Possible Involvement of an Extracellular Superoxide Dismutase (SodA) as a Radical Scavenger in Poly(cis-1,4-Isoprene) Degradation

Abstract

Gordonia westfalica Kb1 and Gordonia polyisoprenivorans VH2 induce the formation of an extracellular superoxide dismutase (SOD) during poly(cis-1,4-isoprene) degradation. To investigate the function of this enzyme in G. polyisoprenivorans VH2, the sodA gene was disrupted. The mutants exhibited reduced growth in liquid mineral salt media containing poly(cis-1,4-isoprene) as the sole carbon and energy source, and no SOD activity was detectable in the supernatants of the cultures.
Growth experiments revealed that SodA activity is required for optimal growth on poly(cis-1,4-isoprene), whereas this enzyme has no effect on aerobic growth in the presence of water-soluble substrates like succinate,
acetate, and propionate. This was detected by activity staining, and proof of expression was by antibody detection of SOD.
When SodA from G. westfalica Kb1 was heterologously expressed in the sodA sodB double mutant Escherichia coli QC779, the recombinant mutant exhibited increased resistance to paraquat, thereby indicating the functionality of the G. westfalica Kb1 SodA and indirectly protection of G. westfalica cells by SodA from oxidative damage. Both sodA from G. polyisoprenivorans VH2 and sodA from G. westfalica Kb1 coded for polypeptides comprising 209 amino acids and having approximately 90% and 70% identical amino acids, respectively,
to the SodA from Mycobacterium smegmatis strain MC2 155 and Micrococcus luteus NCTC 2665. As revealed by activity staining experiments with the wild type and the disruption mutant of G. polyisoprenivorans, this bacterium harbors only one active SOD belonging to the manganese family. The N-terminal sequences of the extracellular
SodA proteins of both Gordonia species showed no evidence of leader peptides for the mature proteins, like the intracellular SodA protein of G. polyisoprenivorans VH2, which was purified under native conditions from the cells. In G. westfalica Kb1 and G. polyisoprenivorans VH2, SodA probably provides protection against reactive oxygen intermediates which occur during degradation of poly(cis-1,4-isoprene).

Full text

APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Dec. 2008, p. 7643–7653 Vol. 74, No. 24
0099-2240/08/$08.00⫹0 doi:10.1128/AEM.01490-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.
Possible Involvement of an Extracellular Superoxide Dismutase (SodA)
as a Radical Scavenger in Poly(cis-1,4-Isoprene) Degradation
䌤
Carina Schulte, Matthias Arensko¨tter, Mahmoud M. Berekaa, Quyen Arensko¨tter,
Horst Priefert, and Alexander Steinbu¨chel*
Institut fu¨r Molekulare Mikrobiologie und Biotechnologie, Westfa¨lische Wilhelms-Universita¨t Mu¨nster, Corrensstrasse 3,
D-48149 Mu¨nster, Germany
Received 2 July 2008/Accepted 20 October 2008
Gordonia westfalica Kb1 and Gordonia polyisoprenivorans VH2 induce the formation of an extracellular
superoxide dismutase (SOD) during poly(cis-1,4-isoprene) degradation. To investigate the function of this
enzyme in G. polyisoprenivorans VH2, the sodA gene was disrupted. The mutants exhibited reduced growth in
liquid mineral salt media containing poly(cis-1,4-isoprene) as the sole carbon and energy source, and no SOD
activity was detectable in the supernatants of the cultures. Growth experiments revealed that SodA activity is
required for optimal growth on poly(cis-1,4-isoprene), whereas this enzyme has no effect on aerobic growth in
the presence of water-soluble substrates like succinate, acetate, and propionate. This was detected by activity
staining, and proof of expression was by antibody detection of SOD. When SodA from G. westfalica Kb1 was
heterologously expressed in the sodA sodB double mutant Escherichia coli QC779, the recombinant mutant
exhibited increased resistance to paraquat, thereby indicating the functionality of the G. westfalica Kb1 SodA
and indirectly protection of G. westfalica cells by SodA from oxidative damage. Both sodA from G. polyiso-
prenivorans VH2 and sodA from G. westfalica Kb1 coded for polypeptides comprising 209 amino acids and
having approximately 90% and 70% identical amino acids, respectively, to the SodA from Mycobacterium
smegmatis strain MC
2
155 and Micrococcus luteus NCTC 2665. As revealed by activity staining experiments with
the wild type and the disruption mutant of G. polyisoprenivorans, this bacterium harbors only one active SOD
belonging to the manganese family. The N-terminal sequences of the extracellular SodA proteins of both
Gordonia species showed no evidence of leader peptides for the mature proteins, like the intracellular SodA
protein of G. polyisoprenivorans VH2, which was purified under native conditions from the cells. In G. westfalica
Kb1 and G. polyisoprenivorans VH2, SodA probably provides protection against reactive oxygen intermediates
which occur during degradation of poly(cis-1,4-isoprene).
Reactive oxygen species (ROS) occur during aerobic metab-
olism and are known to cause damage to many biomacromol-
ecules, with DNA appearing to be the most sensitive target of
these agents (38). Therefore, living cells developed various
mechanisms to protect cellular constituents against oxidative
damage. The microbial oxidative stress response is a result of
well-orchestrated reactions involving synthesis of many pro-
teins and small molecules. These can be grouped into at least
four categories. The first group includes enzymes like super-
oxide dismutase (SOD; EC 1.15.1.1) and catalase (EC 1.11.1.6)
and small molecules for direct detoxification and/or protection
against oxidative stress. Cellular components like DNA can
also be protected by unspecific binding of proteins like Dps
(DNA-binding protein from starved cells) (3, 38) and small
antioxidant molecules like ascorbate and glutathione (42). The
second category comprises enzymes responsible for repair of
damaged cellular components like DNA (24) or protein by
methionine sulfoxide reductase (EC 1.8.4.6) (1, 43). Proteins
involved in signal transduction and regulation like SoxR and
SoxS from Escherichia coli represent the third category (24),
and the fourth group comprises proteins, like glucose-6-phos-
phate dehydrogenase, induced during the oxidative stress
response (24).
SODs are a ubiquitous family of enzymes efficiently cata-
lyzing the dismutation of superoxide anions to molecular oxy-
gen and hydrogen peroxide according to the following equa-
tion (25, 26): 2 O
2
⫺
⫹2H
⫹
3O
2
⫹H
2
O
2
. The primary
function of SODs is the detoxification of cell-damaging super-
oxide anions, but they also play important roles during phyto-
pathogenesis since oxidative stress is an important component
of the plant defense response against microbial invasion (37).
Furthermore, Mycobacterium tuberculosis expresses SOD dur-
ing pathogenesis, leading to a T-cell response (22). For this
bacterium, large amounts of SOD are found extracellularly.
For a long time it was unclear whether the enzyme is actively
secreted or whether the extracellular abundance of SOD is due
to bacterial leakage or autolysis upon a high level of expression
in combination with extracellular stability (54). The latest stud-
ies showed that SodA is actively secreted by M. tuberculosis,
with involvement of SecA2 as an accessory secretion factor
(16). Nocardia asteroides SOD has been implicated as a viru-
lence factor, allowing the cells to survive intracellularly and to
escape killing by phagocytic cells (2).
The tendency of natural and synthetic rubber to become
autoxidized by atmospheric oxygen and ozone is a well-known
phenomenon. This autoxidation process leads to the formation
of activated oxygen species and is the main reason for the
extensive use of antioxidants to protect rubber against aging
* Corresponding author. Mailing address: Institut fu¨r Molekulare
Mikrobiologie und Biotechnologie, Westfa¨lische Wilhelms-Universita¨t
Mu¨nster, Correnstrasse 3, D-48149 Mu¨nster, Germany. Phone: 49-251-
8339821. Fax: 49-251-8338388. E-mail: steinbu@uni-muenster.de.
䌤
Published ahead of print on 24 October 2008.
7643

and microbial attack (8). Degradation of poly(cis-1,4-isoprene)
by species of the genus Gordonia and other bacteria has been
previously described (for reviews, see references 5 and 44).
Our previous studies led us to investigate the involvement and
influence of extracellular SODs produced by strains of Gor-
donia westfalica and Gordonia polyisoprenivorans during deg-
radation of rubber (36).
MATERIALS AND METHODS
Bacterial strains, plasmids, and oligonucleotides. Strains of the genus Gor-
donia and of Escherichia coli and plasmids and primers used in this study are
listed in Table 1. Cells of Gordonia spp. were cultivated in standard I (St-I)
medium (Merck, Darmstadt, Germany) at 30°C on a rotary shaker at 180 rpm.
For growth experiments with poly(cis-1,4-isoprene), 0.5% (vol/vol) natural latex
concentrate (Neotex Latz; Weber & Schaer, Hamburg, Germany) or 0.3% (wt/
vol) synthetic poly(cis-1,4-isoprene) with an average molecular mass of 800 kDa
(182141; Aldrich, Steinheim, Germany) was added to liquid mineral salts me-
dium (MSM), as described by Schlegel et al. (48), as the sole source of carbon
and energy. Cells of E. coli strains were cultivated at 37°C in Luria-Bertani (LB)
broth (46) on a rotary shaker at 180 rpm. Antibiotics were applied as described
by Sambrook et al. (46) as indicated below. Other carbon sources were added to
MSM as indicated below.
