Content uploaded by Kiwamu Tanaka
Author content
All content in this area was uploaded by Kiwamu Tanaka
Content may be subject to copyright.
GS52 Ecto-Apyrase Plays a Critical Role
during Soybean Nodulation1[W][OA]
Manjula Govindarajulu, Sung-Yong Kim, Marc Libault, R. Howard Berg, Kiwamu Tanaka,
Gary Stacey, and Christopher G. Taylor*
Donald Danforth Plant Science Center, St. Louis, Missouri 63132 (M.G., R.H.B., C.G.T.); and Division of Plant
Sciences, National Center for Soybean Biotechnology (S.-Y.K., M.L., K.T., G.S.), and Division of Biochemistry
and Department of Molecular Microbiology and Immunology (G.S.), C.S. Bond Life Sciences Center,
University of Missouri, Columbia, Missouri 65211
Apyrases are non-energy-coupled nucleotide phosphohydrolases that hydrolyze nucleoside triphosphates and nucleoside
diphosphates to nucleoside monophosphates and orthophosphates. GS52, a soybean (Glycine soja) ecto-apyrase, was
previously shown to be induced very early in response to inoculation with the symbiotic bacterium Bradyrhizobium japonicum.
Overexpression of the GS52 ecto-apyrase in Lotus japonicus increased the level of rhizobial infection and enhanced nodulation.
These data suggest a critical role for the GS52 ecto-apyrase during nodulation. To further investigate the role of GS52 during
nodulation, we used RNA interference to silence GS52 expression in soybean (Glycine max) roots using Agrobacterium
rhizogenes-mediated root transformation. Transcript levels of GS52 were significantly reduced in GS52 silenced roots and these
roots exhibited reduced numbers of mature nodules. Development of the nodule primordium and subsequent nodule
maturation was significantly suppressed in GS52 silenced roots. Transmission electron micrographs of GS52 silenced root
nodules showed that early senescence and infected cortical cells were devoid of symbiosome-containing bacteroids.
Application of exogenous adenosine diphosphate to silenced GS52 roots restored nodule development. Restored nodules
contained bacteroids, thus indicating that extracellular adenosine diphosphate is important during nodulation. These results
clearly suggest that GS52 ecto-apyrase catalytic activity is critical for the early B. japonicum infection process, initiation of
nodule primordium development, and subsequent nodule organogenesis in soybean.
Apyrases (nucleotide phosphohydrolases [NTPases];
EC 3.6.1.15) are highly active, membrane-bound hydro-
lytic enzymes that are present in all prokaryotic and
eukaryotic organisms (Steinebrunner et al., 2003). ATP
is an essential energy source for processes such as ion
uptake, protein synthesis, cytoplasmic streaming, and
motility (Shibata et al., 1999). This energy derives from
hydrolysis by ATPases, producing ADP or AMP and
inorganic phosphates. In contrast to ATPases, apyrases
hydrolyze nucleoside triphosphates (NTPs) and nucle-
oside diphosphates yielding nucleoside monophosphates
and orthophosphates. Apyrases have low substrate
specificity and are insensitive to ATPase inhibitors
(Komoszynski and Wojtczak, 1996). Several studies
showed that at least two apyrase genes exist in various
organisms, including yeast (Saccharomyces cerevisiae;
Gao et al., 1999), Arabidopsis (Arabidopsis thaliana;
Steinebrunner et al., 2000), Dolichos biflorus (Roberts
et al., 1999), soybean (Glycine soja; Day et al., 2000),
Medicago truncatula (Cohn et al., 2001), Lotus japonicus
(Cannon et al., 2003), pea (Pisum sativum; Hsieh et al.,
1996), and the protozoan Toxoplasma gondii (Bermudes
et al., 1994).
There are two major categories of apyrases: ecto-
apyrases that typically have an extracellular catalytic
domain (Plesner, 1995) and endo-apyrases with an
intracellular catalytic domain on the inside face of the
cell membrane (Komoszynski and Wojtczak, 1996). For
example, in yeast, two endo-apyrases are required to
regulate the glycosylation of N- and O-linked oligo-
saccharides in the Golgi lumen (Abeijon et al., 1993;
Gao et al., 1999). These endo-apyrases, encoded by the
gda1 and ynd1 genes, control the turnover of GDP
(released by hydrolysis of GTP sugar) to GMP (Abeijon
et al., 1993; Gao et al., 1999). In animals, ecto-apyrases
have several important physiological roles such as
involvement in neuron signaling (Sarkis and Salto,
1991; Plesner, 1995; Komoszynski and Wojtczak, 1996),
blood platelet aggregation (Marcus and Safier, 1993),
and ATP-mediated immunoresponses (Virgilio, 1998).
For instance, animal ecto-apyrases play a critical role
at the synaptic junction of nerve cells where degrada-
1
This work was supported by the National Science Foundation
(grant no. 0421620 to M.G.) and by the National Research Initiative of
the U.S. Department of Agriculture Cooperative State Research,
Education, and Extension Service (grant no. 2005–35319–16192 to
S.-Y.K.).
* Corresponding author; e-mail ctaylor@danforthcenter.org.
The author responsible for distribution of materials integral to the
findings presented in this article in accordance with the policy
described in the Instructions for Authors (www.plantphysiol.org) is:
Christopher G. Taylor (ctaylor@danforthcenter.org).
[W]
The online version of this article contains Web-only data.
[OA]
Open access articles can be viewed online without a sub-
scription.
www.plantphysiol.org/cgi/doi/10.1104/pp.108.128728
994 Plant Physiology, February 2009, Vol. 149, pp. 994–1004, www.plantphysiol.org !2008 American Society of Plant Biologists
tion of extracellular ATP to AMP occurs (Sarkis and
Salto, 1991; Komoszynski and Wojtczak, 1996). The
AMP activates 5#-nucleotidase, an enzyme abundant
in the synaptic space, releasing adenosine, which
reenters the cell and restores the cellular ATP pool
(Komoszynski and Wojtczak, 1996). Therefore, ecto-
apyrase plays a key role during synaptic junction
activity.
In plants, endo-apyrases have been characterized in
soybean (Day et al., 2000), potato (Solanum tuberosum;
Kettlun et al., 2005), and pea (Shibata et al., 2002). For
instance, in potato, an endo-apyrase was suggested to
be involved in the regulation of several key steps
during starch synthesis (Handa and Guidotti, 1996). In
pea, a nuclear-localized apyrase was reported to be
stimulated by red light (Chen and Roux, 1986) and
mediated by calmodulin in a calcium-dependent man-
ner (Chen et al., 1987) or casein kinase II (Hsieh et al.,
2000). This apyrase was expressed both in light- and
dark-grown pea roots, but more strongly expressed in
dark-grown plumules and stems (Hsieh et al., 1996).
