Toward resolving family-level relationships in rust fungi (Uredinales)

Abstract

Rust fungi (Basidiomycota, Uredinales) consist of more than 7000 species of obligate plant pathogens that possess some of
the most complex life cycles in the Eumycota. Traditionally, a limited number of synapomorphic characters and incomplete life-cycle
and host-specificity data have hampered phylogenetic inference within the Uredinales. The application of modern molecular
characters to rust systematics has been limited, and current contradictions, especially in the deeper nodes, have not yet
been resolved. In this study, two nuclear rDNA genes (18S and 28S) were examined across the breadth of the Uredinales to resolve
some systematic conflicts and provide a framework for further studies of the group. Three suborders of rusts are recovered.
Of the 13 rust families most widely accepted, 8 are supported in full or in part (Coleosporiaceae, Melampsoraceae, Mikronegeriaceae,
Phakopsoraceae p.p., Phragmidiaceae, Pileolariaceae, Pucciniaceae, Raveneliaceae), 3 are redundant (Cronartiaceae, Pucciniastraceae,
Pucciniosiraceae), and the status of 2 (Chaconiaceae, Uropyxidaceae) could not be resolved. The Mikronegeriaceae and Caeoma torreyae are the most basal rusts sampled. It is concluded that morphology alone is a poor predictor of rust relationships at most
levels. Host selection, on the other hand, has played a significant role in rust evolution.

Full text

Mycoscience (2006) 47:112–122 © The Mycological Society of Japan and Springer-Verlag Tokyo 2006
DOI 10.1007/s10267-006-0281-0
FULL PAPER
M. Catherine Aime
Toward resolving family-level relationships in rust fungi (Uredinales)
Received: November 30, 2005 / Accepted: January 20, 2006
Abstract Rust fungi (Basidiomycota, Uredinales) consist
of more than 7000 species of obligate plant pathogens
that possess some of the most complex life cycles in
the Eumycota. Traditionally, a limited number of synapo-
morphic characters and incomplete life-cycle and host-
specificity data have hampered phylogenetic inference
within the Uredinales. The application of modern molecu-
lar characters to rust systematics has been limited, and cur-
rent contradictions, especially in the deeper nodes, have not
yet been resolved. In this study, two nuclear rDNA
genes (18S and 28S) were examined across the breadth of
the Uredinales to resolve some systematic conflicts and
provide a framework for further studies of the group.
Three suborders of rusts are recovered. Of the 13 rust
families most widely accepted, 8 are supported in full or
in part (Coleosporiaceae, Melampsoraceae, Mikronege-
riaceae, Phakopsoraceae p.p., Phragmidiaceae, Pileola-
riaceae, Pucciniaceae, Raveneliaceae), 3 are redundant
(Cronartiaceae, Pucciniastraceae, Pucciniosiraceae), and
the status of 2 (Chaconiaceae, Uropyxidaceae) could not be
resolved. The Mikronegeriaceae and Caeoma torreyae are
the most basal rusts sampled. It is concluded that morphol-
ogy alone is a poor predictor of rust relationships at most
levels. Host selection, on the other hand, has played a sig-
nificant role in rust evolution.
Key words Molecular systematics · Pathogenic fungi · Rust
taxonomy · Urediniomycetes
M.C. Aime (*)
Systematic Botany and Mycology Laboratory, USDA Agricultural
Research Service, Beltsville, MD 20705, USA
Tel. +1-301-504-5758; Fax +1-301-504-5810
e-mail: cathie@nt.ars-grin.gov
Mention of trade names or commercial products in this publication is
solely for the purpose of providing specific information and does not
imply recommendation or endorsement by the US Department of
Agriculture.
Introduction
The rusts (Uredinales) are the largest group of phytopatho-
genic fungi (Savile 1976), with at least 7000 described spe-
cies in the order—one-third of all described basidiomycetes
(Kirk et al. 2001). Rusts are phenotypically and genetically
plastic organisms that have the most complicated life cycles
of any Eumycota (Laundon 1973; Hennen and Buriticá
1980; Cummins and Hiratsuka 2003). The rust life cycle can
involve up to five or six different spore types with varying
nuclear composition and may require alternation between
two unrelated host plants for completion (Hiratsuka and
Hiratsuka 1980; Cummins and Hiratsuka 2003). Karyogamy
typically occurs in specialized spores termed teliospores
that germinate to produce the basidia in which meiosis
takes place, but many species have conscripted other spore
stages, such as aeciospores or urediniospores, for comple-
tion of the sexual cycle (Savile 1976; Cummins and
Hiratsuka 2003). Even genome size is quite variable, with
haploid size-estimates ranging from 64 to 418Mbp for some
species in the Pucciniaceae alone (Eilam et al. 1994). Rust
diseases cause serious economic damage worldwide on agri-
cultural, forest, and ornamental plants. Because of the pre-
sumed host-specificity of some species, they also offer a
potential source of biological control organisms for noxious
and invasive weeds (McCain et al. 1990; Evans 1993). Yet,
for the majority of rust species, complete life-cycle data
including host range, geographic distribution, cytology,
identity of alternate hosts, and/or mode of sexual reproduc-
tion are incomplete (Savile 1976; Ono and Hennen 1983;
McCain et al. 1990; Hennen and McCain 1993), and even
family-level classification is contentious (Hennen and
Buriticá 1980; Ono and Hennen 1983) and “requires further
investigation” (Kirk et al. 2001).
Rust taxonomy has been almost entirely informed by
morphology, despite known phenotypic variability of some
species. For instance, in two studied species urediniospore
morphology was found to be dependent on which alternate
host was utilized (Long 1914). Family-level classifications
for the rusts have undergone numerous changes since

113
Dietel (1900), with Uredinales typically divided into any-
where from 2 (Dietel 1928) to 14 (Cummins and Hiratsuka
1983; Kirk et al. 2001) different families (see Hennen and
Buriticá 1980 and Hart 1988 for a summary). Different
morphological characters have been emphasized during
different periods in rust taxonomy (Ono and Hennen
1983). For example, early classifications emphasized
teliospore (Dietel 1928; Thirumalachar and Cummins
1949; Thirumalachar and Mundkur 1949a) and telium
(Thirumalachar and Cummins 1949) morphology as of pri-
mary importance. Cummins and Hiratsuka (1983, 2003)
revised rust taxonomy and developed the systematic treat-
ment most widely used today by deemphasizing telial state
morphology and emphasizing spermogonial structure,
based on the work of Hiratsuka and Cummins (1963) and
Hiratsuka and Hiratsuka (1980). Researchers have often
deemphasized or cautioned against using host associations
in the formation of rust classifications (Thirumalachar and
Mundkur 1949b). The primary exception is in the treatment
of the “fern rusts” – those genera of rusts that form their
telia on ferns – which were widely believed to be the most
primitive rusts because they parasitize a primitive group
of plants (Arthur 1924; Savile 1976), although alternate
hypotheses regarding which group of rusts are the most
primitive exist (Ono and Hennen 1983).
