolysis zone which is involved in the degradation of the yolk, the cytoplasmic zone of the yolk syncytial layer, composed of many cytoplasmic organelles, is implicated in a secretory process. The granular endoplasmic reticulum of the latter is extremely well developed and organized into trabeculae. The yolk nuclei show a RNA positive reaction. The Golgi apparatus is implicated in the elaboration of very low density lipoproteins (VLDL) and of acid phosphatase. The numerous mitochondria seem to suggest an important energy metabolism in the solubilisation area. The appearance of certain special structures (crystalline bodies, pseudovesicular structures, lipochondria) as well as their relation with the organelles of the cytoplasmic zone, re-inforces the impression of a layer with a secretory nature and suggests its participation in the remodelling of the yolk products produced in the vitellolysis zone. The results of the investigations concerning the acid phosphatase activity suggest that this enzyme plays a role on the one hand in the degradation of certain platelets which penetrate into the cytoplasmic zone, and on the other hand in the regulation of VLDL, in the lysis of secretory products elaborated by the cytoplasmic zone. The possible presence of microperoxisomes is discussed as well as the positive detection of glucose-6-phosphate dehydrogenase.
Rat fetuses exhibit a high serum LDL concentration at term. Delivery caused a marked decrease of the LDL apolipoprotein (apo) B concentration independent of whether this occurred on days 21, 22 or 23 of gestation. The interruption of the yolk sac circulation by a ligature in situ for 6 h led to the same alterations of the LDL-apo B concentration as Caesarean section. Immunoelectronmicroscopic studies provided evidence that the epithelial cells of the visceral yolk sac exhibited electron dense LDL-sized and apo B containing particles which were localized over the compartments of the Golgi complexes, endoplasmatic reticulum, secretory vesicles and intercellular spaces, but not over the cell nuclei, mitochondria or lysosomes. ApoB containing LDL-sized particles could be obtained by ultracentrifugation from the disrupted material of the microsomal fraction of yolk sac homogenates. Isolated segments of the yolk sac membranes were capable to secrete apoB containing lipoproteins floating in the d less than 1.020 g/ml as well as in the d = 1.020-1.064 g/ml fraction with a 10-fold higher amount of apoB in the higher density class. Incorporation experiments with [35S] methionine gave evidence that these lipoproteins were at least partially provided with newly synthesized apoB predominantly found in the LDL fraction. The size of the negatively stained particles in the d = 1.020-1.064 g/ml fraction secreted from yolk sac segments corresponded to that of LDL from fetal rat serum. In contrast their acylglycerol content was significantly higher, whereas the percentage contribution of total cholesterol and protein was markedly reduced in comparison with serum LDL of the fetus. In summary, biochemical and ultrastructural studies provide clear cut evidence that the rat yolk sac is able to synthesize and to deliver apo B containing lipoproteins in the density ranges of VLDL, IDL and particular of LDL thus contributing to the supply of serum lipoproteins in the rat fetus. By recalculation of recent tracer kinetic data (Plonné et al. (1990) J. Lipid Res. 31, 747) using a mathematical step function model it was possible to assess the contribution of the rat yolk sac to the LDL influx into the fetal serum.
A cDNA encoding an apolipoprotein (Apo) has been isolated from the Atlantic salmon (Salmo salar) and sequenced. It encodes a peptide of 258 amino acids (aa), including a signal peptide of 18 aa, with 5'- and 3'-untranslated regions of the mRNA of 12 and 329 nucleotides, respectively. The protein has structural features in common with other Apo's of human and avian origin, including conserved sequences in the signal peptide and a series of internal repeats of 22 aa. The sequence has been identified as salmon Apo A-I (sApoA-I), and has 23% aa identity with human ApoA-I. Northern-blot analysis using the sApoA-I cDNA probe against total RNA prepared from several salmon tissues detects the expression of this gene in liver, intestine and muscle. A phylogenetic analysis reveals that the mammalian ApoA-I, ApoA-IV and Apo-E aa sequences are more closely related to each other than any of them are to sApoA-I. This suggests that the duplication events, from which A-I, A-IV and E arose, occurred after the divergence of the tetrapod and teleost ancestors.