Paraquat assay. For the paraquat growth assay, the sodA sodB double mutant E.
coli QC779 and recombinant strains derived from E. coli QC779 harboring plasmid
pSKsod or only the vector pBluescript SK
⫺
as a control were cultivated in LB
medium at 37°C in the presence of an appropriate antibiotic to an optical density at
600 nm (OD
600
) of 1.0. Afterwards, the cultures were rapidly chilled in a water-ice
mixture and were kept cold until they were used for inoculation of prewarmed LB
medium with an initial OD
600
of 0.02. The cultures were then grown at 37°C, and
0.05 mM of the herbicide paraquat (methyl viologen) was added as a redox cycling
agent, which promotes formation of the superoxide radical anion inside cells (27);
cell growth was monitored photometrically at 600 nm.
Isolation, analysis, and manipulation of DNA. Plasmid DNA was prepared
from crude lysates of E. coli cells by the alkaline extraction method (12). Total
DNA of Gordonia sp. cells was prepared as described by Ausubel et al. (6)
with the following modification. Cells of 50-ml cultures were harvested by
centrifugation and suspended in 8.5 ml TE buffer (10 mM Tris-HCl, 1 mM
EDTA, pH 8.0), and 1 ml lysozyme solution (10 mg/ml TE) was added. After
incubation at 37°C for 2 h, 500 ␮l of a sodium dodecyl sulfate (SDS) solution
(100 g/liter) and 50 ␮l of a proteinase K solution (20 g/liter TE) were added
and mixed gently. After additional incubation at 37°C for 1 h, 5 ml 5 M NaCl
and 1.5 ml of a cetyltrimethylammonium bromide solution (100 g per liter of
0.7 M NaCl) were added, and the solution was incubated at 65°C for 20 min.
DNA was transferred to G. polyisoprenivorans by electroporation as described
by Arensko¨tter et al. (4). All other genetic procedures and manipulations
were conducted as described by Sambrook et al. (46).
TABLE 1. Bacterial strains, plasmids and primers used in this study
Strain, plasmid, or primer Relevant characteristics
a
Reference, source, or
alternate strain designation
Strains
E. coli XL1-Blue recA1 endA1 gyrA96 thi1 hsdR17 (r
K
⫺
m
K
⫹
)supE44 relA1 ␭
⫺
lac
关F⬘proAB lacI
q
lacZ⌬M15 Tn10(Tc
r
)兴
19
E. coli QC779 As GC4468 except (sodA::MudPR13)25 ⌽(sodB-kan)1-⌬
2
20
E. coli Rosetta-gami B
(DE3)pLys
⌬(ara-leu)7697 ⌬lacX74 ⌬phoA PvuII phoR araD139 ahpC galE
galK rpsL (DE3) F⬘关lac
⫹
lacI
q
pro兴gor-522::Tn10 trxB
pLysSRARE (Cam
r
Str
r
Tet
r
)
Novagen
M. smegmatis mc
2
155 ept-1 50
G. polyisoprenivorans VH2 Wild type, rubber degrading DSM44266
G. westfalica Kb1 Wild type, rubber degrading DSM44215
T
Plasmids
pBluescript SK(⫺)E. coli cloning vector; Ap
r
Stratagene
pGEM-T Easy E. coli T cloning vector; Ap
r
Promega
pET23a E. coli expression vector; Ap
r
Novagen
pNC9501 E. coli/Rhodococcus shuttle vector; Km
r
; thiostrepton
r
H. Saleki, Japan Energy
Corporation
Primers
P.SOD11 GA(CT)CTGGA(CT)TACGACTA(CT)GC
P.SOD22 CAGGTAGAA(AC)GC(AG)TG(CT)TCCCA
P.IPCRCS3 TTGGGGGACAGGTTCTTC
P.IPCRCS4 TCCAGGGTTCGGGCTGGG
P.SPB AAAAGGATCCGTGGCTGAATACACGCTTGCCG
P.SPE AAAAGAATTCTCAGGCAGGCTCGATGAGGCC
P.SODVH2F1 CACCACA(GC)CAAGCACCACGC(AGCT)(AG)C(GC)TA
P.SODVH2B1 GCGTG(CT)TCCCACATGTC(GC)TC(GC)A(GC)(GC)
P.SODVH2up1bio TGTCGTTGGCGCCCTTGACGTAC
P.SODVH2down1bio TCATCCCGGTCGTCATGCTCG
P.walker1 CTAATACGACTCACTATAGGGNNNNATGC
P.walker2 CTAATACGACTCACTATAGGGNNNNGATC
P.walker3 CTAATACGACTCACTATAGGGNNNNTAGC
P.walker4 CTAATACGACTCACTATAGGGNNNNCTAG
P.nested CTAATACGACTCACTATAGGG
P.SODVH2up1 GACGTACGTAGCGTGGTGCTTG
P.SODVH2down1 GCTCGACGACATGTGGGAACAC
P.SODVH2-647 AGCTGCTGTTTTCCGGAGCGG
P.SODVH2⫹9 GGAACTCAGGCGGGGACGATG
P.pETsod_Nde CATATGGCTGAATACACCTTGCCGGATCTC
P.pETsod_Xho_his CTCGAGGGCGGGGACGATGAGGCCCTTG
a
In primer sequences, recognition sites for restriction enzymes are underlined.
7644 SCHULTE ET AL. APPL.ENVIRON.MICROBIOL.

Directional genome walking. An internal 400-bp DNA fragment of sodA was
obtained from G. polyisoprenivorans by applying wobble primers derived from
highly conserved regions of the sodA sequences of G. westfalica and several
mycobacterial strains. The up- and downstream regions of this internal sodA
fragment of G. polyisoprenivorans were explored by a directional genome walking
method using PCR (39). For each direction, one biotinylated oligonucleotide,
which binds closely to the 5⬘end of the respective DNA strand, was designed.
Four degenerate walker primers described by Mishra et al. (39), expected to
anneal in the flanking regions up- and downstream of the known internal sodA
sequence, were obtained. The first set of eight PCRs was carried out using
genomic DNA of G. polyisoprenivorans as the template and each biotinylated
primer in combination with each of the four walking primers under PCR con-
ditions described previously to amplify the flanking regions. Streptavidin-coupled
magnetic beads (Roche, Switzerland) were then applied according to the man-
ufacturer’s protocol to isolate biotinylated PCR products, which were then used
as the template for a second set of PCRs. For this, for each direction a specific
nested primer binding even more closely to the 5⬘end of the known sequence
than the corresponding biotinylated oligonucleotide was designed. Each specific
nested primer was then used together with a general nested primer, also de-
scribed by Mishra et al. (39), for PCR, and the obtained amplification products
were then cloned into pGEM-T Easy (Promega, Madison, WI) and sequenced.
DNA sequence analysis. DNA sequences were determined with IRD800-la-
beled primers by using the SequiTherm Excel II Long-Read L-C kit and a model
4200 sequencer (LI-COR Biosciences, Lincoln, NE).
Preparation of extracellular protein fractions of Gordonia spp. For prepara-
tive purposes, cells of Gordonia spp. were harvested from the aqueous phase by
30 min of ultracentrifugation at 100,000 ⫻gand 4°C, and the clear supernatant
was subsequently concentrated 200- to 1,000-fold by ultrafiltration by applying a
Difco Amicon chamber equipped with a PM 10 membrane under nitrogen at 4°C.
The concentrated extracellular proteins were equilibrated with 10 mM sodium phos-
phate buffer (pH 7) by a second filtration process. For analytical purposes small
amounts of extracellular proteins were also concentrated from cell-free supernatants
by applying Vivaspin 500 centrifugal filter units with a polyethersulfone membrane
(Sartorius, Go¨ttingen, Germany) having a cutoff of 10 kDa.
Preparation of soluble protein from E. coli.E. coli cells were washed twice with
100 mM potassium phosphate buffer (pH 7.0) and were subsequently resuspended
in 2 volumes of 10 mM potassium phosphate buffer (pH 7.0). During disruption by
sonication employing a Sonifier 250 (Branson Sonic Power Company) with an
amplitude of 16 ␮m (3 min/ml; 50% output control), the cells were cooled with an
ice-salt mixture. Soluble membrane-free protein fractions were then prepared by 60
min of ultracentrifugation of the crude extract at 100,000 ⫻gand 4°C.
SOD activity assay. In supernatants of Gordonia sp. cultures grown in the
presence of synthetic poly(cis-1,4-isoprene), SOD enzyme activity was directly
measured by applying a SOD activity kit (Sigma-Aldrich, Munich, Germany)
according to the manufacturer’s manual. In contrast, in the soluble protein
fractions of recombinant E. coli strains, SOD activity was measured by applying
the xanthine oxidase-nitroblue tetrazolium (NBT) assay modified as described by
Beauchamp and Fridovich (11). One unit of SOD is defined as the amount
required to inhibit the reduction rate of NBT by 50%. The amount of soluble
protein was determined as described by Bradford (15).
Cloning and expression of six-His-tagged SodA. The coding region of sodA
from G. polyisoprenivorans VH2 was amplified by PCR by applying the primers
P.pETsod_Nde and P.pETsod_Xho_his. The amplified PCR product lacking the
stop codon of sodA was then cloned into pGEM-T Easy, excised by restriction
with NdeI and XhoI, and ligated to NdeI-XhoI-linearized plasmid pET23a DNA.
