ChapterPDF Available

Development of Sensors to Trace Toxins from Dinoflagellates and Other Algae to Seafood

June 2008
NATO Security through Science Series C: Environmental Security

June 2008

DOI:10.1007/978-1-4020-8480-5_14

In book: Algal Toxins: Nature, Occurrence, Effect and Detection (pp.301-310)

Authors:

Patrizia Albertano

University of Rome Tor Vergata

Roberta Congestri

University of Rome Tor Vergata

Danila Moscone

University of Rome Tor Vergata

Show all 5 authorsHide

Sensor technology based on immunological ELISA analyses combined with various electrochemical detection systems is being developed to quantify phycotoxins in algae and seafood. The use of disposable screen-printed electrodes for the immunosensor development is illustrated. Laboratory responses on contaminated mussels were obtained by domoic acid and saxitoxin sensors with detection limit of 5 and 0.1 ng/ml respectively. Application to algal extracts was also performed to detect domoic acid concentration in phytoplankton populations along Latium (Middle Tyrrhenian Sea, Mediterranean Sea) coast.

Content uploaded by Danila Moscone

Content may be subject to copyright.

Algal Toxins: Nature, Occurrence, Effect

and Detection

This Series presents the results of scientific meetings supported under the NATO

Advanced Research Workshops (ARW) are expert meetings where an intense but

informal exchange of views at the frontiers of a subject aims at identifying directions for

future action

re-organised. Recent volumes on topics not related to security, which result from meetings

supported under the programme earlier, may be found in the NATO Science Series.

Sub-Series

D. IOS Press

IOS Press

http://www.nato.int/science

http://www.iospress.nl

Springer

E. Human and Societal Dynamics

Springer

http://www.springer.com

The Series is published by IOS Press, Amsterdam, and Springer, Dordrecht, in conjunction

with the NATO Public Diplomacy Division.

A. Chemistry and Biology

C. Environmental Security

B. Physics and Biophysics

and Mediterranean Dialogue Country Priorities. The types of meeting supported are

generally "Advanced Study Institutes" and "Advanced Research Workshops". The NATO

SPS Series collects together the results of these meetings. The meetings are co-

organized by scientists from NATO countries and scientists from NATO's "Partner" or

"Mediterranean Dialogue" countries. The observations and recommendations made at

the meetings, as well as the contents of the volumes in the Series, reflect those of parti-

cipants and contributors only; they should not necessarily be regarded as reflecting NATO

views or policy.

latest developments in a subject to an advanced-level audience

Advanced Study Institutes (ASI) are high-level tutorial courses intended to convey the

Following a transformation of the programme in 2006 the Series has been re-named and

NATO Science for Peace and Security Series

Programme: Science for Peace and Security (SPS).

Defence Against Terrorism; (2) Countering other Threats to Security and (3) NATO, Partner

The NATO SPS Programme supports meetings in the following Key Priority areas: (1)

Information and Communication Security

Series A: Chemistry and Biology

Published in cooperation with NATO Public Diplomacy Division

edited by

Effect

and Detection

Valtere Evangelista

Pisa, Italy

Laura Barsanti

Paolo Gualtieri

CNR Institute of Biophysics,

Algal Toxins: Nature, Occurrence,

Anna Maria Frassanito

Vincenzo Passarelli

ublished b

Sprin

er,

rinted on acid-free

All Rights Reserve

n any form or by any means, electronic, mechanical, photocopying, microfilming,

any material supplied speci

ically

or the purpose o

being entered

and executed on a computer system,

or exclusive use by the purchaser o

the work.

No part of this work may be reproduced, stored in a retrieval system, or transmitted

www.springer.com

recording or otherwise, without written permission from the Publisher, with the exception

P.O. Box 17, 3300 AA Dordrecht, The Netherlands.

Sensor Systems for Biological Threats:

The Algal Toxins Case

Proceedings of the NATO Advanced Study Institute on

Pisa, Italy

30 September – 11 October 2007

ISBN 978-1-4020-8480 -5 (e-book)

ISBN 978-1-4020-8479- 9 (PB)

ISBN 978-1-4020-8478-2 (HB)

Library of Congress Control Number: 2008928517

CONTENTS

Preface........................................................................................................ vii

The World of Algae ..................................................................................... 1

L. Barsanti, P. Coltelli, V. Evangelista, A.M. Frassanito,

V. Passarelli, N. Vesentini and P. Gualtieri

Cyanobacterial Diversity in Relation to the Environment ......................... 17

B.A. Whitton

Toxicity of Fresh Water Algal Toxins to Humans and Animals................ 45

A. Zaccaroni and D. Scaravelli

Toxicity of Sea Algal Toxins to Humans and Animals ............................. 91

A. Zaccaroni and D. Scaravelli

The Role of Allelopathy for Harmful Algae Bloom Formation............... 159

E. Granéli, P.S. Salomon and G.O. Fistarol

Checklist of Phytoplankton on the South Coast of Murcia

(SE Spain, SW Mediterranean Sea) .........................................................

N. Bouza and M. Aboal

Toxic Pseudo-nitzschia Populations from the Middle Tyrrhenian Sea

R. Congestri, S. Polizzano and P. Albertano

Algal Blooms in Estonian Small Lakes ...................................................

A. Rakko, R. Laugaste and I. Ott

Comparative Estimation of Sensor Organisms Sensitivity

P. Gualtieri and T. Parshykova

179

(Mediterranean Sea, Italy)........................................................................ 197

211

for Determination of Water Toxicity ....................................................... 221

CONTENTS

Biochemical Method for Quantitative Estimation of Cyanobacteria

L.A. Sirenko and T.V. Parshykova

Using of Laser-doppler Spectrometry for Determination of Toxicity

V. Vlasenko, T. Parshykova and V. Tretyakov

PCR Techniques as Diagnostic Tools for the Identification

A. Penna and L. Galluzzi

S. Diercks, K. Metfies, F. Schröder, L.K. Medlin and F. Colijn

Development of Sensors to Trace Toxins from Dinoflagellates

P. Albertano, R. Congestri, L. Micheli, D. Moscone

and G. Palleschi

Recombinant Formaldehyde Dehydrogenase and Gene-engineered

Methylotrophic Yeasts as Bioanalitycal Instruments for Assay

G. Gayda, O. Demkiv, S. Paryzhak, W. Schuhmann

and Ɇ. Gonchar

A. Scozzari

L. Barsanti, P. Coltelli, V. Evangelista, A.M. Frassanito,

V. Passarelli, N. Vesentini and P. Gualtieri

Toxins ...................................................................................................... 235

Degree of Chemical and Natural Compounds.......................................... 247

and Enumeration of Toxic Marine Phytoplankton Species...................... 261

Detection of Phytoplankton with Nucleic Acid Sensors.......................... 285

and other Algae to Seafood...................................................................... 301

of Toxic Formaldehyde............................................................................ 311

Electrochemical Sensing Methods: A Brief Review................................ 335

Oddities and Curiosities in the Algal World............................................ 353

Index ........................................................................................................ 393

List of Contributors.................................................................................. 397

PREFACE

This volume contains the lectures and seminars given at the NATO

Advanced Study Institute on “Sensor Systems for Biological Threads: The

Algal Toxins Case”, held in Pisa, Italy in October, 2007. The Institute was

sponsored and funded by the Scientific Affairs Division of NATO. It is my

pleasant duty to thank this institution.

This ASI offered updated information on how far the research on algal

toxins has gone in the exploration of structures, biosynthesis and regulation

of toxins, and the development of technology for bio-monitoring these com-

pounds.

Algae can form heavy growths in ponds, lakes, reservoirs and slow-

moving rivers throughout the world; algae can house toxins which are us-

ually released into water when the cells rupture or die. Hundreds of toxins

have been identified so far. Detection methods, including rapid screening,

have been developed to help us learning more about them, especially to find

out which toxins are a real threat for people and what conditions encourage

their production and accumulation. Early detection of algal toxins is an im-

portant aspect for public safety and natural environment, and significant

efforts are underway to develop effective and reliable tools that can be used

for this purpose.

A quick reacting biosensor simple to use has been a goal for many

years. There are four main challenges that must be dealt with in the choice

of naturally occurring biosensors: identification of a commonly occurring

viable biosensor, establishment of a reliable method for monitoring and col-

lecting data on the biosensor, protocols for the analysis and interpretation

of the data collected, and packaging the system so that it could move out of

the lab environment and into the field. This book will offer updated infor-

mation on the development of automated systems for in situ detection of

harmful algae and their toxin. Moreover, this book will offer a large amount

of data by using a multidisciplinary approach strategy, which utilizes not

only physical, chemistry and engineering sciences, but also biological

The first part of the book deals with a general overview of the toxins

and toxicity related to the algal world, whereas the second part deals with

uses and applications of the different kind of sensors so far developed. The

first part includes an introduction on the main algal features written by our

group; than, Professor Whitton describes the diversity of the cyanobacteria,

information.

vii

PREFACE

viii

phenomenon, i.e. any influence on the growth and development of natural

description of toxic algal blooms in several European geographical areas by

Dr. Congestri, Dr. Rakko and Dr. Bouza.

sms, the use of biochemical methods and laser Doppler techniques for toxin

determination presented by Professor Parshykova; the use of nucleic acid

sensor sensors for identification of toxic species illustrated by Dr. Penna

and Dr. Dierks; the use of immunological ELISA analyses combined with

various electrochemical detection systems to quantify algal toxins tested by

Professor Albertano; a review by Dr. Scozzari on sensors based on electro-

I do hope this book has caught the spirit in which the ASI was conceived.

Toxins Case”.

chemical methods, and a gene-engineered yeast usable as biochemical ins-

The second part of the book deals with the review of sensor organi-

trument for toxin assessment by Dr. Gonchar.

systems produced by the algae metabolites. The first part ends with the

Director of the ASI “Sensor Systems for Biological Threads:

The Algal

Paolo Gualtieri

algal toxins; Professor Graneli and Doctor Fistarol describe the allelophaty

the algal division that possesses more toxic species, in relation to the environ-

ment; Dr. Zaccaroni gives us an overview on the fresh water and marine

V. Evangelista et al. (eds.), Algal Toxins: Nature, Occurrence, Effect and Detection. 1

THE WORLD OF ALGAE

LAURA BARSANTI

, PRIMO COLTELLI

, VALTERE

EVANGELISTA

, ANNA MARIA FRASSANITO

VINCENZO PASSARELLI

, NICOLETTA VESENTINI

AND PAOLO GUALTIERI

Istituto di Biofisica C.N.R.,

Istituto Scienza e Tecnologia

dell’ Informazione C.N.R.,

Istituto di Fisiologia Clinica C.N.R.

Area della Ricerca di Pisa, Via Moruzzi 1, 56124, Pisa, Italy

outline of some algae characteristics and general information on their classi-

fication, distribution, structure, nutrition and reproduction. In the last para-

graph a short account on the origin of eukaryotic algae is set out.

1. Introduction

In the following sections of this chapter we will try to give an outline of

some algae characteristics and general information on their classification,

distribution, structure, nutrition and reproduction. In the last paragraph a

short account on the origin of eukaryotic algae is set out. Some of the most

peculiar and interesting features mentioned in these pages will be discussed

with more details in the last chapter of the book. Although the term algae

has no formal taxonomic standing, it is nevertheless routinely used to indi-

cate a polyphyletic and artificial assemblage, of O

–evolving, photosynthetic

organisms. Then, how can we distinguish algae from plants? The answer is

quite easy since the similarities we have listed between algae and plants are

much fewer than their differences. Actually, plants exhibit an elevated level

of differentiation (e.g. roots, leaves, stems, xylem/phloem vascular network);

______

*To whom correspondence should be addressed. Paolo Gualtieri, Istituto di Biofisica C.N.R., Area

della Ricerca di Pisa, Via Moruzzi 1, 56124, Pisa, Italy. Email: paolo.gualtieri@pi.ibf.cnr.it

Abstract: In the following sections of this chapter we will try to give an

Keywords: Algae, endosymbiosis theory, pigments distribution

L. BARSANTI ET AL.

their reproductive organs are surrounded by a jacket of sterile cells; their

multicellular diployd embryonic development is dependent on the parental

gametophyte for a significant length of time (and this feature is the source

of the name embryophytes given to plants); they exhibit tissue-generating

parenchymatous meristems at the shoot and root apices which give rise to

widely differentiating tissues and, last but not least, all plants have exclu-

sively a sexual reproduction with an alternation between a haploid game-

tophyte and a diploid sporophyte. Algae do not form embryos, all the cells

of their reproductive structures are potentially fertile and sterile cells with

protective function are absent; parenchymatous development is present only

in some groups and, finally, they exhibit both sexual and asexual reproduc-

tion. Moreover, in contrast with the uniformity of vascular plants, algae occur

in many dissimilar forms such as microscopic single cell, macroscopic multi-

cellular loose, or filmy conglomerations, matted or branched colonies, or more

complex leafy or blade forms. Same environmental pressure led to the parallel,

independent evolution of similar traits in both plants and algae, while the

transition from relatively stable aquatic environment to a gaseous medium ex-

posed plants to new physical conditions that resulted in key physiological

and structural changes necessary to be able to invade upland habitats and

fully exploit them.

The profound diversity of size ranging from picoplankton only 0.2–2.0

µm in diameter to giant kelps with fronds up to 60 m in length, ecology and

colonized habitats, cellular structure, levels of organization and morphology,

pigments for photosynthesis, reserve and structural polysaccharides, type of

life history, reflects the varied evolutionary origins of this heterogeneous

assemblage of organisms, including both prokaryote and eukaryote species.

The term algae refers to macroalgae and a highly diversified group of micro-

organisms known as microalgae. The number of algal species has been esti-

mated at between one to ten million, and most of them are microalgae

(Barsanti and Gualtieri, 2006).

2. Classification

No easily definable classification system acceptable to all exists for algae,

since taxonomy is under constant and rapid revision at all levels following

every day new genetic and ultrastructural evidence. Keeping in mind that

the polyphyletic nature of the algal group is somewhat inconsistent with

traditional taxonomic groupings, and that taxonomyc opinion may change

as information accumulates, we will adopt a tentative scheme of classi-

Graham and Wilcox (2000), Lewin, 2002 (Table 1).

fication mainly based on that of Van Den Hoek et al. (1995), and compared

with the classifications of Bold and Wynne (1978), Margulis et al. (1990),

THE WORLD OF ALGAE

TABLE 1. Classification scheme of the different algal groups.