Cladistic analysis of 28 rust characters challenged the
hypothesis that the fern rusts represented the most primi-
tive extant Uredinales (Hart 1988). DNA sequence-based
phylogenetic analyses of the rusts have not been as widely
applied as for other fungi, largely because they are obligate
biotrophs that are generally impossible to maintain in pure
culture. However, the first such study to broadly examine
the rusts at a suprageneric level provided conclusive
evidence that two fern rusts, Uredinopsis Magnus and
Hyalopsora Magnus, did not hold a basal position in the
order (Sjamsuridzal et al. 1999). Two subsequent phyloge-
netic studies have confirmed these findings as well as the
monophyly of the rusts but provide conflicting topologies
(Maier et al. 2003; Wingfield et al. 2004). Sequence data
from ∼600bp of the 5′-end of the large subunit (28S) nuclear
rDNA place Melampsora Castagne in the basalmost posi-
tion for the Uredinales (Maier et al. 2003). Sequence data
from nuclear rDNA encoding the entire small subunit (18S)
RNA place Racospermyces J. Walker in the basal-most po-
sition and show Melampsora in a derived lineage (Wingfield
et al. 2004). In both cases, neither the 28S nor 18S rDNA
alone was capable of full resolution, although the 28S pro-
vided better support for groupings than did the 18S. The
purpose of the present study is to use a two-gene analysis of
combined 18S and 28S sequence data for exemplars from all
13 most widely accepted rust families fide Cummins and
Hiratsuka (2003) toward resolving subordinal relationships
in the rusts. Discussion of the families in a phylogenetic
context is provided with emphasis on which rusts hold
promise as being representative of the most primitive extant
Uredinales.
Materials and methods
Specimens
Materials were obtained as dried field collections or
herbarium specimens, or previously accessioned DNA
sequences from GenBank (http://www.ncbi.nlm.nih.gov/).
Field collections were dried using a standard plant press.
Origin and voucher deposition of all collections are
provided in Table 1.
DNA extraction, polymerase chain reaction,
and cycle sequencing
Sori were excised from the dried host material, placed in
2ml Bead Solution tubes of the UltraClean Plant DNA
Isolation Kit, and extracted per the manufacturer’s instruc-
tions (MoBio Laboratories, Solana Beach, CA, USA).
Polymerase chain reactions (PCRs) were performed in
25-µl reaction volumes with 12.5µl PCR Master Mix
(Promega, Madison, WI, USA), 1.25µl each 10µM primers
(upstream and downstream), and 10µl diluted (10- to 100
fold) DNA template. Approximately 1400bp of a region of
the ribosomal repeat spanning the 5.8S subunit, the internal
transcribed spacer region 2 (ITS-2), and the large subunit
(28S) was amplified with rust-specific primer Rust2inv (5′-
GATGAAGAACACAGTGAAA, based on the reverse-
complement of Rust2 from Kropp et al. 1997) and LR6
(Vilgalys and Hester 1990), and sequenced with Rust2inv,
LR6, LR0R (Moncalvo et al. 1995), and LR3 (Vilgalys
and Hester 1990). The complete 18S rDNA (∼1750bp)
was amplified with rust-specific primer Rust18S-R (5′-
ACCTTGTTACGACTTTTACTTC) and NS1 (White et
al. 1990) and sequenced with NS1, NS3, NS4, NS5, NS6
(White et al. 1990), and Rust18S-R. Amplification of both
regions was achieved with an initial denaturation step of
2min at 94°C; 40 cycles of 30s at 94°C, 1min at 57°C, and
1.5min at 72°C, and a final extension of 7min at 72°C.
PCR products were cleaned by one of two methods. The
majority were cleaned with Montage PCR Centrifugal Filter
Devices (Millipore, Billerica, MA, USA) according to the
manufacturer’s protocol. If more than one PCR product was
produced during amplification, then the band of the correct
size was excised from a 1% agarose gel and cleaned with the
MinElute PCR Gel Extraction Kit (Qiagen, Valencia, CA,
USA). Cleaned PCR products were sequenced with BigDye
Terminator sequencing enzyme v.3.1 (Applied Biosystems,
Foster City, CA, USA) in the reaction: 2µl diluted BigDye
in a 1:3 or 1:1 dilution of BigDye:dilution buffer (400mM
Tris pH 8.0, 10mM MgCl
2
), 0.3µl 10µM primer, 10–20ng
cleaned PCR template, and H
2
O to 5µl total reaction vol-
ume. Cycle sequencing parameters consisted of a 2-min
denaturation step at 94°C, then 35 cycles of 94°C for 39s,
50°C for 15s, and 60°C for 4min. Sequencing reactions were
cleaned by ethanol precipitation and sequenced on an ABI
3100 Genetic Analyzer (Applied Biosystems). DNA se-
quences have been deposited in GenBank, accessions
DQ354508–569 (see Table 1).

114
Table 1. Origin of materials used for sequence analyses
Species Host Location Collection no. Voucher no.
a
GenBank LSU
b
GenBank SSU
b
Aecidium kalanchoe J.R. Hern. Kalanchoe blossfeldiana USA: ID E.K. Vavrika s.n. (U-18) BPI 843633 AY463163* DQ354524
Poelln. (Crassulaceae)
Batistopsora crucis-filii Annona sp. (Annonaceae) Guyana J. Hernandez 2003-085 BPI 863563 DQ354539 DQ354538
Dianese, R.B. Medeiros &
L.T.P. Santos
Blastospora smilacis Dietel Smilax sieboldii Hort. Bog Japan Y. Ono 3179 PUR N270 DQ354568 DQ354567
ex Hassk. (Smilacaceae)
Caeoma torreyae Bonar AF522183* AY123284*
Coleosporium asterum (Dietel) Solidago sp. (Asteraceae) USA: TN M.C. Aime 2600 BPI 863448 DQ354559 DQ354558
Syd. & P. Syd.