The resulting plasmid, pET23a:sodAhis, was subsequently transferred to E. coli
Rosetta-gami B(DE3)pLys for expression. This strain was cultivated in LB me-
dium at 37°C to an OD
600
of 0.5, and expression was then induced by addition of
IPTG (isopropyl-␤-D-thiogalactopyranoside) to a final concentration of 1 mM for
3 h. The cells were harvested and washed with sodium phosphate buffer (50 mM,
pH 7.4) before six-His-tagged SodA was isolated to homogeneity by applying
Ni-nitrilotriacetic acid (NTA) columns (see below).
Isolation of six-His-tagged SodA and generation of anti-SodA antibodies.
C-terminally six-His-tagged SodA was isolated under denaturing conditions from
recombinant E. coli strains expressing sodA from G. polyisoprenivorans VH2
under the control of the T7 promoter by applying Ni-NTA spin columns (Qiagen,
Hilden, Germany). Cells were lysed in buffer A (6 M guanidine hydrochloride,
0.1 M NaH
2
PO
4
, 0.01 M Tris-Cl; pH 8.0) to achieve effective denaturation of the
enzyme. All subsequent steps were carried out according to the manufacturer’s
protocol. The purified protein was separated by SDS-polyacrylamide gel elec-
trophoresis (PAGE), excised from the gel, and analyzed by matrix-assisted laser
desorption ionization–time of flight (MALDI-TOF) mass spectrometry before it
was used for generation of polyclonal antibodies in rabbits. This was done by
Eurogentec (Belgium). The immunoglobulin G fractions from the blood sera
were obtained by chromatography on protein A-Sepharose (29).
SDS-polyacrylamide gel electrophoresis, Western blot analysis, and N-termi-
nal amino acid sequence analysis. Samples were resuspended in gel loading
buffer (0.6%, wt/vol, SDS; 1.25%, wt/vol, ␤-mercaptoethanol; 0.25 mM EDTA;
10%, vol/vol, glycerol; 0.001%, wt/vol, bromophenol blue; and 12.5 mM Tris-
HCl, pH 6.8). Proteins were denatured by 5 min of incubation at 100°C and
separated in 11.5% (wt/vol) SDS-polyacrylamide gels as described by Laemmli
(34). Proteins were stained with Coomassie brilliant blue R-250 (56). Proteins
blotted from SDS-polyacrylamide gels onto nitrocellulose BA83 membranes
(pore size, 0.2 mm; Schleicher & Schuell, Dassel, Germany) using a Semidry Fast
Blot B33 apparatus (Biometra, Go¨ttingen, Germany) were analyzed immuno-
logically as described by Hein et al. (28). To determine the N-terminal amino
acid sequence, the proteins were blotted from an SDS-polyacrylamide gel onto a
polyvinylidene difluoride membrane (Millipore, Bedford, MA) according to the
method of Towbin et al. (52) by use of a Semidry Fast Blot B33 apparatus and
were analyzed by automated Edman degradation.
Native PAGE and SOD activity staining. Cells were harvested by 20 min of
centrifugation at 4,000 ⫻gand 4°C, washed twice with 100 mM sodium phos-
phate buffer (pH 7.0), and resuspended in the same buffer. Cell disruption was
done twice for 10 min in a type MM301 bead mill (Retsch, Haan, Germany). The
cell tube was cooled down with fluid nitrogen before and after the first cell
disruption. Native polyacrylamide gels were prepared as described by Laemmli
(34). Protein samples were loaded with 5⫻loading buffer containing 20% (wt/
vol) sucrose and 0.1% (wt/vol) bromine phenol blue. The native polyacrylamide
gel was handled as described by Juhnke et al. (32), and SOD activity was detected
by the method of Beauchamp and Fridovich (11). Bands of SOD activity ap-
peared as transparent zones on a purple background.
Purification of SodA from G. polyisoprenivorans VH2. Purification of SodA was
carried out as described by Beaman et al. (10) with some modifications. G.
polyisoprenivorans VH2 cells were cultivated in 30 liters MSM containing 0.2%
(wt/vol) sodium propionate. This carbon source was used to compare the intra-
cellular active SOD with the extracellular active SOD expressed by G. polyiso-
prenivorans VH2 cultivated in the presence of poly(cis-1,4-isoprene) as the sole
carbon source. Cell disruption was done twice in a bead mill, and debris and
unbroken cells were removed by1hofcentrifugation at 100,000 ⫻g. Anion-
exchange chromatography was performed as the second purification step, and
the cleared lysate was applied at a flow rate of 0.5 ml min
⫺1
to a Q-Sepharose
column, which had been washed earlier with 0.01 M Tris-HCl and 0.1 mM
EDTA, pH 7.8 (buffer A), at a flow rate of 5 ml min
⫺1
. After the column had
been washed with buffer A, proteins were eluted with a linear gradient of 500 ml
buffer A containing 0 to 1,000 mM NaCl at a flow rate of 5 ml min
⫺1
. Fractions
exhibiting SodA activity were pooled, concentrated to 5 ml, and dialyzed against
buffer A overnight at 4°C. The combined sample was purified by anion-exchange
chromatography again. The Q-Sepharose column was washed with buffer A and
equilibrated with buffer A containing 0.2 M NaCl at a flow rate of 5 ml min
⫺1
.
The dialyzed fraction was applied to the column at a flow rate of 0.5 ml min
⫺1
.
After the column was washed with buffer A containing 0.2 M NaCl, proteins were
eluted by applying a linear gradient with NaCl concentrations increasing from 0.2
to 0.45 M (250 ml) at a flow rate of 5 ml min
⫺1
. Fractions with SodA activity were
combined and concentrated by ultrafiltration.
Nucleotide sequence accession numbers. The DNA sequences of G. westfalica
sodA and the downstream flanking region and G. polyisoprenivorans sodA and the
upstream flanking region are available under GenBank accession numbers
AJ312188 and EF178278, respectively.
RESULTS
Proteins secreted by G. westfalica during rubber degrada-
tion. Cleavage of poly(cis-1,4-isoprene) as the initial step of
degradation occurs extracellularly or at the cell surface. En-
zymes responsible for rubber cleavage by Streptomyces sp.
strain K30 and Xanthomonas sp. strain Y35 were found to be
secreted into the extracellular environment (31, 45, 58). There-
fore, it is supposed that other accessory proteins essential for
the initial step of rubber degradation are also localized outside
the cells. Cell-free culture supernatants of G. westfalica and G.
polyisoprenivorans grown in the presence of poly(cis-1,4-iso-
prene) were therefore derived from various growth phases,
concentrated, and analyzed by SDS-PAGE to identify such
VOL. 74, 2008 SodA INVOLVEMENT IN POLY(CIS-1,4-ISOPRENE) DEGRADATION 7645

proteins. On comparison of the resulting extracellular protein
pattern to that of cultures grown in the presence of succinate,
it was found that one predominant protein band with an ap-
parent molecular mass of 25 kDa was specifically present in
cultures degrading the polymer, as shown in Fig. 1 (lane WT)
for supernatants obtained from a G. polyisoprenivorans VH2
culture. To determine the amino-terminal sequences of these
proteins, the extracellular proteins from poly(cis-1,4-isoprene)
cultures of G. westfalica cells and also from G. polyiso-
prenivorans VH2 cells were separated by SDS-PAGE and
transferred to polyvinylidene difluoride membranes and the
corresponding protein bands were excised and subjected to
Edman degradation. When the obtained amino-terminal se-
quences (EYALPVLDYDYAAL and AEYTLPDLPY, re-
spectively) were compared to sequences of proteins in data-
bases, it was found that they exhibited about 78% and 90%
identical amino acids to the amino-terminal sequences of a
manganese SOD of Nocardia asteroides GUH-2 (accession no.
P53651) and a SOD of Kineococcus radiotolerans SRS30216
(NC009664.1), respectively. The sequences followed the me-
thionine encoded by the translational start codon, and no hints
of a leader sequence were obtained.
Cloning of the complete sodA gene of G. westfalica.G. west-
falica was chosen for further studies, because it was genetically
much more accessible than G. polyisoprenivorans. To amplify
the central region of the G. westfalica sodA gene, primer
P.SOD11 and primer P.SOD22 were used. An approximately
450-bp PCR product was obtained, cloned into pGEM-T Easy
yielding pGEM-TSOD1122, and sequenced. The amino acid
sequence obtained shared 66% identity with that of SodA
from N. asteroides GUH-2. A digoxigenin-labeled pGEM-
TSOD1122 DNA identified one single fragment of about 6,000
bp in SacI-digested total DNA of G. westfalica by DNA-DNA
hybridization. Therefore, a partial genomic library of SacI-
digested genomic DNA was prepared in pBluescript SK
⫺
DNA in E. coli XL1-Blue. DNA-DNA hybridization with
digoxigenin-labeled pGEM-TSOD1122 DNA and analysis
of the nucleotide sequence, which was obtained by applying
the primer hopping strategy, identified the incomplete sodA
on the smaller fragment. To obtain also the sequence of the
DNA region beyond the SacI restriction site encoding the
first 25 amino acids of SodA, inverse PCR was applied to
religated BamHI-digested genomic G. westfalica DNA by
employing primers P.IPCRCS3 and P.IPCRCS4. The ob-
tained product was cloned into plasmid pGEM-T Easy and
sequenced.
A contiguous DNA sequence of 4,439 bp comprising the
entire sodA gene (630 bp) plus 10 and 3,799 bp of the upstream
and downstream regions, respectively, was obtained (Fig. 2).
