Characterization and Distribution of Mating Type Genes in the Dothistroma Needle Blight Pathogens

Abstract

ABSTRACT Dothistroma septosporum and D. pini are the two causal agents of Dothistroma needle blight of Pinus spp. in natural forests and plantations. Degenerate primers amplified portions of mating type genes (MAT1-1-1 and MAT1-2) and chromosome walking was applied to obtain the full-length genes in both species. The mating-type-specific primers designed in this study could distinguish between the morphologically similar D. pini and D. septosporum and between the different mating types of these species. Screening of isolates from global collections of D. septosporum showed that only MAT2 isolates are present in Australian and New Zealand collections, where only the asexual form of the fungus has been found. In contrast, both mating types of D. septosporum were present in collections from Canada and Europe, where the sexual state is known. Intriguingly, collections from South Africa and the United Kingdom, where the sexual state of the fungus is unknown, included both mating types. In D. pini, for which no teleomorph is known, both mating types were present in collections from the United States. These results provided new insights into the biology and global distribution of two of the world's most important pine pathogens and should facilitate management of the diseases caused by these fungi.

Full text

Vol. 97, No. 7, 2007 825
Mycology
Characterization and Distribution of Mating Type Genes
in the Dothistroma Needle Blight Pathogens
Marizeth Groenewald, Irene Barnes, Rosie E. Bradshaw, Anna V. Brown, Angie Dale, Johannes Z. Groenewald,
Kathy J. Lewis, Brenda D. Wingfield, Michael J. Wingfield, and Pedro W. Crous
First, sixth, and tenth authors: CBS Fungal Biodiversity Centre, Uppsalalaan 8, 3584 CT Utrecht, Netherlands; second, eighth, and ninth
authors: Forestry and Agricultural Biotechnology Institute (FABI), Department of Genetics, University of Pretoria, Pretoria 0002, South
Africa; third author: Institute of Molecular BioSciences, Massey University, Palmerston North, New Zealand; fourth author: Forest Re-
search, Alice Holt Lodge, Wrecclesham, Farnham, Surrey, GU10 4LH, United Kingdom; and fifth and seventh authors: University of
Northern British Columbia, 3333 University Way, Prince George, BC V2N 4Z9, Canada.
Accepted for publication 25 January 2007.
ABSTRACT
Groenewald, M., Barnes, I., Bradshaw, R. E., Brown A. V., Dale, A.,
Groenewald, J. Z., Lewis, K. J., Wingfield, B. D., Wingfield, M. J., and
Crous, P. W. 2007. Characterization and distribution of mating type genes
in the Dothistroma needle blight pathogens. Phytopathology 97:825-834.
Dothistroma septosporum and D. pini are the two causal agents of Do-
thistroma needle blight of Pinus spp. in natural forests and plantations.
Degenerate primers amplified portions of mating type genes (MAT1-1-1
and MAT1-2) and chromosome walking was applied to obtain the full-
length genes in both species. The mating-type-specific primers designed
in this study could distinguish between the morphologically similar D.
pini and D. septosporum and between the different mating types of these
species. Screening of isolates from global collections of D. septosporum
showed that only MAT2 isolates are present in Australian and New Zea-
land collections, where only the asexual form of the fungus has been
found. In contrast, both mating types of D. septosporum were present in
collections from Canada and Europe, where the sexual state is known.
Intriguingly, collections from South Africa and the United Kingdom,
where the sexual state of the fungus is unknown, included both mating
types. In D. pini, for which no teleomorph is known, both mating types
were present in collections from the United States. These results provided
new insights into the biology and global distribution of two of the world’s
most important pine pathogens and should facilitate management of the
diseases caused by these fungi.
Additional keywords: ascomycetes, heterothallic, Mycosphaerella, sexual
reproduction.
Dothistroma needle blight, also known as red band needle
blight, is one of the most important diseases of Pinus spp., both in
natural forest ecosystems and particularly in plantations of non-
native pines (9,19,20,27). The disease owes its international
notoriety to the fact that it has been one of the most important con-
straints to the development of plantation forestry in many countries
of Africa as well as in New Zealand, Australia, Chile, and other
South American countries (19,20,27). The disease is particularly
severe on Pinus radiata D. Don. This species is highly desirable
for its rapid growth and exceptional timber and, consequently, it
was one of the first nonnative tree species established in inten-
sively managed plantations in the tropics and Southern Hemisphere.
Outbreaks of Dothistroma needle blight on P. radiata led to
devastating losses and resulted in the abandonment of P. radiata
from plantation forestry in many countries (11,31,51).
The main causal agent of Dothistroma needle blight has been a
matter of considerable taxonomic confusion. Thus, in different
parts of the world, the disease has been attributed to either a
single pathogen, different species of a pathogen, or varieties of a
species. This also has differed depending on whether the pathogen
was considered introduced or native in areas where the disease
has been studied. In a recent study based on DNA sequence com-
parisons, two distinct phylogenetic lineages for Dothistroma
isolates were identified (2). These clearly separated Dothistroma
septosporum, which has a worldwide distribution, and D. pini,
until recently found only in the north-central United States. This
study also showed that the disease which devastated plantations of
P. radiata in the Southern Hemisphere is caused by D. septo-
sporum. Recently, D. pini has been found infecting P. palassiana
D. Don. in the Ukraine (I. Barnes, unpublished data) and it
clearly has a distribution much wider than was believed at the
time of the study of Barnes et al. (2).
Dothistroma needle blight, now known to have been caused by
D. septosporum, resulted in huge damage to P. radiata plantations
in the Southern Hemisphere in the 1950s and 1960s (9,19,20,27).
Consequently, considerable research was conducted on the dis-
ease and great efforts were made to minimize its impact (8,19,
20,41,46). These included selection of alternative species, tree
breeding, agricultural practices, and the first examples of aerial
applications of chemical fungicides in forest plantations (19).
Although the disease has continued to be important, it generally is
considered to be under reasonable control. There has, however,
been a recent resurgence of the disease in various Northern Hemi-
sphere countries and this has raised concern that a new wave of
losses might occur elsewhere in the world (5,53).
Almost nothing is known regarding the genetic diversity among
isolates of D. septosporum and D. pini. D. septosporum first was
identified in New Zealand in 1964 (21). A study by Hirst et al.
(26) applied random amplified polymorphic DNA (RAPD) mark-
ers to a population of D. septosporum (previously described as D.
pini) from New Zealand and the results showed no genetic varia-
tion. These results support the hypothesis that it is an introduced
pathogen that has been spreading asexually ever since its intro-
duction into that country.
Corresponding author: M. Groenewald;
E-mail address: m.groenewald@cbs.knaw.nl
doi:10.1094/ PHYTO-97-7-0825
© 2007 The American Phytopathological Society

826 PHYTO PAT HO LOGY
The sexual state of D. septosporum is a species of Mycosphae-
rella known as Mycosphaerella pini Rostr. (17). In most countries
of the Southern Hemisphere where D. septosporum has long been
an important forest pathogen, only the anamorph has been re-
ported (2,5,14; M. J. Wingfield, unpublished data). In contrast, no
sexual state has ever been reported for D. pini. The absence or
rarity of a sexual state for either of these fungi could be the result
of selection pressure and a reduced need for sexual reproduction
(14). Likewise, lower frequency and limited distribution of the
teleomorph compared with the anamorph suggests that the pri-
mary method of dispersal of the fungus could be an asexual cycle.