Cronartium ribicola J.C. Fisch. Ribes sp. (Grossulariaceae) USA: VA D.E. Farr & E. Farr s.n. (U-396) BPI 871660 DQ354560 M94338*
Cumminsiella mirabilissima Mahonia aquifolium Pursh Germany G. Arnold s.n. (U-480) BPI 871101 DQ354531 DQ354530
(Peck) Nannf. (Berberidaceae)
Dietelia portoricensis (Whetzel & L.S. Mikania micrantha Kunth Costa Rica H. Evans s.n. (U-322) BPI 844288 DQ354516 AY125414*
Olive) Buriticá & J.F. Hennen (Asteraceae)
Endoraecium acaciae Hodges Acacia koa A. Gray USA: HI D.E. Farr & E. Farr, BPI 871098 DQ323916 DQ323917
& D.E. Gardner (Fabaceae) MCA2957
Eocronartium musicola (Pers.) Fitzp. AY512844* AY123323*
Frommeëlla mexicana (Mains) Duchesnea sp. (Rosaceae) USA: MD J. Hernandez & M.C. Aime, BPI 843392 DQ354553 DQ354552
J.W. McCain & J.F. Hennen U-3
Gymnosporangium clavipes Amelanchier canadensis USA: VA M. Sogonov, MCA2568B BPI 871102 DQ354545 DQ354546
(Cooke & Peck) Cooke & Peck Medik. (Rosaceae)
Gymnosporangium juniperi- Malus domestica Borkh. USA: VA D.E. Aime & M.C. Aime BPI 871103 DQ354547 AY123289*
virginianae Schwein. (Rosaceae) 2776
Helicobasidium purpureum Pat. AY512846* D85648*
Hemileia vastatrix Berk. & Broome Coffea arabica L. Mexico J. Hernandez 2002-004 BPI 843642 DQ354566 DQ354565
(Rubiaceae)
Kuehneola uredinis (Link) Arthur Rubus argutus Link USA: NC M.C. Aime 2830 BPI 871104 DQ354551 AY123310*
(Rosaceae)
Kweilingia divina (Syd.) Buriticá Bambusa sp. (Poaceae) Costa Rica M.C. Aime 2887 BPI 871105 DQ354554 AY123288* (as
Dasturella)
Maravalia cryptostegiae n/a AY125404*
(Cummins) Y. Ono
Melampsora epitea Thüm. Salix sp. (Salicaceae) USA: WA L. Roberts s.n. (U-563) BPI 871106 DQ354564 AY123293*
Melampsora euphorbiae Euphorbia heterophylla L. Oman M. Deadman s.n. (U-681) BPI 871135 DQ351722 AY123294*
Castagne (Euphorbiaceae)
Melampsoridium betulinum Kleb. Alnus sp. (Betulaceae) Costa Rica M.C. Aime 2884 BPI 871107 DQ354561 AY125391*
Mikronegeria alba Oehrens & Nothofagus nervosa Phil. Argentina detr. Havrilenko PUR N1122 DQ354569 n/a
R.S. Peterson (Fagaceae)
Miyagia pseudosphaeria Sonchus oleraceus L. USA: CA S.T. Koike s.n. (U-63) BPI 842230 DQ354517 AY125411*
(Mont.) Jørst. (Asteraceae)
Naohidemyces vaccinii (G. Vaccinium ovatum Pursh USA: WA A.Y. Rossman, D. Feuillet, BPI 871754 DQ354563 DQ354562
Winter) Jørst. (Ericaceae) & M. Bair, MCA2780
Olivea scitula Syd. Vitex doniana Sweet Zambia R.G. Kapooria s.n. (U-668) BPI 871108 DQ354541 DQ354540
(Lamiaceae)
Phakopsora pachyrhizi Syd. & P. Syd. Glycine max Merr. Zimbabwe O. Mhembere s.n. (U-644) BPI 871755 DQ354537 DQ354536
(Fabaceae)
Phakopsora tecta H. Jacks. & Holw. Commelina diffusa Burm. f. Costa Rica J. Hernandez 2003-137 BPI 843896 DQ354535 AY125397* (as
(Commelinaceae) Physopella)

115
Pileolaria brevipes Berk. & Ravenel Toxicodendron sp. USA: MN R.W. Stack s.n. (U-607) BPI 871761 DQ323924 AY123314*
(Anacardiaceae)
Platygloea vestita Bourdot & Galzin AY512872* AY124480*
Prospodium lippiae (Speg.) Arthur Aloysia polystachya Argentina J. Hernandez 2001-015 BPI 843901 DQ354555 n/a
(Griseb.) Moldenke
(Verbenaceae)
Puccinia caricis (Schumach.) Rebenh. Grossularia sp. USA: ND R.W. Stack s.n. (U-193) BPI 871515 DQ354514 DQ354515
(Grossulariaceae)
Puccinia convolvuli Castagne Calystegia sepium (L.) R. Br. USA: MD M.C. Aime 2778 BPI 871465 DQ354512 DQ354511
(Convolvulaceae)
Puccinia coronata Corda Rhamnus cathartica L. USA: ND R.W. Stack s.n. (U-244) BPI 84300 DQ354526 DQ354525
(Rhamnaceae)
Puccinia hemerocallidis Thüm. Hemerocallis sp. USA: AL J. Olive s.n. (U-73) BPI 843967 DQ354519 DQ354518
(Hemerocallidaceae)
Puccinia hordei G.H. Otth undetr. Poaceae USA: CA M.C. Aime 2391 BPI 871109 DQ354527 n/a
Puccinia menthae Pers. ex Pers. Cunila origanoides (L.) USA: MD C. Park & M.C. Aime 2989 BPI 871110 DQ354513 AY123315*
Britton (Lamiaceae)
Puccinia physalidis Peck Physalis lanceolata Michx. USA: ND R.W. Stack s.n. (U-189) BPI 844306 DQ354522 DQ354523
(Solanaceae)
Puccinia podophylli Schwein. Podophyllum peltatum L. USA: MD J. Hernandez & M.C. Aime, U-2 BPI 842277 DQ354543 DQ354544
(Berberidaceae)
Puccinia smilacis Arthur Smilax rotundifolia L. USA: MD L. Castlebury s.n. (U-393) BPI 871784 DQ354533 DQ354532
(Smilacaceae)
Puccinia violae (Schumach.) DC. Viola cucullata Aiton USA: MD J. Hernandez & M.C. Aime, U-4 BPI 842321 DQ354509 DQ354508
(Violaceae)
Pucciniosira pallidula (Speg.) Triumfetta semitriloba Jacq. Venezuela R. Urtiaga 18 BPI 863541 DQ354534 n/a
Pers. Lagerh. (Malvaceae)
Racospermyces koae (Arthur) J. Acacia koa A. Gray USA: HI M. Scholler & M.C. Aime 2961 BPI 871071 DQ323918 DQ323919
Walker (Fabaceae)
Ravenelia havanensis Arthur Enterolobium Argentina R. Berndt 5788 Z+ZT RB5788 DQ354557 DQ354556
contortisiliquum Morong.
(Fabaceae)
Sphenospora kevorkianii Linder Stanhopea candida Bab. Peru H. Ruiz, MIA 223837 BPI 863558 DQ354521 DQ354520
Rodr. (Orchidaceae)
Trachyspora intrusa (Grev.) Arthur Alchemilla vulgaris L. Switzerland L. Castlebury, MCA2384 BPI 843828 DQ354550 DQ354549
(Rosaceae)
Tranzschelia discolor (Fuckel) Prunus domestica L. Iran R. Zare s.n. (U-510) KR-0010966 DQ354542 AY125403*
Tranzschel & Litv. (Rosaceae)
Uromyces appendiculatus Phaseolus vulgaris L. USA J.R. Stavely #39 SBML & VL AF522182* DQ354510
(Pers. ex Pers.) Unger (Fabaceae)
Uromyces ari-triphylli Arisaema triphyllum (L.) USA: MD D.E. Farr & E. Farr s.n. (U-637) BPI 871111 DQ354529 DQ354528
(Schwein.) Seeler Schott (Araceae)
Uromycladium fusisporum Acacia salicina Lindl. Australia R. Shivas s.n. BRIP 27608 DQ323921 DQ354548
(Cooke & Massee) Savile (Fabaceae)
LSU, large subunit; SSU, small subunit
a
BPI, US National Fungus Collections, Beltsville, MD, USA; BRIP, Plant Pathology Herbarium, Indooroopilly, Australia; KR, Staatl
iches Museum Für Naturkunde Karlsruhe, Karlsruhe,
Germany; PUR, Arthur Herbarium, Purdue University, West Lafayette, IN, USA; SBML & VL, collection housed as frozen urediniospor
es at the Systematic Botany & Mycology Laboratory and
Vegetable Laboratory, USDA-ARS, Beltsville, MD, USA; Z+ZT, Geobotanisches Institut, Zurich, Switzerland
b
An asterisk (*) denotes sequence obtained from GenBank

116
Sampling strategy and sequence analyses
Sequencing reactions were edited and contiguous se-
quences were assembled in Sequencher v.4.1.4 (Gene
Codes, Ann Arbor, MI, USA). An initial dataset of 630
sequences aligned across the first 500bp of the 5′-region of
the 28S were assembled into a single dataset. Sequence
alignments were constructed by eye in Se-Al v2.0a11
(Andrew Rambaut, Zoology Department, University of
Oxford, UK; http://evolve.zoo.ox.ac.uk/); these include rep-
resentative taxa from all 13 Uredinales families fide
Cummins and Hiratsuka (2003), representative taxa from
58 of 128 rust genera fide Cummins and Hiratsuka (2003),
and ∼500 rust species (duplicate sequences were obtained
from additional collections for many taxa to confirm
derived sequences and phylogenetic placements). Boot-
strapping analyses using maximum-parsimony (MP) and
neighbor-joining (NJ) were conducted in PAUP* version
4.0b10 (Swofford 2002).