The sequenced gene contained the coding region for the N-
terminal sequence of SodA that had been determined by Ed-
man degradation. The translational product of sodA exhibited
significant homologies to various SODs, with the highest ho-
mology (70% identical amino acids) to the putative SOD of
Micrococcus luteus NCTC 2665 (NCBI nr accession no. ZP_
02944066.1), as shown in the phylogenetic tree (Fig. 3). Since
only 10 bp upstream of the start codon of sodA was obtained,
no complete Shine-Dalgarno sequence could be identified, and
genes in sequences upstream of sodA remained unknown.
Three genes encoding a putative ABC transporter (a probable
transmembrane protein, an ATP-binding protein, and a pro-
tein with homologies to hypothetical proteins of unknown
function) are located downstream of sodA.
Functional expression of G. westfalica SodA in an E. coli
sodA sodB double mutant. The PCR product obtained with
primers P.SPB and P.SPE and DNA of G. westfalica as the
template was restricted with BamHI plus EcoRI and ligated
with BamHI-EcoRI-linearized pBluescript SK
⫺
, yielding plas-
mid pSKsod. By this means, sodA was cloned in colinear ori-
entation to the lacZ promoter and in frame with the region of
lacZ responsible for ␣-complementation. To investigate the
fusion of the N-terminal LacZ region with the entire SodA
from G. westfalica with regard to complementation of the
SOD-negative phenotype, pSKsod was transformed into the
sodA sodB double mutant QC779 of E. coli. Soluble protein
fractions from cells harboring pSKsod and cultivated for 12 h
at 37°C in LB medium containing an appropriate antibiotic and
1 mM IPTG for expression of SodA exhibited a specific SOD
activity of 62.6 U/mg protein, whereas in the control harboring
pBluescript SK
⫺
only 6.8 U/mg protein was measured. This
clearly indicated functional expression of the G. westfalica
SodA in E. coli. This was also confirmed by the paraquat assay.
After 42 h of cultivation in the presence of paraquat, E. coli
QC779 harboring pSKsod reached about a threefold-higher
OD
600
(2.1) than E. coli QC779 harboring pBluescript SK
⫺
(0.8). Consequently, the G. westfalica SodA protected E. coli
QC779 from oxidative damage by superoxide radicals and com-
pensated for the absence of the E. coli SODs, as indicated by
an increased paraquat resistance.
Sodium azide (NaN
3
) as a Mn SOD inhibitor affects rubber
degradation by G. westfalica.Different compounds inhibit the
activity of SODs depending on the metal ion present at the
FIG. 1. Extracellular protein fractions of G. polyisoprenivorans
VH2 and mutants grown in the presence of poly(cis-1,4-isoprene) for
30 days at 30°C. Culture supernatants were concentrated approxi-
mately 200-fold, and the proteins were subsequently separated in an
SDS-polyacrylamide gel (12.5%, wt/vol, acrylamide). M, low-molecu-
lar-weight calibration kit (Pharmacia, Uppsala, Sweden); WT, G. poly-
isoprenivorans VH2 wild type; I3 and I5, “irregular” mutants; B, C, and
D, sodA disruption mutants. The position of SodA in the gel is indi-
cated by an arrow; ⴱ, protein occurring in “irregular” mutants and in G.
polyisoprenivorans VH2 sodA⌬Km.
7646 SCHULTE ET AL. APPL.ENVIRON.MICROBIOL.

active site of the enzyme. Cu/Zn SODs are inhibited by CN
⫺
ions, whereas Fe and Mn SODs are effectively inhibited by N
3
⫺
ions (40). Therefore, we studied the effect of NaN
3
on growth
of G. westfalica in MSM with poly(cis-1,4-isoprene) or nonre-
lated carbon sources like gluconate as the sole carbon source
and in complex media like St-I. With only 0.5 mM NaN
3
in the
medium, growth of cells with poly(cis-1,4-isoprene) was com-
pletely inhibited, whereas it was only slightly reduced on glu-
conate and not at all in St-I medium. Growth on any substrate
was completely inhibited by 7 mM NaN
3
.
FIG. 2. Relationship between SODs from different organisms. The dendrogram was constructed using the CLUSTAL_X program as described
by Thompson et al. (51). Relatedness is represented by the branch length. Bar, 0.1 amino acid substitution. GenBank accession numbers for the
organisms represented are as follows: Gordonia sp. strain Kb2, CAC85367; Mycobacterium smegmatis MC
2
155, YP_890640; Micrococcus luteus
NCTC 2665, ZP_02944066; Brevibacterium linens BL2, ZP_00380098; Kineococcus radiotolerans SRS30216, YP_001363305; Nocardia farcinica IFM
10152, YP_116327; Mycobacterium abscessus, YP_001700872; Nocardia brasiliensis ATCC 700358 SodA, ABD64088; Rhodococcus sp. strain RHA1
SodA, YP_703964; Nocardia asteroides GUH2, P53651; Mycobacterium fortuitum, Q59519; Mycobacterium sp. strain MCS, YP_642204; Mycobac-
terium avium subsp. paratuberculosis K10, NP_959121; Mycobacterium avium 104, YP_879475; Kocuria rhizophila DC2201, YP_001853893;
Mycobacterium lepraemurium, O86165; Mycobacterium smegmatis MC
2
155 SodA, YP_890845; Mycobacterium avium subsp. paratuberculosis,
ABZ81482; Renibacterium salmoninarum ATCC 33209, YP_001625417; Mycobacterium avium subsp. avium, ABZ81479.1; Arthrobacter sp. strain
FB24, YP_831566.1; Arthrobacter pascens DMDC12, ABG76965.1; Mycobacterium avium subsp. paratuberculosis, ABZ81484.1; Mycobacterium
avium subsp. hominissuis, ABZ81485.1; Mycobacterium leprae TN, NP_301180.1; Mycobacterium tuberculosis H37Rv, NP_218363.1; Arthrobacter
aurescens TC1, YP_947831.1; Arthrobacter nitroguajacolicus, YP_001210461; Mycobacterium bovis AF 2122/97, NP_857513.1.
VOL. 74, 2008 SodA INVOLVEMENT IN POLY(CIS-1,4-ISOPRENE) DEGRADATION 7647

Cloning of sodA from G. polyisoprenivorans.Several attempts
to inactivate SodA by gene disruption in G. westfalica to obtain
final proof of its involvement in rubber degradation failed due
to the absence of an efficient gene transfer system for G.
westfalica (4). Since G. polyisoprenivorans VH2 also secreted
noticeable amounts of SodA protein (Fig. 1) in the presence of
poly(cis-1,4-isoprene) and since this strain is readily accessible
for DNA uptake by electroporation (4, 7), we continued the
studies with this closely related bacterium.
Primers P.SODVH2F1 and P.SODVH2B1 were deduced
from nucleotide sequences highly conserved in many sodA
genes of actinomycetes and yielded by PCR a central region of
the sodA gene comprising 423 bp from total genomic DNA of
strain VH2. The up- and downstream regions of this central
sodA region were obtained by directional PCR-based genome
walking (39) employing one of the biotinylated primers
P.SODVH2up1bio and P.SODVH2down1bio in combination
with each of the walker primers P.walker1 to P.walker4 in the
first round. After purification of biotinylated amplification
products, a more specific PCR product was then amplified in
the second round using primers P.SODVH2up1 and
P.SODVH2down1 individually, in combination with primer
P.nested. The obtained PCR products were cloned into
pGEM-T Easy, and the sequences were assembled, yielding a
1,285-bp fragment. Putative start (GTG) and stop (TGA)
codons were identified at positions 647 and 1277, respectively.
Therefore, the G. polyisoprenivorans sodA gene comprises 630
bp coding for a protein of 209 amino acids. Highest homologies
of 90% and 69% identical amino acids were obtained with
SodA from G. westfalica and with SodA from M. smegmatis
MC
2
155 (accession no. YP_890640.1) and M. luteus NCTC
2665 (accession no. ZP_02944066.1), respectively (Fig. 2).
SOD homologues of Gordonia strains are closely related to
other sodA-encoded proteins from representative species of
gram-positive bacteria.
Construction of sodA disruption mutants of G. polyiso-
prenivorans.The 1,285-bp sequence comprising the entire sodA
coding region (positions 647 to 1279) exhibited a unique re-
striction site for ClaI at position 810, which was 163 nucleo-
tides downstream of the putative start codon. For this reason a
1,284-bp fragment was amplified by PCR using primers
P.SODVH2-647 and P.SODVH2⫹9 and cloned into pGEM-T
Easy. This vector was used because of the missing cleavage site
for ClaI in the vector. Since the resulting plasmid, pGEM-T-
1.3sod, isolated from E. coli TOP10 could not be digested with
ClaI, indicating methylation at its recognition site, it was trans-
formed into E. coli ET12567 lacking DNA-methylating en-
zymes. It could then be linearized with ClaI. The 3⬘protruding
ends were blunted with T4 DNA polymerase, and an approx-
imately 1,000-bp SmaI-SmaI kanamycin resistance (Km) cas-
sette was inserted at position 163 of sodA.
The 2.3-kbp sodA⌬Km DNA fragment was amplified by
PCR using again P.SODVH2-647 and P.SODVH2⫹9, and the
resulting linear DNA fragment was purified, dialyzed, and
transferred to G. polyisoprenivorans VH2 by electroporation.