3. Distribution and Occurrence

Distribution of algae can be aquatic or subaerial, when they are exposed to

the atmosphere rather than being submerged in water. Aquatic algae are

found almost anywhere from freshwater spring to salt lakes, with tolerance

Kingdom Division Class

Cyanophyta Cyanophyceae

PROKARYOTA

EUBACTERIA

Prochlorophyta Prochlorophyceae

Glaucophyta Glaucophyceae

Bangiophyceae

Rhodophyta

Florideophyceae

Chrysophyceae

Xanthophyceae

Eustigmatophyceae

Bacillarophyceae

Raphidophyceae

Dictyochophyceae

Heterokontophyta

Phaeophyceae

Haptophyta Haptophyceae

Cryptophyta Cryptophyceae

Dinophyta Dinophyceae

Euglenophyta Euglenophyceae

Chlorarachniophyta Chlorarachniophyceae

Prasinophyceae

Chlorophyceae

Ulvophyceae

Cladophorophyceae

Bryopsidophyceae

Zygnematophyceae

Trentepohliophyceae

Klebsormidiophyceæ

Charophyceae

EUKARYOTA

Chlorophyta

Dasycladophyceae

L. BARSANTI ET AL.

They can be either planktonic, as is the case of most unicellular species,

living suspended throughout the lighted regions of all water bodies includ-

ing under ice in polar areas, or they can be benthonic, living attached to the

bottom or within sediments, limited to shallow areas because of the rapid

attenuation of light with depth. Benthic algae can grow attached on stones

(epilithic), on mud or sand (epipelic), on other algae or plants (epiphytic) or

on animals (epizoic). On the basis of their growth habits, marine algae are

designated as supralittoral, when they grow above the high tide-level, within

reach of waves and spray; intertidal, when they grow on shores exposed to

tidal cycles, or sublittoral, when they grow in the benthic environment from

the extreme low-water level to around 200 m deep, in the case of very clear

water (Bourelly, 1966, 1968, 1970).

Oceans contain more than 5000 species of planktonic microscopic algae,

the phytoplankton, which forms the base of the marine food chain and pro-

duces roughly 50% of the oxygen we inhale. However, phytoplankton may

become a cause of death when the population increases in response to pollu-

tion with nutrients such as nitrogen and phosphate and it’s blooms reduce

the water transparency, causing the death of other photosynthetic organisms.

They are often responsible for massive fish and bird kills, producing poisons

and toxins (Tilden, 1935). The cause and effect of pollution and algal blooms,

the toxins produced by algae and their outcome as well as the sensors adopted

to detect these phenomena will be the issue of the other chapters of this book.

The temperate pelagic marine environment is also the realm of giant algae,

the kelp. These algae have thalli up to 60 meter long, and the community can

be so crowded that it forms a real submerged forest. The kelp not only in-

habits temperate waters but may also form luxuriant thickets beneath polar ice

sheets, and can survive at very low depth. Internal freshwater environment dis-

play a wide diversity of form of microalgae, although not exhibiting the pheno-

menal size range of their marine relatives. Freshwater phytoplankton and the

A considerable number of subaerial algae have adapted to life on land.

The activities of land algae are thought to convert rock into soil, to mini-

mize soil erosion, to increase water retention and nutrient availability for

plants growing nearby. Algae also form mutually beneficial partnership with

other organisms. They live with fungi to form lichens, or inside the cells of

reef-building corals, in both cases providing oxygen and complex nutrients

to their partner, and in return receiving protection and simple nutrients. This

arrangement enables both partners to survive in conditions that they could

not endure alone.

The different type of habitat colonized by the algae of the divisions is

shown in Table 2.

benthonic algae form the base of the aquatic food chain.

for a broad range of pH, temperature, turbidity, O

and CO

concentration.

THE WORLD OF ALGAE

TABLE 2. Distribution of algal divisions. (n.d.: not detected).

Habitat

Division

Marine Freshwater Terrestrial Symbiotic

Cyanophyta yes yes yes yes

Prochlorophyta yes n.d. n.d. yes

Glaucophyta n.d. yes yes yes

Rhodophyta yes yes yes yes

Heterokontophyta yes yes yes yes

Haptophyta yes yes yes yes

Cryptophyta yes yes n.d. yes

Chlorarachniophyta yes n.d. n.d. yes

Dinophyta yes yes n.d. yes

Euglenophyta yes yes yes yes

Chlorophyta yes yes yes yes

4. Structures

On the basis of thallus structure algae may have a unicellular, filamentous,

siphonous or parenchimatous organization. Examples of the distinctive morp-

hological characteristics within different divisions are set forth in Tables 3–5.

TABLE 3. Thallus morphology in the different algal divisions. (n.a.: not available; n.d.: not

detected).

Division Unicellular and non-motile Unicellular and motile

Cyanophyta Synechococcus n.d.

Prochlorophyta Prochloron n.d.

Glaucophyta Glaucocystis Gloeochaete

Rhodophyta Porphyridium n.d.

Heterokontophyta Navicula Ochromonas

Haptophyta n.d. Chrysochromulina

Cryptophyta n.d. Cryptomonas

Dynophyta Dinococcus Gonyaulax

Euglenophyta Ascoglena Euglena

Chlorarachniophyta n.d. Chlorarachnion

Chlorophyta Chlorella Dunaliella

L. BARSANTI ET AL.

TABLE 4.Thallus morphology in the different algal divisions. (n.a.: not available; n.d.: not

detected).

Division Colonial and non-motile Colonial and motile

Cyanophyta Anacystis n.d.

Prochlorophyta n.d. n.d.

Glaucophyta n.d. n.d.

Rhodophyta Cyanoderma n.d.

Heterokontophyta Chlorobotrys Synura

Haptophyta n.d. Corymbellus

Cryptophyta n.d. n.d.

Dynophyta Gloeodinium n.d.

Euglenophyta Colacium n.d.

Chlorarachniophyta n.d. n.d.

Chlorophyta Pseudosphaerocystis Volvox

TABLE 5. Thallus morphology in the different algal divisions. (n.a.: not available; n.d.: not

detected).

Division Filamentous Siphonous Parenchimatous

Cyanophyta Calothrix n.d. Pleurocapsa

Prochlorophyta Prochlorothrix n.d. n.d.

Glaucophyta n.d. n.d. n.d.

Rhodophyta Goniotricum n.d. Palmaria

Heterokontophyta Ectocarpus Vaucheria Fucus

Haptophyta n.d. n.d. n.d.

Cryptophyta Bjornbergiella n.d. n.d.

Dynophyta Dinoclonium n.d. n.d.

Euglenophyta n.d. n.d. n.d.

Chlorarachniophyta n.d. n.d. n.d.

Chlorophyta Ulothrix Bryopsis Ulva

Many algae are solitary cells, with or without flagella, hence motile or

non-motile. Other algae exist as aggregates of several to many single cells

held together loosely or in a highly organized fashion, the colony. In this

type of aggregate, cell number is indefinite, growth occurs by cell division

of its components, there is no division of labor and each cell can survive on

its own. When the number and arrangement of cells are determined at the

THE WORLD OF ALGAE

time of origin of the colony, and remain constant during the life span period

of the individual colony, the colony is termed coenobium; this can or can

not be motile.

The characteristic filaments of filamentous algae result from cell division

in the plane perpendicular to the axis of the filament, and have cell chains

consisting of daughter cells connected to each other by their end wall. Fila-

ments can be simple, or, otherwise, have false or true branching; they may

be uniseriate or multiseriate, consisting respectively of a single or multiple

layer of cells.

Siphonous algae are characterized by a siphonous or coenocytic cons-

truction, consisting of tubular filaments lacking transverse cell walls. These

algae undergo repeated nuclear division without forming cell walls; hence

they are unicellular, but multinucleate (or coenocytic).

Parenchimatous, as well as pseudoparenchimatous algae are mostly macro-

scopic with tissue of undifferentiated cells and growth originating from a

meristem with cell division in three dimensions. In the case of parenchy-

matous algae, cells of the primary filament divide in all directions, and any

essential filamentous structure is lost. This tissue organization is present in

many of the brown algae. Pseudoparenchymatous algae are made up of a

loose or close aggregation of numerous, intertwined, branched filaments

that collectively form the thallus, held together by mucilages, especially

in red algae. Thallus construction is entirely based on a filamentous con-

struction with little or no internal cell differentiation.

5. Nutrition

In consideration of their general definition, most algal groups should be

considered photoautotrophs, i.e. depending entirely upon their photosyn-

thetic apparatus for their metabolic necessities, using sun light as source of

energy, and CO

as carbon source to produce carbohydrates and ATP. Most

algal divisions contain colorless heterotropic species that can obtain organic

carbon from the external environment, either by taking up dissolved sub-

stances (osmotrophy) or by engulfing bacteria and other cells as particulate

prey (phagotrophy) (Graham and Wilcox, 2000). Algae incapable of syn-

thesizing essential components such as the vitamins of the B

complex, or

fatty acids, and have to import them are defined auxotrophic.

Actually, algae are mixotrophic organisms, that is, they are competent to

use a complex spectrum of nutritional strategies, combining photoautotro-

phy and heterotrophy. The relative contribution of either nutritional strategy

within mixotrophic species varies along a gradient from algae whose do-

minant mode of nutrition is phototrophy, through those for which photo-

trophy or heterotrophy provide essential nutritional supplements, to those

L. BARSANTI ET AL.

for which heterotrophy is the dominant strategy. Some mixotrophs are

mainly photosynthetic and only occasionally use an organic energy source.

Others meet most of their nutritional demand by phagotrophy, but may use

some of the products of photosynthesis from sequestered prey chloroplasts

(Jones, 2000). Photosynthetic fixation of carbon and use of particulate food

as a source of major nutrients (nitrogen, phosphorus and iron) and growth

factors (e.g. vitamins, essential amino acids, and essential fatty acids) can

enhance growth, especially in extreme environments where resources are

limited. Heterotrophy can be important for the acquisition of carbon when

light is limiting and, conversely, autotrophy can maintain a cell during

periods when particulate food is scarce.

Algae that derive their nutriment from prey, but are capable, in lack of

the latter, of sustaining themselves by phototropy are said obligate hetero-

trophic -it is the case, for example, of Gymnodium gracilentum, Dynophyta.

On the other hand, algae that obtain energy primarily from sunlight and

carbon from CO

, but in case of limiting light, are capable of opting for

phagotrophy and/or osmotrophy are named obligate phototrophic.

Algae that, depending on the environmental conditions, grow equally

well as photoautotrophs or heterotrophs are called facultative mixotrophic,

while algae that are mainly photoautotrophs, but require for their survival

nutriments obtained via phagotrophy and/or osmotrophy, are named obligate

mixotrophic algae.

6. Reproduction

Methods of reproduction in algae may be vegetative by division of a single

cell or fragmentation of a colony, asexual by production of motile spore, or

sexual by union of gametes. Sexual mode involves plasmogamy (union of

cells), karyogamy (union of nuclei), chromosome/gene association, and

meiosis, resulting in genetic recombination. Vegetative and asexual modes

provide a fast and economical means of increasing the number of individuals

and grant the stability of an adapted genotype within a species from a gener-

ation to the next, although genetic variability is restricted. On the other

hand, sexual reproduction allows variation but is more costly, because of the

waste of gametes that fail to mate.

The simplest form of reproduction is by binary fission. In this mode of

reproduction, which is, for example, that of Euglena (Euglenophyta), the

parent organisms divide into two equal parts, each having the same hereditary

information as the parents. In unicellular algae cell division may be longi-

tudinal or transverse. The growth of the population follows a typical curve

consisting of a lag phase, an exponential or log phase, and a stationary or

plateau phase, where increase in density has leveled off.

THE WORLD OF ALGAE

Another method of asexual reproduction is by formation of zoospores.

These, that are typical, for example, of Chlamydomonas (Chlorophyta) are

flagellate motile spores produced within a parental vegetative cell. Spores

that begin their development within the parent cell wall and are released

still partially undeveloped, are named aplanospores. The latter have no

flagellum, but may develop it, and thus be unrecognizable form zoospores.

Finally, spores that are almost perfect replicas of the vegetative cells that

produce them but do not develop flagella are named autospores. Examples

of autospore forming genera are Nannochloropsis (Heterokontophyta) and

Chlorella (Chlorophyta). Spores may be produced within and by ordinary

vegetative cells or within specialized cells or structures called sporangia.

The reproductive mode of coenobia or colonies is named autocolony

formation. This kind of reproduction implies that each cell within the colony

can produce a new colony similar to the one to which it belongs. Thus, cell

division gives rise no longer to unicellular individuals, but to multicellular

groups: a sort of embryonic colony that differs from the parent in cell size

but not in cell number. This is the reproductive mode of green algae such as

Volvox (Chlorophyta) and Pediastrum (Chlorophyta).

Vice versa, non-coenobic colonies reproduce themselves via fragment-

ation: that is filaments break into two or more fragments that develop into

new individuals.

Sexual reproduction involves, of course, gamete formation. Gametes may

be morphologycally identical with vegetative cells or markedly differ from

them, depending upon the algal group. The main difference is obviously the

DNA content that is haploid instead of diploid. Different combinations of

gamete types are possible. In the case of isogamy, gametes are both motile

and indistinguishable. When the two gametes differ in size, we have hetero-

gamy. This combination occurs in two types: anysogamy, where both gametes

are motile, but one is small (sperm) and one is large (egg); oogamy, when only

one gamete is motile (sperm), and fuses with the other that is non-motile and

very large (egg).

Algae exhibit three different life cycles with variation inside the dif-

ferent groups. The main difference is the point where meiosis occurs and the

type of cells it produces, and whether or not there is more than one free-

living stage present in the life cycle.