Here, conidia rather than ascospores would represent the inocu-
lum of primary epidemiological importance (10,28).
Mating type genes play an important part in the biology and
evolution of fungal species. Thus, knowledge of these genes can
provide insight into the potential prevalence of sexual reproduc-
tion in different species. Some heterothallic Pyrenomycetes and
Discomycetes can contain up to four genes at the mating type 1
idiomorph (MAT1-1) of the MAT locus (40,43,44,55). These
include the MAT1-1-1 encoding an α domain protein, the MAT1-
1-2 encoding an amphipathic α helix protein, the MAT1-1-3 gene
encoding a high mobility group (HMG) domain protein, and the
MAT1-1-4 gene encoding a metallothionein protein. Only one
gene has been characterized for the mating type 2 idiomorph
(MAT1-2) and it encodes a regulatory protein with an HMG
domain. The DNA sequences of the idiomorphs, located at the
MAT locus of individuals of two different mating types, are
unrelated and, therefore, cannot be called alleles; however, these
sequences are flanked by conserved regions (32). The formal no-
menclature that is proposed for mating type genes of heterothallic
ascomycetes is used here for the MAT1-1-1 and, because only a
single MAT1-2 gene has been identified for filamentous ascomy-
cetes, this gene is referred to as MAT1-2 (49).
DNA and amino acid sequences of the MAT1-1-1 and MAT1-2
genes in fungi show no obvious similarities, although the mating
type locus has common flanking regions (48). Except for the
HMG and α domains, the similarity of homologous mating type
genes usually is very low between different species (47). The
direct target genes of the mating type proteins have not yet been
described, although there is evidence for the control of some
genes, such as pheromone genes (4). Mating type genes have been
described from various sexual and presumably asexual fungi that
are close relatives of the genus Dothistroma (Mycosphaerel-
laceae). Detailed analyses have been done on the distribution of
the mating types of the sexually reproducing M. graminicola
(50,56) and the presumably asexual species Septoria passerinii
(23), Cercospora beticola, C. zeae-maydis, and C. zeina (25).
Equal distribution of the mating types was found in most of the
populations from these five species sampled from different
geographical scales, indicating that sexual stages probably exist
for the latter four apparently asexual species.
D. septosporum first was described from Idaho (United States)
but now is seen in many parts of the world (2). In most of the
areas where this species has been introduced and causes serious
disease, only the asexual state of the fungus is ever seen. This
raises the interesting question as to whether this could be attributed
to the introduction of only one mating type into these new environ-
ments. Thus, the aims of this study were to characterize the mat-
ing type gene or genes of the causal agents of Dothistroma needle
blight and to ascertain which mating types are present in the
different countries where diseases caused by these fungi occur. To
achieve this objective, the full-length MAT1-1-1 and MAT1-2
genes of D. septosporum and D. pini were isolated and sequenced
using polymerase chain reaction (PCR)-based techniques. This
made it possible to develop a multiplex PCR method for the rapid
screening of MAT1-1-1 and MAT1-2 in isolates of the pathogens.
A global collection of isolates subsequently was screened to de-
termine which mating types are present in these collections.
MATERIALS AND METHODS
Fungal isolates. In all, 230 Dothistroma isolates obtained from
various locations in 15 countries were chosen to represent a
global distribution of Dothistroma spp. (Table 1). Countries for
which more than one isolate was screened included Austria (n =
10), Canada (n = 106), Chile (n = 10), New Zealand (n = 38),
Poland (n = 11), South Africa (n = 11), Ukraine (n = 4), the
United Kingdom (n = 10), and the United States (n = 17). Isolates
were obtained from different culture collections and standard
protocols were used to isolate the genomic DNA.
The initial screening of the mating type genes was undertaken
for D. septosporum using two isolates. These included CBS
116489 obtained from P. radiata in Tzaneen, South Africa and
American Type Culture Collection (ATCC) MYA-605 obtained
from P. radiata in Rotorua, New Zealand. For D. pini, four iso-
lates were used: CBS 116485, obtained from P. nigra in Crystal
Township, MI; CBS 116487, obtained from P. nigra in Evergreen
Township, MI; CBS 116483, obtained from River Township, MI;
and CBS 117609, obtained from P. palassiana in Tsyurupinsk,
Ukraine. The identities of the six isolates used for the screening
of the mating types previously had been confirmed using
comparisons of DNA sequence data for the internal transcribed
spacer (ITS) regions of the ribosomal DNA (2; J. Z. Groenewald,
unpublished data).
Isolation and characterization of MAT1-1-1 of Dothistroma
spp. The MAT1-1-1-specific degenerate primers (MgMfSpMat1-
1f1 and MgMfSpMat1-1r2) (Table 2), designed by Groenewald et
al. (25), were used to screen and amplify a partial region of the
MAT1-1-1 genes of the Dothistroma isolates.
The PCR mixtures and amplification reactions were the same
as described by Groenewald et al. (25) for the amplification of the
partial MAT1-1-1 in Cercospora spp. The PCR products obtained
were separated by electrophoresis at 80 V for 1 h on a 1%
(wt/vol) agarose gel containing ethidium bromide at 0.1 µg/ml in
1× Tris-acetate-EDTA buffer (0.4 M Tris, 0.05 M sodium acetate,
and 0.01 M EDTA, pH 7.85) and visualized under UV light. Am-
plicons were sequenced in both directions using the PCR primers
and a DYEnamic ET Terminator Cycle Sequencing kit (Amer-
sham Biosciences, Roosendaal, Netherlands) following the
manufacturer’s recommendations. The products were analyzed on
an ABI Prism 3730 DNA Sequencer (Applied Biosystems, Foster
City, CA). A consensus sequence was computed from the forward
and reverse sequences with SeqMan from the Lasergene package
(DNA-STAR, Madison, WI).
Internal primers were designed in the partially sequenced
MAT1-1-1 genes for each of the species (CBS 116489 for D.
septosporum and CBS 116487 for D. pini). In order to obtain the
full-length genes, these internal primers were used together with
the appropriate primers from the DNA walking speedup kit
(Seegene Inc., Rockville, MD) to determine additional sequences
upstream and downstream of the partial MAT1-1-1 sequences.
The Blastx algorithm (1) was used to compare the sequences
obtained from the two Dothistroma spp. with protein sequences of
other fungi present in the National Center for Biotechnology
Information (NCBI) nonredundant protein database. The geneid
web server (v1.2; Research Unit on Biomedical Informatics of
IMIM, Barcelona, Spain) was used to predict the gene and intron
or exon boundaries using the genetic code of Neurospora crassa.