Recombinant clones were selected for chromosomal integra-
FIG. 3. Screening for sodA disruption mutants of G. polyisoprenivorans VH2 by colony PCR. Single colonies of putative sodA disruption
mutants were suspended in 50 ␮l TE buffer, and the suspension was then boiled for 15 min. After centrifugation, 0.5 ␮l was applied as a template
for a 10-␮l PCR mixture, and the products were separated in a 1% (wt/vol) agarose gel. M, ␭DNA digested with PstI; WT, G. polyisoprenivorans
VH2 wild type; I3, “irregular” mutant; B, C, and D, sodA⌬Km disruption mutants of G. polyisoprenivorans VH2.
7648 SCHULTE ET AL. APPL.ENVIRON.MICROBIOL.

tion of the 2.3-kbp sodA⌬Km fragment on St-I medium agar
plates containing kanamycin (50 ␮g/ml). Two individual trans-
formation reactions yielded in total more than 400 kanamycin-
resistant colonies. Colony PCR using again P.SODVH2-647
and P.SODVH2⫹9 gave, surprisingly, only 18 clones that did
not possess the wild-type 1,284-bp PCR product, only the 2.3-
kbp sodA⌬Km knockout PCR product (Fig. 3), as expected for
knockout mutants. All other clones (more than 382) exhibited
both the wild-type 128-bp fragment and the 2.3-kbp sodA⌬Km
fragment, indicating unspecific integration of the 2.3-kbp
sodA⌬Km DNA fragment somewhere else in the chromosome.
Noticeably, mutants A to O, which did not harbor the 128-bp
wild-type fragment exhibited delayed growth on St-I medium
after electroporation and a colony morphology slightly differ-
ent from those of the wild type, with colonies being rougher.
The phenotype of only two mutants (mutants I3 and I5) did not
differ from that of the wild type. DNA-DNA hybridization
experiments employing sodA as a digoxigenin-labeled probe
also confirmed disruption of sodA in each of the rough mutants
(mutants A to O) (Fig. 4). In comparison to those of the wild
type, the hybridizing ApaI fragments of these mutants were
approximately 1 kb larger, corresponding to the size of the
inserted kanamycin resistance cassette. However, the ApaI
DNA fragments of mutants I3 and I5 were approximately 2.5
to 3.0 kb larger than the corresponding fragments of the wild
type hybridizing to the sodA probe, suggesting an irregular
integration of the 2.3-kbp sodA⌬Km DNA fragment.
Effect of sodA disruption on growth. If SodA has some func-
tion for poly(cis-1,4-isoprene) degradation in Gordonia spp., its
absence should have a deleterious effect on the utilization of
this polymer. The effect of sodA inactivation on growth of
mutants B, C, D, and H of G. polyisoprenivorans VH2 and
of the “irregular” mutants, I3 and I5, of G. polyisoprenivorans
VH2 in the presence of poly(cis-1,4-isoprene) was abundantly
clear (Fig. 5, right). After 45 days of incubation, MSM cultures
of the wild type with 0.2% (wt/vol) synthetic poly(cis-1,4-iso-
prene) as the sole carbon source reached an OD
600
of 3.32,
whereas the G. polyisoprenivorans VH2sodA⌬Km insertion
mutants (mutants B, C, D, and H) grew much slower and to an
OD
600
of only 1.32. Both irregular mutants (I3 and I5) also
differed from the wild type, but to a lesser extent: they grew to
an OD
600
of 2.45.
SODs are of general importance for detoxification of bacte-
rial cells during aerobic growth. Therefore, the effect of the
FIG. 4. DNA-DNA hybridization experiments. Total DNA of G.
polyisoprenivorans VH2 and of putative sodA mutants was digested
with ApaI and separated in a 1% (wt/vol) agarose gel. sodA DNA
labeled with digoxigenin by PCR was used as a probe. M, ␭DNA
digested with PstI; WT, G. polyisoprenivorans VH2 wild type; I3 and I5,
“irregular” mutants; B, C, D, and H, sodA⌬Km disruption mutants of
G. polyisoprenivorans VH2.
FIG. 5. Growth behavior of sodA mutants. Cells were cultivated in duplicate; graphs show the arithmetic means with standard deviations of two
experiments. (Right) Effect of sodA disruption on growth in the presence of poly(cis-1,4-isoprene) or other carbon sources. f, wild type of G.
polyisoprenivorans VH2; ŒsodA⌬Km disruption mutants B, C, D, and H of G. polyisoprenivorans VH2; F“irregular” mutants I3 and I5 of G.
polyisoprenivorans VH2. Cells were grown in the presence of synthetic poly(cis-1,4-isoprene) as the sole source for carbon and energy, and growth
was recorded for an incubation period of 45 days by measuring the optical density. (Left) Growth of the wild type and of the sodA⌬Km mutants
B, C, D, and H of G. polyisoprenivorans VH2 in the presence of 1% (wt/vol) sodium acetate or 1% (wt/vol) sodium succinate: f, wild type of G.
polyisoprenivorans VH2 grown in the presence of acetate (cells were cultivated in duplicate. F,sodA⌬Km disruption mutants B and C of G.
polyisoprenivorans grown on acetate; Œ, wild type of G. polyisoprenivorans VH2 grown on succinate (cells were cultivated in duplicate); ,sodA⌬
Km disruption mutants B, C, D and H of G. polyisoprenivorans grown on succinate.
VOL. 74, 2008 SodA INVOLVEMENT IN POLY(CIS-1,4-ISOPRENE) DEGRADATION 7649

inactivated sodA gene not only on growth in the presence of
poly(cis-1,4-isoprene) but also on growth in the presence of
other carbon sources like acetate and succinate was investi-
gated. MSM cultures containing either 1% (wt/vol) sodium
acetate or succinate were inoculated with St-I precultures of
the wild-type G. polyisoprenivorans VH2 or the mutant G.
polyisoprenivorans VH2 sodA⌬Km grown for 48 h, and growth
was monitored by measuring OD
600
(Fig. 5, left). All four
sodA⌬Km disruption mutants mentioned above exhibited
growth almost identical to that of the wild type, indicating that
SodA did not affect growth on substrates not related to iso-
prenoids. The effect of a lack of SodA on growth on carbon
sources other than poly(cis-1,4-isoprene) was also confirmed
by comparing levels of colony growth of the wild type and of
the mutants on solid MSM containing various carbon sources.
In these cases absolutely no effect could be observed, whereas
the effect of SodA on utilization of the polymer on solidified
latex MSM was clearly visible.
Effect of sodA disruption on the presence of extracellular
SodA and enzyme activity. At the end of the cultivation exper-
iments described above, the extracellular protein fractions
were analyzed by SDS-PAGE (Fig. 1). As expected, SodA
protein was present in the supernatants of cultures of G. poly-
isoprenivorans and also of both irregular mutants, I3 and I5, but
was completely absent in cultures of G. polyisoprenivorans VH2
sodA⌬Km mutants B, C, D, and H. In the culture supernatants
of all regular and irregular mutants, there was an additional
protein with an apparent molecular mass of 30 kDa which was
absent in the supernatant of the wild type. Since it was present
if the wild-type allele had been replaced (G. polyisoprenivorans
VH2 sodA⌬Km mutants A to O) or if it was integrated irreg-
ularly, as in mutants I3 and I5, this protein probably is the
kanamycin phosphotransferase.
Analysis of SOD enzyme activity in the supernatants con-
firmed the observations described above. Whereas SOD activ-
ity in supernatants of the wild type was approximately 1.8 U/ml,
it was only 1.0 U/ml in the supernatants of the irregular mu-
tants, I3 and I5, and below 0.01 U/ml in the supernatants of the
disruption mutants (G. polyisoprenivorans VH2 sodA⌬Km mu-
tants A to O).
Additionally, analysis of the intracellular and extracellular
protein patterns of the regular disruption strains by native
PAGE in combination with activity staining demonstrated total
absence of SOD activity in comparison to that associated with
protein patterns of the irregular disrupted mutants (Fig. 6).
Complementation of the VH2 sodA⌬Km mutant. The E.
coli/Rhodococcus shuttle vector pNC9501 was used to restore
SOD activity in disruption mutants of G. polyisoprenivorans
VH2. Therefore, the vector pGEM-T-1.3sod was restricted
with EcoRI, yielding a linearized vector and a 1.3-kbp DNA
fragment comprising sodA with its putative promoter region.
The 1.3-kbp EcoRI sodA DNA fragment was ligated with the
EcoRI-linearized E. coli/Rhodococcus shuttle vector pNC9501,
yielding pNC9501::sodA, and transformed into G. polyiso-
prenivorans VH2 sodA⌬Km sodA disruption mutants B, C, D,
H, I3, and I5. All randomly chosen transformants, which were
selected on St-I agar plates containing thiostrepton (25 ␮g/ml),
harbored pNC9501::sodA. Cultivation experiments in liquid
MSM with poly(cis-1,4-isoprene) as the sole carbon source
revealed that growth of G. polyisoprenivorans VH2 sodA⌬Km
was restored by pNC9501::sodA to a level comparable to that
of the wild type. Moreover, SOD enzyme activity staining in
nondenaturing polyacrylamide gels demonstrated expression
of active SOD in cells of all complemented mutants like that
in wild-type cells and unlike that in the disruption mutants
(Fig. 7).