Plant ecto-apyrases have been proposed to play
several roles, including phosphate transport and mo-
bilization (Thomas et al., 1999), toxin resistance
(Thomas et al., 2000), and cytoskeleton-based cellular
metabolism (Shibata et al., 1999). Early reports have
suggested that this cytoskeleton-associated apyrase
may be involved during signal transduction on the
cytoskeleton (Komoszynski and Wojtczak, 1996) or
transported to other locations through the cytoskele-
ton (Davies et al., 1996). Thomas et al. (1999) showed
that transgenic Arabidopsis plants expressing the
psNTP9 ecto-apyrase exhibited enhanced growth in
comparison to wild-type plants when supplied with
exogenous ATP as an inorganic phosphate source,
suggesting that this apyrase may play an important
role in the uptake of inorganic phosphate from the
extracellular matrix. A role for ecto-apyrases in nod-
ulation has previously been proposed. For example, in
D.biflorus, an ecto-apyrase originally isolated from
roots as a unique lectin (DB46) was named a lectin-
nucleotide phosphohydrolase (Db-LNP; Etzler et al.,
1999). Although showing no significant sequence sim-
ilarity to classical lectins, this Db-LNP/apyrase was
shown to bind to the lipo-chitin Nod factor, produced
by Rhizobium and essential for nodulation. Using an-
tibodies, Db-LNP was localized to the epidermal cell
surface of young roots, predominantly on the root hair
surface, the primary site of rhizobial infection. Pre-
treatment of roots with anti-LNP serum inhibited root
hair deformation and nodulation (Kalsi and Etzler,
2000). These data argued strongly for a role for Db-
LNP during the early nodulation response (Etzler
et al., 1999). In M. truncatula, four putative apyrase
genes were identified (Mtapy1-4); two of which (Mtapy1
and Mtapy4) showed evidence of increased mRNA
levels (within 3–6 h) when roots were inoculated with
Sinorhizobium meliloti, while mRNA levels of Mtapy2
and Mtapy3 remained unaffected by rhizobial inocu-
lation (Cohn et al., 2001). In soybean, two apyrases,
GS50, an endo-apyrase localized in the Golgi, and
GS52, an ecto-apyrase localized to the plasma mem-
brane, were identified and partially characterized
(Day et al., 2000). Semiquantitative reverse transcrip-
tion (RT)-PCR showed that GS52, but not GS50, was
induced within 6 h of inoculation with Bradyrhizobium
japonicum, suggesting a possible role for this ecto-
apyrase during early nodulation. Roots treated with
antibody directed against GS52 or GS50 blocked soy-
bean nodulation only with the former (Day et al.,
2000). A phylogenetic analysis also showed that the
GS52 apyrase, the Db-LNP, and other legume ortho-
logs belonged to an apparent legume-specific clade,
suggesting a unique function for these enzymes in
legumes (Roberts et al., 1999; Cannon et al., 2003).
More recently, McAlvin and Stacey (2005) reported
that overexpression of soybean GS52 ecto-apyrase in L.
japonicus enhanced infection by Mesorhizobium loti and
increased nodulation, again suggesting an important
role during nodulation. Despite several reports indi-
cating apyrase function in legumes, the specific role
for GS52 ecto-apyrase during nodulation in soybean
remains unknown. We therefore investigated the role
of GS52 ecto-apyrase using a RNA interference (RNAi)
approach during nodulation in soybean (Glycine max).
RNA silencing or posttranscriptional gene silencing
is a powerful tool for the analysis of gene function in
plants (Waterhouse and Helliwell, 2003). RNAi using
Agrobacterium rhizogenes-mediated root transformation
is an efficient method to silence genes in legume roots
(e.g. M.truncatula; Limpens and Bisseling, 2003; and L.
japonicus; Kumagai and Kouchi, 2003). In this study,
we show that RNAi-mediated silencing of the GS52
ecto-apyrase results in severe suppression of nodule
primordium development and maturation. Addition
of exogenous ADP (100 mM) to the GS52 silenced roots
restores mature nodule formation. These data suggest
that the catalytic activity of the GS52 ecto-apyrase,
which would result in ADP release, likely plays a
beneficial role during nodulation. Our data clearly
indicate that GS52 ecto-apyrase is important for the
early B. japonicum infection process, nodule primor-
dium development, and subsequent maturation re-
vealing a novel role for GS52 during nodulation in
soybean.
RESULTS
Differential Expression of Two Apyrase Genes in
Soybean Tissues
Soybean contains two distinct apyrase genes, GS50
and GS52, with 73% sequence identity (Day et al.,
2000). As a result, we used quantitative real-time-PCR
(qRT-PCR) analysis, with gene-specific primers, to
measure the expression of GS50 and GS52 mRNA in
different soybean tissues. The qRT-PCR was per-
formed with total RNA isolated from 10 different
soybean tissue types: root tips, stripped roots (roots
GS52 Is Essential for Soybean Nodulation
Plant Physiol. Vol. 149, 2009 995
devoid of root hairs), root hair cells, mature whole
roots, mature stems, leaves, apical meristems, flowers,
young pods, and green pods (Fig. 1). The expression
levels for GS50 and GS52 genes were normalized with
a constitutively expressed reference gene cons6, an
F-box protein (Libault et al., 2008). GS50 mRNA levels
were higher than those of GS52 in all tissues tested
except in the root tips, where the expression levels
were similar. GS50 mRNA was weakly expressed in
the root tips, but strongly expressed in mature whole
roots, root hair cells, mature stems, leaves, apical
meristems, flowers, young pods, and green pods and
very strongly expressed in stripped roots (Fig. 1). GS52
mRNA was strongly expressed in 18-d-old roots.
Lower levels of GS52 expression were observed in
root hair cells, root tip, and stripped root samples. In
contrast to GS50,GS52 mRNA was detected only in the
stem and not in the other aerial tissues of the soybean
plant.
GS52 Ecto-Apyrase Is Induced during Nodulation
To determine the role of apyrase during nodulation
in soybean, we used qRT-PCR analysis to assess GS50
and GS52 mRNA levels during the later stages of
infection by B.japonicum. The qRT-PCR analysis was
performed with total RNA isolated from uninoculated
roots and roots inoculated with B.japonicum at 0, 4, 8,
16, 24, and 32 d postinoculation (dpi; Fig. 2). The
expression of ENOD40 mRNA, an early nodulin gene,
was also measured as a positive control because it
shows rapid accumulation in response to B.japonicum
inoculation (Kouchi and Hata, 1993; Yang et al., 1993;
Asad et al., 1994; Papadopoulou et al., 1996). The
inoculated and uninoculated soybean roots may be in
different metabolic states, with the inoculated roots
nodulating and fixing nitrogen, while the uninocu-
lated roots are in a nitrogen-deprived state. Therefore,
soybean encoding cons6 was used as a reference gene
(Libault et al., 2008) to normalize the expression levels
of GS50,GS52, and ENOD40 in both inoculated and
uninoculated roots. The normalized values from inoc-
ulated roots were compared against uninoculated
roots to give the ratio of expression levels for GS52,
GS50, and ENOD40 (Fig. 2). The GS52 and ENOD40
mRNA levels were strongly induced during nodula-
tion. Our experiments showed that the GS52 mRNA
levels were not induced at 3, 6, 12, 24, and 48 h
postinoculation (data not shown). However, GS52
expression levels increased at 8, 16, and 24 dpi and
continued to remain high 32 dpi. GS50 mRNA levels
increased only during the later stages of nodulation
Figure 1. Expression profile of apyrase GS52 and
GS50 mRNA levels in different soybean tissues.
Expression levels of GS52 and GS50 mRNA were
measured by real-time PCR analysis from apical
meristem at 14 d; trifoliate leaves, stem, and roots
at 18 d; flowers, seeds, and pods at R6 stage; and root
hair cells, stripped roots, and root tips at 3 d
postgermination in soybean plants. Soybean encod-
ing Cons6 was used as a reference gene (expression
level = 1) to normalize the expression of GS52 (black
bars) and GS50 (gray bars). The error bars represent
the SEs of three independent biological replicates and
two technical repeats.
Figure 2. Ratio of GS52,GS50, and ENOD40 expression levels in
soybean roots after inoculation with B.japonicum. Using real-time PCR
analysis, the expression levels for GS52,GS50, and ENOD40 were
measured in inoculated roots and uninoculated roots at 4, 8, 16, 24,
and 32 dpi. The uninoculated roots were mock inoculated with water.