The conversion of DNA sequences to putative amino acid se-
quences was done using the translation tool of the proteomics
server ExPASy (18). The percentage of identities between the
predicted MAT1-1-1 gene sequences for the Dothistroma spp. was
calculated using the alignment tool of ALIGN (37).
Isolation and characterization of MAT1-2 of Dothistroma
spp. The MAT1-2-specific degenerate primers (MgMfSpMat1-2f2
and MgMfSpMat1-2fr1) (Table 2), designed by Groenewald et al.
(25), were used to screen isolates of D. septosporum and D. pini

Vol. 97, No. 7, 2007 827
TABLE 1. Origins of the Dothistroma septosporum and D. pini strains used during this study and the distribution of their mating types
Country, area, site Collector Species Number of strains MAT1-1-1 MAT1-2
Australia
A.C.T. Canberra K. Old D. septosporum 10 0 10
Austria
Thenneberg T. Kirisits D. septosporum 10 6 4
Brazil
São Paulo T. Namekata D. septosporum 1 0 1
Canada
Northwest British Columbia (BC)
Brown Bear Road K. Lewis & A. Dale D. septosporum 10 5 5
Bell Irving River K. Lewis & A. Dale D. septosporum 1 0 1
Bulkley Canyon K. Lewis & A. Dale D. septosporum 9 5 4
Evelyn Pasture K. Lewis & A. Dale D. septosporum 1 0 1
Jonas Creek K. Lewis & A. Dale D. septosporum 2 0 2
Kinskutch Road K. Lewis & A. Dale D. septosporum 8 7 1
Kuldo Creek K. Lewis & A. Dale D. septosporum 7 2 5
Kisgegas Canyon K. Lewis & A. Dale D. septosporum 5 2 3
Squingula River Mine K. Lewis & A. Dale D. septosporum 8 1 7
Mosque River K. Lewis & A. Dale D. septosporum 6 1 5
Mitten Road K. Lewis & A. Dale D. septosporum 7 4 3
Nangeese Road K. Lewis & A. Dale D. septosporum 8 4 4
North Kuldo Road K. Lewis & A. Dale D. septosporum 4 1 3
Sanyam River K. Lewis & A. Dale D. septosporum 1 0 1
Nash Y K. Lewis & A. Dale D. septosporum 9 7 2
Orendo K. Lewis & A. Dale D. septosporum 7 6 1
Motaze Lake & Squingula River K. Lewis & A. Dale D. septosporum 8 6 2
Sunday Lake K. Lewis & A. Dale D. septosporum 4 1 3
Goldstream River, BC D. Morrison D. septosporum 1 0 1
Chile
Valdivia M. J. Wingfield D. septosporum 10 0 10
France
Meurthe-et-Moselle M. Morelet D. septosporum 1 0 1
Germany
Bavarian Alps L. Pehl D. septosporum 1 0 1
Guatemala
Sierra de Chuacús Unknown D. septosporum 1 0 1
New Zealand
Bay of Plenty M. A. Dick D. septosporum 1 0 1
Golden Downs sites 1/2/3 P. Hirst D. septosporum 4 0 4
Kaingora Forest M. J. Wingfield D. septosporum 10 0 10
Kaingora sites 1/2/3 P. Hirst D. septosporum 11 0 11
Kinleith P. Hirst D. septosporum 5 0 5
Mt. Maunganui K. Dobbie D. septosporum 1 0 1
Rotorua M. E. Buchanan D. septosporum 2 0 2
Tongariro J. W. Gilmour D. septosporum 1 0 1
West Coast South Island B. Doherty D. septosporum 1 0 1
Poland
Miechow Forest, Cracow T. Kowalski D. septosporum 11 3 8
Slovakia E. Foffova D. septosporum 1 1 0
South Africa
Hogsback J. Roux D. septosporum 10 3 7
Tzaneen I. Barnes D. septosporum 1 1 0
Ukraine
Tsyurupinsk A. C. Usichenko D. pini 4 4 0
United Kingdom
West Midlands A. Coggin D. septosporum 1 0 1
South East England A. V. Brown D. septosporum 1 0 1
Forest of Dean R. Beasley D. septosporum 1 1 0
New Forest A. V. Brown D. septosporum 7 1 6
United States
Bandon, Oregon S. Cooley D. septosporum 1 0 1
Michigan
Crystal Township G. Adams D. pini 10 4 6
Evergreen Township G. Adams D. pini 1 1 0
River Township G. Adams D. pini 1 0 1
Central Minnesota T. Nicholls D. pini 1 1 0
Lincoln, Nebraska G. Peterson D. pini 3 2 1
Total … … 230 80 150

828 PHYTO PAT HO LOGY
to obtain a partial region of the MAT1-2 genes. The same PCR
conditions described above were used to amplify the partial
MAT1-2 regions. Twelve internal primers were designed in the
partially sequenced MAT1-2 sequences for both species (ATCC
MYA-605 for D. septosporum and CBS 116485 for D. pini) and
the chromosome walking method also was used to obtain the full-
length MAT1-2 genes. The same procedure and programs
described for the characterization and analyses of the MAT1-1-1
sequences were used to characterize and analyze the Dothistroma
MAT1-2 sequences.
Development and screening of D. pini and D. septosporum
mating-type-specific primers. Dothistroma MAT1-1-1-specific
primers (Table 2) were designed from the aligned MAT1-1-1 se-
quences of D. pini and D. septosporum (GenBank accession nos.
DQ915449 and DQ915450, respectively). The forward primers
were designed to be specific for D. septosporum (DseptoMat1f)
or D. pini (DpiniMat1f2) and, therefore, are both species and mat-
ing type specific. The reverse primer (DotMat1r) was designed
from homologous regions within the MAT1-1-1 genes and, there-
fore, is only mating type specific.
Dothistroma MAT1-2-specific primers (Table 2) were designed
from the aligned MAT1-2 sequences of D. pini and D. septo-
sporum (GenBank accession nos. DQ915451 and DQ915452,
respectively). The two forward primers were designed in regions
of the genes that were variable between the two species. Dsepto-
Mat2f was designed to be specific for D. septosporum and Dpini-
Mat2f for D. pini, and both, therefore, are species and mating type
specific. The reverse primer (DotMat2r) was designed from
homologous regions within both the MAT1-2 genes and, thus, is
only mating type specific.
Multiplex PCR was used to screen for the MAT1-1-1 or the
MAT1-2 of D. pini and D. septosporum in two separate reactions.
The reaction mixtures had a total volume of 12.5 µl and contained
0.7 µl of diluted genomic DNA, 1× PCR buffer (Bioline,
Randolph, MA), 48 µM each of the dNTPs, 4 pmol of each
primer, 1 mM MgCl2, and 0.7 units of Taq polymerase (Bioline,
Randolph, MA). The amplification reactions were done on a
GeneAmp PCR System 9600 (Applied Biosystems). The initial
denaturation step was done at 94°C for 5 min, followed by 40
cycles of 94°C (20 s), 65°C (20 s), and 72°C (40 s). A final
elongation step at 72°C (5 min) was included in the run. The re-
sulting PCR products were visualized as described above.