Purification of six-His-tagged SodA. The coding region of
sodA from G. polyisoprenivorans VH2 was cloned into the E.
coli expression vector pET23a under the control of the T7
promoter, yielding plasmid pET23a:sodAhis. Recombinant
strains of E. coli Rosetta-gami B(DE3)pLys harboring this
plasmid were employed for heterologous expression as de-
scribed in Materials and Methods. Six-His-tagged SodA was
purified to homogeneity with Ni-NTA columns (Qiagen,
Hilden, Germany) by applying buffer A for denaturation (6 M
guanidine hydrochloride, 0.1 M NaH
2
PO
4
, 0.01 M Tris-Cl; pH
8.0) since purification after lysis with buffer B (8 M urea, 0.1 M
NaH
2
PO
4
, 0.01 M Tris-Cl; pH 8.0) was not successful. The
purified protein was separated by SDS-PAGE, excised from
the gel, and analyzed by MALDI-TOF mass spectrometry
(data not shown) before it was used for generation of anti-
bodies.
Native PAGE and SOD activity staining. To compare super-
natants of cells grown with sodium succinate, intracellular and
extracellular proteins from cultures cultivated with water-sol-
uble substrates (glucose or sodium salts of propionate, acetate,
FIG. 6. Detection of SOD activity in regular and irregular G. poly-
isoprenivorans VH2 disruption mutants during growth in the presence
of poly(cis-1,4-isoprene) or sodium propionate by native PAGE. Cells
were incubated at 30°C in MSM containing 0.2% (wt/vol) sodium
propionate (lanes 1 to 7) or 0.2% (wt/vol) poly(cis-1,4-isoprene) (lanes
8 to 14), and crude extracts were analyzed. Lanes: 1 and 8, G. polyiso-
prenivorans mutant B; 2 and 9, G. polyisoprenivorans mutant C; 3 and
10, G. polyisoprenivorans mutant D; 4 and 11, G. polyisoprenivorans
mutant F; 5 and 12, G. polyisoprenivorans mutant H; 6 and 13, G.
polyisoprenivorans “irregular” mutant I3; 7 and 14, G. polyiso-
prenivorans “irregular” mutant I5.
FIG. 7. Detection of SOD activity in wild-type G. polyiso-
prenivorans VH2, G. polyisoprenivorans VH2 sodA⌬Km mutant C, and
the SodA-complemented G. polyisoprenivorans VH2 sodA⌬Km
(pNC9501::sodA) mutant. Cells were incubated in MSM containing
0.2% (wt/vol) poly(cis-1,4-isoprene) at 30°C for 14 days. Lanes con-
tained soluble protein fractions. Lanes: 1, wild-type G. polyiso-
prenivorans VH2; 2, G. polyisoprenivorans VH2 sodA⌬Km mutant C; 3
to 7, different transformants of G. polyisoprenivorans VH2 sodA⌬Km
harboring plasmid pNC9501::sodA for genetic complementation.
7650 SCHULTE ET AL. APPL.ENVIRON.MICROBIOL.

or gluconate), latex, and synthetic rubber were analyzed by
native PAGE with activity staining. The SOD activity was vi-
sualized with NBT (11). Interestingly, the activity of only one
SOD protein could be detected on native gels in all intracel-
lular protein samples. These results indicate that G. polyiso-
prenivorans VH2 contains only a single SOD. In contrast, no
extracellular SOD activity was detectable in native gels from
cultures grown with water-soluble substrates as carbon sources.
After 1 week of incubation at 30°C, the extracellular protein
fractions of latex cultures already showed SOD activity, and
after 2 weeks the extracellular protein fractions of poly(cis-1,4-
isoprene) cultures also exhibited SOD activity (Fig. 8). All
results obtained from native PAGE were confirmed by West-
ern blotting employing the antibodies raised against SodA.
DISCUSSION
Biochemical studies at a molecular level of biodegradation
of the polyisoprenoids natural rubber and gutta percha started
only recently. Whereas almost nothing is still known about the
microbial degradation of poly(trans-1,4-isoprene) and the first
axenic cultures only recently became available (55), two extra-
cellular enzymes capable of cleaving poly(cis-1,4-isoprene)
were identified (31, 45). RoxA (rubber oxygenase A) is secreted
by the gram-negative Xanthomonas sp. strain 35Y during
growth of cells on natural rubber latex (30). Isolated dioxygen-
ase RoxA cleaves poly(cis-1,4-isoprene) at the double bonds,
yielding 12-oxo-4,8-dimethyltrideca-4,8-diene-1-al as the major
cleavage product (13, 14). Lcp (latex clearing protein) cleaves
poly(cis-1,4-isoprene) in Streptomyces sp. strain K30 (45). A
dicarbonyl isoprenoid with keto and aldehyde terminal groups
resulted from oxidative cleavage by Nocardia farcinica S3 har-
boring an Lcp homologue (30). Oxidative degradation of cis-
and trans-polyisoprenes and of vulcanized natural rubber was
also demonstrated in vitro by two different artificial enzyme
mediator systems. One applied lipoxygenase/linoleic acid and
horseradish peroxidase/1-hydroxybenzotriazole, yielding poly-
isoprenoid molecules with low molecular weight (23). Degra-
dation of vulcanized and nonvulcanized polyisoprenes by lipid
peroxidation catalyzed by oxidative enzymes and transition
metals was also demonstrated (47).
Although rubber-degrading Gordonia species possess genes
coding for functional active Lcp (18), the functions of these
homologues and the enzymes in these bacteria initiating rub-
ber degradation are not known. As in other bacteria, cleavage
of poly(cis-1,4-isoprene) occurred at the double bonds by ox-
ygen addition (21, 53), yielding cleavage products with alde-
hyde and keto groups at the surface of degrading rubber ma-
terials (35). During growth on poly(cis-1,4-isoprene), the
rubber-degrading bacteria G. polyisoprenivorans and G. west-
falica expressed 25-kDa extracellular proteins (Fig. 1) which
were unequivocally identified as Mn SODs. A Mn SOD was
also observed in two-dimensional gels in supernatants obtained
from rubber-degrading Nocardia farcinica IFM10152 cells (Q.
Arensko¨tter, unpublished data).
Although little is known about the function of extracellular
SODs, they are obviously important for certain lifestyles. For
pathogenic microorganisms, an involvement in resistance
against immune defense has been discussed (2). Some organ-
isms express a SOD during degradation of certain compounds;
one of these is the lignin degrader Phanerochaete chrysospo-
rium, which expressed a Mn SOD during exposure to dibenzo-
p-dioxin (33). The diatom Skeletonema costatum increased
SOD activity during exposure to 2,4-dichlorophenol (57). In
FIG. 8. Comparison of SOD activities in G. polyisoprenivorans VH2 growing on various carbon sources. Cells were incubated at 30°C in MSM
containing 0.5% (vol/vol) latex, 0.2% (wt/vol) poly(cis-1,4-isoprene), 0.2% (wt/vol) glucose, 0.2% (wt/vol) gluconate, 0.2% (wt/vol) propionate, or
0.2% (wt/vol) acetate. Proteins of soluble cell fractions and supernatants were tested. Lanes: 1, 1-day incubation with latex (soluble cell fraction);
2, 1-day incubation with latex (supernatant); 3, 2-day incubation with latex (soluble cell fraction); 4, 2-day incubation with latex (supernatant);5,
3-day incubation with latex (soluble cell fraction); 6, 3-day incubation with latex (supernatant); 7, 12-day incubation with poly(cis-1,4-isoprene)
(soluble cell fraction); 8, 12-day incubation with poly(cis-1,4-isoprene) (supernatant); 9, 13-day incubation with poly(cis-1,4-isoprene) (soluble cell
fraction); 10, 13-day incubation with poly(cis-1,4-isoprene) (supernatant); 11, 14-day incubation with poly(cis-1,4-isoprene) (soluble cell fraction);
12, 14-day incubation with poly(cis-1,4-isoprene) (supernatant); 13, 1-day incubation with glucose (soluble cell fraction); 14, 1-day incubation with
gluconate (soluble cell fraction); 15, 1-day incubation with propionate (soluble cell fraction); 16, 1-day incubation with acetate (soluble cell
fraction).
VOL. 74, 2008 SodA INVOLVEMENT IN POLY(CIS-1,4-ISOPRENE) DEGRADATION 7651

rat liver, copper/zinc SOD activity was shown to stimulate
anthranilamide hydroxylation by a microsomal monooxygenase
system (41), and in Phanerochaete chrysosporium BKM-F-1767
SOD activity enhanced the rate of veratryl alcohol oxidation by
lignin peroxidase (9). Since SOD activity produces hydrogen
peroxide from superoxide anions, it may in this case provide
the substrate for the lignin peroxidase reaction and thereby
increase enzyme activity. Additionally, during oxidation of cer-
tain extracellular compounds, large amounts of cell-damaging
ROS arise.