ENOD40 was used as an internal control. Soybean encoding Cons6
was used as a reference gene to normalize the expression levels of
GS52 (black bars), GS50 (gray bars), and ENOD40 (white bars) in
inoculated roots and in uninoculated roots. Each bar represents the SEs
of three independent biological replicates and two technical repeats.
The expression levels for GS52,GS50, and ENOD40 in inoculated
roots were normalized and compared to uninoculated roots and were
significantly different (* = P,0.05; ** = P,0.01; *** = P,0.001
using Student’s ttest).
Govindarajulu et al.
996 Plant Physiol. Vol. 1 49, 2009
and were not as highly expressed as the GS52 gene at
24 and 32 dpi. These results suggest GS52, previously
reported as an early nodulin (Day et al., 2000), may
also play a major role during later stages of nodule
development.
Reduction in GS52 Gene Expression Affects
Nodule Development
To enhance our understanding of the role of GS52
during nodulation, we chose to silence GS52 mRNA
expression using RNAi in roots transformed with A.
rhizogenes. The empty vector control and RNAi con-
structs (GUS control and GS52 ecto-apyrase) driven by
the constitutive figwort mosaic virus (FMV) promoter
were expressed in composite soybean plants (Collier
et al., 2005; Govindarajulu et al., 2008). Transgenic
roots were identified using a scorable GFP marker
driven by the superubiquitin promoter (Collier et al.,
2005; Govindarajulu et al., 2008). The expression of
GFP indicated that 50% to 60% of the roots produced
from the inoculated stem were transformed. Pheno-
typic characterization of composite plants expressing
the empty vector control, RNAi GUS control, and
RNAi GS52 gene showed no obvious differences (i.e.
no statistically significant differences in the number of
transgenic GFP roots formed per shoot, the length or
width of the transgenic roots produced, or the number
of lateral roots per transgenic root [data not shown]).
However, nodule number per transgenic root varied
according to construct tested. Roots transformed with
the empty vector control produced 6.9 60.7 pink, fully
formed nodules per transgenic root (Fig. 3, A and D).
The RNAi GUS control exhibited 6.6 60.7 fully
formed nodules per transgenic root (Fig. 3, B and E).
Roots expressing the RNAi GS52 gene exhibited a
dramatic decrease in the formation of fully formed
pink nodules (0.1 60.01 fully formed nodules per
transgenic root; Fig. 3F). Along with numerous nodule
primordia, we observed the formation of small bumps
emerging on the root surface from the root cortex.
These emerging nodules were translucent and devoid
of bacteria. Both nodule primordia and emerging but
empty nodules were grouped together under the small
empty nodule category. These small empty nodules in
the GS52 silenced transgenic roots failed to develop
into mature pink nodules (14.4 60.9 small empty
nodules formed per transgenic root; Fig. 3, C and F)
upon extended incubation. It is likely that this ob-
Figure 3. Nodulation profile in transgenic soybean GS52 knock-down roots after inoculation with B.japonicum. A to C, Four-
week-old GFP-expressing root nodule phenotypes for empty vector (A; control); RNAi GUS (B; control); and RNAi GS52 apyrase
on soybean hairy roots (C). Inset, The RNAi GS52 roots exhibited very poor nodulation (as small bumps or empty nodules),
whereas the controls show fully matured nodules as indicated by white arrowheads. SE, Small empty nodule. D to F, Phenotypic
nodulation analysis in empty vector (control), RNAi GUS (control), and RNAi GS52 apyrase on soybean hairy roots. Small empty
nodules (gray bar) were counted as small bumps just emerging on the root surfacefrom the root cortex and as clearly visible small
translucent nodules. The data represent average of 24 individual plants (per biological replicate) containing transgenic nodulated
roots. SE bars are shown for total number of mature nodules and small empty nodules of three independent biological replicates.
GS52 Is Essential for Soybean Nodulation
Plant Physiol. Vol. 149, 2009 997
served decrease in fully formed nodules is primarily
due to the inhibition of nodule development after
nodule primordia are formed. There was no apparent
alterations in the morphology of leaves, stems, or roots
on the RNAi GS52 composite plants other than the
aberrant nodule morphology.
Addition of ADP to RNAi GS52 Roots Rescues Mature
Nodule Formation
Due to the predicted catalytic activity of GS52, we
investigated the effect of exogenous application of
nucleotide phosphates on transgenic silenced GS52
soybean roots during nodulation. Figure 4, A and B,
shows the effect of the addition of various concentra-
tions of exogenous ADP and ATP to nodulation on
wild-type soybean roots, whereas control wild-type
roots were mock inoculated with autoclaved water.
Exogenous addition of 100 mMADP to wild-type roots
showed the highest number of mature nodules formed
(18.2 60.3) in comparison to the control roots (7.6 6
0.14), whereas addition of 5, 10, 25, 50, and 250 mM
ADP to wild-type roots gave a similar number of root
nodules (7.2 60.14, 7 60.14, 7 60.13, 8.4 60.1, and
860.16 nodules per root, respectively; Fig. 4A) to that
found on control roots (7.6 60.14 nodules per root).
However, exogenous addition of 125, 150, 175, and 200
mMADP to wild-type roots had a small effect on
nodulation (17.9 60.3, 16.8 60.4, 15.2 60.4, and 11.6 6
0.3 nodules per root, respectively; Fig. 4A) in compar-
ison the control roots (7.6 60.14 nodules per root). In
similar experiments, exogenous addition of 100 mM
ADP to the wild-type roots of L.japonicus Gifu and M.
truncatula A17 wild-type roots resulted in higher nod-
ule numbers (Supplemental Fig. S1). Addition of ex-
ogenous 10, 50, 100, 150, and 200 mMATP to wild-type
roots gave a similar number of mature root nodules
(7.3 60.11, 6.2 60.1, 7.7 62.3, 7.2 60.13, and 5.9 6
0.07 nodules per root, respectively; Fig. 4B) to that
found on control roots (7.6 60.14 nodules per root).
Therefore, exogenous 100 mMADP was chosen to
study its effect on nodulation in silenced GS52 roots.
Addition of 100 mMADP to either the empty vector
control or RNAi GUS control transgenic roots 48 h
after inoculation with B.japonicum did not change the
nodule number or nodule size (5.9 60.4 and 6.4 60.3
Figure 4. Effect of different nucleotide concentrations
on nodulation in wild-type soybean roots. Wild-type
soybean roots were treated with different concentra-
tions of 5, 10, 25, 50, 75, 100, 125, 150, 175, 200,
and 250 mMADP (A) and 10, 50, 100, 150, and 200
mM(B) of ATP, respectively, 2 d after inoculation with
B.japonicum. Control roots were mock inoculated
with autoclaved water. Values (n= 24) are mean 6SE
in an experiment representing .25 wild-type roots
per plant.
Govindarajulu et al.
998 Plant Physiol. Vol. 1 49, 2009
mature nodules per transgenic root, respectively; Fig.
5A). However, addition of exogenous 100 mMADP to
RNAi GS52 transgenic roots partially rescued mature
nodule formation (3.6 60.4 mature nodules per trans-
genic root; Fig. 5A). Addition of exogenous 100 mM
AMP to either the wild-type, empty vector control or
RNAi GUS control transgenic roots showed no effect
on nodule size or number, while application of AMP to
RNAi GS52 roots did not have any effect on the
aberrant nodule phenotype observed in the silenced
GS52 (data not shown). Additionally, exogenous ap-
plication of 100 mMATP to empty vector control or
RNAi GUS control transgenic roots did not produce
any change in the nodule number or size (5.8 60.3 and
6.6 60.3 nodules per transgenic root, respectively; Fig.