Human apolipoprotein E, a blood plasma protein, mediates the transport and uptake of cholesterol and lipid by way of its high
affinity interaction with different cellular receptors, including the low-density lipoprotein (LDL) receptor. The three-dimensional
structure of the LDL receptor-binding domain of apoE has been determined at 2.5 angstrom resolution by x-ray crystallography.
The protein forms an unusually elongated (65 angstroms) four-helix bundle, with the helices apparently stabilized by a tightly
packed hydrophobic core that includes leucine zipper-type interactions and by numerous salt bridges on the mostly charged
surface. Basic amino acids important for LDL receptor binding are clustered into a surface patch on one long helix. This structure
provides the basis for understanding the behavior of naturally occurring mutants that can lead to atherosclerosis.
We present the complementary DNA and deduced amino acid sequence of rat apolipoprotein A-II (apoA-II), and the results of a detailed statistical analysis of the nucleotide and amino acid sequences of all the apolipoprotein gene sequences published to date: namely, those of human and rat apoA-I, apoA-II and apoE, rat apoA-IV, and human apoC-I, C-II and C-III. Our results indicate that the apolipoprotein genes have very similar genomic structures, each having a total of three introns at the same locations. Using the exon/intron junctions as reference points, we have obtained an alignment of the coding regions of all the genes studied. It appears that the mature peptide regions of these genes are almost completely made up of tandem repeats of 11 codons. The part of mature peptide region encoded by exon 3 contains a common block of 33 codons, whereas the part encoded by exon 4 contains a much more variable number of internal repeats of 11 codons. These genes have apparently evolved from a primordial gene through multiple partial (internal) and complete gene duplications. On the basis of the degree of homology of the various sequences, and the pattern of the internal repeats in these genes, we propose an evolutionary tree for the apolipoprotein genes and give rough estimates of the divergence times between these genes. Our results show that apoA-II has evolved extremely rapidly and that apoA-I and apoE also have evolved at high rates but some regions are better conserved than the others. The rate of evolution of individual regions seems to be related to the stringency of their functional requirements.
Using an antibody against chicken apolipoprotein (apo) A-I, we identified multiple cDNA clones for the protein in two intestinal cDNA libraries in lambda gt11. The complete nucleotide sequence of chicken apoA-I cDNA was determined. The sequence predicts a mature protein of 240 amino acids, a 6-amino acid propeptide and an 18-amino acid signal peptide. Using a 32P-cDNA probe, we detected the presence of apoA-I mRNA in 21 day old chicken intestine, liver, kidney, spleen, breast muscle and brain. The primary sequence of apoA-I contains numerous tandem repeats of 11 and 22 residues in a manner similar to the mammalian proteins. Our analysis of apoA-I sequences from human, rabbit, dog, rat, and chicken indicates that the rate of amino acid substitution is considerably faster in the rat lineage than in other mammalian lineages.
Apolipoprotein E is a plasma protein that serves as a ligand for low density lipoprotein receptors and, through its interaction with these receptors, participates in the transport of cholesterol and other lipids among various cells of the body. A mutant form of apolipoprotein E that is defective in binding to low density lipoprotein receptors is associated with familial type III hyperlipoproteinemia, a genetic disorder characterized by elevated plasma cholesterol levels and accelerated coronary artery disease. Apolipoprotein E is synthesized in various organs, including liver, brain, spleen, and kidney, and is present in high concentrations in interstitial fluid, where it appears to participate in cholesterol redistribution from cells with excess cholesterol to those requiring cholesterol. Apolipo-protein E also appears to be involved in the repair response to tissue injury; for example, markedly increased amounts of apolipoprotein E are found at sites of peripheral nerve injury and regeneration. Other functions of apolipoprotein E, unrelated to lipid transport, are becoming known, including immunoregulation and modulation of cell growth and differentiation.