Multiple pieces of evidence for the involvement of SodA in
rubber degradation were obtained in this study. (i) Its forma-
tion is induced in the presence of poly(cis-1,4-isoprene). (ii)
Regular sodA⌬Km mutants, which were obtained by a homog-
enotization approach using the knockout cassette sodA⌬Km
(Fig. 3), mineralized rubber to CO
2
much slower than the wild
type. (iii) The typical Mn SOD inhibitor NaN
3
affected growth
of G. westfalica significantly at low concentrations during cul-
tivation on poly(cis-1,4-isoprene) but not on nonisoprenoid
carbon sources. (iv) SodA restored enhanced paraquat resis-
tance in the E. coli sodA sodB double mutant QC779. (v) SOD
enzyme activity could be measured in recombinant E. coli cells
expressing SodA of G. polyisoprenivorans. (vi) SOD enzyme
activity was also demonstrated by activity staining in polyacryl-
amide gels. Detailed analyses of the function of Sod in these
Gordonia species were mostly done with G. polyisoprenivorans
because it is much more genetically accessible than G. west-
falica (4). All mutants with confirmed sodA disruption exhib-
ited almost no extracellular SOD activity, and also no SodA
was detectable by SDS-PAGE, Western blotting, and native
PAGE analysis (Fig. 1). The phenotype of the “irregular” mu-
tants and how they still synthesize a functional SodA (Fig. 1)
are not understood. Surprisingly, disruption sodA mutants
were distinguishable from the wild type due to an altered,
rougher colony morphology. This indicated not only that SodA
affects growth on poly(cis-1,4-isoprene) but also that it is im-
portant for other functions. However, whereas growth of G.
polyisoprenivorans VH2 sodA⌬Km on synthetic poly(cis-1,4-
isoprene) was clearly reduced (Fig. 5, right panel) in compar-
ison to that of the wild type, no negative effect was observed
during growth on acetate or succinate (Fig. 5, left panel).
The genomes of most bacteria closely related to G. polyiso-
prenivorans encode at least two SODs; typically, they synthesize
both a copper/zinc SOD and an iron/manganese SOD. Various
analyses clearly indicated that the investigated G. polyiso-
prenivorans strain possesses only one SOD, which belongs to
the latter group. SODs isolated from extracellular fractions of
actinomycetes also usually belong to the iron/manganese SOD
family. Although Western blot analysis and native PAGE also
demonstrated expression of SodA during growth on nonpoly-
isoprenoid substrates like acetate, SodA is not essential for
aerobic growth of G. polyisoprenivorans VH2, as revealed by
the phenotype of the sodA mutant. SodA was present in the
wild type only intracellularly after growth on these substrates.
Since the extracellular SOD expressed during growth on poly-
(cis-1,4-isoprene) and the intracellular SOD expressed during
growth on propionate exhibited identical N-terminal amino
acid sequences, only one SOD, rather than two SODs which
are differently expressed during growth on substrates that have,
e.g., rubber on one side and a nonisoprenoid on the other side,
is present in G. polyisoprenivorans. Since sodA disruption mu-
tants of G. polyisoprenivorans degraded poly(cis-1,4-isoprene)
at a reduced rate, a lack of SodA cannot be compensated for
by another SOD enzyme, and other oxidant defense enzymes
like glutathione reductase, catalase, and peroxidase (49) must
compensate for the lack of SOD in G. polyisoprenivorans. Since
also almost no extracellular SOD activity was measured in
supernatants of the sodA mutants, SodA is unlikely to produce
hydrogen peroxide as a substrate for a rubber-cleaving enzyme.
Otherwise, inactivation of sodA would have led to a total loss
of rubber-degrading ability. This clearly indicates that SodA
functions as an extracellular radical scavenger enzyme during
cleavage of poly(cis-1,4-isoprene) when toxic ROS superoxide
anions are probably released at elevated concentrations.
Tullius et al. (54) proposed that extracellular SODs from
mycobacteria are not actively secreted but appear extracellu-
larly due to bacterial leakage or autolysis; the extracellular
abundance of these enzymes resulted from their high level of
expression and extracellular stability. N-terminal analysis of
SOD from G. westfalica and G. polyisoprenivorans VH2 gave
no hints that SodA is secreted actively, as described for M.
tuberculosis (16), but rather indicated that it was detectable due
to long incubation periods and the stability of the enzyme.
Otherwise, SodA should be also be detected extracellularly
when cultivated on water-soluble substrates. Possibly, SodA
released from perforated and/or dying cells during the long
incubation times required for rubber degradation may protect
the surviving cells from oxidative damage. Secretion of SodA
by M. tuberculosis depends on an alternative SecA pathway.
This pathway is not based on a signal peptide (17). Whether
Gordonia also possesses such an alternative Sec pathway is not
known. In this case, intracellular SodA could protect cells
during growth on water-soluble substrates and is secreted only
after induction of the alternative pathway, e.g., in the presence
of poly(cis-1,4-isoprene). This has to be investigated in the
future.
ACKNOWLEDGMENTS
We are indebted to Bernhard Schmidt (Institut fu¨r Biochemie II der
Georg-August-Universita¨t Go¨ttingen, Germany) and Barbara Sched-
ding (Institut fu¨r Physiologische Chemie und Pathobiochemie, Univer-
sita¨tsklinikum Mu¨nster, Germany) for N-terminal sequence analyses.
MALDI-TOF analyses by Simone Ko¨nig (Integrated Functional
Genomics, Interdisciplinary Center for Clinical Research, West-
fa¨lische Wilhelms-Universita¨t Mu¨nster) are gratefully acknowledged.
REFERENCES
1. Alamuri, P., and R. J. Maier. 2006. Methionine sulfoxide reductase in
Heliobacter pylori: interaction with methionine-rich proteins and stress-
induced expression. J. Bacteriol. 188:5839–5850.
2. Alcendor, D. J., G. D. Chapman, and B. L. Beaman. 1995. Isolation, se-
quencing and expression of the superoxide dismutase-encoding gene (sod)of
Nocardia asteroides strain GUH-2. Gene 164:143–147.
3. Almiron, M., A. Link, D. Furlong, and R. Kolter. 1992. A novel DNA binding
protein with regulatory and protective roles in starved E. coli. Genes Dev.
6:2646–2654.
4. Arensko¨tter, M., D. Baumeister, R. Kalscheuer, and A. Steinbu¨chel. 2003.
Identification and application of plasmids suitable for transfer of foreign
DNA to members of the genus Gordonia. Appl. Environ. Microbiol. 69:
4971–4974.
5. Arensko¨tter, M., D. Bro¨ker, and A. Steinbu¨chel. 2004. Biology of the meta-
bolically diverse genus Gordonia. Appl. Environ. Microbiol. 70:3195–3204.
6. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A.
Smith, and K. Struhl (ed.). 1987. Current protocols in molecular biology, 1st
ed., vol. 1. John Wiley & Sons, New York, NY.
7. Banh, Q., M. Arensko¨tter, and A. Steinbu¨chel. 2005. Establishment of
7652 SCHULTE ET AL. APPL.ENVIRON.MICROBIOL.

Tn5096-based transposon mutagenesis in Gordonia polyisoprenivorans. Appl.
Environ. Microbiol. 71:5077–5084.
8. Barnard, D., and P. M. Lewis. 1988. Oxidative ageing, p. 621–673. In A. D.
Roberts (ed.), Natural rubber: science and technology, part II. Oxford Uni-
versity Press, New York, NY.
9. Barr, D. P., and S. D. Aust. 1994. Effect of superoxide and superoxide-
dismutase on lignin peroxidase-catalyzed veratryl alcohol oxidation. Arch.
Biochem. Biophys. 311:378–382.
10. Beaman, B. L., S. M. Scates, S. E. Moring, R. Deem, and H. P. Misra. 1983.
Purification and properties of a unique superoxide dismutase from Nocardia
asteroides. J. Biol. Chem. 258:91–96.
11. Beauchamp, C., and I. Fridovich. 1971. Superoxide dismutase: improved
assay and an assay applicable to acrylamide gels. Anal. Biochem. 44:276–287.
12. Birnboim, H. C., and J. Doly. 1979. A rapid alkaline extraction procedure for
screening recombinant plasmid DNA. Nucleic Acids Res. 7:1513–1523.
13. Braaz, R., P. Fischer, and D. Jendrossek. 2004. Novel type of heme-depen-
dent oxygenase catalyzes oxidative cleavage of rubber (poly-cis-1,4-iso-
prene). Appl. Environ. Microbiol. 70:7388–7395.
14. Braaz, R., W. Armbruster, and D. Jendrossek. 2005. Heme-dependent rub-
ber oxygenase RoxA of Xanthomonas sp. cleaves the carbon backbone of
poly(cis-1,4-isoprene) by a dioxygenase mechanism. Appl. Environ. Micro-
biol. 71:2473–2478.
15. Bradford, M. M. 1976. A rapid and sensitive method for the quantification of
microgram quantities of protein utilizing the principle of protein-dye bind-
ing. Anal. Biochem. 72:248–254.
16. Braunstein, M., A. M. Brown, S. Kurtz, and W. R. Jacobs, Jr. 2001. Two
nonredundant SecA homologues function in Mycobacteria. J. Bacteriol. 183:
6979–6990.
17. Braunstein, M., B. J. Espinosa, J. Chan, J. T. Belisie, and W. R. Jacobs.
2003. SecA2 functions in the secretion of superoxide dismutase A and in the
virulence of Mycobacterium tuberculosis. Mol. Microbiol. 48:453–464.
18. Bro¨ker, D., D. Dietz, M. Arensko¨tter, and A. Steinbu¨chel. 2008. The genomes
of the non-clearing-zone-forming and natural rubber-degrading species Gor-
donia polyisoprenivorans and Gordonia westfalica harbor genes expressing
Lcp activity in Streptomyces strains. Appl. Environ. Microbiol. 74:2288–2297.
19. Bullock, W. O., J. M. Fernandez, and J. M. Short. 1987. XL1-Blue: high
efficiency plasmid transforming recA Escherichia coli strain with ␤-galactosi-
dase selection. BioTechniques 5:376–378.