5B), while application of ATP to RNAi GS52 roots had
no effect on the aberrant nodule phenotype observed
with the silenced GS52 (9.2 60.7 small empty nodules
per transgenic root; Fig. 5B). These results suggest that
ADP is a critical component for nodule development
in soybean roots.
Decreased Transcript Levels in Soybean Silenced
GS52-Infected Roots
To verify silencing of GS52, we analyzed GS52
expression levels in the transgenic roots. In addition,
to ensure sequence-specific silencing of GS52 and not
GS50, we quantified GS50 mRNA levels. Figure 6, A to
C, shows the transcript levels of GS52,GS50, and
ENOD40 measured by qRT-PCR from total RNA iso-
lated from empty vector control, RNAi GUS control,
and RNAi-GS52 roots after inoculation with B.japoni-
cum. Soybean encoding cons6 was used as a reference
gene (Libault et al., 2008) to normalize the expression
levels of GS50,GS52, and ENOD40 in empty vector
control, RNAi GUS control, and RNAi GS52 nodulated
roots. As expected, the transcript levels of GS52 were
significantly reduced in the RNAi GS52 roots, whereas
GS52 expression in RNAi GUS control roots remained
unaffected when compared to empty vector control
(Fig. 6A). However, GS50 expression was also altered
in RNAi GS52 roots and in RNAi GUS roots in com-
parison to GS50 transcript levels in empty vector
controls (Fig. 6B). Although the RNAi construct was
designed for GS52 sequence, the levels of GS52 and
GS50 were both significantly reduced in the RNAi
GS52 transgenic roots. It is possible that the high
sequence similarity between GS52 and GS50 (i.e. iden-
tity in the coding region sequence is 73%) resulted in
silencing of GS50. However, it is also possible that,
similar to the results for ENOD40 (Fig. 6C), the phys-
iological effects of GS52 silencing may also have led to
lower GS50 expression. This may also explain why
GS50 expression was slightly reduced in RNAi GUS
roots. Given that GS50 was slightly down-regulated in
roots transgenic for RNAi GUS (Fig. 6B) and yet these
same roots were unaffected in nodule formation (Fig.
3E), we conclude that down-regulation of GS50 alone
has no effect on nodulation. In RNAi GS52 nodulated
roots, the expression level of ENOD40 was reduced
when compared with the empty vector control nodu-
lated roots (Fig. 6C). These results likely reflect the
poor nodulation response on the GS52 silenced roots.
The transcript levels of GS52,GS50, and ENOD40
were also measured in RNAi GS52 transgenic roots
treated with exogenous 100 mMADP. Interestingly,
ENOD40 mRNA levels in silenced roots were restored
by exogenous 100 mMADP application (Fig. 6C),
consistent with the restoration of the nodulation re-
sponse. However, the reduction of expression of GS50
and GS52 was not restored by the addition of ADP
(Fig. 6, A and B).
Figure 5. Effect of nucleotides on transgenic soybean GS52 silenced
roots after inoculation with B.japonicum. Phenotypic nodulation
analysis of RNAi transformed soybean roots for empty vector (control) +
100 mMADP, RNAi-GUS (control) + 100 mMADP, and RNAi silenced
GS52 + 100 mMADP (A); and empty vector (control) + 100 mMATP,
RNAi-GUS (control) + 100 mMATP, and RNAi silenced GS52 + 100 mM
ATP (B). Small empty nodules were counted as small bumps just
emerging on the root surface from the root cortex and as clearly visible
small translucent nodules. The data represent average of 24 individual
plants (per biological replicate) containing transgenic nodulated roots.
SE bars are shown for total number of mature nodules and small empty
nodules of three independent biological replicates.
GS52 Is Essential for Soybean Nodulation
Plant Physiol. Vol. 149, 2009 999
The GS52 Ecto-Apyrase Is Essential for Mature
Nodule Formation
To determine whether GS52 is required for nodule
development, nodules formed on empty vector con-
trol, RNAi GUS control, and RNAi GS52 roots were
analyzed using light microscopy and transmission
electron microscopy (TEM). Longitudinal sections of
the mature pink nodules from empty vector control,
RNAi GUS control, and the small translucent nodules
from RNAi GS52 roots were cytologically analyzed. In
the RNAi GUS and empty vector nodules, the infected
host cells were populated with mature bacteroids
within a symbiosome (Fig. 7, A and B, black arrow-
heads). However, the RNAi GS52 nodule sections
revealed that all the cells in the infected zone of the
nodular tissue were devoid of bacteroids, containing
only infection thread stubs (Fig. 7C). TEM studies also
showed that, within the infected region of the mature
root nodules (empty vector and RNAi GUS controls),
several symbiosomes enclosing mature bacteroids
(two to four) that contained poly-b-hydroxybutyrate
crystals were clearly visible (Fig. 8, A and B). In the
RNAi GS52 nodule sections, TEM studies confirmed
the lack of functional bacteroids within a symbiosome
and a few released bacteria remained inside the dead
plant cell (Fig. 8C). Because GS50 expression was
reduced in the RNAi GUS plants (Fig. 6B), but nodule
numbers and nodule ultrastructure were not affected
(Figs. 3E and 8B), these data argue that reduced GS50
transcript levels do not adversely affect nodulation.
Interestingly, light microscopy and TEM analyses of
RNAi GS52 nodules after the addition of exogenous
ADP also displayed well-developed bacteroids (two to
four) surrounded by a symbiosome (Figs. 7D and 8D),
which was very similar to that seen in the empty
vector control and RNAi GUS control nodules (Fig. 8,
A and B). These data clearly indicate that reduction in
GS52 expression levels in the roots interfered with
bacteroid development within the nodule and, there-
fore, demonstrate that GS52 is essential for normal
nodule development.
DISCUSSION
The previous study by Day et al. (2000) identified
and partially characterized two distinct soybean apy-
rase genes, GS50 and GS52. Using semiquantitative
RT-PCR, they reported that GS52, but not GS50, was
transcriptionally induced within 6 h of inoculation in
soybean roots, thus identifying GS52 as a possible
early nodulin. In addition, McAlvin and Stacey (2005)
demonstrated that transgenic L.japonicus constitu-
tively expressing soybean apyrase GS52 not only dou-
bled nodule number, but also increased root infections
by M.loti. To expand upon these earlier studies, we
silenced GS52 expression in soybean roots by means of
transient expression of double-stranded RNA using
hairy root transformation mediated by A.rhizogenes.
GS52 silencing resulted in a significant reduction in
both GS52 and GS50 expression, likely due to the high
level of sequence identity between these two genes.
However, the data argue that it is silencing of GS52
expression that was responsible for the nodule phe-
Figure 6. Expression levels of GS52,GS50, and ENOD40 using gene-
specific primers in soybean silenced hairy roots 4 weeks after inocu-
lation with B.japonicum. A to C, GS52 (A), GS50 (B), and ENOD40 (C)
mRNA levels in nodulated roots for RNAi GUS (control), RNAi GS52
apyrase, and RNAi GS52 apyrase after exogenous ADP (100 mM)
treatment (as represented in the xaxis). The yaxis represents the fold
change (log2ratio) in comparison to the empty vector (control).