Phylogenetic analyses. The nucleotide sequences of the α do-
main (MAT1-1-1) and HMG domain (MAT1-2) of D. septosporum
and D. pini determined in this study and additional mating type
sequences for other species representing different fungal orders
downloaded from NCBI’s GenBank database were used for
phylogenetic analyses. These sequences were analyzed using the
mating type gene sequences of Magnaporthe grisea (GenBank
accession nos. AB080672 and AB080673, respectively) as the
outgroup. All phylogenetic analyses were done using Phyloge-
netic Analysis Using Parsimony (PAUP) v4.0b 10 (Swofford, D.
L. 2003. Sinauer Associates, Sunderland, MA). Maximum parsi-
mony analyses were conducted as described by Groenewald et al.
(24). All sequences generated were deposited in GenBank, and
the alignments and trees were deposited in TreeBASE (TreeBASE
accession no. SN3047).
RESULTS
Isolation and characterization of MAT1-1-1 in Dothistroma
spp. The degenerate primers MgMfSpMAT1-1f1 and
MgMfSpMAT1-1r2 amplified a fragment of 914 bp for three of
the six Dothistroma isolates tested (Fig. 1). The fragments ob-
tained from strains CBS 116489, CBS 117609, and CBS 116487
were sequenced. The translated sequence of the fragment
obtained from strain CBS 116489 (D. septosporum) showed 39
and 46% identity to a 229- and 63-amino-acid (aa) region of the
M. graminicola MAT1 protein and 32% identity to a 213-aa
region of the S. passerinii MAT1 protein using Blastx on the
GenBank database. This confirmed that the 914-bp fragment is
part of the MAT1-1-1 gene of D. septosporum.
Sequences for the fragments obtained from the D. pini strains
(CBS 117609 and CBS 116487) showed 100% identity to each
other in this region. The translated sequences showed 39% iden-
tity to a 226-aa (E = 2 × 10–30) and 37% identity to a 78-aa region
(E = 2 × 10–30) of the M. graminicola mating type 1-1 protein
(GenBank accession no. AAL30838). It also showed 32% identity
to a 218-aa region (E = 5 × 10–18) of the S. passerinii MAT-1 pro-
tein (GenBank accession no. AAO49357). This confirmed that the
914-bp fragment is part of the MAT1-1-1 gene of D. pini.
Four chromosome walking steps were used to obtain the full-
length MAT1-1-1 gene sequences for D septosporum and D. pini.
The geneid software predicted that the MAT1-1-1 genes of both
species contained four exons. The predicted length of the genes
and the exon and intron positions are illustrated in Figure 2. Al-
though the number of nucleotide and amino acid residues was the
same for the MAT1-1-1 of D. septosporum and D. pini, an identity
of 94.1 and 94.3% was found between the 1,311-nucleotide and
the 387-aa residues, respectively. All introns of the MAT1-1-1
from both species contained a perfect lariat sequence (RCTRAC),
except for the second intron of the MAT1-1-1 of D. septosporum.
When this intron is included in the coding region, an early stop
codon is introduced in the reading frame, indicating that this is a
true intron. The positions of the three predicted introns in the
Dothistroma spp. studied correlate with those found for Cerco-
spora spp. (25). The number of predicted introns (two) in the
conserved α domain of the Dothistroma spp. correlated with the
number predicted for the same region in M. graminicola (50) and
S. passerinii (23).
Isolation and characterization of MAT1-2 of Dothistroma
spp. The degenerate primers MgMfSpMAT1-2f2 and
MgMfSpMAT1-2r1 amplified a fragment of 332 bp for the
Dothistroma isolates that did not amplify the 914-bp fragment
using the MAT1-1-1 degenerate primers (Fig. 1). An extra 180-bp
fragment also was obtained from the two D. septosporum strains
and an extra 280-bp fragment from the four D. pini strains. The
332-bp fragment obtained from strain ATCC MYA-605 (D. septo-
TABLE 2. Primers used during this studya
Primer 5′–3′ Description
MgMfSpMat1-1f1 CATTNGCNCATCCCTTTG MAT1-1-1-specific degenerate primer
MgMfSpMat1-1r2 GGCTTNGANACCATGGTGAG MAT1-1-1-specific degenerate primer
MgMfSpMat1-2f2 CAAAGAANGCNTTCNTGATCT MAT1-2-specific degenerate primer
MgMfSpMat1-2r1 TTCTTCTCNGATGGCTTGC MAT1-2-specific degenerate primer
DseptoMat1f CGCAGTAAGTGATGCCCTGAC Dothistroma septosporum MAT1-1-1-specific primer
DpiniMat1f2 AGTAAGCGACGCGCTCCCATG D. pini MAT1-1-1MAT1-specific primer
DotMat1r TTGCCTGACCGGCTGCTGGTG Dothistroma MAT1-1-1-specific primer
DseptoMat2f GTGAGTGAACGCCGCACATGG D. septosporum MAT1-2-specific primer
DpiniMat2f GTAAGTGATCGTTGAACATGC D. pini MAT1-2-specific primer
DotMat2r CTGGTCGTGAAGTCCATCGTC Dothistroma MAT1-2-specific primer
a Nucleotides specific to the given Dothistroma sp. are underlined.

Vol. 97, No. 7, 2007 829
Fig. 2. Diagrammatic representation of the full-length MAT1-1-1 and MAT1-2 genes of Dothistroma septosporum and D. pini. The predicted sites of exons (white
bars), and introns (black bars) are shown, and their locations (nucleotide position) are indicated. The areas amplified by the MgMfSpMAT1-1 and MgMfSpMAT1-
2 primer sets as well as the mating-type-specific primers for each species are indicated.
Fig. 1. Amplification products obtained from Dothistroma septosporum (in bold face) and D. pini isolates containing the partial MAT1-1-1 (914-bp) and MAT1-2
(332-bp) genes using the degenerate primer pairs MgMfSpMAT1-1 and MgMfSpMAT1-2, respectively.

830 PHYTO PAT HO LOGY
sporum) was sequenced, and the translated sequence showed 55%
identity to a 65-aa (E = 1 × 10–19) and 70% identity to a 27-aa
region (E = 1 × 10–19) of the M. graminicola mating type 1-2
protein (GenBank accession no. AAL30836) as well as 50%
identity to a 65-aa region (E = 7 × 10–17) of the S. passerinii MAT-
2 protein (GenBank accession no. AAO49358) using Blastx on
the GenBank database. This confirmed that the 332-bp fragment
is part of the MAT1-2 gene of D. septosporum. The 332-bp trans-
lated sequences for the fragments obtained from the two D. pini
strains (CBS 116483 and CBS 116485) showed 52% identity to a
65-aa (E = 1 × 10–19) and 68% identity to a 29-aa region (E = 1 ×
10–19) of the M. graminicola mating type 1-2 protein (GenBank
accession no. AAL30836) as well as a 47% (E = 7 × 10–17) and
68% identity (E = 7 × 10–17) to the same amino acid regions of the
S. passerinii MAT-2 protein (GenBank accession no. AAO49358).
This confirmed that the 332-bp fragment is part of the MAT1-2
gene of D. pini. Sequences for the 180-bp (D. septosporum) and
280-bp (D. pini) fragments showed no homology to protein
sequences available in GenBank.