In the haplontic or zygotic life cycle the predominant vegetative state is

haploid and meiosis takes place upon germination of the zygote. The oppo-

site comes about in the diplontic or gametic life cycle, in which the predomi-

nant vegetative state is diploid and meiosis gives rise to haploid gametes. The

former mode of reproduction is typical, for example of Chlamydomonas

(Chlorophyta) and the latter of Diatoms and Fucus (Heterokonphyta). In dip-

lohaplontic or sporic life cycles there is an alternation of generation between

L. BARSANTI ET AL.

the two phases of haploid gametophyte and diploid sporophyte. The former

produces gametes by mitosis and the fomer spores by meiosis. Alternation of

generation can be isomorphic – morphologically identical – (as is the case

in Ulva (Chlorophyta)) or heteromorphic with predominance of either the

Porphiria (Rhodophyta)).

Under unfavorable conditions, such as shortage of environmental nutrients,

cells, such as hypnospores, hypnozygotes, statospores, and akinetes. Resting

stages represent a survival strategy and resting cells may dwell in sediments

for many years, enduring very harsh conditions, and remain viable to assure

the continuance of the species. When suitable conditions for vegetative growth

are restored, the akinete germinates into new vegetative cells.

7. Origin of Eukaryotic Algae

Cyanobacteria are the living procariotic ancestors of algae. Cyanobacteria

evolved more than 2.8 billion years ago and have played fundamental roles

in driving much of the ocean carbon, oxygen and nitrogen fluxes from that

time to present. The evolution of cyanobacteria was a major turning point in

biogeochemistry of Earth. Prior to the appearance of these organisms, all

photosynthetic organisms were anaerobic bacteria that used light to couple

the reduction of carbon dioxide to the oxidation of low free energy mole-

cules, such as H

S or preformed organics. Cyanobacteria developed a meta-

bolic process, the photosynthesis, that exploits the energy of visible light to

oxidize water and simultaneously reduces CO

to organic carbon represented

by (CH

O)n using light energy as a substrate and chlorophyll a as a requisite

catalytic agent (Carr and Whitton, 1982). Formally oxygenic photosynthesis

can be summarized as:

+ H

O + light

Chlorophylla

> (CH

O)n + O

All other oxygenic producing algae are eukaryotic, that is they contain

internal organelles, including a nucleus, one or more chloroplasts (Marin,

2004), one or more mitochondria, and, most importantly, in many cases

they contain a membrane bound storage compartment or vacuole.

Historically, the major groups of algae are classified into Divisions (the

equivalent taxon in the zoological code was the Phylum) on the basis of

pigmentation, chemical nature of photosynthetic storage product, photo-

synthetic membranes (thylakoids) organization and other features of the

chloroplasts, chemistry and structure of cell wall, number, arrangement and

ultrastructure of flagella (if any), occurrence of any other special features,

and sexual cycles. Recently, all the studies that compare the sequence of

sporophyte (e.g. Laminaria (Heterokontophyta)) or the gametophyte (e.g.

limiting light or desiccation, many algal groups produce thick walled resting

THE WORLD OF ALGAE

macromolecules genes and the 5S, 18S and 28S ribosomal RNA sequences

Smith, 2002; Lewis and McCourt, 2004). This confirms that these divisions

are non-artificial, even though they were originally defined on the basis of

summarize the main characteristics of the different algal divisions.

TABLE 6. The main pigments of the algal divisions.

tend to assess the internal genetic coherence of the major divisions (Cavalier-

morphology only (Van den Hoek et al., 1995). Table 6 and 7 attempt to

Division Pigments

chlorophylls phycobilins carotenoids xantophylls

Cyanophyta

c-Phycoerythrin

c-Phycocyanin

Allophycocyanin

ȕ-carotene

myxoxanthin

zeaxanthin

Prochlorophyta

a, b absent ȕ-carotene zeaxanthin

Glaucophyta

Phycoerythrocyanin

c-Phycocyanin

Allophycocyanin

ȕ-carotene zeaxanthin

Rhodophyta

r,b-Phycoerythrin

r-Phycocyanin

Allophycocyanin

Į-, and

ȕ-carotene

lutein

Cryptophyta

a, c

Phycoerythrin-545

r-Phycocyanin

Allophycocyanin

Į-, ȕ-, and

İ-carotene

alloxanthin

Heterokontophyta

a, c absent

Į-, ȕ- and

İ-carotene

fucoxanthin

violaxanthin

Haptophyta

a, c absent

Į- and

ȕ-carotene

fucoxanthin

Dynophyta

a, c absent ȕ-carotene

peridinin

fucoxanthin

diadinoxanthin

dinoxantin

gyroxanthin

Euglenophyta

a, b absent

ȕ- and

Ȗ-carotene

diadinoxanthin

Chlorarachniophyta

a, b absent absent

lutein

neoxanthin

violaxanthin

Chlorophyta

a, b absent

Į-, ȕ- and

Ȗ-carotene

lutein

prasinoxanthin

L. BARSANTI ET AL.

TABLE 7. The main storage products of the algal divisions.

Division

Storage products

Cyanophyta

cyanophycin (argine and asparagine polymer)

cyanophycean starch (Į -1,4-glucan)

Prochlorophyta cyanophycean starch (Į -1,4-glucan)

Glaucophyta starch (Į -1,4-glucan)

Rhodophyta floridean starch (Į -1,4-glucan)

Cryptophyta starch (Į -1,4-glucan)

Heterokontophyta chrysolaminaran (ȕ -1,3-glucan)

Haptophyta chrysolaminaran (ȕ -1,3-glucan)

Dynophyta starch (Į -1,4-glucan)

Euglenophyta paramylon (ȕ -1,3-glucan)

Chlorarachniophyta paramylon (ȕ -1,3-glucan)

Chlorophyta starch (Į -1,4-glucan)

Within the algae, different evolutionary lineages are discernable. Three

major eukaryotic photosynthetic groups have descended from a common

prokaryotic ancestor, through an endosymbiotic event (Patterson, 1999).

Therefore these algae possess primary plastid, i.e. derived directly from the

prokaryotic ancestor. Other algal groups have acquired their plastids via

secondary (or tertiary) endosymbiosis, where a eukaryote already equipped

with plastids is preyed upon by a second eukaryotic cell. Endosymbiotic

process produced nested cellular compartments one inside the other, which

The three major algal lineages of primary plastids are the Glaucophyta

lineage, the Chlorophyta lineage, and the Rhodopyta lineage.

Glaucophyta lineage occupies a key position in the evolution of plastids.

Unlike other plastids, the plastids of glaucophytes retain the remnant of a

gram-negative bacterial cell wall of the type found in cyanobacteria, with

a thin peptidoglycan cell wall and cyanobacterium-like pigmentation that

clearly indicate its cyanobacterial ancestry.

Green algae (Chlorophyta) constitute the second lineage of primary

plastids. The simple two membrane system surrounding the plastid, the

congruence of phylogenies based on nuclear and organellar genes, and the

antiquity of the green algae in the fossil record all indicate that the green

can give information about the evolutionary history of the algae containing

them (Keeling, 2002; Dyall et al., 2004).

THE WORLD OF ALGAE

algal plastid is of primary origin. In these chloroplasts chlorophyll b was

synthesized as a secondary pigment and phycobiliproteins were lost. Another

hypothesis is that the photosynthetic ancestor of green lineage was a pro-

chlorophyte that possessed chlorophylls a and b and lacked phycobili-

proteins.

The green lineage played a major role in oceanic food webs and the

carbon cycle from about 2.2 billion years ago until the end-Permian ex-

tinction, approximately 250 million years ago. It was this similarity to the

pigments of plants that led to the inference that the ancestors of land plants

(i.e. embryophytes) would be among the green algae, and is clear that

phylogenetically plants are a group of green algae adapted to life on land.

Euglenophyta and Chlorarachniophyta derived from this primary plastid

lineage by secondary endosymbiosys; the green algal plastid present in Eug-

lenophyta is bounded by three membranes, while the green algal plastid

present in the Chlorarachniophyta is bound by four membrane.

Since that time however, a second group of eukaryotes has risen to eco-

logical prominence; that group is commonly called the “red lineage”. The

plastids of the red algae (Rhodophyta) constitute the third primary plastid

lineage. Like the green algae, the red algae are an ancient group in the fossil

record, and some of the oldest fossils interpreted as being of eukaryotic

origin are often referred to the red algae, although clearly these organisms

were very different from any extant alga (McFadden and van Dooren,

2004). Like those of green algae, the plastids of red algae are surrounded by

two membranes. However, they are pigmented with chlorophyll a and phy-

cobiliproteins, which are organized into phycobilisomes. Phycobilisomes are

relatively large light-harvesting pigment/protein complexes that are water-

soluble and attached to the surface of the thylakoid membrane. Thylakoids

with phycobilisomes do not form stacks like those in other plastids, and

consequently the plastids of red algae (and glaucophytes) bear an obvious

ultrastructural resemblance to cyanobacteria.

A number of algal groups have secondary plastids derived from those of

red algae, including several with distinctive pigmentation. The cryptomo-

nads (Cryptophyta) were the first group in which secondary plastids were

recognized, on the basis of their complex four membrane structure. Like red

algae, they have chlorophyll a and phycobiliproteins, but these are dis-

tributed in the intrathylakoidal space rather than in the phycobilisomes

found in red algae, Glaucophyta, and Cyanophyta. In addition, crypto-

monads possess a second type of chlorophyll, chlorophyll c, which is found

in the remaining red lineage plastids. These groups, which include the Het-

erokontophyta (including kelps, diatoms, chrysophytes, and related groups),

L. BARSANTI ET AL.

Haptophyta (the coccolithophorids), and probably those dinoflagellates

(Dynophyta) pigmented with peridinin, have chlorophylls a and c, along

with a variety of carotenoids, for pigmentation. Stacked thylakoids are found

in those lineages (including the cryptomonads) that lack phycobilisomes.

The derivation of chlorophyll c containing plastids from the red algal lineage

is still somewhat conjectural, but recent analyses of both gene sequences

and gene content are consistent with this conclusion.

A few groups of dinoflagellates have plastids now recognized to be

derived from serial secondary endosymbiosis (the uptake of a new primary

plastid- containing endosymbiont) such as Lepidodinium spp. or tertiary

endosymbiosis (the uptake of the secondary plastid-containing endosym-

biont), such as Dinophysis, Karenia, and Kryptoperidinium.

of dinoflagellates and coccolithophorids approximately parallels the rise of

dinosaurs, while the rise of diatoms approximates the rise of mammals in

organic carbon, produced primarily by members of the red lineage in shal-

low seas in the Jurassic period provide the source rocks for most of the

petroleum reservoirs that have been exploited for the past century by humans.

References

Barsanti L., and Gualtieri P., 2006, Algae – Anatomy, Biochemistry and Biotechnology,

Taylor & Francis, Boca Raton, Florida.

Bold H.C., and Wynne M.J., 1978, Introduction to the algae – Structure and reproduction,

Prentice-Hall, Inc., Englewood Cliffs, New Jersey.

Bourrelly P., 1966, Les Algues d’eau douce. Initiation à la Systèmatique. Les algues verdes.

Editions N. Boubèe, Paris.

Bourrelly P., 1968, Les Algues d’eau douce. Initiation à la Systèmatique. Les algues jaunes

et brunes. Editions N. Boubèe, Paris.

nies, Algues rouges et Algues bleues. Editions N. Boubèe, Paris.

Cavalier-Smith T., 2002, Chloroplast Evolution: Secondary Symbiogenesis and Multiple

Losses. Current Biology, 12, R62–R64.

Dyall S.D., Brown M.T., and Johnson P.J., 2004, Ancient Invasions: From Endosymbionts to

Organelles Science 304: 253–257.

Hackett J.D., Anderson D.M., Erdner D.L., and Bhattacharya D., 2004, Dinoflagellates: a

remarkable evolutionary experiment, American Journal of Botany 91: 1523–1534.

219–226.

Bourrelly P., 1970, Les Algues d’eau douce. Initiation à la Systèmatique. Eugleniens, Peridi-

Graham L.E., and Wilcox L.W., 2000, Algae, Prentice Hall, Upper Saddle River, New Jersey.

Carr N.G., and Whitton B.A., 1982, The Biology of Cyanobacteria. Blackwell Scientific,

the Cenozoic (Hackett et al ., 2004). The burial and subsequent diagenesis of

All of these groups are comparatively modern organisms; indeed the rise

Jones R.I., 2000, Mixotrophy in planktonic protists: an overview. Freshwater Biology, 45,

Oxford, UK.

THE WORLD OF ALGAE

Keeling P.J., 2004, Diversity and evolutionary history of plastids and their hosts, American

Journal of Botany. 91: 1481–1493.

Journal of Botany 91: 1535–1556.

Margulis L., Corliss J.O., Melkonian M., and Chapman D.J., 1990, (Eds.). Handbook of

Protoctista, Jones and Bartlett Publishers, Boston.

Marin B., 2004, Origin and Fate of Chloroplasts in the Euglenoida, Protist 155: 1, 13–14.

Common Origin of All Plastids, Current Biology 14: 13, R514–R516.

Patterson D.J., 1999, The diversity of Eukaryotes. The American Naturalist, 65, S96–S124.

Tilden J.E., 1935, The Algae and their life relations. Fundamentals of Phycology. The

University of Minnesota Press, Minneapolis.

Cambridge University Press, Cambridge, United Kingdom.

Lewis L.A., and McCourt R.M., 2004, Green algae and the origin of land plants, American

73: 59–61.

McFadden G.I., and van Dooren G.G., 2004, Evolution: Red Algal Genome Affirms a

Lewin R.A., 2002, Prochlorophyta, a matter of class distinctions. Photosynthesis Research,

Van den Hoek C., Mann D.G., and Jahns H.M., 1995, Algae – An introduction to phycology,

V. Evangelista et al. (eds.), Algal Toxins: Nature, Occurrence, Effect and Detection. 17

CYANOBACTERIAL DIVERSITY IN RELATION

TO THE ENVIRONMENT

BRIAN A. WHITTON*

School of Biological and Biomedical Sciences, University of

Durham DH1 3LE, UK. Email: b.a.whitton@durham.ac.uk

knowledge for researchers concerned with cyanobacterial toxins and toxi-

city, with emphasis on ecological, morphological and physiological aspects.