Soybean encoding Cons6 was used as a reference gene to normalize
the expression levels of GS52,GS50, and ENOD40 measured using
real-time PCR analysis. Each bar represents the SEs of three experimen-
tal repeats each evaluating 25 independent nodulated roots. Asterisks
(*) indicate statistically significant differences compared to empty
vector control (Student’s ttest; * = P,0.05).
Govindarajulu et al.
1000 Plant Physiol. Vol. 149, 2009
notypes seen. Also, previous studies (Day et al., 2000;
McAlvin and Stacey, 2005) clearly implicated GS52
and not GS50 as playing an important role both in
soybean and L.japonicus nodulation. For example, as
shown in Figure 2 as well as earlier studies by Day
et al. (2000), only GS52 mRNA levels increased signif-
icantly upon inoculation with B.japonicum. Day et al.
(2000) also demonstrated that the addition of anti-
GS52 antibodies to soybean roots, but not anti-GS50
antibodies, blocked nodulation. Moreover, reduction
of GS50 expression in RNAi GUS control plants (Fig.
6B) did not result in an alteration in the nodulation
phenotype (Fig. 3, B and E), which would be expected
if GS52 played an important role in nodulation.
With respect to nodulation phenotypes, our data
demonstrated a significant decrease in the formation
Figure 7. Light micrographs of soybean
root nodule infected by B.japonicum
strain USDA110. A to D, Light microscopy
of 4-week-old root nodule sections for
empty vector (A; control), RNAi GUS (B;
control), RNAi GS52 apyrase (C), and
RNAi GS52 apyrase (D) after exogenous
ADP (100 mM) treatment. Note that the
infected cells in A, B, and D are packed
with bacteroids, while in C the infected
cells are dead and devoid of bacteroids
and contain only infection thread rem-
nants (see black arrowheads). Bars = 10
mm (A, B, and D); bar = 20 mm (C).
Figure 8. TEMs of soybean root nodule in-
fected by B.japonicum strain USDA110. A to
D, Ultrastructure of 4-week-old soybean root
nodules empty vector (A; control), RNAi GUS
(B; control), RNAi GS52 apyrase (C), and
RNAi GS52 apyrase (D) after exogenous
ADP (100 mM) treatment. Note: Mature bac-
teroids within a symbiosome are seen in A, B,
and D, whereas C shows early senescence
with rhizobia enclosed inside the infection
thread (it) and a few released bacteria (b)
inside the dead plant cell (see black arrows).
Bars = 53 mm.
GS52 Is Essential for Soybean Nodulation
Plant Physiol. Vol. 149, 2009 1001
of mature nodules in GS52 knock-down roots. Control
roots showed fully formed, mature nodules. RNAi
knock-down of GS52 by hairy root transformation led
to the formation of numerous small empty nodules
instead of fully developed pink nodules. McAlvin and
Stacey (2005) showed that transgenic L.japonicus
plants overexpressing apyrase GS52 had significantly
more infections, thus suggesting that GS52 plays a role
during the early infection events. Complete nodule
formation in the silenced GS52 roots was strongly
inhibited during the nodule primordia stage resulting
in small empty nodules. Such nodule phenotypes have
been reported in a number of legume symbiotic mu-
tants disrupted in genes involved in early nodulation
events (Kumagai et al., 2006). For example, Kumagai
et al. (2006) demonstrated that silencing of ENOD40,
an early nodulin, significantly suppressed nodule
primordium initiation and subsequent nodule devel-
opment in the transgenic L.japonicus roots. In nodulation-
deficient mutant lines of M.truncatula, apyrase
expression was severely reduced, consistent with de-
fects in bacterial infection and the formation of nodule
primordia (Cohn et al., 2001). Taken together, our
results suggest that apyrase GS52 plays a key role in
the early nodulation response. The lack of efficient
infection in the RNAi GS52 roots likely results in the
subsequent defects seen in nodule primordium devel-
opment and the deviant nodule ultrastructure ob-
served. Our microscopy analysis also showed GS52
silencing resulted in aberrant nodules with impaired
bacteroid development. Such aberrant nodule pheno-
types have also been observed in other early nodulin-
deficient mutant lines (Wan et al., 2007).
The predicted protein structure for GS52 and its
localization to the soybean plasma membrane predicts
that GS52 is an ecto-apyrase, with its ATPase catalytic
domain positioned to be extracellular matrix (Day
et al., 2000). Kim et al. (2006) clearly demonstrate the
presence of extracellular ATP at the root tips of M.
truncatula using a novel cell wall-bound luciferase.
Demidchik et al. (2003) demonstrate that the addition
of exogenous ATP can increase intracellular calcium
levels in root hairs. It is well known that an increase in
cytoplasmic calcium is an essential component during
the early stages of rhizobial infection of the root hair
(Cohn et al., 1997). Our results suggest that the GS52
ecto-apyrase may act to hydrolyze extracellular ATP at
the soybean root hair surface. The ADP formed by this
activity thus appears to be beneficial during nodula-
tion in soybean roots by B.japonicum. Indeed, addition
of exogenous ADP enhanced nodulation in control
roots and largely reversed the effects of RNAi GS52
silencing. The specific mechanism of ADP action re-
mains to be elucidated. However, extracellular ATP
clearly exists in plants and can have profound effects
on growth and metabolism. For example, Kim et al.
(2006) showed that addition of potato apyrase to M.
truncatula root hairs inhibited root hair growth, which
is essential for rhizobial infection. It may be that fine
control of ATP and ADP at the root hair surface is
essential to allow for the proper balance between root
hair growth and rhizobial infection.
In summary, this study highlights a critical role of
the GS52 ecto-apyrase catalytic activity during the
early events in soybean nodulation leading to normal
nodule development. The data argue that the key step
is the hydrolysis of extracellular ATP, leading to the
release of ADP, which appears beneficial, at the ap-
propriate concentration, for efficient nodulation. These
results provide strong evidence that soybean GS52
ecto-apyrase is essential for the initiation of nodule
primordia and nodule development.
MATERIALS AND METHODS
Tissue Collection for Real-Time PCR
Soybean (Glycine max ‘Williams 82’) seeds sown on Pro-Mix BX soil
(Premier Horticulture; www.premierhort.com) were grown in the greenhouse
(16-h day/8-h night) at 27"C. The apical meristematic tissues (n.30) were
harvested from 14-d-old soybean plants; trifoliate leaves (n.8), stem (n.5),
and roots (n.4) from 18-d-old plants; and flowers (n.30), seeds (n.30),
and pods (n.12) at R6 stage. For isolating root hair (n.2,000), stripped roots
(n.15; seedling roots with no root hair), and root tips (n.30), soybean seeds
were first surface sterilized twice for 10 min in 20% commercial bleach and
then rinsed in sterile water three times, followed by 10-min treatment in 0.1 N
HCl and then rinsed in sterile water three times. The sterilized seeds were
sown on nitrogen-free B & D agar medium (1 mMCaCl2, 0.5 mMKH2PO4, 10
mMferric citrate, 0.25 mMMgSO4, 0.25 mMK2SO4, 1 mMMnSO4, 2 mMH3BO3, 0.5
mMZnSO4, 0.2 mMCuSO4, 0.1 mMCoSO4, 0.1 mMNa2MoO4; Broughton and
Dilworth, 1971). The root tip (2–3 mm of the root extremity) and root hair were
harvested 3 d after germinating the seeds under dark conditions (80%
humidity at 25"C). For isolating nodulated roots, sterilized soybean seeds
were placed between humidified Whatman paper under dark conditions (80%
humidity at 25"C). Three-day-old germinated seedlings were placed in
vermiculite:perlite mix (3:1) and each seedling was inoculated with 1 mL of
Bradyrhizobium japonicum suspension (OD600 = 0.1) while control seedlings
were fed with 1 mL of water. The nodulated roots were harvested at 0, 4, 8, 16,
24, and 32 dpi and stored at 280"C for RNA extractions. Three independent
biological replicates were performed and analyzed.