For both of the species, four chromosome walking steps were
used to obtain the full-length MAT1-2 gene sequences. The geneid
software predicted that the MAT1-2 sequences of both species
contain three exons. The predicted length of the genes, as well as
exon and intron positions, is illustrated in Figure 2. Although the
number of nucleotide and amino acid residues was the same for
the MAT1-2 of the two Dothistroma spp., an identity of 94.4 and
92.7% was found between the 1,012-nucleotide and the 302-aa
residues, respectively. All the introns found for both species con-
tained a perfect lariat sequence. The number of predicted introns
(two) of the Dothistroma spp. studied correlates with the number
predicted for Cercospora spp. (25), but the specific locations of
these introns within the gene differed. Only one predicted intron
was found in the HMG domain of species of Cercospora (25),
M. graminicola (51), and S. passerinii (23), whereas two pre-
dicted introns were found in the same region of the Dothistroma
spp. studied.
Screening with D. pini and D. septosporum mating-type-
specific primers. In the D. pini MAT1 isolates, DpiniMat1f2 and
DotMat1r amplified an 820-bp fragment and, in the D. pini MAT2
isolates, DpiniMat2f and DotMat2r amplified a 480-bp fragment
(Fig. 3). Each isolate tested showed either the 820- or 480-bp
fragment of the MAT1-1-1 or MAT1-2 genes, respectively. None
of the isolates contained both fragments. The D. pini mating-type-
specific primers did not amplify the MAT1-1-1 and MAT1-2 frag-
ments in any of the D. septosporum isolates (Fig. 3). The majority
of the D. pini isolates were from areas in the United States where
both mating types are known to exist. Eight isolates of each
mating type were found for these D. pini isolates, whereas only
MAT1 isolates were found for the D. pini collection from the
Ukraine (Table 1). In the D. septosporum MAT1 isolates, Dsepto-
Mat1f2 and DotMat1r amplified an 820-bp fragment; in the
D. septosporum MAT2 isolates, DseptoMat2f and DotMat2r
amplified a 480-bp fragment (Fig. 3). Each isolate tested showed
either the 820- or 480-bp fragment of the MAT1-1-1 or MAT1-2
genes, respectively. None of the isolates amplified both fragments.
The D. septosporum mating-type-specific primers did not am-
plify the MAT1-1-1 and MAT1-2 fragments of the D. pini isolates
(Fig. 3). In all, 20 D. pini and 210 D. septosporum isolates (Table
1) were screened with the two mating-type-specific primer sets to
determine the mating type and to confirm the identity of each
isolate. All D. septosporum isolates obtained from Chile,
Australia, and New Zealand contained only the MAT1-2. In con-
trast, isolates representing both mating types were present in the
Austria, Canada, Poland, South Africa, and United Kingdom
collections. Only one isolate was available each from Germany,
Brazil, France, Guatemala, Slovakia, and the United States. All of
these isolates contained the MAT1-2 gene, except for the isolate
from Slovakia that contained MAT1-1-1.
Phylogenetic analyses. The alignment of partial MAT1-1-1
nucleotide sequences (α domain) contained 21 strains, including
M. grisea as the outgroup, and had a total length of 174 charac-
ters. Of the 174 characters, 23 were constant, 15 were variable
and uninformative, and 136 were parsimony informative. The
alignment of partial MAT1-2 nucleotide sequences (HMG do-
main) contained 21 strains, including M. grisea as outgroup, and
had a total length of 253 characters. Of the 249 characters, 37
were constant, 13 were variable and uninformative, and 199 were
parsimony informative. Two equally parsimonious trees were
obtained from each of the MAT1-1 alignments (Fig. 4A; tree
length of 638 steps; CI = 0.498, RI = 0.649, RC = 0.324) and
from the MAT1-2 alignment (Fig. 4B; tree length of 886 steps;
CI = 0.512, RI = 0.659, RC = 0.338).
The topology of the phylogenetic trees using the α domain
(Fig. 4A) and HMG domain (Fig. 4B) sequences were similar.
Fig. 3. Dothistroma septosporum (bold face) and D. pini isolates screened using the Dsepto/Dpini/DotMat1 primer set (820-bp fragment) and the same
Dothistroma isolates screened with the Dsepto/Dpini/DotMat2 primer set (480-bp fragment).

Vol. 97, No. 7, 2007 831
The Capnodiales, Hypocreales, and Pleosporales clades showed
high bootstrap support (92 to 97%) in both trees. The phyloge-
netic analysis using the DNA sequences in the HMG-box and α
domain showed that D. pini and D. septosporum, respectively, are
phylogenetically closely related to Cercospora spp., M. gramini-
cola, and S. passerinii as illustrated by the 92% (MAT1-1-1) and
97% (MAT1-2) bootstrap support values.
DISCUSSION
This study represents the first attempt to ascertain which
mating types are present in the different countries where diseases
caused by D. septosporum and D. pini occur. In this regard,
emphasis is on D. septosporum, because it has been introduced
into numerous countries, where it has caused very damaging dis-
ease problems. Thus, the degenerate primer sets MgMfSpMAT1-1
and MgMfSpMAT1-2 (25) were used successfully to amplify por-
tions of the mating type genes of D. septosporum and D. pini.
This made it possible to characterize the full-length MAT1-1-1 or
MAT1-2 genes of both species.
The MAT1-1-1 and MAT1-2 genes characterized for D. septo-
sporum and D. pini in this study contained areas that correspond
to a putative α domain and an HMG domain also described for
the MAT1-1-1 and MAT1-2 of other ascomycetes. The two puta-
tive introns in the α domains of the Dothistroma MAT1-1-1 also
have been found in corresponding areas in M. graminicola (50),
S. passerinii (23), and several Cercospora spp. (25). However, the
third predicted intron in the downstream area flanking the α
domain of the MAT1-1-1 of both Dothistroma spp. is present only
in the Cercospora sp., and not in M. graminicola or S. passerinii.
The number of introns found in the HMG domain of the MAT1-2
in both Dothistroma spp. differed from that of closely related spe-
cies. The first predicted intron also is present in M. graminicola
(50), S. passerinii (23), and Cercospora spp. (25). In contrast, the
second predicted intron is present only in the MAT1-2 of the Do-
thistroma spp., and not in any other members of the My-
cosphaerellaceae thus far studied. These data indicate that clear
differences can be found even within the conserved regions of the
corresponding genes in different Mycosphaerella spp.
The predicted length of the encoded proteins among different
MAT1-1-1 and MAT1-2 genes of ascomycetes varies greatly
(23,25,40). In most species, the MAT1 protein is much larger than
the MAT2. Results of this study have shown that this also is the
case for the Dothistroma spp., where 387 aa were found for
MAT1 and 302 aa for MAT2. Expression studies have not been
done on the mating type genes of any of the above-mentioned
members of the Mycosphaerellaceae. Additional studies at the
mRNA and protein levels would be necessary to confirm the exact
length of the coding regions and the intron and exon boundaries
for the mating type genes of the Dothistroma spp.