Based on the results from the primary 28S dataset (trees
not shown), 49 taxa were selected from across the breadth
of the 28S-derived phylogenetic tree for combined 18S and
28S analyses. These included at least one representative of
each of the 13 families fide Cummins and Hiratsuka (2003).
Preference was given to include type taxa for families and
genera wherever possible. Outgroups [Helicobasidium
purpureum Pat., Eocronartium muscicola (Pers.) Fitzp.,
Platygloea vestita Bourdot & Galzin] were chosen from
Urediniomycete taxa believed to be closely related to the
rusts (Leppik 1955; Hiratsuka 1990; Cummins and
Hiratsuka 2003). Approximately 1150bp of 28S sequence
data, covering divergent domains D1–D3 (Hopple and
Vilgalys 1999) and all ∼1750bp of 18S for each exemplar
taxon were combined into a single dataset, aligned in Se-Al,
and analyzed in PAUP. A total of 317bp (305bp of the 28S
and 12bp of 18S) were too ambiguous to confidently align
and were excluded from further analyses.
MP analyses were conducted in PAUP as heuristic
searches with 100 random addition replicates and TBR
branch swapping. Support for MP branching topologies was
evaluated by bootstrap analysis derived from 10000 repli-
cates with 10 random addition replicates each. Maximum-
likelihood (ML) analyses were conducted by the quartet
puzzling method (Strimmer and von Haeseler 1996) in
PAUP with 10000 puzzling steps; transition/transversion
ratio = 2.
Results
Forty-six rust taxa from 34 genera representing all 13 fami-
lies fide Cummins and Hiratsuka (2003) were sampled and
analyzed for two rDNA genes (Fig. 1). A total of 2562
characters were included in the combined 18S and 28S
analysis, of which 389 were parsimony informative and 312
were variable but parsimony uninformative. A single most
parsimonious tree of length 1806 was found by MP; consis-
tency index (CI) = 0.52; retention index (RI) = 0.55. The
Uredinales appear monophyletic with three major rust lin-
eages recovered (Fig. 1, I–III). Support was found for com-
ponents of 8 established families, indicated by encircled
numbers (in Fig. 1), with some revision. A few genera,
Tranzschelia Arthur, Gymnosporangium R. Hedwig, and
Olivea Arthur, could not be confidently assigned to any of
the supported families with these data (Fig. 1). The position
of Olivea scitula Syd. is conflicted: in MP analyses it is an
unsupported member of crown lineage I; in ML analyses it
forms a sister to the Mikronegeriaceae (Fig. 1, no. 8) in
basal lineage III. When O. scitula is removed from this
dataset, all three major lineages are strongly supported (not
shown). In all cases, Caeoma torreyae Bonar is the most
basal rust sampled (see Fig. 1).
Discussion
Many hypotheses regarding which may be the most primi-
tive rusts have been proposed. The molecular study of
Sjamsuridzal et al. (1999) refuted the fern rust hypothesis of
Arthur (1924) and others, but sampling was too limited to
determine the true ancestral rusts. Durrieu (1980) proposed
Melampsora to be ancestral, and some support for this hy-
pothesis was found with 28S sequence data (Maier et al.
2003). Alternatively, the short-cycled tropical members of
the Chaconiaceae sensu Ono and Hennen (1983) (Goplana
Racib., Chrysocelis Lagerh. & Dietel, Chaconia Juel, and
Olivea Arthur) have been proposed as the most primitive
rusts (Ono and Hennen 1983; Hart 1988). In earlier works,
Leppik (e.g., 1955) proposed that the primitive rust genera
were those he termed “stomatosporous,” i.e., short-cycled
rusts with telia that emerge through the host stomata, such
as Desmella H. & P. Syd. (Uropyxidaceae fide Cummins
and Hiratsuka 2003), Hemileia Berk. & Broome
(Chaconiaceae fide Cummins and Hiratsuka 2003), and
Gerwasia Racib. (Phragmidiaceae fide Cummins and
Hiratsuka 2003). In the present study, the anamorphic
rust Caeoma torreyae was found to be the most basal
rust sampled, with the Mikronegeriaceae, Hemileia, and
Maravalia cryptostegiae (Cummins) Y. Ono (Chaconiaceae
fide Cummins and Hiratsuka 2003), forming the remainder
of basal lineage III (see Fig. 1, no. 8). Thus lineage III,
herein defined as suborder Mikronegeriineae, contains an
assemblage of rusts that have not been allied in any previ-
ous classification; these are discussed further under the
Mikronegeriaceae below.
Fig. 1. The single most parsimonious tree recovered from combined
28S and 18S sequence data. A thickened branch indicates a node recov-
ered by both maximum-likelihood (ML) and maximum-parsimony
(MP) methods. Numbers above a branch represent support >50% for
those nodes: the first number represents the quartet puzzling reliability
score; bootstrapping values for MP are shown in parentheses. Circled
numbers indicate lineages referred to in the text
䉴

117

118
The other two lineages resolved (see Fig. 1; I, II) most
closely correspond to the two-meta-family system of
Dietel (1928) and others (Arthur 1934; Bessey 1950).
Lineage II, Dietel’s Melampsoraceae, herein defined as
suborder Melampsorineae, contains rusts placed in the
Melampsoraceae, Pucciniastraceae, Coleosporiaceae, and
Cronartiaceae fide Cummins and Hiratsuka (2003). The
Melampsorineae contains the fern rusts and many impor-
tant pathogens of conifers. A unifying feature of these rusts
is that the aecial stage, when present, is typically formed
on members of the Pinaceae. Lineage I, herein defined as
suborder Uredinineae, contains Dietel’s (1928) Puccinia-
ceae with the exclusion of the rusts that belong to the
Mikronegeriineae. Rusts in this suborder that form aecia do
so on angiosperms. Many researchers have subdivided the
Pucciniaceae sensu Dietel into various segregate families
(Hennen and Buriticá 1980; Hart 1988). The system
of Cummins and Hiratsuka (2003) divides this group into
nine families: Mikronegeriaceae, Phakopsoraceae, Cha-
coniaceae, Uropyxidaceae, Pileolariaceae, Raveneliaceae,
Phragmidiaceae, Pucciniaceae, and Pucciniosiraceae, pri-
marily based on spermogonia type. Topology within this
lineage is less resolved than for the other two, yet at least
five clades are recovered that correspond, with some revi-
sion, to the Pucciniaceae, Phakopsoraceae, Pileolariaceae,
Phragmidiaceae, and Raveneliaceae fide Cummins and
Hiratsuka (2003). The Pucciniosiraceae is found to be
confamilial with the Pucciniaceae. Both the Chaconiaceae
(represented here by Olivea, Hemileia, and Maravalia
Arthur) and Uropyxidaceae (represented by Tranzschelia,
and Prospodium Arthur) appear polyphyletic (see Fig. 1).