Ways in which the environment influences cyanobacterial morphology on

evolutionary and short-term time-scales are assessed, because lack of un-

derstanding about this underlies some of the muddle in current taxonomic

approaches. The review then deals with how cyanobacteria respond to their

environment, including sensing, N versus P limitation, some less well re-

cognized aspects of P limitation and responses to grazers. The importance

of considering flowing water and other types of envirponment besides lakes

and reservoirs is stressed. Comment on interactions between cyanobacteria

and other organisms includes mention of the use of barley straw in con-

trolling blooms, an approach which has often proved successful in the

British Isles and elsewhere in Europe, but less so in the USA. The review

ends with how the environment influences toxin production and toxicity of

the toxins released. Several topics are suggested where there is a need for

research, such as whether the calyptra of some Oscillatoriaceae has a role in

sensing the environment, and whether some rice cultivars produce straw

useful for controlling blooms.

Keywords: Cyanobacteria, environment, toxins, toxicity, taxonomy, phosphorus

______

*To whom correspondence should be addressed. Brian A. Whitton, School of Biological and

Biomedical Sciences, University of Durham DH1 3LE, UK. Email: b.a.whitton@durham.ac.uk

Abstract: Cyanobacterial diversity is reviewed to provide background

limitation, phosphatases, grazers, allelopathy, barley straw

B. A. WHITTON

1. Introduction

The cyanobacteria are photosynthetic prokaryotes found in most, though not

all, types of illuminated environment (Whitton and Potts, 2000; Castenholz,

2001). They all have the ability to synthesize chlorophyll a and most can

also form the blue accessory phycobilin pigment, phycocyanin; in some

cases the red accessory pigment, phycoerythrin, is formed as well. However,

several genera do not form the phycobilin pigments, instead possessing

chlorophyll b. Among these, Prochlorococcus was first reported as recently

as 1988 by Chisholm et al., but is now realized to be of major importance

in the oceans (Zwirglmaier et al., 2007) and it seems surprizing that it was

overlooked for so long. Other important phenomena were also long over-

looked, so the reader is encouraged to take a critical approach to the present

literature on cyanobacteria.

A number of features favour their success. The temperature optimum for

many or most is higher by at least several degrees than for most eukaryotic

algae (Castenholz and Waterbury, 1989). Many terrestrial forms tolerate

high levels of ultra-violet irradiation (see 2.3), whereas the success of many

planktonic forms is favoured by their ability to utilize light for photosyn-

thesis efficiently at low photon flux densities (van Liere and Walsby, 1982).

Tolerance of desiccation and water stress is widespread (Potts, 1994) and

cyanobacteria are among the most successful organisms in highly saline

environments (Bauld, 1981). Photosynthetic CO

reduction can sometimes

proceed efficiently at very low concentrations of inorganic carbon (Pierce

and Omata, 1988). The ability of many species to fix atmospheric nitrogen

provides a competitive advantage where combined nitrogen concentrat-

ions are low (see 3.2.1). Free sulphide is tolerated by some species at much

higher levels than by most eukaryotic algae and H

S is sometimes utilized

as the hydrogen donor during photosynthesis (Cohen et al., 1986). The abi-

lity to form gas-vacuoles in some common freshwater plankton species and

the marine Trichodesmium, and hence increase buoyancy, gives an advent-

age in waters where the rate of vertical mixing of the water column is rela-

tively low (van Liere and Walsby, 1982).

The fact that some species are highly toxic to humans and some other

animals has been reported extensively, though most accounts relate to

bloom-forming species in freshwaters and shallow coastal waters (Codd

et al., 2005); several chapters in the present book review methods for moni-

toring these species and their toxins. It is less clear how widespread cyano-

bacterial toxicity is in other types of environment or how the environment

may influence the toxicity of species where toxins can occur. (The terms

toxins and toxicity is used here to refer to effects on mammals, including

humans, unless other organisms are mentioned specifically).

CYANOBACTERIAL DIVERSITY AND ENVIRONMENT

The aim of this chapter is to provide an environmental perspective for

researchers investigating these aspects of toxicity and who are not neces-

sarily specialists in cyanobacteria, though anyone lacking previous experi-

ence of the organisms is recommended to read the account by Mur et al.

(1992) first of all. Because of the wide range of topics covered, the choice

here is highly selective. The chapter starts with a brief overview of cyano-

bacterial diversity, followed by comments on how the environment influ-

ences cyanobacteria, both their long-term evolution and short-term responses,

including methods for sensing their environment. This is followed by an

account of the environments where toxicity has been reported. Finally, there

is an attempt to bring the two subjects together by assessing what is known

about the influence of environmental factors on toxins and toxicity. Mole-

cular aspects of cyanobacterial toxins are mentioned only briefly, partly

because there are reviews elsewhere (Börner and Dittmann, 2005; Neilan

et al., 2007) and partly because the rapid progress in the subject, exem-

plified by the sequencing of the genome of a toxic strain of Microcystis

aeruginosa (Kaneko et al., 2007), means that comments are likely to date

rapidly.

2. Long-term Responses to Environment

2.1. MORPHOLOGY

Single-celled cyanobacteria range in size from about 0.6 µm to well over 30

µm in their largest dimension. Although most species exceed 2 µm, the

upper limit of organisms recognized as picoplankton, it seems likely that,

based on world-wide biomass, the majority are below this limit. The picophy-

toplankton include both Prochlorococcus and the phycocyanin-containing

Synechococcus, which together form the dominant phototrophs of many

regions of the tropical and subtropical oceans (Zwirglmaier et al., 2008). In

contrast, they are conspicuously absent or rare in polar oceans (Vincent,

2000).

Small-celled cyanobacteria also occur in the plankton of almost all

freshwater lakes, (Hawley and Whitton, 1991), though not in the most

acidic (Steinberg et al., 1997). Their relative importance is greatest in large,

low-nutrient lakes (Callieri, 2007), where the cells are typically larger than

the marine forms and sometimes slightly exceed the picoplankton size limit.

Unlike those in the open oceans, some of the freshwater picoplankton-size

cyanobacteria are joined by mucilage strands or other arrangements (Skuja,

1948). Such organisms typically occur in humus-rich waters and are often

overlooked in standard counting procedures. The plankton of small water-

bodies is sometimes dominated by slightly larger individual cells, but most

B. A. WHITTON

of the larger unicellular forms are aggregated in various ways to form

colonies. Microcystis, the most notorious of the freshwater toxin-formers, is

an example (Visser et al., 2005). There are also many colonial unicellular

genera associated with surfaces.

The trichomes of filamentous cyanobacteria come into the diameter

range 0.4 µm to 50 µm, but there are a few records of species with tri-

chomes well over 100 µm diameter. Even when they include only a single

trichome, filaments may be much wider due to the presence of extracellu-

lar polymers organized into firm sheaths. The filamentous forms have been

separated in various ways into several orders, with the important split bet-

ween those without and those with heterocysts, the site of nitrogen fixation

in most nitrogen-fixing cyanobacteria of well-oxygenated environments.

Phylogenetic studies indicate that the non-heterocystous filamentous forms

are highly diverse, but the large number of genes involved in heterocyst

development suggests that the main steps in heterocyst evolution occurred

only once (Henson et al., 2004).

2.2. TAXONOMY AND NOMENCLATURE

It is important for toxicity and other studies to be able to give meaningful

and consistent names to the diversity of organisms found in field and labo-

ratory samples, yet perhaps for more than any other group of phototrophs,

this can be a challenge. This is in part because there have been four differ-

ent approaches to their nomenclature. Although a critical assessment of these

approaches lies outside the scope of this chapter, some understanding is nee-

ded to interpret the literature on toxicity. One of the approaches, that due to

F. Drouet (e.g. 1968) was based on a huge reduction in number of species,

with individual species distinguished from one another only by large differ-

ences in morphology. This approach has now largely been discarded and is

only mentioned here because Drouet’s taxonomic names were used for the

colour pictures shown by Palmer (1966). This book was distributed widely

round the world free of charge and the pictures subsequently reproduced in

many editions of Standard Methods for Water and Wastewater Treatment

published by American Public Health Association and the names given by

Drouet have therefore been seen by numerous people in water management.

The classical approach evolved during the 19th century, with much of

the morphological diversity of what were then known universally as blue-

green algae being recognized at the generic level by the end of that century.

However, the information was not really consolidated clearly until Geitler’s

(1932) flora, which is the best known text of what may be considered

as classical taxonomy. While it is essential to use a more up-to-date account

CYANOBACTERIAL DIVERSITY AND ENVIRONMENT

(e.g. Komárek and Anagnostidis, 1999) to describe the diversity of unicellular

cyanobacteria in field populations, Geitler (1932) is still a useful source to

start to assess the diversity of filamentous forms.

A third approach is that introduced in the 1970s by R. Y. Stanier, who

became convinced that these organisms should be treated like bacteria, with

isolation and culture of individual cells or filaments (Rippka et al., 1979). It

was proposed that their taxonomy should follow the rules of the Inter-

national Code of Nomenclature of Bacteria (rather than the International

Code of Botanical Nomenclature), together with a change in name to cyano-

bacteria (Stanier et al., 1978). The many subsequent steps towards this have

been reviewed by Oren (2004), who stressed the need for botanical and bac-

teriological taxonomists to use unified rules to describe new taxa. Bergey’s

Manual of Determinative Bacteriology (Boone and Castenholz, 2001) pro-

vides the most recent taxonomic account using the bacteriological approach.

The fourth approach is that given in a number of articles by Anagnostidis

and Komárek (e.g. 1985) and two books by the same authors (Komárek and

Anagnostidis, 1999, 2002). This is essentially an on-going elaboration of the

classical system with frequent reconsideration of the importance of various

characters and at the same time incorporating as much new information

as possible. Whitton’s (2002) account for the British Isles was much nearer

that of Geitler (1932). A conservative approach was adopted because it see-

med best to wait until much more molecular data are available before

making a major reconsideration of nomenclature for the whole group. None

of the present approaches is ideal for all purposes and the situation can be

confusing to non-specialists who are unaware of the situation.

2.3. STRESS

Some of the most important criteria in the 19th century descriptions of

genera or species were ones which we now know are responses to stress or

limitation, though the original authors had little or no understanding of this.

The sheaths which enclose the trichomes of many filamentous forms pro-

vide one example. Among the freshwater plankton they occur in only some

species. Species on terrestrial surfaces subjected to intermittent drying

mostly surrounded by firm sheaths or mucilage, which aid desiccation toler-

ance (Potts, 1994), though may also have other functions, which are not

necessarily the same in different species. In many cases species glide out of

their sheath if submerged in liquid, but reform them again under water

stress. Species with firm sheaths are much less common in the plankton,

although many do have surrounding mucilage.

B. A. WHITTON

The brown pigment scytonemin which is present in the sheaths or mu-

cilage protects cells again damage by UVR (ultra-violet radiation) damage

(Castenholz and Garcia-Pichel, 2000) and in most cases UVR is required to

initiate its synthesis (Garcia-Pichel and Castenholz, 1991).

Heterocyst formation in Anabaena occurs when combined nitrogen

is absent or low in relation to supply of other key nutrients (Wolk, 1983)

and most heterocystous genera probably behave in a similar way, though

there are examples such as the hair-forming genus Calothrix (Sinclair and

Whitton, 1977), where heterocyst formation is less clearly linked to the

recent environment.

Genera able to form multicellular hairs or other types of long, markedly

tapered trichomes do this under conditions of phosphorus limitation (Whitton,

1988). The extent of tapering in Aphanizomenon flos-aquae, which in some

cases leads to the formation of hair-like ends to the filaments, is also

enhanced by phosphorus limitation (author, unpublished data). In contrast

to heterocysts, the formation of multicellular hairs has almost certainly

evolved a number of times. Colonial cyanobacteria forming hairs, such as

Calothrix and Rivularia, exist in this condition for most of their growth

period (Whitton, 1987), only producing motile hormogonia when exposed

to high phosphate. Unfortunately the taxonomy of hair-forming cyano-

bacteria is confused in accounts based on the Stanier system, because the

growth medium used for assays (BG11: Allen and Stanier, 1968) contained

such a high phosphate concentration (5 mg L

–1

P) that morphological fea-

tures associated with phosphate limitation are seldom seen in culture. Even

if a reduced concentration of 1 mg L

–1

P is used for batch culture studies,

this is usually still too high for the characteristic morphology to be seen

(author, unpublished data).

The cells of multicellular hairs are highly vacuolated, the vacuoles

being formed as a result of the separation of the two thylakoidal membranes

(Whitton, 2005). Although the hair cells lose their chlorophyll, the intra-

thylakoidal vacuoles which sometimes occur in other genera can develop

in cells which still contain chlorophyll, though it is unclear whether the

particular membranes surrounding the vacuole are still pigmented. Such

vacuoles often occur in Scytonema, where the cells furthest from the fila-

ment apex develop them. They also occur in the terminal regions of some

non-heterocystous filamentous forms, which taper towards the apex, as illus-

trated for Phormidium autumnale by Geitler (1932). In both these cases the

vacuoles form in cells furthest from the growing region of the filament,

suggesting that their presence is a sign that the cell is becoming unhealthy.

Liquid (intrathylakoidal) vacuoles often occur in all cells of populatons of

the unicellular Synechococcus aeruginosus and the filamentous Oscillatoria

bornetii and O. bourrellyi, though O. bourrellyi and perhaps also the others

CYANOBACTERIAL DIVERSITY AND ENVIRONMENT

can also exist in a state where the presence of the vacuoles is scarcely

visible with the light microscope (Whitton, 2002). In (Lake) Windermere,

England, the highly vacuolated form of O. bourrellyi used to develop in

summer and the less vacuolated form in winter, when ambient phosphate

concentrations were much higher than in summer (J. W. G. Lund, pers.

comm.). When considered together, these observations suggest it would

be worth investigating whether intrathylakoidal vacuole formation is asso-

ciated with a mechanism for optimizing phosphate uptake under P-limiting

conditions.

3. Short-term Responses to Environment

3.1. SENSING THE ENVIRONMENT

An ability to detect and respond to variations in the environment is very

important and a range of studies have been reported, mainly with respect to

light, nitrogen and phosphorus. but also toxin formation. Although dealing

mainly with biochemical and molecular aspects, the review by Mann (2000)

provides a broader guide to the literature. Many of the earlier studies were

concerned with detection and responses to light of motile filamentous forms

gliding on a surface. For instance, Castenholz (1983) concluded that most

responses to light occurred only after apparently random movements have

resulted in the long axis lying parallel to the light field. However, steering

did occur in some articulated trichomes, such as members of the Nosto-

caceae. More recently it has been shown that a range of receptors exist for

sensing light (Mullineaux, 2001), including phytochromes, cryptochromes

and rhodopsin (Albertano et al., 2001; Jung et al., 2004).