Results of this study showed substantial differences between
the nucleotide as well as amino acid sequences of the correspond-
ing mating type genes and proteins of D. septosporum and
D. pini. Using nucleotide sequences for phylogenetic inference in
these fungi is consistent with previous studies where conserved
domains within the mating type genes have been used to study the
phylogenetic relationships among different fungal species and
families (12,25,34,35,52). Differences in mating type sequences
Fig. 4. One of two equally parsimonious trees obtained from each of the A, MAT1-1-1 sequence alignment rooted to Magnaporthe grisea (AB080672) and B,
MAT1-2 sequence alignment rooted to M. grisea (AB080673). In both trees, bootstrap support values from 1,000 replicates are shown at the nodes, whereas
thickened lines indicate strict consensus branches.

832 PHYTO PAT HO LOGY
for D. septosporum and D. pini show that these species are dis-
tinct genetic entities and provides strong support for the results of
Barnes et al. (2), who provided the first DNA-based evidence that
the species are distinct.
Based on morphological characteristics, Barr (3) attempted to
reclassify Mycosphaerella pini in a new genus outside of My-
cosphaerella. However, molecular phylogenetic analyses have
shown that Mycosphaerella is the most appropriate designation
for this fungus classification (2,22). Phylogenetic analyses, based
on the sequences of the HMG and α domains, also confirm that
Dothistroma spp. are members of the Mycosphaerellaceae. All
remaining species also grouped within their corresponding
families; however, the relationship between different families is
unresolved.
The mating-type-specific primer sets developed in this study,
DpiniMat1 and DpiniMat2 as well as DseptoMat1 and Dsepto-
Mat2, can be used effectively in multiplex PCR assays to amplify
areas within the mating type genes for D. pini and D. septo-
sporum populations, respectively. These primers also can be used
to distinguish between the two Dothistroma spp., making them
useful tools for rapid and accurate diagnoses of two important
pathogens that are morphologically similar. Prior to this study, the
only diagnostic tool available to distinguish between D. pini and
D. septosporum, was to amplify the ITS of the ribosomal DNA
region with universal primers and then to digest the amplicon
with the restriction endonuclease AluI (2). Although the latter
technique is useful, the ITS amplicon of D. pini is digested into
two fragments whereas that of D. septosporum is not. Therefore,
to prevent a false positive result for D. septosporum, a prior
confirmation that the fungus is a Dothistroma sp. is required. The
mating-type-specific primer sets emerging from this study are
species specific and do not require a prior view on the identity of
unknown isolates. They are, therefore, multifunctional and can be
used for the rapid identification of the species as well as its
mating type.
Although results of this study have shown that D. pini is proba-
bly heterothallic with a single isolate containing only one of the
two mating type genes, no teleomorph has yet been linked to this
species. Where both mating types were observed for the isolates
from the United States, the sexual state most likely is present, but
has not been observed. In contrast, the M. pini teleomorph of
D. septosporum previously has been observed in some parts of the
United States (9,38,39) where D. pini is predominantly found.
Given that the anamorphs of these fungi are morphologically
similar and have been confused in the past, it is possible that
teleomorph structures reported for D. septosporum could have
been linked to D. pini and not to D. septosporum.
Although a small number of isolates were screened for most
countries, this study shows that D. septosporum probably are
heterothallic and that one mating type (MAT2) seems to be more
prevalent in several of the collections studied (e.g., New Zealand).
Although sexual reproduction has been confirmed in D. septo-
sporum, asexual reproduction happens more frequently, and the
absence or rarity of the opposite mating type (MAT1) in most of
the collections can explain the common occurrence of the asexual
stage. Therefore, it also is possible that the teleomorph is not as
rare as first believed. We found that both mating types exist
within D. septosporum populations from Europe (Poland and
Austria) and Canada, where the sexual stage (M. pini) has been
reported in the past (7,15,17,28,29). However, the teleomorph has
never been found in countries in the Southern Hemisphere such as
Chile, Australia, and New Zealand, where these pathogens have
long been a major problem (14,31). These are also the countries
for which only one mating type (MAT2) has been observed, and
this might explain the absence or rarity of the sexual stage.
Discovery in this study of only a single mating type of
D. septosporum in New Zealand, Australian, and Chilean collec-
tions can be explained by the fact that the fungus is an introduced
pathogen in those countries. For New Zealand, Hirst et al. (26)
also found that no genetic variation exist among isolates of a
D. septosporum population, which is strongly supported by the
results of the present study. Dothistroma needle blight was
introduced in Australia in the 1970s and it was suggested that this
occurred by natural means, with conidia being blown across the
Tasman Sea from New Zealand. This view was supported by the
fact that the strict quarantine regulations in Australia would have
made it unlikely that infected plant material entered the country
(13,31,33). The presence of only one mating type shown in this
study and the fact that no genetic diversity has been found yet for
the pathogen in New Zealand (26) supports the view that only one
genotype was introduced into or became established in Australia
and New Zealand. Asexual reproduction evidently has perpetu-
ated the spread of the fungus subsequently. We suspect that the
same situation will have been true for Chile.
An intriguing result of this study has been the discovery that
both mating types of D. septosporum exist in the South African
and United Kingdom collections. This is especially interesting
because the pathogen is non-native in these countries and it might
have been expected that the situation would have been similar to
that in other countries such as New Zealand, where the pathogen
also is an alien invasive. In addition, the teleomorph of D. septo-
sporum has never been observed in South Africa (M. J. Wingfield,
unpublished data) and the United Kingdom (A. V. Brown, unpub-
lished data), despite concerted efforts to detect it.
It is important to recognize that the presence of both mating
types of D. septosporum in these two countries could indicate the
presence of clandestine sex in the fungus. This would indicate the
potential for the pathogen to evolve more effectively in these
countries than would be true elsewhere in the world, where only a
single mating type exists. Such change in the fungus could
complicate efforts to develop trees resistant to Dothistroma needle
blight infection in South Africa and the United Kingdom. In this
regard, it has been shown previously that the introduction of the
second mating type of a pathogen can cause rapid increase in
virulence, gene transfer, and genetic variation, such as in Phy-
tophthora infestans (16,30,42,45) and Ophiostoma novo-ulmi
(36). This implies that the accidental introduction of the opposite
mating type of D. septosporum into countries such as New
Zealand, Australia, and Chile could seriously exacerbate red band
needle disease in those countries. Thus, every effort must be made
to ensure that new mating types of D. septosporum do not enter
these countries.