Preliminary 28S data (not presented) place some members
of Chaconia within the Raveneliaceae. However, until type
genera and species can be studied, the status for both of
these families remains unresolved. A discussion of each
resolved family follows.
Pucciniaceae Chevall
The Pucciniaceae (Fig. 1, no. 1) forms the crown group of
extant rusts and contains ∼4000 of the ∼7000 described spe-
cies (Kirk et al. 2001). Fifteen genera are placed here by
Cummins and Hiratsuka (2003). These analyses do not
confirm the placement of 1 of these, Gymnosporangium,
within the Pucciniaceae (see Fig. 1). A few species currently
placed in Puccinia Pers. ex Pers. have affinities elsewhere
(e.g., P. podophylli Schwein., Fig. 1), but the vast majority
belong to this family. Other genera whose placement in the
family is confirmed with these data are Cumminsiella
Arthur, Miyagia Miyabe ex H. & P. Syd., and Uromyces
(Link) Unger. The anamorphic rust Aecidium kalanchoe
J.R. Hern. belongs to this family, as is expected for most
Aecidium spp. (Cummins and Hiratsuka 2003). The large
genera Puccinia and Uromyces are not monophyletic, as has
been noted elsewhere (Savile 1978; Maier et al. 2003).
Two genera from the Pucciniosiraceae have been
sampled (Dietelia Henn. and Pucciniosira Lagerh.). The
Pucciniosiraceae is an artificial family of endocyclic rusts
(Cummins and Hiratsuka 2003). Placement of the two spe-
cies sampled here, including Pucciniosira pallidula (Speg.)
Lagerh. [=P. triumfettae Lagerh., the type of Pucciniosira
(Buriticá and Hennen 1980)] confirms the hypothesis of
Buriticá and Hennen (1980) that most if not all the
Pucciniosiraceae will eventually be found to have affinities
within the Pucciniaceae. Similar to Endophyllum Lév.
(Pucciniaceae), these are most likely polyphyletic taxa
derived from various Pucciniaceae ancestors, including
Endophyllum-like forms (Jackson 1931).
The placement of Sphenospora kevorkianii Linder
(Raveneliaceae fide Cummins and Hiratsuka 2003) within
this family was unexpected. Sphenospora kevorkianii is a
parasite of orchids (Linder 1944). Most taxa currently
placed in the genus occur on other monocots (Linder 1944;
Cummins and Hiratsuka 2003), whereas most members of
the Raveneliaceae parasitize fabaceous hosts in subfamily
Mimosoideae. Sampling from the type species S. pallida (G.
Winter) Dietel is needed to resolve the status of this genus,
which most likely is allied with the Pucciniaceae rather than
the Raveneliaceae.
In all analyses the genus Gymnosporangium is resolved
as a monophyletic group separate from the Pucciniaceae,
which was also found by Maier et al. (2003) using different
taxa. Gymnosporangium is unusual in that the members of
this genus are the only rusts that form their telia on gymno-
sperms, on members of the Cupressaceae (Leppik 1973).
Thus far, the genus holds a rather isolated position in phy-
logenetic studies and may represent a separate family-level
lineage of rusts within the Uredinineae.
Phakopsoraceae (Arthur) Cummins & Y. Hirats
The Phakopsoraceae contains a morphologically diverse
group of 12 (Buriticá and Hennen 1994) to 13 (Cummins
and Hiratsuka 2003) different teleomorphic genera and 10
(Buriticá and Hennen 1994) different anamorphic-form
genera. Representatives from three of these – Batistopsora
Dianese, Medeiros & Santos, Kweilingia Teng., and
Phakopsora Dietel – were sampled for this study. Addi-
tional species of Phakopsora were sampled in the extended
28S analyses (not presented). All analyses to date indicate
that the family and the genus Phakopsora itself are poly-
phyletic, divided into two monophyletic but unrelated lin-
eages [Fig. 1, no. 2 and K. divina (Syd.) Buriticá]. The genus
Phakopsora contains at least 90 morphologically variable
species (Ono et al. 1992; Cummins and Hiratsuka 2003) and
several genera have been segregated from or synonymized
with it (Mains 1934; Cummins and Ramachar 1958; Ono
et al. 1992; Buriticá and Hennen 1994). The type species of
Phakopsora, P. punctiformis (Barclay & Dietel) Dietel (on
Rubiaceae), must be sampled to determine the taxonomic
status of these two lineages.
The genus Angiopsora Mains was erected to accommo-
date Phakopsora-like species on Poaceae (Mains 1934).
Although Angiopsora has been synonymized with
Physopella Arthur (Cummins and Ramachar 1958), which
in turn is considered synonymous with Phakopsora

119
(Cummins and Hiratsuka 2003), analysis of the type species
is warranted to ascertain whether this genus represents
the sister to Kweilingia, forming a distinct lineage of
Phakopsora-like species on grass hosts. However, of the
additional species of Phakopsora that have been sampled
with 28S data, only those on Poaceae thus far are sisters to
K. divina (also on Poaceae); thus, it is likely that clade no. 2
(see Fig. 1) contains the true Phakopsoraceae.
Pileolariaceae (Arthur) Cummins & Y. Hiratsuka
Cummins and Hiratsuka (2003) place four genera in this
family: Atelocauda Arthur & Cummins, Pileolaria
Castagne, Uromycladium McAlpine, and Endoraecium
Hodges & D.E. Gardner (an endocyclic genus). A fifth
genus, Racospermyces J. Walker, has recently been segre-
gated from Atelocauda (Walker 2001). All but Atelocauda
were sampled in this study. Contrary to the findings of
Wingfield et al. (2004), these analyses support a monophyl-
etic Pileolariaceae s.s., containing Pileolaria and Uromy-
cladium (Fig. 1, no. 3). Racospermyces and Endoraecium,
on the other hand, are more closely allied with other
mimosoid rusts in the Raveneliaceae, which is discussed in
Scholler and Aime (2006).
Phragmidiaceae Corda
This is a well-circumscribed family of nine genera, most or
all autoecious on Rosaceae, primarily on subfamily
Rosoideae (Cummins and Hiratsuka 2003). Monophyly of
the Phragmidiaceae has been established with 28S sequence
data for four genera (Maier et al. 2003) and for seven gen-
era (not presented) and with three generic representatives
(Frommeëlla Cummins & Y. Hirats. and Kuehneola
Magnus, Trachyspora Fuckel) in the two-gene analysis of
this study (Fig. 1, no. 4). Also included in this family are at
least some species of Triphragmium Link (Maier et al. 2004;
and unpresented 28S data). Triphragmium is currently
placed in the Raveneliaceae based on spermogonial charac-
teristics (Cummins and Hiratsuka 2003), and there are two
species on Fabaceae that may indeed be allied with that
family. However, the type species T. ulmariae (DC.) Link
and three others parasitize the Rosoideae (Cummins and
Hiratsuka 2003) and belong to the Phragmidiaceae as hy-
pothesized by Savile (1968).