RNAi Plasmid Construction
The RNAi gene constructs were made according to Collier et al. (2005). In
short, a 343-bp gene fragment for the RNAi construct was amplified by PCR
from soybean genomic DNA using apyrase GS52 specific primers as given in
Supplemental Table S1. A control RNAi gene fragment in plants was created
using a fragment of GUS (uidA; Jefferson et al., 1987). The gene fragments for
the RNAi GUS construct was amplified via PCR from the GUS expression
plasmid pCGT 1427 using GUS-specific primers (Supplemental Table S1) and
blunt-end cloned into pCR-BLUNT (Invitrogen). The amplified GS52 and
cloned GUS fragments were cloned into the FMV-driven RNAi shuttle vector,
pCGT 2255 (XhoI-KpnI sites for the sense orientation and XbaI-HindIII sites for
the antisense orientation; Collier et al., 2005). The entire RNAi shuttle cassettes
(promoter/double-stranded RNA/terminator) was excised using flanking
Sse8387I restriction endonuclease sites and cloned into the T-DNA of the
binary vector, pAKK 1467B (the T-DNA of pAKK 1467B contains GFP and
BAR expression modules along with a unique Sse8387I restriction site; Collier
et al., 2005). RNAi binary vectors created included the RNAi apyrase GS52
plasmid (pCGT 6288) and the RNAi GUS plasmid (pCGT 5200). An empty
vector control (pCGT 6419A) was also generated by cloning the FMV RNAi
shuttle (without gene fragments) using the flanking Sse8387I sites into pAKK
1467B. The fidelity of the clones was verified by sequencing and electro-
porated into Agrobacterium rhizogenes strain K599 (McCormac et al., 1998).
Production of Hairy Roots Using the Composite
Plant System
Soybean composite plants were generated according to Govindarajulu
et al. (2008). In short, soybean seeds (cv Williams 82) were surface sterilized
Govindarajulu et al.
1002 Plant Physiol. Vol. 1 49, 2009
using chlorine gas. Sterilized seeds were sown in germinating mix (4 M;
Hummert International) and grown in the greenhouse for 2 weeks. Hairy root
transformation was carried out with A.rhizogenes strain K599 transformed
with the RNAi apyrase GS52 and RNAi GUS constructs along with the empty
vector control, pCGT 6419A. A.rhizogenes cultures were grown in Luria-
Bertani broth with kanamycin (50 mg mL21) in a flask at 225 rpm at 28"C
overnight. Bacterial cells were spun down at 3,000gfor 10 min at 23"C, and
resuspended in sterile water to an OD600 nm of 0.3. Sterilized FibrGro cubes (1
cm3; Hummert International) were inoculated with A.rhizogenes bacterial
suspension. Apical stem sections were excised from greenhouse-grown soy-
bean plants and inserted into the inoculated cubes. These plants were
incubated in the growth chamber (temperature 22"C; light 15 mmol m22s21;
humidity 30%, 16-h day/8-h night photoperiod) for a week. FibrGro cubes
were removed and each composite soybean plant was placed in individual
4-inch pot containing sterile vermiculite: perlite (3:1) wetted with nitrogen-
free plant nutrient solution (Lullien et al., 1987). The pots were incubated in
the growth chamber (temperature 26"C; light 200 mmol m22s21; humidity
60%; 16-h-day/8-h-night photoperiod) for 2 weeks. Plants were watered every
other day alternating water with nitrogen-free plant nutrient solution. Pro-
duction of transgenic hairy roots on soybean stems was monitored by
observing the formation of GFP-expressing roots.
Inoculation of B.japonicum and Phenotypic
Nodulation Analysis
Soybean composite plants were inoculated with B.japonicum USDA110
strain for nodulation. Cultures were grown in HEPES-MES liquid medium
(Cole and Elkan, 1973) and 20 mg mL21chloramphenicol at 30"C for 2 d with
agitation to an OD600 nm of 0.5. The cells were centrifuged at 7,000gfor 15 min
at 10"C, pellet washed with sterile water, and then resuspended in nitrogen-
free plant nutrient solution to a final OD600 of 0.08 (approximately 108cells
mL21). After 2 weeks of plant growth in vermiculite/perlite, 10 mL of the B.
japonicum bacterial suspension were inoculated onto each plant. Control
plants (noninoculated) were mock inoculated with 10 mL of nitrogen-free
plant nutrient solution. Roots used in this analysis were verified as trans-
formed by their GFP epifluorescence using a Zeiss Stemi SV11 microscope
outfitted with a 480-nm excitation/515 emission fluorescein isothiocyanate
filter. Twenty-four individual plants were scored for GFP roots containing
nodules for RNAi construct. Twenty-five root tissues with nodules were
frozen in liquid nitrogen after nodule counting and stored at 280"C for RNA
extractions. For each RNAi construct, experiments were performed three
times and analyzed.
Treatment of Soybean Roots with ATP or ADP
Soybean seeds were surface sterilized and composite plants were gener-
ated as described above, the difference being sterilized FibrGro cubes (1 cm3;
Hummert International) were inoculated with autoclaved water to produce
wild-type roots. Two days after inoculation with B.japonicum (OD600 = 0.2),
each wild-type root produced from the composite plant was treated with 10
mL of different concentrations of ADP (5, 10, 25, 50, 75, 100, 125, 150, 175, 200,
and 250 mM, respectively) or ATP (10, 50, 100, 150, and 200 mMrespectively).
Control plants were mock inoculated with 10 mL of water. After 4 weeks, 24
individual plants were scored and roots were washed (n.25 per plant) with
water and mature root nodules counted. For complementation assays, indi-
vidual transgenic plants containing either empty vector, RNAi GUS control or
RNAi apyrase GS52 constructs were treated with 10 mL of 100 mMATP or
ADP, 48 h after inoculating plants with B.japonicum (OD600 = 0.08). Control
plants were mock inoculated with 10 mL of autoclaved water. Four weeks
after B.japonicum inoculation, GFP roots were carefully excised, rinsed with
water, and the number of nodules counted manually. Twenty-four individual
plants were scored for GFP roots containing nodules for each RNAi construct.
Twenty-five root tissues with nodules were frozen in liquid nitrogen after
nodule counting and stored at 280"C for RNA extractions. For each RNAi
construct, experiments were performed three times and analyzed.
Isolation of RNA and Real-Time PCR
To quantify GS50,GS52, and ENOD40 gene expression, total RNA was
extracted from tissues (as described above) using TRIzol reagent (Invitrogen)
and purified using chloroform extraction. cDNA synthesis was performed as
described by Libault et al. (2008). Gene-specific primers used to quantify and
normalize gene expression are described in Supplemental Table S1. qRT-PCR
using SYBR Green PCR master mix (Applied Biosystems) was performed with
a 7900 HT sequence detection system and a 7500 real-time PCR system
(Applied Biosystems). The following PCR parameters were used: 50"C for 2
min, 95"C for 10 min, 40 cycles at 95"C for 15 s, and 60"C for 1 min. The data
were analyzed using SDS 2.2.1 software and the 7500 System, version 1.3.0
(Applied Biosystems), respectively, when the 384-well and the 96-well plate
qRT-PCR machines were used. PCR efficiencies (E) were calculated according
to a linear regression analysis using LinRegPCR software (R2value .0.995;
Ramakers et al., 2003). Absolute gene expression levels relative to the
housekeeping gene Cons6 were calculated for each cDNA sample using the
following equation: relative ratiogene/Cons6 = (Egene
2(Ctgene))/(ECons6
2(CtCons6)).