A new method called the neighbor-joining method is proposed for reconstructing phylogenetic trees from evolutionary distance data. The principle of this method is to find pairs of operational taxonomic units (OTUs [= neighbors]) that minimize the total branch length at each stage of clustering of OTUs starting with a starlike tree. The branch lengths as well as the topology of a parsimonious tree can quickly be obtained by using this method. Using computer simulation, we studied the efficiency of this method in obtaining the correct unrooted tree in comparison with that of five other tree-making methods: the unweighted pair group method of analysis, Farris's method, Sattath and Tversky's method, Li's method, and Tateno et al.'s modified Farris method. The new, neighbor-joining method and Sattath and Tversky's method are shown to be generally better than the other methods.
The chapter collates available data on the physicochemical characteristics of the plasma lipoproteins and their apolipoproteins in mammals in such a way as to provide both a rapid access to the main features of the lipid transport system in each species and to facilitate a ready comparison between them. When studies of lipoprotein and apolipoprotein profiles are initiated in animals in which little prior information is available, techniques of isopycnic density gradient ultracentrifugation may profitably be applied. In the vast majority of mammals, high-density lipoproteins are the predominant class, and may account for up to 80% of the total substances. In man, the bulk of the circulating cholesterol is transported in esterified form as LDL; however, this is not the case in the majority of mammals in which HDL is often the primary cholesterol carrier. The microviscosities of the lipid domains of rabbit, bovine, and porcine lipoproteins differed little from those of the corresponding human particles, apart from the elevated microviscosity of bovine HDL, indicative of significant lipid–protein interaction. However, the molecular biological studies are now providing an insight not only into the amino acid sequences of mammalian apoproteins, but also into the proteolytic processing of the nascent polypeptides and into the structure and modulation of their genes.
We have previously demonstrated that astrocytes synthesize and secrete apolipoprotein E in situ. In the present work, primary cultures of rat brain astrocytes were used to study apolipoprotein E synthesis, secretion, and metabolism in vitro. The astrocytes in culture contained immunoreactive apolipoprotein E in the area of the Golgi apparatus. Incubation of the astrocytes with [35S]methionine resulted in the secretion of labeled immunoprecipitable apolipoprotein E, which constituted 1-3% of the total secreted proteins. The apolipoprotein E secreted in culture and the apolipoprotein E in rat brain extracts differed from serum apolipoprotein E in two respects: both had a slightly higher apparent molecular weight (approx. 36,000) and more acidic isoforms than serum apolipoprotein E. Sialylation of the newly secreted apolipoprotein accounted for the difference in both the apparent molecular weight and isoelectric focusing pattern of newly secreted apolipoprotein E and plasma apolipoprotein E. The astrocytes possessed apolipoprotein B,E(LDL) receptors capable of binding and internalizing apolipoprotein E-containing lipoproteins. The uptake of lipoproteins by the cells led to a reduction in the number of cell surface receptors and to the intracellular accumulation of cholesteryl esters. Since apolipoprotein E is present within the brain, and since brain cells can express apolipoprotein B,E(LDL) receptors, apolipoprotein E-containing lipoproteins may function to redistribute lipid and regulate cholesterol homeostasis within the brain.
The messages for two small but abundant apolipoproteins found in lamprey blood plasma were cloned with the aid of oligonucleotide probes based on amino-terminal sequences. In both cases, numerous clones were identified in a lamprey liver cDNA library, consistent with the great abundance of these proteins in lamprey blood. One of the cDNAs (LAL1) has a coding region of 105 amino acids that corresponds to a 21-residue signal peptide, a putative 8-residue propeptide, and the 76-residue mature protein found in blood. The other cDNA (LAL2) codes for a total of 191 residues, the first 23 of which constitute a signal peptide. The two proteins, which occur in the "high-density lipoprotein fraction" of ultracentrifuged plasma, have amino acid compositions similar to those of apolipoproteins found in mammalian blood; computer analysis indicates that the sequences are largely helix-permissive. When the sequences were searched against an amino acid sequence data base, rat apolipoprotein IV was the best matching candidate in both cases. Although a reasonable alignment can be made with that sequence and LAL1, definitive assignment of the two lamprey proteins to typical mammalian classes cannot be made at this point.