There has also been considerable interest in chemical signalling. Akinete

(spore) formation in an exponentially growing Cylindrospermum licheniforme

could be induced by cell-free supernatant of an akinete-containing culture

(Fisher and Wolk, 1976). The akinete-inducing substance was isolated and

its structure partially determined (Hirosawa and Wolk, 1979). Heterocysts,

but not active nitrogen fixation, were essential for akinete formation (Van

de Water and Simon, 1982). Once sporulation commenced in a culture, the

process spread rapidly through the population. Field observations on several

Cylindrospermum populations growing on sediments indicated that a similar

behaviour probably occurred there.

It has long been considered that a range of cyanobacterial responses

probably involve chemotaxis (Castenholz, 1983), but the first convincing

evidence came from Waterbury et al. (1985) for marine phycoerythrin-

containing Synechococcus isolates showing swimming motility. These did

B. A. WHITTON

not exhibit photokinesis, photophobic or photactic responses and motility

was retained in the dark. The swimming behaviour, which was confined to

open ocean isolates, showed a marked chemotactic response to various

nitrogenous compounds (Willey and Waterbury, 1989). The threshold levels

for chemotactic responses were in the range 10

–9

–10

M, which could be

ecologically significant in the ocean.

The study of chemotaxis in cyanobacteria has in recent years largely

focussed on the attraction of hormogonia to potential symbiotic partners.

The first full account was for Nostoc and the liverwort Blasia (Knight and

Adams, 1996), but the phenomenon has now been shown for a range of

associations (Adams, 2000; Nilsson et al., 2006). The mutual attraction of

cyanobacterial cells to each other, such as hormogonial aggregation during

colony formation in genera like Rivularia (Whitton, 2002), still awaits detai-

led study.

Strangely, the role of the calyptra and other modifications of the terminal

cell of many motile non-heterocystous filamentous forms (Oscillatoriceae)

has never been investigated. It is probably the best known morphological

structure in cyanobacteria about which nothing is known of its function. How-

ever, it seems to the author likely that this may be involved in chemotaxis.

The fact that such cells form only at one end of the trichome and that the ter-

minal regions of these trichomes often flex around suggests the possibility

of their playing a role in detecting features of their environment such as

phosphate or other nutrient gradients. If the calyptra does prove to be an

important detector region, perhaps it could be used to incorporate detector

molecules for toxins and other compounds.

Many authors have suggested the likelihood that quorum sensing is

involved in various cyanobacterial processes (e.g. Mann, 2000). This is

partly because of similarities with other bacterial processes or genes where

it is known to be involved. For instance, some microcystin related genes

show a high similarity to genes in other bacteria which are regulated by

a quorum sensing system. However, several studies have failed to find evi-

dence for quorum sensing influencing microcystin formation. Density chan-

ges during growth of Microcystis do not seem to influence transcription of

the microcystin gene cluster (Dittmann et al., 2001; Braun and Bachofen,

2004; Pearson et al., 2004).

C studies with M. aeruginosa PCC 7806

showed that cells were not subject to significant loss processes such as

export from the cells or intracellular breakdown, and the authors (Rohrlack

and Hyenstrand, 2007) interpreted this as lack of evidence for quorum sens-

ing or other functions requiring export of compounds to the medium, such

as protection from epiphytes.

CYANOBACTERIAL DIVERSITY AND ENVIRONMENT

3.2. MORPHOLOGY AND PHYSIOLOGY

3.2.1. Introduction

Although morphological characters relating to the ability of a cyanobac-

terium to withstand stress have evolved over long periods of time, many of

these characters are also ones which vary during the growth of individual

organisms, as described above for scytonemin, heterocysts and multicellular

hairs. The extent of gas vacuole formation and hence buoyancy is another

obvious way in which planktonic cyanobacteria can respond to their envi-

ronment. In general high light or limitation by major nutrients such as nitro-

gen or phosphorus leads to a decrease in number of gas vesicles per cell and

hence a decrease in buoyancy, though there are many factors which may

complicate this (Oliver and Ganf, 2000).

In most cases the ‘stress’ characters start to develop in response to only

moderate stress or limitation. The pronounced occurrence of a particular

character at a site therefore indicates the likely importance of the relevant

stress there. This has been considered most often for the heterocyst, because

of the ease with which its frequency can be quantified. Nitrogen scarcity

favours the development of nitrogen-fixing cyanobacteria, because of their

competitive advantage where the concentration of combined nitrogen is low

(Howarth et al., 1988; Kardinaal and Visser, 2005). Nitrogen-fixers in well-

oxygenated freshwater and terrestrial environment are likely to possess

heterocysts. However, the relationship between heterocyst frequency and

the concentration of ambient combined nitrogen may sometimes be ob-

scured by the fact that the same heterocyst persists for much longer periods

in the morphologically more complex genera like Aphanizomenon and

Gloeotrichia than they do in Anabaena.

Cyanobacterial nitrogen fixation in freshwater and terrestrial environ-

ments with low dissolved oxygen is usually carried out by species lacking

heterocysts and in most cases there are no morphological features indicating

whether or not this ability is likely to occur. In the marine environment

heterocystous nitrogen-fixers are largely confined to the upper intertidal

zone or shallow brackish waters. The main nitrogen-fixers in the open sea

are the unicellular Crocosphaera watsonii (Zehr et al., 2007) and filament-

tous Trichodesmium (Lagomela et al., 2002), which lacks heterocysts, but

does possess special cells recognizable with light microscopy.

3.2.2. N versus P limitation

The relative importance of particular nitrogen fractions and the envi-

ronmental N : P ratio have a been suggested to influence the success of

particular groups of cyanobacteria. Blomqvist et al. (1994) concluded that

non-nitrogen-fixing cyanobacteria are favoured by NH

-N, as was found for

B. A. WHITTON

Oscillatoria (Planktothrix) in enclosures (Klemer, 1976), while NO

-N

favours the development of eukaryotic phytoplankton. The importance of

the environmental N : P ratio has often been mentioned and Smith (1983),

based on data from 17 lakes, suggested that cyanobacteria are generally

better competitors for nitrogen than phosphorus and thus in lakes with low

total N : total P ratio. However, this interpretation should be treated with

considerable caution, because most cyanobacteria have several different

strategies for optimizing P acquisition, such as the abilities to store phosphate

in polyphosphate granules, to hydrolyze a range of organic phosphates and

to adjust rapidly to changes in phosphorus conditions (Whitton et al., 2005).

It is often overlooked that some environments, especially streams, show

frequent shifts in conditions and some species appear to be adapted espe-

cially to deal with such shifts. For instance, genera which can form both

heterocysts and either hairs or long tapered filaments are responding to en-

vironments with different nutrient conditions at different stages in their

growth cycle. Rivularia typically undergoes a relatively short period of nit-

rogen limitation alternating with a long period of phosphorus limitation

(Yelloly and Whitton, 1996; Whitton et al., 1998).

One final point should be stressed, because of its value for monitoring

purposes. The shape of a filamentous cyanobacterium can tell a lot about its

environment, especially nutrient conditions, even without knowing its name.

It seems likely, for instance, that morphologically complex cyanobacteria

are associated with environments which show characteristic fluctuations in

environmental conditions. Further information about the more recent environ-

ment is provided if details of intracellular contents, such as the extent of for-

mation of the various types of storage granule and gas vacuoles, is also

included.

In addition to the morphological studies on nitrogen and phosphorus limi-

tation mentioned earlier, much information has accumulated on physio-

logical, biochemical and molecular responses to nutrient status. However, it

is not always straightforward to establish whether an organism is N- or

P-limited. While it may be relatively easy to do so by a combination of mor-

phological and physiological studies in the more complex filamentous forms,

Post (2005) concluded that no available measurement provides an unequi-

vocal answer for marine phytoplankton. Although this viewpoint may seem

strict, it is worth listing the three methodological problems Post raised.

Knowledge of the concentration of a nutrient such as ammonium in the en-

vironment does not provide direct information on its flux into cells. Some pot-

ential N and P sources are not covered by standard determinations in water

chemistry. Bioassays based on nutrient additions in enrichment experiments

have a number of inherent problems, such as the possibility of colimitation

by trace metal availability. All these problems can occur in freshwater studies,

CYANOBACTERIAL DIVERSITY AND ENVIRONMENT

especially the failure to include the full range of potential N and P sources

in water analyses. Because of this, there has been much interest in finding

molecules, especially proteins, that indicate nutrient limitation (Dignum

et al., 2005), or genes (Mann, 2000) that respond to nutrient limitation or

more directly to particular molecules in the external environment.

3.2.3. Assessing phosphorus limitation

The widespread occurrence of phosphate limitation in nature has led to

much interest in the various types of strategy used by cyanobacteria to deal

with this and the ways it can be investigated (Dignum et al., 2005). The

formation of surface phosphatase activities under conditions of moderate

phosphorus limitation and its complete suppression under high ambient

phosphate concentration has been reported for so many cyanobacteria that it

seems save to conclude that this is the typical response (Whitton et al.,

2005) and that this is a good way to assess phosphorus limitation. Theore-

tically, the production rate of derepressible (surface) phosphatases should

give the best measurement, but in practice the potential phosphatase activity

is normally used. Potential phosphatase activity is usually assayed with a

suitable artificial substrate at substrate concentrations near the saturation

concentration to allow the reactions to proceed at maximum rate. However,

such routine assays cannot be used to make a quantitative estimate of acti-

vity in nature, because other factors influence activity (Jansson et al., 1988).

A review by Whitton et al. (2005) makes clear how many factors can in-

fluence surface phosphatases. There is a need for caution when making

comparisons based on potential phosphatase activities and some recent

accounts of phosphatase activity of cyanobacteria and other phototrophs in

freshwaters need critical re-evaluation. Nevertheless the ELF-97

phosphate

now widely used as a substrate for cell phosphatase activity in fluorescence

studies can give some insight in understanding differences within communi-

ties and populations (Dignum et al., 2004), though it measures only phos-

phomonoesterase and not phosphodiesterase or other phosphatase activities.

The overall phosphorus concentration of cells is a more direct measure

of potential phosphorus limitation, but quantification is time-consuming and

difficult to apply to large numbers of cells in a mixed community. Although

it is well known that most cyanobacteria form storage polyphosphate when

internal phosphate exceeds a certain concentration (Whitton et al., 2005),

the information for particular species or populations is sparse. There are a

number of reports for freshwater cyanobacteria differing in their phosphorus

content by a factor of 8 or more between phosphorus-replete and phos-

phorus-limited cultures (e.g. Calothrix: Islam and Whitton, 1992). How-

ever, the equivalent values for strains of the marine picoplanktonic Prochlo-

rococcus and Synechococcus lay between 3 and 4 (Bertilsson et al., 2003).

B. A. WHITTON

In addition, the phosphorus-limited cultures of these marine cyanobacteria

have only about one-third the percentage phosphorus (expressed as mass) of

3.2.4. Responses to grazers

Besides the detection and responses to physical and chemical factors, there

are several reports of morphological and other changes in the presence of

potential grazers. The first for such a behavioural response in cyanobacteria

came from Fialkowska and Pajdak-Stós (1997) in a study on two Phor-

midium isolates from shallow pools. When these were subjected to grazing

pressure by the ciliate Pseudomicrothorax dubius, both strains showed signi-

ficant increases in the number of filaments terminating in an empty sheath.

This was due to active withdrawal of a trichome inside a sheath when dis-

turbed by grazers. P. dubius was unable to ingest trichomes enclosed in a

sheath, though Phormidium may be less efficient under these conditions,

perhaps by reduced nutrient uptake.

Another example of a response to a grazer is that of microcolony for-

mation of a strain of Cyanobium sp. from single cells, which was induced

by the presence of the photophagotroph, Ochromonas sp. DS (Jezberová

and Komárková, 2007). Colonies were characterized by hundreds of tubu-

Cyanobium cells cultured together with Ochromonas. Presumably the res-

ponses of Cyanobium and the Phormidium described above involve the de-

tection of molecules associated with grazer activity.

4. Occurrence of Toxicity

4.1. INTRODUCTION

Some types of toxin have been reported from a range of genera, especially

microcystins, though this is in part because of the wide range of micro-

cystins reported (71 in 2005 according to Codd et al.). However, the toxin

content can differ between genotypes of the same species, as with micro-

cystins in Microcystis aeruginosa (Fastner et al., 1999; Rohrlack et al.,

2001) and cylindrospermopsins in Cylindrospermopsis raciborskii (Saker

and Neilan, 2001). Microcystin-LR is considered to be especially widespread

large filamentous cyanobacteria (Whitton et al., 2005). It will remain un-

clear to what extent these difference reflect the different types of environ-

ment or merely the difference in cell size until similar studies have been

made on freshwater picoplanktonic cyanobacteria.

les (spinae), 100 nm to 1 ȝm long and 63 ± 6 nm wide on the surface of

CYANOBACTERIAL DIVERSITY AND ENVIRONMENT

(Sivonen and Jones, 1999), whereas some toxins have so far been recor-

ded from only one species, such as anatoxin-a(s) in Anabaena flos-aquae

(Matsunaga et al., 1989) and saxitoxin in one cyanobacterial species, Cylin-

drospermopsis raciborskii (Lagos et al., 1999), though its occurrence in

some eukaryotic algae is notorious (see relevant chapters in this book). The

toxic amino acid BMAA (ȕ-N-methylamino-L-alanine), which was first

found in Nostoc isolated from a cycad root, was later found in every cyano-

bacterial culture screened by Cox et al. (2005) and the authors suggested

that it may be produced all groups of cyanobacteria. Surprizingly, their

screening programme did not include Arthrospira (“Spirulina”).