The values of three replicates were used in a Student’s ttest to calculate
probabilities of distinct induction or repression, and the average ratio of these
values was used to determine the fold change in transcript level in treatment
samples compared with control.
Preparation of Nodule Samples for Light Microscopy
and TEM
Freshly harvested mature nodules from empty vector control transgenic
roots, RNAi GUS control transgenic roots, and small empty nodules from
RNAi apyrase GS52 transgenic roots were dissected to fit the specimen
planchettes for high-pressure freezing, packed in 0.15 MSuc in 50 mMPIPES
buffer (pH 6.8) and frozen in a Bal-Tec high-pressure freezer (Danforth Plant
Science Center). Frozen nodule samples were freeze substituted in acetone
containing 2% osmium tetroxide and 0.1% uranyl acetate for 5 d at 285"C, 24 h
at 220"C, and 1 h at 0"C (on ice). Then, the samples were warmed gradually to
room temperature for 1 h, rinsed in acetone, and infiltrated with Epon/
Araldite resin slowly for 7 d (Hess, 2007). Thin sections were stained in uranyl
and lead salts and observed using a Leo 912 energy filter TEM; images were
digitally captured. For light micrographs, 0.5-mm sectionsfrom resin-embedded
material was stained with toluidine blue and observed using a phase contrast
light microscope.
Sequence data from this article can be found in the GenBank/EMBL data
libraries under accession numbers AF207687 (GS50) and AF207688 (GS52).
Supplemental Data
The following materials are available in the online version of this article.
Supplemental Figure S1. Effect of nodulation using different concentra-
tions of nucleotides applied to wild-type legume roots.
Supplemental Table S1. Nucleotide sequences of primer sets used in this
study.
ACKNOWLEDGMENTS
We wish to thank James M. Elmore, Thomas Fester, and Christine Ehret
for critically reviewing the manuscript.
Received August 29, 2008; accepted November 15, 2008; published November
26, 2008.
LITERATURE CITED
Abeijon C, Yanagisawa K, Mandon EC, Hausler A, Moreman K, Hirschberg
CB, Robbins PW (1993) Guanosine diphosphatase is required for protein
and sphingolipid glycosylation in the Golgi lumen of Saccharomyces
cerevisiae. J Biol Chem 122: 307–323
Asad S, Fa ng Y, Wycoff KL, Hirsch AM (1994) Isolation and characteri-
zation o f cDNA and genomic clones of MsENOD40: Transcripts are
detected in meristemati c cells of alfalfa. Protoplasma 183: 10–23
Bermudes D, Peck KR, Afifi M, Beckers CJM, Joiner KA (1994) Tandemly
repeated genes en code nucleoside triphosphate hydrolase isoforms
secreted into the parasit ophorous vacuole of Toxoplasma gondii. J Biol
Chem 269: 29252–29260
Brough ton WJ, Dilworth MJ (1971) C ontrol of legha emoglobin synthesis in
snake be ans. Biochem J 125: 1075–1080
GS52 Is Essential for Soybean Nodulation
Plant Physiol. Vol. 149, 2009 1003
Cannon S, McCombie W, Sato S, Tabata S, Denny R, Palme r L, Katari M,
Young N, Stacey G (2003) Evolution and microsynteny of the apyrase
gene fam ily in three leg ume genomes. M ol Genet Genomics 270: 347–361
Chen YR, Datta N, Roux SJ (1987) Purification and partial characterization
of a calmodulin-stimulated nucleoside t riphosphatase f rom pea nuclei.
J Biol Chem 262: 10689–10694
Chen YR, Roux SJ (1986) Characterization of nucleoside triphosphatase
activity in isolated pea nuclei and it s photore versible regulation by
light. Plant Physiol 81: 609–613
Cohn J, Day RB, Stacey G (1997) Legume nodule organogen esis. Trends
Plant Sci 3: 105–110
Cohn JR, Uhm T, Ramu S, Nam YW, Kim DJ, Penm etsa RV, Wo od TC,
Denny RL , Young ND, Cook DR, et al (2001) Differential regulation of a
family of apyrase g enes from Medicago truncatula. Plant Physiol 125:
2104–2119
Cole MA, Elkan GH (1973) Transmissible resistance to penicillin G,
neomyc in, and chloramphenicol in Rhizobium japonicum. Ant imicrob
Agents C hemother 4: 248–253
Collier R, Fuchs B, Walter N, Lutke WK, Taylor CG (2005) Ex vitro
composite plants: an inexpensive, rapid method for root biolog y. Plant J
43: 449–457
Davies E, Fillingham BD, Abe S (1996) The plant cytoskeleton. In JE
Hesketh, IF Pryme, eds, The Cytoske leton. Elsevier Science and Tech-
nology Books, Oxford, pp 405–449
Day RB, McAlvin CB, Loh JT, Denny RL , Wood TC, Young ND, Stacey G
(2000) Differential expression of two soybean apyrases, one of which is
an early nodulin. Mol Plant Microbe Interact 13: 1053–1070
Demidchik V, Nichols C, Oliynyk M, Dark A, Glover BJ, Davies JM
(2003) Is ATP a signaling agent in plan ts? Plant Physiol 133: 456–461
Etzler ME, Kalsi G, Ewin g NN, Roberts NJ, Day RB, Murph y JB (1999) A
nod factor binding lectin with apyrase activity from legume roots. Proc
Natl Aca d Sci USA 96: 5856–5861
Gao XD, Kaigorodov V, Jigami Y (1999) YND1, a homologue of GD A1,
encodes membrane-bound apyrase required for golgi N- and O-glyco-
sylati on in Saccharomyces cerevisiae. J Biol Chem 274: 21450–21456
Govind arajulu M, Elmore J M, Fester T, Taylor CG (20 08) Evaluation of
consti tutive viral promoters in transgenic soybean roots and nodules.
Mol Plant Microbe Interact 21: 1027–1035
Handa M, Guidotti G (1996) Purification and cloning of a so luble ATP
diphos phohydrolase (apyrase) f rom potato tubers ( Solanum tuberosum).
Biochem Biophys Res Commun 218: 916–923
Hess WM (2007) Cryoprepar ation methodology for plant cell biology.
Method s Cell Biol 79: 57–100
Hsieh HL , Song CJ, Roux S J (2000) Regulation of a recombinant pea
nuclear apyrase by calmodulin and casein kinase II. Biochim Biophys
Acta 1494: 248–255
Hsieh HL , Tong CG, Thomas C, Roux SJ (1996) Light-modulated abun-
dance of an mRNA encoding a calmodulin-regulated, chromatin-associated
NTPase in pea. Plant Mol Biol 30: 135–147
Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS fusion: b-glucuron-
idase as a s ensitive and vers atile gene fusion marker in higher plants.
EMBO J 6: 3901–3907
Kalsi G, Etzler M (2000) Localization of a nod factor-binding protein in
legume roots and factors influencin g its distribution and expression.