I have previously described [Babin (1987) J. Biol. Chem. 262, 4290-4296] the apolipoprotein composition of the major classes of trout plasma lipoproteins. The present work describes the use of an isopycnic density gradient centrifugation procedure and sequential flotation ultracentrifugation to show: (1) the presence of intermediate density lipoproteins (IDL) in the plasma, between 1.015 and 1.040 g/ml; (2) the existence of a single type of Mr 240,000 apoB-like in the low density lipoproteins (LDL, 1.040 less than p less than 1.085 g/ml); (3) the presence of apoA-I-like (Mr 25,000) in the densest LDL; (4) the adequacy of 1.085 g/ml as a cutoff between the LDL and high density lipoproteins (HDL); (5) the accumulation of Mr 55,000 and 76,000 apolipoproteins and apoA-like apolipoproteins in the 1.21 g/ml infranatant. The fractionation of trout lipoprotein spectrum thus furnishes the distribution of the different lipoprotein classes and leads to the description of the constituent apolipoproteins, which account for about 36% of circulating plasma proteins in this species.
RNA from goosecoid, a homeobox-containing gene expressed during gastrulation in the anterior mesoderm of vertebrate embryos, can generate organizer activity when injected into ventral mesoderm, resulting in a secondary body axis; it is not yet understood, however, how goosecoid performs its organizer function. We report here that in the zebrafish gastrula, a domain of goosecoid expression arises in presumptive anterior neurectoderm which lies directly above goosecoid-expressing mesendodermal cells. From this position, goosecoid expression then spreads gradually across the ectodermal layer. In cyclops mutant embryos, which lack a ventral anterior brain, expression of goosecoid is abnormal in the mesendoderm and completely absent in the overlying neurectoderm. These results indicate that cyclops is required for correct specification of the mesendoderm and suggest that goosecoid expression in the ectoderm may result from vertical induction from the mesoderm. We propose that in the gastrula head, goosecoid may be important in organizing the ventral neurectoderm.
The dominant structural motif of the peripheral apolipoproteins is the amphipathic helix, which is responsible for the reversible association of these proteins with lipids, as well as for many biological functions mediated by these apolipoproteins. This chapter reviews the different classes of amphipathic helices, using a combination of powerful computer programs to develop a comparison database and to analyze these structures. It also discusses their evolutionary origins, physical-chemical properties, X-ray structure determination, and conformational analysis. Although the structures of these lipoprotein classes are similar, they differ in relative proportion of lipids, in the apolipoprotein: lipid ratio and in the apolipoprotein species. The amphipathic α helix plays a pivotal role in the structure and functions of the exchangeable apolipoproteins. Site-directed mutagenesis and other molecular biology-based techniques are available for probing the structural motif. The location and properties of the amphipathic helices in apolipoproteins and the results are compared with recently developed and ever-expanding computer methods for the location and characterization. A variety of structure-function studies, including the activation of lipoprotein lipase, receptor recognition, lecithin-cholesterol acyltransferase (LCAT) activation, and antiviral and anti-inflammatory activities are also discussed.
This chapter focuses on the role of apoE in lipoprotein metabolism and the most completely described function of the protein. Apolipoprotein E (apoE) is one of the best characterized in terms of its structural and functional properties. Plasma apolipoproteins regulate lipoprotein metabolism and control the transport and redistribution of lipids among tissues and cells. Apolipoproteins can perform one of three major roles because of their ability to bind lipid. First, apolipoproteins stabilize the pseudomicellar structure of lipoprotein particles. Second, apolipoproteins can act as cofactors or activators of various enzymes or lipid transfer proteins that participate in the metabolism of “remodeling” of lipoproteins as they circulate in plasma. A third function of plasma apolipoproteins-one that is restricted to apoB100 and ApoE- is to serve as a ligand for cell surface lipoprotein receptors. The three-dimensional structure of a 22-kDa fragment of human apoE is solved by X-ray crystallography; the relation of this structure to the role of apoE in lipoprotein metabolism is discussed, together with a critical and extensive examination of the chemistry and biology of this apolipoprotein, which plays such a central role in lipoprotein metabolism. Apolipoprotein E has three major isoform in the human population, which affect lipoprotein metabolism differently, resulting in different levels of the plasma lipoproteins. The role of apoE as a cofactor in lipolytic processing of triglyceride-rich lipoproteins, and the role of apoE in the reverse cholesterol transport process are described.