Most cyanobacterial molecules associated with toxicity been considered

to be secondary metabolites, rarely being involved in primary metabolism,

but having nevertheless in many, if not most, cases evolved to benefit a

species. For instance, Osborne et al. (2001) reported that the shallow-water

marine Lyngyba majuscula had been credited with the production of more

than 100 novel secondary metabolites. Studies on the synthesis of toxic cya-

nobacterial peptides have shown that an enzyme complex (hybrid peptide-

polyketide synthetase) directed the production of microcystin and is one

of the largest known prokaryote gene clusters (Nishizawa et al., 2000;

Christiansen et al., 2003; Neilan et al., 2007). Homologous gene clusters

have been found in other genera, such as the nodularin synthetase gene

cluster in Nodularia spumigena (Moffitt and Neilan, 2004) and the hector-

chlorin biosynthetic gene cluster in L. majuscula reported by Ramaswamy

et al. (2007). It is particularly important to understand gene regulation of

products in this organism, because it can form not only a range of allelo-

pathic molecules and ones toxic or carcinogenic to animals, but molecules

which may have significant therapeutic effects for human health (Rossi

et al., 2001; Gerwick et al., 2001).

4.2. LAKES AND RIVERS

The majority of reports for toxic cyanobacteria in nature are from the plank-

ton of fresh, brackish or coastal marine waters (Codd et al., 2005), but it is

unclear how much the worries about toxic blooms have led a frequent as-

sumption that this is the main ecological group where they occur. Benthic

cyanobacterial mats in lakes have also been reported to be toxic, causing

animal deaths in lowland lakes Scotland (Owen, 1984; Gunn et al., 1992)

and alpine lakes in Switzerland (Mez et al., 1997, 1998). Mats of Oscillatoria

limosa and two other Oscillatoriaceae were responsible for toxicity in the

Swiss lakes. Benthic cyanobacterial mats at a hot spring site in Lake Bogora,

Kenya, were also been found to be toxic (Krienitz et al., 2003).

B. A. WHITTON

There have been an increasing number of reports of the toxicity of

cyanobacterial mats in rivers, especially Phormidium mats on sediments or

floating near the surface if buoyed by gas bubbles. For instance, Wood et al.

(2006) found that Phormidium mats from R. Hutt and four other rivers on

the North Island of New Zealand contained the neurotoxins homoanatoxin-a

and anatoxin-a. These toxins were also found in the stomach of a labrador,

one of five dogs killed in the R. Hutt. The problem was considered suf-

ficiently severe for access restrictions to be placed on over 60% of river

catchments in the western Wellington region of North Island.

The algal communities of several small calcareous rivers in Spain with

abundant cyanobacteria were shown to be toxic to benthic macroinverte-

brates (Aboal et al., 2000, 2002), although the studies did not include details

of the presumed toxins. Toxicity was greatest when the temperature and

nutrient concentrations were both low. The authors suggested that the toxi-

city is a factor enhancing the low diversity of macroinvertebrates at the sites.

The colonies of Rivularia, which was usually the dominant in the phototroph

community, are known to persist for many months. It seems likely that this

is a more general phenomenon. Cyanobacterial colonies such as those of

Rivularia, which persist for long periods in streams and are relatively little

affected by grazing (Whitton, 1987), are likely to be toxic to many potential

grazers (Pentecoast and Whitton, 2000). As colonies which persist for long

periods often show high surface phosphatase activities (Whitton et al.,

2005), it would worth investigating if there is any correlation between

surface phosphatase activities and toxin formation.

4.3. EFFECTS ON INVERTEBRATES AND HETEROTROPHIC

MICROORGANISMS

Other types of environment for which there are records of toxic cyanobac-

teria include various examples of close or obligate symbiotic associations.

In some cases the evidence for toxicity is only circumstantial. There are re-

ports from several locations of submarine populations of the shrimp Crangon

living in tubes of the red-coloured cyanobacterium Lyngbya sordida (Whitton,

1973). These tubes can persist in environments subject to intense grazing,

suggesting the possibility that the Lyngbya may be sufficiently toxic to

reduce grazing predation on both itself and the shrimp. Similarly, circums-

tantial evidence suggests that Prochloron, a unicellular chlorophyll-b con-

tainining cyanobacterium, occurring symbiotically in some tropical ascidian

colonies, may protect the host from predation (Hirose and Maruyama, 2004)

The evidence for this comes from observations on the ascidian Diplosoma

virens, where numerous Prochloron cells surround copepods which feed

on the tunic matrices of the ascidian, yet the Prochloron cells are rarely

CYANOBACTERIAL DIVERSITY AND ENVIRONMENT

ingested. The authors concluded that the presumed toxicity of Prochloron to

organisms other than the host tunicate may be important not only here, but

in Lissoclinum punctatum, where the Prochloron cells are intracellular and

previous research (Hirose et al., 1996) led to the conclusion that transfer of

photosynthates from the cyanobacterium to the tunicate is the key factor

involved in the assocation.

Simmons et al. (2008) concluded that marine invertebrates in general

are likely to prove particularly rich in bioactive molecules in a range of

microorganisms including cyanobacteria. They suggested that natural selec-

tion began as ancient marine microorganisms were required to compete for

limited resources. These pressures resulted in the evolution of diverse gene-

tically encoded small molecules with a variety of ecological and metabolic

roles. Many of the most biologically active molecules derive from inverte-

brates richly populated by associated microorganisms.

In addition to toxicity to animals, there are accounts of toxicity to other

organisms, including possible allelopathic effects on other cyanobacteria

and eukaryotic algae. There have been numerous reports of toxicity of cyano-

bacterial strains to bacteria and fungi (Patterson et al., 1994). Caution is

needed in assessing the results of studies where the strains were non-axenic

or had been in culture collections for many years and hence risk of their

ability of bioactive molecules being lost altogether, making it hard to assess

the ecological significance of the findings.

4.4. ALLELOPATHY

4.4.1. Cyanobacteria against eukaryotic algae

Comments that dense blooms of ‘blue-green algae’, usually include only

low densities of algae belonging to other phyla go back at least as far as

Lefèvre (1932). There were a number of quite detailed studies in the 1960s

and 1970s which suggested that, even if the chemical environment was

especially favourable for a particular species, antagonistic effects were

involved as well. Vance (1965) investigated the situation in Randolph Pond,

Missouri, in particular detail. Only six species were consistent and important

constituents of blooms, the most important being Microcystis aeruginosa,

Coelosphaerium naegelianum and Aphanizomenon flos-aquae. When Micro-

cystis was at its maximum, Aphanizomenon was hardly detectable, and vice

versa. Vance commented that it was improbable that the abrupt decline of a

bloom can be attributed to nutrient deficiency alone, and produced evidence

suggesting that active metabolites may play an important role. Tests with

laboratory inocula on isolated sections of the pond showed that Microcystis

aeruginosa had more inhibitory activity than any other species. Strong

B. A. WHITTON

circumstantial evidence for allelopathy playing a role in bloom succession

in a eutrophic lake was also provided by Keating (1977).

Interest in the possibility of chemical interactions waned for several

decades, but has revived more recently. A great deal more circumstantial

evidence has come from field studies and also strong or direct evidence

from experimental studies in the laboratory. Figueredo et al. (2007) sug-

gested that part of the explanation for changes in Cylindrospermopsis

raciborskii populations in a pond in France (Briand et al., 2002) and re-

servoirs in Brazil (Bouvy et al., 2001) might be due to allelopathy, although

none of the original authors included this when interopreting their results.

Perhaps the most detailed laboratory study is by Schlegel et al. (1999),

where almost all 198 cyanobacterial strains had been isolated recently from

S-E. Asia and Australia. Although many of the strains were not axenic, the

authors included various studies which make it likely that most, if not

all, the observations were due to cyanobacterial allelochemicals. Activity

was tested against species of the planktonic green algae Monoraphidium,

Scenedesmus and Coelastrum. Ten strains of Fischerella, seven Nostoc and

three Calothrix produced antialgal compounds with a broad activity spec-

trum. The 20 active strains were then tested against one strain of each of

three bloom-forming cyanobacteria, Microcystis aeruginosa, Anabaena cir-

cinalis and Nodularia spumigena. Fourteen of the strains active against

green algae killed one or more of the bloom-forming strains, the effects

being particularly strong with three Fischerella strains.

Laboratory studies have led to suggestions that extracellular iron che-

lators (siderophores) may play a role in competitive success, similar to that

known in some bacteria. For instance, Maz et al. (2004) thought it likely

that siderophore(s) played a role in the inhibition of Chlamydomonas rein-

hardtii by Anabaena flos-aquae, but only when the latter was Felimited.

However, allelochemicals inhibiting photosynthetic activities more directly

seem likely to be the most important (Figueredo et al., 2007), though their

molecular structure remains uncertain (see below). Photosystem II seems to

be the target site for cyanobacterial allelochemicals influencing photo-

synthesis (Smith and Doan, 1999; Sukenik et al., 2002). The possible role of

cyanophage in competition between cyanobacterial dominants has not been

considered in most studies, so cannot be ruled as an explanation of some

past observations.

Cell-free filtrates of a Cylindrospermopsis raciborskii bloom and the

medium from cultures of four non-axenic strains of C. raciborskii from the

same lake showed inhibitory effects on photosynthetic activities of Micro-

cystis aeruginosa and two widespread planktonic green algae, though not

much stronger inhibitory effects on the test organisms than the others.

the diatom Navicula sp. (Figueredo et al., 2007). Two of the strains showed

CYANOBACTERIAL DIVERSITY AND ENVIRONMENT

As well as the growth conditions of the producer organism, the growth con-

ditions of the test organisms can also be important, as shown for Anabaena

doliolum, where photoheterotrophically grown cultures were inhibited by

Fischerella JAVA 94/20 and Nostoc NSW, but not heterotrophic cultures

(Schlegel et al., 1999).

Various authors have investigated whether microcystins inhibit eukar-

yotic algae, but a study (Babica et al., 2007) of the effects of microcystin-LR

and microcystin-RR on five planktonic green algae showed no significant

growth changes at environmentally relevant concentrations (1–10 µg L

–1

though there were some effects at much higher concentrations. Pseudokir-

chneriella subcapitata was the most sensitive. The authors included a

thorough assessment of previous studies on the effects of microcystins on

eukaryotic algae. In some cases microcystins had led to an initial stimulation

of growth, followed later by inhibition. However, all reports of inhibition

involved concentrations higher than the range considered environment-

ally relevant. The most sensitive was a unicellular cyanobacterium Syne-

chococcus elongatus, where growth inhibition and biochemical parameters

related to the antioxidative system were found with exposure to micro-

cystin-RR for 6 days (Hu et al., 2005).

The evidence for allelopathic effects of Cylindrospermopsis raciborskii

seems so convincing that Figueredo et al. (2007) suggested this may be a

partial explanation for its recent spread in temperate lakes (Padisak, 1997;

Fastner et al., 2003). As the organism in well-known in tropical and sub-

tropical lakes, its spread has been attributed to climatic warming. However,

Figueredo et al. (2007) wonder whether its rapid increase in particular

temperate lakes may also be due to the inability of native algae in the lakes

to withstand allelochemicals to which they may not have been exposed

previously. If so, the competitive success of C. raciborskii at a site may

decrease when native algal populations acquire improved ability to with-

stand the allelochemicals.

4.4.2. Eukaryotic phototrophs against cyanobacteria

The inhibition of cyanobacterial bloom formation by eukaryotic photo-

trophs has been suggested in several studies and there are reports of green

algae inhibiting other phototrophs in laboratory experiments (e.g. Harris,

1970). Nutrient chemistry is nevertheless usually considered the main factor

favouring dominance of the freshwater plankton by green and other eu-

karyotic algae (Klemer, 1976: see above). However, several submerged

vascular plants (e.g. Myriophyllum spicatum) produce polyphenolic com-

pounds inhibitory to cyanobacteria (Nakai et al., 2000; Leu et al., 2002).

Presumably the presence of dense beds of submerged aquatics would reduce

B. A. WHITTON

the likely of blooms occurring in shallow lakes, but the field data supporting

this are largely circumstantial.

4.4.3. Barley straw

Barley straw is now used widely in the British Isles and some other tem-

perate countries to control the development of cyanobacterial blooms (Welch

et al., 1990; Gibson et al., 1990; Martin and Ridge, 1999; Brownlee et al.,

2003) and the release of polyphenolics from rotting stems has been sug-

gested to be the main factor involved (Pillinger et al., 1994; Everall and

Lees, 1997). Other factors such as microbial activity and increased density

of zooplankton grazers have also been suggested. The method has proved

rather less successful in North America (e.g. Boylan and Morris, 2003),

perhaps due to different barley cultivars or fertilizer application. Although

there are conflicting reports on how effective the method is, there is con-

vincing evidence for success in shallow, well aerated waters, when care is

taken in applying the straw – sufficient bales sufficiently early for rotting to

be well underway by the time a bloom population would normally start to

increase – typically, late spring in temperate regions.

Barrett et al. (1999) observed no change in response after the use of

barley for six consecutive years. However, several authors have raised the

possibility that continued use may lead to more sensitive species or strains

being replaced with less sensitive ones. The author has observed at a very

shallow water site on the Isle of Sheppey, UK, where straw bales have been

used for a number of years, that there has been a change from dominance

by Oscillatoria agardhii and O. redekei to one by Anabaenopsis. The shift

from non-N

-fixers to a N

-fixer might of course have been due to other

factors. Repeated addition of organic matter to a shallow water might itself

lead to changes in water chemistry, such a shift in the N : P ratio.

An experimental study with decaying rice straw showed inhibition of

cyanobacterial growth and nitrogen fixation, apparently due to phenolic com-

pounds (Rice et al., 1980). Anecdotal reports from deepwater rice farmers

in Bangladesh to the author also indicate that leaving rice straw to rot on

soils in autumn decreases winter growths of cyanobacteria. Perhaps the

straw of some rice cultivars could be used to control cyanobacterial blooms in

warmer regions in a manner similar to barley in temperate regions.

5. Influence of Environment on Toxins and Toxicity

There is considerable evidence for some toxins that the concentrations

present in a population or individual culture can change markedly. For in-

stance, the monitoring of microcystin concentrations in lakes has shown a

high variability in space and time (Kardinaal and Visser, 2005). Cox et al.

CYANOBACTERIAL DIVERSITY AND ENVIRONMENT

(2005) concluded that BMAA production and storage is a function of growth

conditions and/or life cycle stage. They quoted results for Calothrix and

Nodularia spumigena cultures, where initial samples showed no BMAA,

but quantifiable amounts later. Detailed results obtained by Ballot et al.