Raveneliaceae (Arthur) Leppik
The Raveneliaceae is a large family of 21 genera (Cummins
and Hiratsuka 2003) containing many rusts on Mimo-
soideae (Fabaceae) that have been traditionally circum-
scribed by morphology. Results show that species from
two genera on nonleguminous hosts – Sphenospora and
Triphragmium – should be reassigned to the Pucciniaceae
and Phragmidiaceae, respectively, whereas two other
genera – Racospermyces and Endoraecium – both parasitic
on mimosoids but currently assigned to the Pileolariaceae,
are allied here (Fig. 1, no. 5). This finding is consistent with
a reinterpretation of the family to include primarily rusts
that have evolved on mimosoid hosts. For instance, prelimi-
nary 28S analyses (not presented) indicate that Chaconia is
polyphyletic, which has been predicted (Thirumalachar and
Cummins 1949; Thirumalachar and Mundkur 1949a). Of
the species sampled, those that infect legumes are allied
with Ravenelia Berk. and not with other genera currently
placed in the Chaconiaceae. The type, C. alutacea Juel,
although not sampled, also occurs on a mimosoid host,
which might indicate that the Chaconiaceae are confamilial
with the Raveneliaceae. Certainly, much additional sam-
pling is required from among the other genera currently
placed in both of these families to fully resolve the limits of
the Raveneliaceae and deposition of extrafamilial genera
and species currently allied here.
Coleosporiaceae Dietel
The rusts in this group have been segregated from Dietel’s
(1928) Melampsoraceae and subsequently subdivided into
as many as four segregate families (Leppik 1972). Cur-
rently, they are placed in three families, Coleosporiaceae
(three genera), Cronartiaceae (two genera, one endocyclic),
and Pucciniastraceae (nine genera), fide Cummins and
Hiratsuka (2003). Molecular studies show that these rusts
are confamilial (Fig. 1 and unpresented 28S data; Maier
et al. 2003).
Of the four (Leppik 1972) family names available for
this group, two have priority: Coleosporiaceae Dietel
(1900) and Cronartiaceae Dietel (1900). Dietel (1928) later
revised his classification, including Coleosporiaceae and
Cronartiaceae within the Melampsoraceae. However,
the Coleosporiaceae was used by Raciborski (1909, as
Coleosporieae) and by Sydow and Sydow (1915), who place
members of the Cronartiaceae within the Melampsoraceae,
thus giving Coleosporiaceae priority over Cronartiaceae
(Greuter et al. 2000). In the present study, the Coleo-
sporiaceae appears paraphyletic (Fig. 1, no. 6) with the
Melampsoraceae. Additional studies are needed to confirm
the reciprocal monophyly of the Coleosporiaceae and
Melampsoraceae.
Melampsoraceae Dietel
This is a monotypic family of mostly heteroecious rusts that
form telia on members of the Salicaceae or Euphorbiaceae.
This clade (see Fig. 1, no. 7) has been recovered in all
analyses, including Maier et al. (2003) and Wingfield et al.
(2004).
Mikronegeriaceae Cummins & Hirats
Teliospores of Mikronegeria alba Oehrens & R.S. Peterson
are so poorly developed and uncharacteristic of Uredinales
that they have been interpreted as nonexistent. Instead of
forming a distinguishable teliospore, M. alba produces
metabasidia by apical elongation of simple, clavate

120
probasidia (Peterson and Oehrens 1978). This simple mode
of reproduction and the absence of conventional telio-spores
has been interpreted as evidence to suggest this taxon shares
more affinities with the Auriculariales than Uredinales
(Peterson and Oehrens 1978), but other researchers suggest
that morphologically simple short-cycled rusts are derived
from the convergent influence of a secondarily tropical exist-
ence rather than indicative of “primitive” status (Savile
1978). Cummins and Hiratsuka (1983) created the mono-
typic Mikronegeriaceae to accommodate this unique taxon.
The family concept has since expanded to include other rusts
that have type 12 spermogonia (Hiratsuka and Hiratsuka
1980), Blastospora Dietel and Chrysocelis Lagerh. & Dietel
(Cummins and Hiratsuka 2003). Molecular data consistently
place M. alba within a lineage that includes Blastospora
smilacis Dietel, Hemileia vastatrix Berk. & Broome, and
Maravalia cryptostegiae (Cummins) Y. Ono (Chaconiaceae
fide Cummins and Hiratsuka 2003) near the base of the
Uredinales (see Fig. 1, no. 8).
The classification of Hemileia has been difficult, but it
has recently been allied with the Chaconiaceae (Cummins
and Hiratsuka 2003). Ono et al. (1986) recognized affinities
of this taxon with B. smilacis, including similar modes
of spore production within the sori. Thirumalachar and
Mundkur (1949a) suggested Blastospora was related to
Dietel’s (1928) tribe Hemileiae of the Pucciniaceae. The
members of Hemileia produce unusual urediniospores,
termed “hunchback” (Cummins and Hiratsuka 2003), that
probably indicate its monophyly. No spermogonial stages
have been discovered for any of the ∼50 known species of
Hemileia (Cummins and Hiratsuka 2003), or for Maravalia
cryptostegiae, which has a similar life cycle to H. vastatrix
(Evans 1993). The classification for Maravalia has been
equally problematic, and the genus has been formally trans-
ferred from the Raveneliaceae to the Chaconiaceae, al-
though its true affinities remain obscure (Ono 1984), and it
is potentially a polyphyletic genus (Cummins and Hiratsuka
2003). This study strongly supports the placement of
Hemileia and M. cryptostegiae within the Mikronegeriaceae
(Fig. 1, no. 8). The newly described monotypic genus
Desmosorus A. Ritschel, Oberw. & Berndt (2005), a Cen-
tral and South American orchid rust with suprastomatal
sori and Hemileia-like urediniospores and no known
spermogonial stage, is probably also allied within the
Mikronegeriaceae. Olivea scitula, another chaconiaceous
rust for which the spermogonial stage is unknown (Ono and
Hennen 1983), forms part of this lineage in ML analyses but
not in MP analyses.
All analyses consistently place Caeoma torreyae as
the most basal of the Uredinales sampled (Fig. 1). No
telial stage is known for C. torreyae, which produces
spermogonia on Torreya californica Torr. (Taxales:
Taxaceae) (Bonar 1951). Two known teleomorphic rusts
produce spermogonia on non-Pinaceae gymnosperms:
Mikronegeria alba (Cupressaceae) and M. fagi (Dietel &
Neger) Dietel (Araucariaceae) (Peterson and Oehrens
1978). Similarities in the simple spermogonia of these three
taxa have been previously noted (Peterson and Oehrens
1978).