We have identified and characterized a previously unreported human gene that is found within the apolipoprotein (apo) E/C-I/C-II gene locus. On the basis of its location and its properties, this new gene has been designated APOC4. Nucleotide sequence analysis of genomic DNA and liver cDNA clones revealed a 3.3-kb gene consisting of three exons and two introns. Its 3' terminus lies 555 bp upstream of APOC2, giving both genes the same transcriptional orientation. The promoter of the APOC4 gene lacks a typical TATA box, consistent with an apparent heterogeneity in transcription start sites. RNase protection analysis indicated relatively low apoC-IV mRNA levels in human liver, compared to apoC-II mRNA levels. The predicted apoC-IV protein sequence, comprising 127 amino acid residues, contains a putative 25-residue signal peptide and two potential amphipathic alpha-helical domains. Amino acid sequence comparisons indicate a limited homology between apoC-IV and either apoC-I or apoC-II. Since its hepatic expression and predicted protein structure are characteristic of the other genes in this cluster, we propose that the APOC4 gene is a member of the apolipoprotein gene family.
In this study we have characterized four of the principle goose apolipoproteins and compared their physicochemical properties with human and avian counterparts. Goose ApoB‐100 and ApoAI amino acid compositions were very similar to their chicken and human homologous proteins. The partial N‐terminal sequence from goose ApoAI was 91% and 82% similar to the corresponding duck and chicken proteins, respectively. Most of the observed amino acid changes detected between the ApoAI sequences were amino acid replacements having the same characteristics and could be the result of a single base mutation.
The N‐terminal portion of two ApoC‐like apolipoproteins were also studied. Goose ApoCa had an electrophoretic mobility of 0.31 and exhibited a nine‐residue motif that was well conserved between ApoCIII sequences from different species. We therefore suggest that ApoCa is the equivalent of mammalian ApoCIII. The N‐terminal portion of goose ApoCb, the second major ApoC in high‐density apolipoprotein, showed no similarity to proteins previously described in the literature. This protein displayed two isomorphs in alkaline urea gel electrophoresis called ApoCb1 and ApoCb2 with R f values of 0.36 and 0.39, respectively. A genetic polymorphism was detected in the population whereby 25% of the animals carried only one isomorph and 50% exhibited both ApoCb isomorphs. These frequencies were similar in females and males. The transmission mode of these ApoCb isomorphs was consistent with two segregating alleles from a single codominantly expressed gene.
The defective binding of apolipoprotein (apo) E2 to lipoprotein receptors, an underlying cause of type III hyperlipoproteinemia, results from replacement of Arg 158 with Cys, disrupting the naturally occurring salt bridge between Asp 154 and Arg 158. A new bond between Asp 154 and Arg 150 is formed, shifting Arg 150 out of the receptor binding region. Elimination of the 154-150 salt bridge by site-directed mutagenesis of Asp 154 to Ala restored the receptor binding activity to near normal levels. The X-ray crystal structure of apoE2 Ala 154 demonstrated that Arg 150 was relocated within the receptor binding region. Our results demonstrate that defective binding of apoE2 occurs by a novel mechanism of the replacement of one salt bridge with another.
Human apolipoprotein (apo) E, long known for its prominent role in cholesterol transport and plasma lipoprotein metabolism, has recently emerged as a major genetic risk factor for Alzheimer's disease, a neurodegenerative disorder. In a variety of populations worldwide, one of the three common alleles of apoE, apoE4, is overrepresented in Alzheimer's subjects compared with age- and sex-matched controls. The genetic and epidemiologic evidence suggests that apoE is a major susceptibility gene for Alzheimer's disease; it likely accounts for a major portion of the genetic heterogeneity in the disease. Although its role in the development of Alzheimer's disease is unknown, biochemical and cell biology studies are providing important insights into how apoE may be involved in neurodegenerative disorders. Based on an understanding of the structure and function of apoE in lipid transport and cellular metabolism, it is suggested that apoE is involved in a final common pathway of neuronal repair and remodeling: apoE3 (most common allele) supporting effective repair and remodeling after neuronal injury by noxious agents, and apoE4 being less effective in these processes.