(2004) on the range values for microcystins (assayed as microcystin-LR

equivalents) and anatoxin-a present in the cyanobacterial populations in two

Rift Valley Lakes are of particular interest, because L. Sonachi was domi-

nated by Arthrospira fusiformis and L. Simbi co-dominated by it. A mono-

cyanobacterial strain of A. fusiformis isolated from L. Sonachi was shown to

produce microcystin-YR and anatoxin-a. As A. fusiformis is closely related

to A. platensis, the source of the health food marketed as Spirulina (Vonshak

and Tomoselli, 2000), it is especially important to establish what factors can

influence toxin production in this genus.

Most studies on the influence of environmental effects have dealt with

Microcystis aeruginosa. Mez et al. (1998) summarize the conclusions from

various studies, but it is difficult to generalize. The most convincing con-

clusion is about light, with intensity having a positive effect on growth rate

and toxin concentrations assayed in several laboratory studies (Watanabe

and Oishi, 1985; Van der Westhuizen and Eloff, 1985; Van der Westhuizen

et al., 1986; Utkilen and Gjølme, 1992), which taken together give evidence

for a correlation between growth rate and light intensity on M. aeruginosa.

Light has also been shown to have an effect on the transcription of genes for

microcystin biosynthesis (Kaebernick et al., 2000). The situation is com-

plicated by the fact that light can determine which microcystin variants are

actually produced (Rohrlack and Hyenstrand, 2007). Microcystis PCC 7806

produced mainly (D-Asp3) microcystin-LR in the light, but switched

to microcystin-LR in the dark. Interpretation of results in nature also requires

understanding of the effects of environmental factors. For instance, Sedmank

and Kosi (1998) found marked effects of microcystins at very low light in-

tensity (4 µmol photon m

–2

–1

The responses to other environmental factors cases have led to even

more contradictory conclusions, but the results can often be interpreted dif-

ferently from the ways the authors did, especially in studies on nutrients, so

it is well worth reading the original papers in full. As shown in several re-

ports mentioned above and a study of Cylindrospermopsis raciborskii (Saker

and Neilan, 2001), stressful conditions sometimes provide a stimulus for

production of toxins and allelochemicals.

6. Concluding Comments

Information about the relative importance of the environment and genoty-

pic differences is essential for predicting future changes in the toxicity of

B. A. WHITTON

species at a site. Field studies on toxicity can provide quantitative data for

statistical purposes and insight on factors difficult to assess in the labo-

ratory, such as possible interactions with cyanophage, bacteria and zoo-

plankton. Experimental studies in the laboratory on the influence of the

environment can help interpretation of the results of quantitative field data,

but in the long term it is important to understand how toxin synthethis is

regulated at the biochemical and molecular levels, since this may provide

clues on the cellular functions of the toxins (Börner and Dittmann, 2005).

The rapid progress in molecular studies means it is now worth relooking

more critically at the results of previous field and laboratory studies.

References

Aboal, M., Puig, M. A., Mateo, P., and Perona, E., 2002, Implications of cyanophyte toxicity

on biological monitoring of calcareous streams in north-east Spain, J. Appl. Phycol.

14: 49–56.

Aboal, M., Puig, M. A., Ríos, H., and López-Jiménez, E., 2000, Relationship between

macroinvertebrate diversity and toxicity of Cyanophyceae (Cyanobacteria) in some

streams from eastern Spain, Verh. Int. Verein. Limnol. 27: 555–559.

Adams, C. D., 2000, Symbiotic interactions, in: The Ecology of Cyanobacteria, B. A.

Whitton and M. Potts, eds., Kluwer Academic Publishers, Dordrecht, 688: 523–561.

Albertano, P., Barsanti, L., Passarelli, V., and Gaultieri, P., 2000, A complex photoreceptive

structure in the cyanobacterium Leptolyngbya sp., Micron. 31: 27–34.

Allen, M. M., and Stanier, R. Y., 1968, Growth and division of some unicellular blue-green

algae, J. Gen. Microbiol. 51: 199–202.

Anagnostidis, K., and Komárek. J., 1985, Modern approach to the classification system of

cyanophytes. 1. Introduction, Arch. Hydrobiol., Suppl. 71: 291–302: 327–472.

Babica, P., Hilscherová, K., Börtova, K., Blaha, L., and Marsálek, B., 2007, Effect of dis-

solved microcystins on growth of planktonic photoautotrophs, Phycologia 46: 137–142.

Ballot, A., Krienitz, L., Kotut, K., Wiegand, C., and Metcalf, J. S., 2004, Cyanobacteria and

cyanobacterial toxins in three alkaline Rift Valley lakes of Kenya, J. Plankton Res.

26: 925–935.

Bauld, J., 1981, Occurrence of benthic microbial mats in saline lakes, Hydrobiologia 81:

87–111.

Bertilsson, S., Berglund, O., Karl, D. M., and Chisholm, S. W., 2003, Elemental composition

of marine Prochlorococcus and Synechococcus: Implications for the ecooogical stoichio-

metry of the sea, Limnol. Oceanogr. 48: 1721–1731.

Blomqvist, P., Pettersson, A., and Hyenstrand, P., 1994, Ammonium-nitrogen: A key re-

gulatory factor causing dominance of non-nitrogen-fixing cyanobacteria in aquatic

systems, Arch. Hydrobiol. 132: 141–164.

Boone, D. R., and Castenholz, R. W., (eds.), 2001, Bergey’s Manual of Determinative

Bacteriology, 2nd Edn, Vol. 1, Springer, N.Y.

Börner, T., and Dittmann, E., 2005, Molecular biology of cyanobacterial toxins, in: Harmful

Cyanobacteria, J. Huisman, C. P. Matthijs, and P. M. Visser, Springer, Dordrecht, 241:

25–40.

CYANOBACTERIAL DIVERSITY AND ENVIRONMENT

Bouvy, M., Pagano, M., and Troussellier, M., 2001, Effects of a cyanobacterial bloom

(Cylindrospermopsis raciborskii) on bacteria and zooplankton communities in Ingazeira

reservoir (northeast Brazil), Aquat. Microb. Ecol. 25: 215–227.

Boyland, J. D., and Morris, J. E., 2003, Limited effects of barley straw on algae and

zooplankton in a midwestern pond, Lake Res. Management 19: 265–271.

Braun, W., and Bachofen, R., 2004, Homoserine-lactones and microcystin in cyanobacterial

assemblages in Swiss lakes, Hydrobiologia 522: 271–280.

Briand, J. F., Robillot, C., Quiblier-Llobéras, C., Humbert, J. F., Couté, A., and Bernard, C.,

2002, Environmental context of Cylindrospermopsis raciborskii (Cyanobacteria) blooms

in a shallow piond in France, Water Res. 36: 3183–3192.

Brownleee, E. F., Sellner, S. G., and Sellner, K. G., 2003, Effects of barley straw (Hordeum

vulgare) on freshwa ter and brackish phytoplankton and cyanobact eria, J. Appl. Phycol.

15: 52–531.

Callieri, C., 2007, Picophytoplankton in freshwater ecosystems: the importance of small-

sized phototrophs. Freshwater Reviews 1: 1–28.

Castenholz, R. W., 1983, Motility and taxes, in: The Biology of Cyanobacteria, N. G. Carr

and B. A. Whitton, eds., Blackwell Scientific Publications, Oxford, 688: 413–440.

Castenholz, R. W., 2001, General characteristics of the cyanobacteria, in Bergey’s Manual of

Determinative Bacteriology, 2nd Edn, Vol. 1, Boone D. R., and Castenholz, R. W., eds.,

Springer, N.Y., pp. 474–487.

Castenholz, R. W., and Garcia-Pichel, F., 2000, Cyanobacterial responses to UV-radiation,

in: The Ecology of Cyanobacteria, B. A. Whitton and M. Potts, eds., Kluwer Academic

Publishers, Dordrecht, 688: 591–611.

Castenholz, R. W., and Waterbury, J. B., 1989, Cyanobacteria, in: Bergey’s Manual of

Systematic Bacteriology Volume 3, Staley, J. T. Bryant, M. P. Pfennig N. and Holt J. G.,

eds., Williams & Wilkins, Baltimore, pp. 1710–1727.

Christiansen, G., Fastner, J., Erhard, M., Börner, and Dittmann, E., 2003, Microcystin bio-

synthesis in Planktothrix: Genes, evolution, and manipulation, J. Bact. 185(2): 564–572.

Chisholm, S. W., Olson, R. J., Zettler, E. R., Goericke, R., Waterbury, J. B., and Weischmeyer,

N. A., 1988, A novel free-living prochlorophyte abundant in the oceanic euphotic zone,

Nature 334: 340–343.

Codd, G. A., Lindsay, J., Young, F. M., Morrison, L. F., and Metcalf, J. S., 2005, Harmful

cyanobacteria, in: Harmful Cyanobacteria, J. Huisman, C. P. Matthijs and P. M. Visser,

Springer, Dordrecht, 241: 1–23.

Cohen, Y., Jørgensen, B. B., Revsbech, N. P., and Poplawski, R., 1986, Adaptation to

hydrogen sulfide of oxygenic and anoxygenic photosynthesis among cyanobacteria,

Appl. Environ. Microbiol. 51: 398–407.

Cox, G. A., Banack, S. A., Murch, S. J., Rasmussen, U., Bidigare, A. R., Metcalf, J. S.,

Morrison, L. F., Codd, G. A., and Bergman, B., 2005, Diverse taxa of cyanobacteria

produce ȕ-N-methylamino-L-alanine, a toxic amino acid, PNAS 102(14): 5074–5078.

Dignum, M., Hoogveld, H. L., Matthijs, H. C. P., Laanbroek, H. J., and Pel, R., 2004,

Detecting the phosphate status of phyoplankton by enzyme labelled fluorescence and

flow cytometry, FEMS Microbiol. Ecol. 48: 29–38.

Dignum, M., Matthijs, H. C. P., Pel, R., Laanbroek, H. J., and Mur, L. R., 2005, Nutrient

limitation of freshwater cyanobacteria, in: Harmful Cyanobacteria, Huisman J., Matthijs

C. P. and Visser P. M., Springer, Dordrecht, 241: 65–86.

Dittmann, E., Erhard, M., Kaerbernick, M., Scheler, C., Neilan, B. A., von Dühren, H., and

Borner, T., 2001, Altered expression of two-light dependent genes in a microcystin-

lacking mutant of Microcystis aeruginosa PCC 7806, Microbiology 147: 3113–3119.

B. A. WHITTON

Drouet, F., 1968, Revision of the Classification of the Oscillatoriaceae. Monographs of the

Academy of Natural Sciences, Philadelphia 15, 334 pp.

Everall, N. C., and Lees, D. R., 1997, The identification and significance of chemcials

released from decomposing barley straw during reservoir algal control, Water Res. 31:

614–620.

Fastner, J., Erhard, M., and van Döhren, H., 2001, Determination of oligopeptide diver-

sity,with a natural population of Microcystis spp. (Cyanobacteria) by typing single

colonies by matrix-assisted laser desorption ionisation – time of flight mass spec-

trophotometry, Appl. Environ. Microbiol. 67: 5069–5076.

Fastner, J., Heinze, R., Humpage, A. R., Mischke, V., Eaglesham, G. K., and Chorus, I.,

2003, Cylindrospermopsin occurrence in two German lakes and preliminary assessment

of toxicity and toxin production of Cylindrospermopsis raciborskii (Cyanobacteria)

isolates, Toxicon 42: 13–321.

Fialkowska, E., and Pajdak-Stós, A., 1997, Inducible defence against a ciliate grazer,

Pseudomicrothorax dubius, in two strains of Phormidium (cyanobacteria), Proc. Roy.

Soc. Lond. B 264: 937–941.

Figueredo, C. C., Giani, A., and Bird, D. F., 2007, Does allelopathy contribute to Cylindro-

spermopsis raciborskii (Cyanobacteria) bloom occurrence and geographic expansion?,

J. Phycol. 43: 256–265.

Fisher, R. W., and Wolk, C. P., 1976, Substance stimulating the differentiation of spores of

the blue-green alga, Cylindrospermum licheniforme, Nature 259: 394–395.

Garcia-Pichel, F., and Castenholz, R. W., 1991, Characterization and biological implications

of scytonemin, a cyanobacterial sheath pigment, J. Phycol. 27: 395–409.

Geitler, L., 1932, Cyanophyceae, in Rabenhorst’s Kryptogamen-Flora von Deutschland,

Österreich und der Schweiz 14, Akademische Verlagsgesellschaft, Leipzig, 1356 pp.

Gerwick, W. H., Tan, L. T., and N. Sitachitta, N., 2001, Nitrogen-containing metabolites

Cordell G., ed., Academic Press, pp. 75–177.

Gillor, O., Hadas, O., Post, A. F., and Belkin, S., 2002, Phosphorus bioavailability moni-

toring by a bioluminescent cyanobacterial sensor strain, J. Phycol. 38: 107–115.

Gunn, G. J., Rafferty, A. G., Rafferty, G. C., Cockburn, N., Edwards, C., Beattie, K. A., and

Codd, G. A., 1992, Fatal canine neurotoxicosis attributed to blue-green algae (cyano-

bacteria). Vet. Rec. 4: 301–302.

Harris, D. O., 1970, Growth inhibitors produced by the green algae (Volvocaceae), Arch.

Microbiol. 76: 47–50.

Hawley, G. R. W., and Whitton, B. A., 1991, Survey of algal picoplankton from lakes in five

continents, Verh. Int. Verein. Limnol. 24: 1220–1222.

Henson, B. J., Hessbrock, S. M., Watson, L. E., and Barnum, S. R., 2004, Molecular

phylogeny of the heterocystous cyanobacteria (subsections IV and V) based on nif D,

Int.

J. Sys. Ecol. Microbiol. 54: 493–497.

Hirosawa, T., and Wolk, C. P., 1979, Isolation and characterization of a substance which

stimulates the formation of akinetes in the cyanobacterium Cylindrospermum licheniforme

Kütz., J. Gen. Microbiol. 114: 433–441.