20. Carlioz, A., and D. Touati. 1986. Isolation of superoxide dismutase mutants
in Escherichia coli: is superoxide dismutase necessary for aerobic life?
EMBO J. 5:623–630.
21. Cundell, A. M., and A. P. Mulcock. 1974. The biodegradation of vulcanized
rubber. Dev. Ind. Microbiol. 16:88–96.
22. Dong, Y., S. Demaria, X. Sun, F. R. Santori, B. M. Jesdale, A. S. De Groot.
W. N. Rom, and Y. Bushkin. 2004. HLA-A2-restricted CD8
⫹
-cytotoxic-T-
cell responses to novel epitopes in Mycobacterium tuberculosis superoxide
dismutase, alanine dehydrogenase, and glutamine synthetase. Infect. Immun.
72:2412–2415.
23. Enoki, M., Y. Doi, and T. Iwata. 2003. Oxidative degradation of cis- and
trans-polyisoprenes and vulcanized natural rubber with enzyme-mediator
systems. Biomacromolecules 4:314–320.
24. Farr, S. B., and T. Kogoma. 1991. Oxidative stress responses in Escherichia
coli and Salmonella typhimurium. Microbiol. Rev. 55:561–585.
25. Fridovich, I. 1986. Superoxide dismutases. Adv. Enzymol. 58:61–97.
26. Fridovich, I. 1995. Superoxide radical and superoxide dismutases. Annu.
Rev. Biochem. 64:97–112.
27. Hassan, H. M., and I. Fridovich. 1978. Regulation and role of superoxide
dismutase. Biochem. Soc. Trans. 6:356–361.
28. Hein, S., H. Tran, and A. Steinbu¨chel. 1998. Synechocystis sp. PCC6803
possesses a two-component polyhydroxyalkanoic acid synthase similar to that
of anoxygenic purple sulfur bacteria. Arch. Microbiol. 170:162–170.
29. Hjelm, H., K. Hjelm, and J. Sjo¨quist. 1972. Protein A from Staphylococcus
aureus. Its isolation by affinity chromatography and its use as an immuno-
sorbent for isolation of immunoglobulins. FEBS Lett. 28:73–76.
30. Ibrahim, E. M. A., M. Arensko¨tter, H. Luftmann, and A. Steinbu¨chel. 2006.
Identification of poly(cis-1,4-isoprene) degradation intermediates during
growth of moderately thermophilic actinomycetes on rubber and cloning of
a functional lcp homologue from Nocardia farcinica strain E1. Appl. Environ.
Microbiol. 72:2275–2282.
31. Jendrossek, D., and S. Reinhardt. 2003. Sequence analysis of a gene product
synthesized by Xanthomonas sp. during growth on natural rubber latex.
FEMS Microbiol. Lett. 224:61–65.
32. Juhnke, S., N. Peitzsch, N. Hu¨bener, C. Große, and D. H. Nies. 2002. New
genes involved in chromate resistance in Ralstonia metallidurans strain
CH34. Arch. Microbiol. 179:15–25.
33. Kurihara, H., H. Wariishi, and H. Tanaka. 2002. Chemical stress-responsive
genes from the lignin-degrading fungus Phanerochaete chrysosporium ex-
posed to dibenzo-p-dioxin. FEMS Microbiol. Lett. 212:217–220.
34. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of
the head of bacteriophage T4. Nature (London) 227:680–685.
35. Linos, A., M. M. Berekaa, R. Reichelt, U. Keller, J. Schmitt, H. C. Flemming,
R. M. Kroppenstedt, and A. Steinbu¨chel. 2000. Biodegradation of cis-1,4-
polyisoprene rubbers by distinct actinomycetes: microbial strategies and de-
tailed surface analysis. Appl. Environ. Microbiol. 66:1639–1645.
36. Linos, A., and A. Steinbu¨chel. 2001. Biodegradation of natural and synthetic
rubbers, p. 321–359. In T. Koyama and A. Steinbu¨chel (ed.), Biopolymers,
vol. 2. Wiley-VCH, Weinheim, Germany.
37. Loprasert, S., P. Vattanaviboon, W. Praituan, S. Chamnongpol, and S.
Mongkolsuk. 1996. Regulation of the oxidative stress protective enzymes,
catalase and superoxide dismutase in Xanthomonas—a review. Gene 179:
33–37.
38. Martinez, A., and R. Kolter. 1997. Protection of DNA during oxidative stress
by the nonspecific DNA-binding protein Dps. J. Bacteriol. 179:5188–5194.
39. Mishra, R. N., S. L. Singla-Pareek, S. Nair, S. K. Sopory, and M. K. Reddy.
2002. Directional genome walking using PCR. BioTechniques 33:830–832.
40. Misra, H. P., and I. Fridovich. 1978. Inhibition of superoxide dismutases by
azide. Arch. Biochem. Biophys. 189:317–322.
41. Ohta, Y., I. Ishiguro, J. Naito, and R. Shinohara. 1984. Role of cytosolic
superoxide dismutase as a stimulator in anthranilamide hydroxylation by a
microsomal monooxygenase system in rat liver. J. Biochem. 96:1323–1336.
42. Polle, A. 2001. Dissecting the superoxide dismutase-ascorbate-glutathione-
pathway in chloroplasts by metabolic modeling. Computer simulations as a
step towards flux analysis. Plant Physiol. 126:445–462.
43. Porque´, P. G., A. Baldestein, and P. Reichards. 1970. The involvement of the
thioredoxin system in the reaction of methionine sulfoxide and sulfate.
J. Biol. Chem. 245:2371–2374.
44. Rose, K., and A. Steinbu¨chel. 2005. Biodegradation of natural rubber and
related compounds: recent insights into a rare and hardly understood cata-
bolic capability of microorganisms. Appl. Environ. Microbiol. 71:2803–2812.
45. Rose, K., K. B. Tenberge, and A. Steinbu¨chel. 2005. Identification and char-
acterization of genes from Streptomyces sp. strain K30 responsible for clear
zone formation on natural rubber latex and poly(cis-1,4-isoprene) rubber
degradation. Biomacromolecules 6:180–188.
46. Sambrook, J. E., F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a
laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring
Harbor, NY.
47. Sato, S., Y. Honda, M. Kuwahara, and T. Watanabe. 2003. Degradation of
vulcanized and nonvulcanized polyisoprene rubbers by lipid peroxidation
catalyzed by oxidative enzymes and transition metals. Biomacromolecules
4:321–329.
48. Schlegel, H. G., H. Kaltwasser, and G. Gottschalk. 1961. Ein Submersver-
fahren zur Kultur wasserstoffoxidierender Bakterien: Wachstumsphysiolo-
gische Untersuchungen. Arch. Mikrobiol. 38:209–222.
49. Scott, M. D., S. R. Meshnick, and J. W. Eaton. 1987. Superoxide dismutase-
rich bacteria. J. Biol. Chem. 262:3640–3645.
50. Snapper, S. B., R. E. Melton, S. Mustafa, T. Kieser, and W. R. Jacobs, Jr.
1990. Isolation and characterization of efficient plasmid transformation mu-
tants of Mycobacterium smegmatis. Mol. Microbiol. 4:1911–1919.
51. Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin, and D. G.
Higgins. 1997. The CLUSTAL_X Windows interface: flexible strategies for
multiple sequence alignment aided by quality analysis tools. Nucleic Acids
Res. 25:4876–4882.
52. Towbin, H., T. Staehelin, and J. Gordon. 1979. Electrophoretic transfer of
proteins from polyacrylamide gels to nitrocellulose sheets: procedure and
some applications. Proc. Natl. Acad. Sci. USA 76:4350–4354.
53. Tsuchii, A., T. Suzuki, and K. Takeda. 1985. Microbial degradation of nat-
ural rubber vulcanizates. Appl. Environ. Microbiol. 50:965–970.
54. Tullius, M. V., G. Harth, and M. A. Horwitz. 2001. High extracellular levels
of Mycobacterium tuberculosis glutamine synthetase and superoxide dis-
mutase in actively growing cultures are due to high expression and extracel-
lular stability rather than to a protein-specific export mechanism. Infect.
Immun. 69:6348–6363.
55. Warneke, S., M. Arensko¨tter, K. B. Tenberge, and A. Steinbu¨chel. 2007.
Bacterial degradation of poly(trans-1,4-isoprene) (gutta percha). Microbiol-
ogy 153:347–356.
56. Weber, K., and M. Osborn. 1969. The reliability of molecular weight deter-
minations by sodium dodecyl sulfate-polyacrylamide gel electrophoresis.
J. Biol. Chem. 244:4406–4412.
57. Yang, S., R. S. Wu, and R. Y. Kong. 2002. Biodegradation and enzymatic
responses in the marine diatom Skeletonema costatum upon exposure to
2,4-dichlorophenol. Aquat. Toxicol. 59:191–200.
58. Yikmis, M., M. Arensko¨tter, K. Rose, N. Lange, H. Wernsmann, L. Wiefel,
and A. Steinbu¨chel. 2008. Secretion and transcriptional regulation of the
latex clearing protein Lcp by the rubber-degrading bacterium Streptomyces
sp. strain K30. Appl. Environ. Microbiol. 74:5373–5382.
VOL. 74, 2008 SodA INVOLVEMENT IN POLY(CIS-1,4-ISOPRENE) DEGRADATION 7653