There has been a dramatic increase in the impact of Dothis-
troma needle blight caused by D. septosporum in western Canada,
the United States, and the United Kingdom in recent years
(5,6,53). Possible reasons for this change in the disease situation
in these countries are an abundance of host material or a
directional climate change, as suggested by Woods et al. (54). The
discovery that both mating types exist in these countries is
another factor that can contribute to the change in the disease
situation. The presence of both mating types increases the
possibility for sexual reproduction. This, in turn, can lead to the
exchange of genetic material between different strains, resulting
in a possible increase in the viability of this species. Therefore,
further investigation is necessary to determine whether the pres-
ence of both mating types, which could increase genetic diversity,
a dramatic climate change, or possibly a combination of both
these factors might account for the drastic increase in the severity
of this disease.
Because only one mating type of D. septosporum appears to be
present in most countries of the Southern Hemisphere, it is impor-
tant to restrict the MAT1 isolates to their present locations. This
can be achieved through refining quarantine regulations based on
the knowledge that only one mating type of the pathogen is pre-
sent in the country. The mating-type-specific PCR developed dur-
ing this study could be implemented easily as a control method to

Vol. 97, No. 7, 2007 833
test for the presence of the mating types for Dothistroma spp. in
pine plantations. One of the weaknesses of quarantine regulations
internationally is that they typically rely on lists of names of
pathogens rather than on knowledge of their biology and popula-
tion genetics. Results of this study have provided valuable new
insights into the distribution of mating types of D. septosporum
and D. pini that should enhance the quality of quarantine regula-
tions in the future.
ACKNOWLEDGMENTS
We thank the CBS-Odo van Vloten Stichting and the Royal Nether-
lands Academy of Arts and Sciences for financial support to M.
Groenewald; G. C. Adams (United States), T. Kirisits (Austria), T.
Kowalski (Poland), R. Ahumada (Chile), and A. Carnegie (Australia) for
providing specimens of D. pini and D. septosporum; and M. Guo for
technical assistance.
LITERATURE CITED
1. Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z.,
Miller, W., and Lipman, D. J. 1997. Gapped BLAST and PSI-BLAST: A
new generation of protein database search programs. Nucleic Acids Res.
25:3389-3402.
2. Barnes, I., Crous, P. W., Wingfield, B. D., and Wingfield, M. J. 2004.
Multigene phylogenies reveal that red band needle blight of Pinus is
caused by two distinct species of Dothistroma, D. septosporum and D.
pini. Stud. Mycol. 50:551-565.
3. Barr, M. E. 1996. Planistromellaceae, a new family in the Dothideales.
Mycotaxon 60:433-442.
4. Bobrowicz, P., Pawlak, R., Correa, A., Bel-Pedersen, D., and Ebbole, D. J.
2002. The Neurospora crassa pheromone precursor genes are regulated
by the mating type locus and the circadian clock. Mol. Microbiol. 45:795-
804.
5. Bradshaw, R. E. 2004. Dothistroma (red-band) needle blight of pines and
the dothistromin toxin: a review. For. Pathol. 34:163-185.
6. Brown, A. V., Rose, D, R., and Webber, J. F. 2003. Red Band Needle
Blight of Pine. Forest Research Information Note 49. Forestry
Commission, Edinburgh.
7. Butin, H., and Richter, J. 1983. Dothistroma needle blight: a new pine
disease in the Federal Republic of Germany. Nachrichtenbl. Deut.
Pflanzenschutzel. 35:129-131.
8. Carson, S. D., Dick, A. M. P., and West, G. G. 1991. Benefits of the
Dothistroma-resistant breed of radiata pine. Pages 251-262 in: New
Directions in Forestry Costs and Benefits of Change. J. C. Allen and
A. G. D. Whyte, eds. Aust. & N. Z. Inst. Forestry, Christchurch, New
Zealand.
9. Cobb, F. W., and Miller, D. R. 1968. Hosts and geographic distribution of
Scirrhia pini—the cause of red band needle blight in California. J. For.
66:930-933.
10. Cobb, F., Uhrenholdt, B., and Drohn, R. 1969. Epidemiology of Dothi-
stroma pini needle blight on Pinus radiata. Phytopathology 59:1021-
1022.
11. Coops, N., Stanford, M., Old, K., Dudzinski, M., Culvenor, D., and Stone,
C. 2003. Assessment of Dothistroma needle blight of Pinus radiata using
airborne hyperspectral imagery. Phytopathology 93:1524-1532.
12. Du, M., Schardl, C. L., Nuckles, E. M., and Vaillancourt, L. J. 2005.
Using mating-type gene sequences for improved phylogenetic resolution
of Colletotrichum species complexes. Mycologia 97:641-658.
13. Edwards, D. W., and Walker, J. 1978. Dothistroma needle blight in
Australia. Aust. For. Res. 8:125-137.
14. Evans, H. C. 1984. The genus Mycosphaerella and its anamorphs
Cercoseptoria, Dothistroma and Lecanosticta on pines. Mycol. Pap.
153:1-102.
15. Fonseca, N. 1998. Mycosphaerella pini (Scirrhia pini), the perfect state of
Dothistroma septospora: first observation in Portugal. Pages 69-74 in:
Foliage, Shoot and Stem Diseases of Trees. G. Laflamme, J. A. Bèrubé,
and R. C. Hamelin, eds. Can. For. Serv., Quebec City, Canada.
16. Fry, W. E., and Goodwin, S. B. 1997. Re-emergence of potato and tomato
late blight in the United States. Plant Dis. 81:1349-1357.
17. Funk, A., and Parker, A. K. 1966. Scirrhia pini n. sp., the perfect state of
Dothistroma pini Hulbary. Can. J. Bot. 44:1171-1176.
18. Gasteiger, E., Gattiker, A., Hoogland, C., Ivanyi, I., Appel, R. D., and
Bairoch, A. 2003. ExPASy: the proteomics server for in-depth protein
knowledge and analysis. Nucleic Acids Res. 31:3784-3788.
19. Gibson, I. A. S. 1972. Dothistroma blight of Pinus radiata. Annu. Rev.
Phytopathol. 10:51-72.
20. Gibson, I. A. S. 1974. Impact and control of Dothistroma blight of pines.
Eur. J. For. Pathol. 4:89-100.
21. Gilmour, J. W. 1967: Distribution and significance of the needle blight of
pines caused by Dothistroma pini in New Zealand. Plant Dis. Rep.
51:727-730.
22. Goodwin, S. B., Dunkle, L. D., and Zismann, V. L. 2001. Phylogenetic
analysis of Cercospora and Mycosphaerella based on the internal
transcribed spacer region of ribosomal DNA. Phytopathology 91:648-658.
23. Goodwin, S. B., Waalwijk, C., Kema, G. H. J., Cavaletto, J. R., and
Zhang, G. 2003. Cloning and analysis of the mating-type idiomorphs
from the barley pathogen Septoria passerinii. Mol. Gen. Genomics 269:1-
12.
24. Groenewald, M., Groenewald, J. Z., and Crous, P. W. 2005. Distinct
species exist within the Cercospora apii morphotype. Phytopathology
95:951-959.
25. Groenewald, M., Groenewald, J. Z., Harrington, T. C., Abeln, E. C. A.,
and Crous, P. W. 2006. Mating type gene analysis in apparently asexual
Cercospora species is suggestive of cryptic sex. Fungal Genet. Biol.