In conclusion, the data presented in this study indicate
that rust phylogeny, at least at the family level, has been
strongly influenced by host associations, and that morpho-
logical characters typically emphasized in rust taxonomy
are often the result of convergent evolution coupled with
the plastic life cycles typical of the order. The findings
that the Mikronegeriaceae along with some short-cycled
chaconiaceous species and C. torreyae represent the most
basal rusts sampled suggests that the ancestors to the
extant rusts may have been tropical species with simple
teliospores. The earliest probable fossil record for a rust
spore dates to ∼300mya (Tiffney and Barghoorn 1974),
which is considerably older than molecular clock-based es-
timates of ∼150mya (Wingfield et al. 2004). The association
between the basalmost rusts in these analyses and gymno-
sperm lineages suggest an estimate for the extant rusts of
radiation in the Triassic (∼250mya) concurrent with the
rise of the Araucariaceae and Taxales, and predating the
breakup of Pangaea.
Taxonomy
Uredinineae Aime, subord. nov.
Familia typica: Pucciniaceae Chevall. [as “Puccinieae”],
Flore Gén. Env. Paris 413 (1826).
Biologia variabilis. Spermogonia e turma VI (typis 5, 7), V
(4), et IV (6, 8, 10, 11). Aecia heteroecia in angiospermas.
Aeciosporae variabiles. Uredinia variabilia. Uredinio-
sporae variabiles. Telia variabilia. Teliosporae typice
pedicellatae, 1 multicellulares.
Life cycle variable. Spermogonia Group VI (type 5, 7),
Group V (type 4), and Group IV (6, 8, 10, 11). Aecia of
heteroecious species on angiosperms. Aeciospores, ure-
dinia, urediniospores, and telia variable. Teliospores typi-
cally pedicellate, 1- to multicelled.
Melampsorineae Aime, subord. nov.
Familia typica: Melampsoraceae Dietel, in Engler and
Prantl, Nat. Pflanzenfam. 1(1**): 38 (1897).
Plerumque heterociae et macrocyclicae. Spermogonia
e turma 1 (typis 1,2,3) vel II (9). Aecia heteroecia in
Pinaceas, pro parte maxima in Peridermium typo
vel Caeoma typo (interdum Milesia typo). Uredinia-
variabilia. Urediniosporae typice echinulatae. Telia
variabilia. Teliosprae typice sessiles non quiescentes,
basidiis externis.
Mostly heteroecious and macrocyclic. Spermogonia
Group I (type 1, 2, 3) or Group II (type 9). Aecia of hetero-
ecious species on Pinaceae, mostly Peridermium type
or Caeoma type (occasionally Milesia type). Uredinia vari-
able. Urediniospores typically echinulate. Telia variable.
Teliospores typically sessile; basidia usually external and
germinating without dormancy.
Mikronegeriineae Aime, subord. nov.
Familia typica: Mikronegeriaceae Cummins & Hirats., Illus.
Genera Rust Fungi. Rev. ed.: 13 (1983).

121
Biologia vulgo maxima ignota. Spermogonia e turma III
typo 12 (et fortasse V 4) ubi cognita. Aecia ubi cognita
typice, sed non semper, in arboribus coniferis non-Pinaceis.
Aeciosporae catenulatae. Uredinia pro parte maxima e
Uredo wel Wardia typis. Urediniosporae vulgo asymmetri-
cae, typice supra stomata, pori obscure. Telia typice simi-
lia urediniis. Teliosporae sessiles vel brevipedicellatae,
1-cellulares, pallidae, tenuibus parietibus, typice supra sto-
mata; basidia externa vel semiinterna, typicenon quie-
scentes, germinantes per apicalem extensionem.
Life cycles incompletely known for many. Spermogonia
Group III type 12 (and possibly Group V, type 4) where
known. Aecia where known typically, but not always, on
non-Pinaceae conifers. Aeciospores catenulate. Uredinia
mostly Uredo- or Wardia type. Urediniospores usually
asymmetrical, typically suprastomatal, pores obscure. Telia
typically as uredinia. Teliospores sessile or short-pedicillate,
1-celled, pale, thin-walled, typically suprastomatal; basidia
external or semi-internal, typically germinating without
dormancy by apical extension.
Acknowledgments I am extremely grateful to my technician, Cindy
Park, for excellent laboratory assistance. I am also grateful for the
laboratory support of Malcolm DeCruise and for assistance with cata-
loging specimens provided by Allison Le and Allison Kennedy. I thank
Ernest Delfosse for continued support of the rust program at SBML.
Dave Farr created invaluable databases that I use daily. Ian Thompson
(Arthur Herbarium, Purdue University, IN) and Erin McCray (US
National Fungus Collections, Beltsville, MD) have been especially
helpful in providing access to herbarium material for study. I am in-
debted to the many individuals who have collected rusts from which
sequences were obtained for this study: Günter Arnold, Reinhard
Berndt, Lisa Castlebury, Michael Deadman, Harry Evans, Dave and
Ellen Farr, José Hernández, Gopal Kapooria, Oliver Mhembere, John
Olive, Libby Roberts, Amy Rossman, Markus Scholler, Mikhail
Sogonov, Bob Stack, Radames Urtiaga; to Talo Pastor-Corrales for
access to the urediniospore collection of James Stavely; and BRIP
(Plant Pathology Herbarium, Australia). Host identification for
Coleosporium asterum and Kuehneola uredinis was kindly provided by
Ed Lickey. Thanks to Christian Feuillet for providing the Latin trans-
lations. Finally, I thank the reviewers of this manuscript, especially Lisa
Castlebury, Markus Scholler, Yoshitaka Ono, and Amy Rossman, for
their helpful suggestions and comments.
References
Arthur JC (1924) Fern rusts and their aecia. Mycologia 16:245–251
Arthur JC (1934) Manual of the rusts in United States and Canada.
Purdue Research Foundation, Lafayette, IN
Bessey EA (1950) Morphology and taxonomy of Fungi. Blakiston,
Philadelphia
Bonar L (1951) Two new fungi on Torreya. Mycologia 43:62–66
Buriticá P, Hennen J (1994) Familia Phakopsoraceae (Uredinales). 1.
Géneros anamórficos y teliomórficos. Rev Acad Colombiana Cien
Exact Fís Natu 19:47–62
Cummins GB, Hiratsuka Y (1983) Illustrated genera of rust fungi,
revised edition American Phytopathological Society, St. Paul, MN
Cummins GB, Hiratsuka Y (2003) Illustrated genera of rust fungi, 3rd
edn. American Phytopathological Society, St. Paul, MN
Cummins GB, Ramachar P (1958) The genus Physopella replaces
Angiopsora. Mycologia 50:741–744
Dietel P (1900) Uredinales. In: Engler A, Prantl K (eds) Die
natürlichen Pflanzenfamilien, vol 1. Engelmann, Leipzig, pp 546–553
Dietel P (1928) Uredinales. In: Engler A, Prantl K (eds) Die
Natürlichen Pflanzenfamilien, vol 2. Engelmann, Leipzig, pp 24–98
Durrieu G (1980) Phylogeny of Uredinales on Pinaceae. Rep Tottori
Mycol Inst 18:283–290
Eilam T, Bushnell WR, Anikster Y (1994) Relative nuclear DNA
content of rust fungi estimated by flow cytometry of propidium
iodide-stained pycniospores. Phytopathology 84:728–735
Evans H (1993) Studies on the rust Maravalia cryptostegiae, a potential
biological control agent of rubber-vine weed (Cryptostegia grandi-
flora, Asclepiadaceae: Periplocoideae) in Australia. I: Life-cycle.