Plant Physiol 124: 1039–1048
Kettlun AM, Espinosa V, Garcia L, Valenzuela MA (2005) Potato tuber
isoapyrases: substrate specificity, affinity labeling, and proteolytic sus-
ceptibility. Phytochemistry 66: 975–982
Kim SY, Sivaguru M, Stacey G (2006) Extracellular ATP in p lants. Visu-
alization, localizati on, and analysis of physiological significance in
growth and signaling. Plant Physiol 142: 984– 992
Komosz ynski M, Wojtczak A (1996) Apyrases (ATP diphosphohydrolases,
EC 3.6.1.5): function and relationship to ATPases. Biochim Biophys Acta
1310: 233–241
Kouchi H, Hata S (1993) Isolation and c haracterization of novel nodulin
cDNAs representing genes expressed at early stages of soybean nodule
development. Mol Gen Genet 238: 106–119
Kumagai H, Kinoshita E, Ridge RW, Kouchi H (2006) RNAi knock-d own
of ENOD40s leads to significant suppression of nodule for mation in
Lotus japonicus. Plant Cell Physiol 47: 1102–1111
Kumagai H, Kouchi H (2003) Gene sil encing by expressi on of hairpin RNA
in Lotus japonic us roots and root nod ules. Mol Plant Microbe Interact 16:
663–668
Libault M, Thibivilliers S, Bilgin DD, Radwan O, Benitez M, Clough SJ,
Stacey G (2008) Identification of f our soybean refe rence genes for gene
expression normalization. Plant Genome 1: 44–54
Limpens E, Bisseling T (2003) Signa ling in symbiosis . Curr Opin Plant Biol
6: 343–350
Lullien V, Barke r DG, de Lajudie P, Huguet T (1987) Plant g ene expression
in effec tive and ineffective root nodules of alfalf a (Medicago sativa). Plant
Mol Biol 9: 469–478
Marcus AJ, Safier LB (1993) Thromboregulation: multicellular modulation
of plate let reactivity in hemostasis and thrombosis. FASEB J 7: 516–522
McAlvin CB, Stacey G (2005) Transgenic expression of the soybean
apyras e in Lotus japonicus enhances nodulation. Plant Physiol 137:
1456–1462
McCormac AC, Elliott MC, Chen DF (1998) A simple method for t he
production of highly competent cells of Agrob acterium for transforma-
tion via e lectroporation. Mol Biotechnol 9 : 155–159
Papadopoulou K, Roussis A, Katinakis P (1996) Phaseolus ENOD40 is
involved in symbiotic and non-sym biotic organogenetic processes:
expression duri ng nodule and lateral root development. Plant Mol
Biol 30: 403–417
Plesner L (1995) Ecto-ATPases: identities and functions. Int Rev Cytol 158:
141–214
Ramakers C, Ruij ter JM, Deprez RH, Moorman AF (2003) Assumption-
free analysis of quantitative real-time polymerase chain reaction (PCR)
data. Neurosci Lett 339: 62–66
Robert s NJ, Brigham J, Wu B, Murphy JB, Volpin H, Ph illips DA, Etzler
ME (1999 ) A Nod factor-binding lectin is a member of a dist inct class
of apyrases that may be unique to the legumes. Mol Gen Genet 262 :
261–267
Sarkis JJ, Salto C (1991) Characterization of a syntapt osomal ATP diphos-
phohyd rolase from the electric organ of Torpedo marmorata. Brain Res
Bull 26: 871–876
Shibata K, Abe S, Yoneda M, Davies E (2002) Subcellular distribution and
isotypes of a 49-kDa apyrase from Pisum sativum. Plant Phy siol Biochem
40: 407–415
Shibata K, Morita Y, Abe S, Stankovic B, Davies E (1999) Apyrase from
pea stem s: isolation , purification , characterization an d identification of a
NTPase from the cytoskeleton fraction of pea stem tissue. Plant Phys iol
Biochem 37: 881–888
Steine brunner I, Jeter C, S ong C, Roux SJ (2000) Molecular and biochem-
ical compariso n of two different apyrases from Arabidopsis th aliana.
Plant Physiol Biochem 38: 913–922
Steinebrunner I, Wu J, Sun Y, Corbett A, Roux SJ (2003) Disruption of
apyrases inhibits polle n germination in Arabidopsis. Plant Physiol 131:
1638–1647
Thomas C, Rajagopal A, Windsor B, Dudler R, Lloyd A, Roux SJ (2000) A
role for ectophosphatase in xenobiotic resistance. Plant Cell 12: 519–534
Thomas C, Sun Y, Naus K, Lloyd A, Roux SJ (1999) Apyrase functions in
plant phosphate n utrition and mobilizes pho sphate from extracellular
ATP. Plant Ph ysiol 119: 543–552
Virgilio FD (1998) ATP as a death factor. Biofactors 8: 301–303
Wan X, Hontelez J, Lillo A, Guarnerio C, van de P eut D, Fedorova E,
Bisseling T, Fransse n H (2007) Medicago truncatula ENOD40-1 and
ENOD40-2 are both involved in nodule initiation and bacteroid devel-
opment. J Exp Bot 58 : 2033–2041S
Waterhouse PM, Helliwell CA (2 003) Exploring pl ant genomes by RNA-
induced gene silencing. Nat Rev Genet 4: 29–38
Yang WC, Katinakis P, Hendriks P, Smolders A, de Vries F, Spee J, van
Kammen A, Bisseling T, FranssenH (1993) Characterizationof GmENOD40,
a gene showing novel patterns of cell-specific expression during soybean
nodule development. Plant J 3: 573–585
Govindarajulu et al.
1004 Plant Physiol. Vol. 1 49, 2009
0
2
4
6
8
10
12
14
16
Total number of nodules
0
1
2
3
4
5
6
7
8
Total number of nodules
Figure S1. Effect of nodulation using different
concentrations of nucleotides applied to wild-type
legume roots. (A) Wild-type Medicago truncatula
roots were treated with 10 µM, 100 µM and 200 µM
ADP and ATP respectively two days after
inoculation with S. meliloti. Control roots were
mock inoculated with autoclaved water (B) Wild
type Lotus japonicus roots were treated with 100
µM ADP and 100 µM ATP respectively two days
after inoculation with M. loti. Control roots were
mock inoculated with autoclaved water. Values
(n=15) are mean ±SE in an experiment and
representative of at least two independent
experiments.
A
B
Supplemental Table S1.
Nucleotide sequences of primer sets used in this study
Gene Forward Primer (5' to 3') Reverse Primer (5' to 3')
ENOD40 GAAAGGGGTGTGAGAGGAGAG CGCCACTCAAGAAAGAATGTT
GS50 CCAAAGTTCGTCCTGTGGAT CCATCCTTAACACGAGGGAA
GS52 AAGATCTTCCCCAAACAGGAA CAAGTTCTGGTCGAAATGGAA
Cons6 AGATAGGGAAATGGTGCAGGT CTAATGGCAATTGCAGCTCTC
Transformation RNAi GS52 CCCTCTAGACTCGAGGTTCCTCTCCATCTGGTGG CCCAAGCTTGGTACCGGGGCGACTGCAGGTTTAAGG
GUS CAATGGCCGGCCTACCCGCTTCGCGTCGGCATCCGG CTCTGGCCTGGGTGGCCGTAGCAATTCCCGAGGCTGTAGCC
ENOD40 GAAAGGGGTGTGAGAGGAGAG CGCCACTCAAGAAAGAATGTT
GS50 CCAAAGTTCGTCCTGTGGAT CCATCCTTAACACGAGGGAA
GS52 TTTCGGCACTTCGTCTTTCTA CAGGGTTTGGATAGGTGGACT
Cons6 AGATAGGGAAATGGTGCAGGT CTAATGGCAATTGCAGCTCTC
Differential
expression and
Nodulation qRT-PCR
studies
Knock-down qRT-
PCR studies