43:813-825.
26. Hirst, P., Richardson, T. E., Carson, S. D., and Bradshaw, R. E. 1999.
Dothistroma pini genetic diversity is low in New Zealand. New Zeal. J.
For. Sci. 29:459-472.
27. Ivory, M. H. 1967. A new variety of Dothistroma pini in Kenya. Trans. Br.
Mycol. Soc. 50:289-297.
28. Karadzic, D. 1989. Scirrhia pini Funk et Parker. Life cycle of the fungus
in plantations of Pinus nigra. Arn. in Serbia. Eur. J. For. Pathol. 19:231-
236.
29. Kowalski, T., and Jankowiak, R. 1998. First record of Dothistroma
septospora (Dorog.) Morelet in Poland: a contribution to the
symptomology and epidemiology. Phytopathol. Pol. 16:15-29.
30. Lee, Y. S., and Kim K. J. 2002. Genetic DNA marker for A2 mating type
in Phytophthora infestans. J. Microbiol. 40:254-259.
31. Marks, G. C., Smith, I. W., and Cook, I. O. 1989. Spread of Dothistroma
septospora in plantations of Pinus radiata in Victoria between 1979 and
1988. Aust. For. 52:10-19.
32. Metzenberg, R. L., and Glass, N. L. 1990. Mating type and mating
strategies in Neurospora. BioEssays 12:53-59.
33. Mireku, E., and Simpson, J. A. 2002. Fungal and nematode threats to
Australian forests and amenity trees from importation of wood and wood
products. Can. J. Plant Pathol. 24:117-124.
34. O’Donnell, K., Ward, T. J., Geiser, D. M., Kistler, H. C., and Aoki, T.
2004. Genealogical concordance between the mating type locus and seven
other nuclear genes supports formal recognition of nine phylogenetically
distinct species within the Fusarium graminearum clade. Fungal Genet.
Biol. 41:600-623.
35. Paoletti, M., Buck, K. W., and Brasier, C. M. 2005. Cloning and sequence
analysis of the MAT-B (MAT-2) genes from the tree Dutch elm disease
pathogens, Ophiostoma ulmi, O. novo-ulmi, and O. himal-ulmi. Mycol.
Res. 109:983-991.
36. Paoletti, M., Buck, K. W., and Brasier, C. M. 2006. Selective acquisition
of novel mating type and vegetative incompatibility genes via interspecies
gene transfer in the globally invading eukaryote Ophiostoma novo-ulmi.
Mol. Ecol. 15:249-262.
37. Pearson, W. R., Wood, T., Zhang, Z., and Miller, W. 1997. Comparison of
DNA sequences with protein sequences. Genomics 46:24-36.
38. Peterson, G. W. 1982. Dothistroma needle blight of pines. In: Forest
Insect and Disease Leaflet 143. U. S. Dep. Agric. For. Serv., Washington,
DC.
39. Peterson, G. W., and Harvey, G. M. 1976. Dispersal of Scirrhia
(Dothistroma) pini conidia and disease development in a shore pine
plantation in western Oregon. Plant Dis. Rep. 60:761-764.
40. Pöggeler, S. 2001. Mating-type genes for classical strain improvements of
ascomycestes. Appl. Microbiol. Biotechnol. 56:589-601.
41. Ray, J. W., and Vanner, A. L. 1988. Improvements in the Technology of
Dothistroma Control. What’s New in Forest Research No. 169. New
Zealand Research Institute, Rotorua.
42. Ristaino, J. B. 2002. Tracking historic migrations of the Irish potato
famine pathogen, Phytophthora infestans. Microbes Infect. 4:1369-1377.
43. Singh, G., and Ashby, A. M. 1998. Cloning of the mating-type loci from
Pyrenopeziza brassicae reveals the presence of a novel mating type gene
within a discomycete MAT1-2 locus encoding a putative metallothionin-
like protein. Mol. Microbiol. 30:799-806.
44. Singh, G., and Ashby, A. M. 1999. Erratum to Singh and Ashby 1998.
Cloning of the mating-type loci from Pyrenopeziza brassicae reveals the
presence of a novel mating type gene within a discomycete MAT1-2 locus
encoding a putative metallothionin-like protein. Mol. Microbiol. 32:1115.
45. Smart, C. D., and Fry, W. E. 2001. Invasions by the late blight pathogen:
Renewed sex and enhanced fitness. Biol. Invas. 3:235-243.
46. Stone, C., Chisholm, L. A., and McDonald, S. 2003. Spectral reflectance
characteristics of Pinus radiata needles affected by Dothistroma needle

834 PHYTO PAT HO LOGY
blight. Can. J. Bot. 81:560-569.
47. Turgeon, B. G. 1998. Application of mating type gene technology to
problems in fungal biology. Annu. Rev. Phytopathol. 36:115-137.
48. Turgeon, B. G., Bohlmann, H., Ciuffetti, L. M., Christiansen, S. K., Yang,
G., Schafer, W., and Yoder, O. C. 1993. Cloning and analysis of the
mating type genes from Cochliobolus heterostrophus. Mol. Gen. Genet.
238:270-284.
49. Turgeon, B. G., and Yoder, O. C. 2000. Proposed nomenclature for mating
type genes of filamentous ascomycetes. Fungal Genet. Biol. 31:1-5.
50. Waalwijk, C., Mendes, O., Verstappen, E. C., de Waard, M. A. D., and
Kema, G. H. J. 2002. Isolation and characterization of the mating-type
idiomorphs from the wheat Septoria leaf blotch fungus Mycosphaerella
graminicola. Fungal Genet. Biol. 35:277-286.
51. Wingfield, M. J, Slippers, B., Roux, J., and Wingfield, B. D. 2001.
Worldwide movement of exotic forest fungi, especially in the tropics and
the Southern Hemisphere. BioScience 51:134-140.
52. Witthuhn, R. C., Harrington, T. C., Steimel, J. P., Wingfield, B. D., and
Wingfield, M. J. 2000. Comparison of isozymes, rDNA spacer regions
and MAT-2 DNA sequences as phylogenetic characters in the analysis of
the Ceratocystis coerulescens complex. Mycologia 92:447-452.
53. Woods, A. J. 2003. Species diversity and forest health in northwest British
Columbia. For. Chronobiol. 79:892-897.
54. Woods, A., Coates, K. D., and Hamann, A. 2005. Is an unprecedented
Dothistroma needle blight epidemic related to climate change?
BioScience 55:761-769.
55. Yun, S. H., Arie, T., Kaneko, I., Yoder, O. C., and Turgeon, B. G. 2000.
Molecular organization of mating type loci in heterothallic, homothallic,
and asexual Gibberella/Fusarium species. Fungal Genet. Biol. 31:7-20.
56. Zhan, J., Kema, G. H. J., Waalwijk, C., and McDonald, B. A. 2002.
Distribution of mating type alleles in the wheat pathogen Mycosphaerella
graminicola over spatial scales from lesions to continents. Fungal Genet.
Biol. 36:128-136.