Mycopathologia 124:163–174
Greuter W, McNeill J, Barrie FR, Burdet HM, Demoulin V, Filgueiras
TS, Nicolson DH, Silva PC, Skog JE, Trehane P, Turland NJ,
Hawksworth DL (2000) International code of botanical nomencla-
ture (St. Louis code). Regnum Vegetabile 138. Koeltz, Königstein
Hart JA (1988) Rust fungi and host plant coevolution: do primitive
hosts harbor primitive parasites? Cladistics 4:339–366
Hennen JF, Buriticá P (1980) A brief summary of modern rust taxo-
nomic and evolutionary theory. Rep Tottori Mycol Inst 18:243–256
Hennen JF, McCain JW (1993) New species and records of Uredinales
from the Neotropics. Mycologia 85:970–986
Hiratsuka Y (1990) Auriculariaceous “rust.” Rep Tottori Mycol Inst
28:25–30
Hiratsuka Y, Cummins GB (1963) Morphology of the spermogonia of
the rust fungi. Mycologia 55:487–507
Hiratsuka Y, Hiratsuka N (1980) Morphology of spermogonia and
taxonomy of rust fungi. Rep Tottori Mycol Inst 18:257–268
Hopple JS, Vilgalys R (1999) Phylogenetic relationships in the mush-
room genus Coprinus and dark-spored allies based on sequence data
from the nuclear gene coding for the large ribosomal subunit RNA:
divergent domains, outgroups, and monophyly. Mol Phylogenet
Evol 13:1–19
Jackson HS (1931) Present evolutionary tendencies and the origin of
life cycles in the Uredinales. Mem Torrey Bot Club 18:5–108
Kirk PM, Cannon PF, David JC, Stalpers JA (2001) Dictionary of the
fungi, 9th edn. CABI, Wallingford, UK
Kropp BR, Hansen DR, Wolf PG, Flint KM, Thomson SV (1997)
A study on the phylogeny of the dyer’s woad rust fungus and
other species of Puccinia from Crucifers. Phytopathology 87:565–
571
Laundon GF (1973) Uredinales. In: Ainsworth CG, Sparrow FK,
Sussman AS (eds) The Fungi, vol IVB. Academic, New York,
pp 247–279
Leppik EE (1955) Evolution of angiosperms as mirrored in the phylog-
eny of rust fungi. Arch Soc Zool Bot Fennicae Vanamo 9(Suppl):
149–160
Leppik EE (1972) Evolutionary specialization of rust fungi
(Uredinales) on the Leguminosae. Ann Bot Fenn 9:135–148
Leppik EE (1973) Origin and evolution of conifer rusts in the light of
continental drift. Mycopathol Mycol Appl 49:121–136
Linder DH (1944) A new rust of orchids. Mycologia 36:464–468
Long WH (1914) Influence of the host on the morphological characters
of Puccinia ellisiana and Puccinia andropogonis. J Agric Res 2:303–
319
Maier W, Begerow D, Weib M, Oberwinkler F (2003) Phylogeny of the
rust fungi: an approach using nuclear large subunit ribosomal DNA
sequences. Can J Bot 81:12–23
Mains EB (1934) Angiopsora, a new genus of rusts on grasses.
Mycologia 26:122–132
McCain JW, Hennen JF, Ono Y (1990) New host species and state
distribution records for North American rust fungi (Uredinales).
Mycotaxon 39:281–300
Moncalvo JM, Wang HH, Hseu RS (1995) Phylogenetic relationships
in Ganoderma inferred from the internal transcribed spacers and 25S
ribosomal DNA sequences. Mycologia 87:223–238
Ono Y (1984) A monograph of Maravalia (Uredinales). Mycologia
76:892–911
Ono Y, Buriticá P, Hennen JF (1992) Delimitation of Phakopsora,
Physopella and Cerotelium and their species on Leguminosae. Mycol
Res 96:825–850
Ono Y, Hennen JF (1983) Taxonomy of the Chaconiaceous genera
(Uredinales). Trans Mycol Soc Jpn 24:369–402
Ono Y, Kakishima M, Kudo A, Sato S (1986) Blastospora smilacis, a
teleomorph of Caeoma makinoi, and its sorus development.
Mycologia 78:253–262
Peterson RS, Oehrens E (1978) Mikronegeria alba (Uredinales).
Mycologia 70:321–331

122
Raciborski M (1909) Nalistne i pasrzytne grzyby Jawy: parasitische und
epiphytische Pilze Java’s. Bull Int Acad Sci Cracov Ser 1 (Sci Mat
Nat) 3:346–394
Ritschel A, Oberwinkler F, Berndt R (2005) Desmosrus, a new rust
genus (Uredinales). Mycol Prog 4:333–338
Savile DBO (1968) Parasite relationships and disposition of
Filipendula. Brittonia 20:230–231
Savile DBO (1976) Evolution of the rust fungi (Uredinales) as re-
flected by their ecological problems. Evol Biol 9:137–207
Savile DBO (1978) Paleoecology and convergent evolution in rust
fungi (Uredinales). BioSystems 10:31–36
Scholler M, Aime MC (2006) On some rust fungi (Uredinales)
collected in an Acacia koa-Metrosideros polymorpha woodland,
Mauna Loa Road, Big Island, Hawaii. Mycoscience 47:159–
165
Sjamsuridzal W, Nishida H, Ogawa H, Kakishima M, Sugiyama
J (1999) Phylogenetic positions of rust fungi parasitic on ferns:
evidence from 18S rDNA sequence analysis. Mycoscience 40:21–
27
Strimmer K, von Haeseler A (1996) Quartet puzzling: a quartet maxi-
mum-likelihood method for reconstructing tree topologies. Mol Biol
Evol 13:964–969
Swofford DL (2002) PAUP*: phylogenetic analysis using parsimony
(*and other methods), version 4. Sinauer, Sunderland, MA
Sydow P, Sydow H (1915) Monographia Uredinearum, vol III.
Pucciniaceae (excl. Puccinia et Uromyces) – Melampsoraceae –
Zaghouaniaceae – Coleosporiaceae. Lipsiae, Fratres Borntraeger
Thirumalachar MJ, Cummins GB (1949) The taxonomic significance of
sporogenous basal cells in the Uredinales. Mycologia 41:523–526
Thirumalachar MJ, Mundkur BB (1949a) Genera of rusts I. Ind
Phytopathol 2(1):65–101
Thirumalachar MJ, Mundkur BB (1949b) Genera of rusts II. Ind
Phytopathol 2(2):1–52
Tiffney BH, Barghoorn ES (1974) The fossil record of the fungi. Occas
Pap Farlow Herb 7:1–42
Vilgalys R, Hester M (1990) Rapid genetic identification and mapping
of enzymatically amplified ribosomal DNA from several Cryptococ-
cus species. J Bacteriol 172:4238–4246
Walker J (2001) A revision of the genus Atelocauda (Uredinales) and
description of Racospermyces gen. nov. for some rusts of Acacia.
Australas Mycol 20:3–29
White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct
sequencing of fungal ribosomal RNA genes for phylogenetics. In:
Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds) PCR protocols:
a guide to methods and applications. Academic Press, San Diego,
pp 315–322
Wingfield BD, Ericson L, Szaro T, Burdon JJ (2004) Phylogenetic
patterns in the Uredinales. Australas Plant Pathol 33:327–335