Hirose, E., and Maruyama, T., 2004, What are the benefits in the ascidian-Prochloron

symbiosis? Endocytobiosis Cell Res. 15: 51–62.

from marine cyanobacteria, in: The Alkaloids. Chemistry and Biology: Volume 57,

CYANOBACTERIAL DIVERSITY AND ENVIRONMENT

Hirose, E., Maruyama, T., Cheng, L., and Lewin, R. A., 1996, Intracellular symbiosis of a

photosynthetic prokaryote, Prochloron sp., in a colonial ascidian, Invertebrate Biol. 115:

343–348.

Howarth, R. W., Marino, R., Lane, J., and Cole, J. J., 1988, Nitrogen fixation in freshwater,

estuarine, and marine ecosystems, 1. Rates and importance, Limnol. Oceanogr. 33:

669–687.

Hu, Z. Q., Liu, Y. D., Li, D. H., and Dauta, A., 2005, Growth and antioxidant system of the

cyanobacterium Synechococcus elongatus in response to microcystin-RR, Hydrobiologia

534: 23–29.

Huisman, J., and Hylot, F. D., 2005 Population dynamics of harmful cyanobcteria, in:

Harmful Cyanobacteria, J. Huisman, C. P. Matthijs and P. M. Visser, eds., Springer,

Dordrecht, 241: 143–176.

Islam, M. R., and Whitton, B. A., 1992, Phosphorus content and phosphatase activity of

the deepwater rice-field cyanobacterium (blue-green alga) Calothrix D764. Microbios:

697–616.

Jansson, M., Olsson, H., and Petterson, K., 1988, Phosphatases: origin, characteristics and

function in lakes, Hydrobiologia 180: 157–175.

Jezberová, J., and Komárková, J., 2007, Morphological transformation in a freshwater

Cyanobium sp. inducated by grazers, Environ. Microbiol. 9: 1858–1862.

Kaebernick, M., Neilan, B. A., Bürner, T., and Dittmann, E., 2000, Light and the transcript-

tional response of the microcystin biosynthesis gene cluster, Appl. Environ. Microbiol.

66: 3387–3392.

Kanecko, T., Nkakjima, N., Okamoto, S., Suszuki, I., Tanabe, Y., Tamaoki, M., Nakamura, Y.,

Kasai, F., Watanabe, A., Kawashima, K., Yoshie Kishida, Y., Ono, A., Shimizu, Y.,

Takahashi, C., Minami, C., Fujishiro, T., Kohara, M., Katoh, M., Nakazaki, N.,

Nakayama, S., Yamada, M., Tabata, S., and Watanabe, M. M., 2007, Complete genomic

structure of the bloom-forming toxic cyanobacterium Microcystis aeruginosa NIES-843,

DNA Res. 14(6): 247–256.

Kardinaal, W. E. A., and Visser, P. M., 2005, Dynamics of cyanobacterial toxins, in:

Harmful Cyanobacteria, J. Huisman, C. P. Matthijs and P. M. Visser, eds., Springer,

Dordrecht, 241: 41–63.

Keating, K. I., 1977, Allelopathic influence on blue-green bloom sequence in a eutrophic

lake, Science 196: 155–164.

Knight, C. D., and Adams, D. G., 1996, A method for studying chemotaxis in nitrogen-fixing

cyanobacterium-plant symbioses, Physiol. Mol. Plant Pathol., 49

: 73–77.

Komárek, J., and Anagnostidis, K., 1999, Cyanoprokaryota 1. Teil: Chroococcales, in

Süßwasserflora von Mitteleuropa 19/1, G. Fisher, Jena, Stuttgart & Lübeck, 548 pp.

Komárek, J., and Anagnostidis, K., 2001, Cyanoprokaryota: Oscillatoriales. Süßwasserflora

von Mitteleuropa 19(2), Gustav Fischer, Jena, 750 pp.

Krienitz, L., Ballot, A., Kotut, K., Wiegand, C., Pütz, S., Metcalf, J. S., Codd, G. A., and

Pflugmacher, S., 2003, Contribution of hot spring cyanobacteria to the mysterious deaths

of Lesser Flamingoes at Lake Bogoria, Kenya, FEMS Microbiol. Ecol. 43: 141–148.

Lagos, N., Onodera, H., Zagatto, P. A., Andrinolo, D., Azevedo, S. M. F. Q., and Oshima,

S. M. F. Q., 1999, The first evidence of paralytic shellfish toxins in the freshwater

cyanobacterium Cylindrospermopsis raciborskii, isolated from Brazil, Toxicon 37:

1359–1373.

Lefèvre, M., 1932, Recherche sur la biologie et la systématique de quelques algue obtenues

en culture, Rev. Algol. 6: 313–318.

B. A. WHITTON

Lugomela, C., Lyimo, T. J., Bryceson, I., Semesi A. K., and Bergman B., 2002, Trichodesmium

in coastal waters of Tanzania: diversity, seasonality, nitrogen fixation, Hydrobiologia

477: 1–13.

Mann, N. H., 2000, Detecting the environment, in: The Ecology of Cyanobacteria, B. A.

Whitton and M. Potts, eds., Kluwer Academic Publishers, Dordrecht, 688: 367–395.

Matsunaga, S., Moore, R. E., Niemeczura, W. O., and Carmichael, W. W., 1989, Anatoxin-

a(s), potent anticholinesterase from Anabaena flos-aquae, J. Am. Chem. Soc. 111:

8021–8023.

Matz, C. J., Christensen, M. R., Bone, A. D., Gress, C. D., Widenmaier, S. B., and Weger,

H. G., 2004, Only iron-limited cells of the cyanobacterium Anabaena flos-aquae inhibit

growth of the green alga Chlamydomonas reinhardtii, Can. J. Bot. 82: 436–442.

Martin, D., and Ridge, I., 1999, The relative sensitivity of algae to decomposiing barley

straw, J. Appl. Phycol. 11: 285–291.

Mez, K., Beattie, K. A., Codd, G. A., Hanselmann, K., Hauser, B., Naegeli, H. P., and

Preisig, H. R., 1997, Identification of a microcystin in benthic cyanobacteria linked to

the cattle deaths on alpine pastures in Switzerland, Eur. J. Phycol. 32: 111–117.

Mez, K., Hanselmann, K., and Preisig, H. R., 1998, Environmental conditions in high

mountain lakes containing toxic benthic cyanobacteria. Hydrobiologia 368: 1–15.

Mullineaux, C. W., 2001, How do cyanobacteria sense and respond to light?, Mol. Micro-

biol. 41: 965–971.

Moffitt, M. C., and Neilan, B. A., 2004, Characterization of the nodularin synthetase gene

cluster and proposed theory of the evolution of cyanobacterial hepatotoxins, Appl.

Environ. Microbiol. 70(11): 6353–6362.

Mur, L. R., Skulberg, O. M., Skulberg., and Hans Utkilen, H., 1999, Cyanobacteria in the

Environment, in: Toxic Cyanobacteria in Water: a Guide to their Public Health Conse-

quences, Monitoring and Management, I. Chorus and J. Bartram, eds., Spon, London,

UK, pp. 14–40.

Nakai, S., Inoue, Y., Hosomi, M., and Murakami, A., 2000, Myriophyllum spicatum-released

allelopathic polyphenols inhibiting growth of blue-green algae Microcystis aeruginosa,

Water Res. 34(11): 3026–3032.

Pomati, F., 2007, A brief history of the molecular biology & genetics of cyanobacterial

toxicity & its future in the agae of OMICS, Advances in Experimental Medicine &

Biology, Springer.

Nilsson, M., Rasmussen, U., and Bergman, B., 2006, Cyanobacterial chemotaxis towards

hosts and non-host plants, FEMS Microbiol Ecol. 55: 382–390.

Oksanen, I., Jokela, J., Fewer, D. P., Wahlsten, M., Rikkinen, J., and Sivonen, K., 2004,

Discovery of rare and highly toxic microcystins from lichen-associated cyanobacterium

Nostoc sp. strain IO-102-I, Appl. Environ. Microbiol.

70(10): 5756–5763.

Oliver, R., L., and Ganf, G. G., 2000, Freshwater blooms, in: The Ecology of Cyanobacteria,

B. A. Whitton and M. Potts, eds., Kluwer Academic Publishers, Dordrecht, 688:

149–194.

Oren, A., 2004, A proposal for further integration of the cyanobacteria under the Bac-

teriological Code, Int. J. Syst. Evol. Microbiol. 54: 1895–1902.

Osborne, N. J. T., Webb, P. M., and Shaw, G. R., 2001, The toxins of Lyngbya majuscula

and their human and ecological health effects. Environ. Int. 27: 381–392.

Owen, R. P., 1994, Biological and economic significance of benthic cyanobacteria in two

Scottish Highland Lochs, in: Detection Methods for Cyanobacterial Toxins, G. A. Codd,

T. M. Jefferies, C. W. Keevil and E. Potter. eds., The Royal Society for Chemistry.

Cambridge, pp. 145–148.

Neilan, B. A., Pearson, L. A., Moffitt, M. C., Kabernick, M., Mihali, K. T., Kellmann, R., and

CYANOBACTERIAL DIVERSITY AND ENVIRONMENT

Padisak, J., 1997, Cylindrospermopsis raciborskii (Woáoszynska) Seenaya and Subba Raju,

an expanding, highly adaptive cyanobacterium: worldwide distribution and review of

ecology, Arch. Hydrobiol., Suppl. 107: 563–593.

Palmer, C. M., 1962, Algae in Water Supplies, U.S. Department of Health, Education, and

Welfare Division of Water Supply and Pollution Control, Washington , D.C., 88 pp.

Patterson, G. M. L., Larsen, L. K., and Moore, R. E., 1994, Bioactive products from blue-

green algae, J. Phycol. 27: 530–536.

Pearson, L. A., Hisbergues, M., Börner, T., Dittmann, E., and Neilan, B. A., 2004, Inacti-

vation of an ABC transporter gene, mcyH, results in loss of microcystin production in

the cyanobacterium Microcystis aeruginosa PCC 7806, Appl. Environ. Microbiol. 70:

6370–6378.

Pentecost, A., and Whitton, B. A., 2000, Limestones, in: The Ecology of Cyanobacteria,

Pierce, J., and Omata, T., 1988, Uptake and utilization of inorganic carbon by cyanobacteria,

Photosynthesis Res. 16: 141–154.

Pillinger, J., Cooper, J. A., and Ridge, I., 1994, Role of phenolic compounds in the antialgal

activity of barley straw, J. Chem. Ecol. 20(7): 1557–1569.

Post, A. F., 2005, Nutrient limitation of marine cyanobacteria, in: Harmful Cyanobacteria,

J. Huisman, C. P. Matthijs and P. M. Visser, Springer, Dordrecht, 241: 87–107.

Potts, M., 1994, Desiccation resistance of prokaryotes, Microbiol Revs. 58: 755–805.

Ramaswamy, A., Sorrels, C., and Gerwick, W. H., 2007, Cloning and biochemical charac-

terization of the hectochlorin biosynthetic gene cluster from the marine cyanobacterium

Rice, E. L., Lin, C. -Y., and Huang, C. -Y., 1980, Effects of decaying rice straw on growth

and nitrogen fixation of a blue-green alga, Bot Bull Academia Sinica 21: 111–117.

Rippka, R., DeRuelles, J. B., Waterbury, J. B., Herdman, M., and Stanier, R. Y., 1979,

Generic assignment, strain histories, and properties of pure cultures of cyanobacteria,

J. Gen. Microbiol. 111: 1–61.

Rohrlack, T., Henning, M., and Kohl, J. G., 2001, Isolation and characterization of colony-

forming Microcystis aeruginosa strains, in: I. Chorus, ed., Cyanotoxins – Occurrence,

Causes, Consequences, Springer-Verlag, Berlin, pp. 152–158.

Rohrlack, T., and Hyenstrand, P., 2007, Fate of intracellular microcystins in the cyano-

bacterium Microcystis aeruginosa (Chroococcales, Cyanophyceae), Phycologia 46

277–283.

Rossi, J. V., Roberts, M. A., Yoo H. -D., and Gerwick, W. H., 1997, Pilot scale culture of the

marine cyanobacterium Lyngbya majuscula for its pharmaceutically-useful natural

metabolite curacin A J. Appl. Phycol. 9: 195–204.

Saker, M. L., and Neilan, B. A., 2001, Variable diazotrophic morphologies, and toxicities of

genetically similar isolates of Cylindrospermopsis raciborskii (Nostocales, Cyanophyceae)

from northern Australia, Appl. Environ. Microbiol. 67: 1839–1845.

Schlegel, I., Doan, N. T., Chazal, N. de., and Smith, G. D., 1999, Antibiotic activity of new

cyanobacterial isolates from Australia and Asia against green algae and cyanobacteria,

J. Appl. Phycol. 210: 471–479.

Sedmak, B., and Eleršek, T., 2005, Microcystins induce morphological and physiological

changes in selected representative phytoplanktons, Microb. Ecol. 50: 298–305.

Sedmak, B., and Kosi, G., 1998, The role of microcystins in heavy cyanobacterial bloom

formation, J. Plankton Res. 20: 691–708.

B. A. Whitton and M. Potts, eds., Kluwer Academic Publishers, Dordrecht, 688: 233–255.

Lyngbya majuscula, J. Nat Prod. 70: 1977–1986.

B. A. WHITTON

Simmons, T. L., Coates, R. C., Clark, B. R., Engene, N., Gonzalez, D., Esquenazi, E.,

Dorrestein, P. C., and Gerwick, W. H., 2008, Biosynthetic origin of natural products

Sinclair, C., and Whitton, B. A., 1977, Influence of nutrient deficiency on hair formation in

the Rivulariaceae. Br. Phycol. J. 12: 297–313.

Sivonen, K., and Jones, G. J., 1999, Cyanobacterial toxins, in: Toxic Cyanobacteria in

Water: A Guide to their Public Health Consequences, Monitoring and Management,

Spon, London, UK, pp. 41–111.

Skuja, H., 1948, Taxonomie des Phytoplanktons einiger Seen in Uppland, Schweden.

Symbolae Botanicae Upsalienses 9(3): 1–399.

Smith, G. D., and Doan, N. T., 1999, Cyaobacterial metabolites with bioactivity against

photosynthesis in cyanobacteria, algae and higher plants, J. Appl. Phycol. 11: 337–344.

Smith, V. H., 1983, Light and nutrient dependence of photosynthesis by algae, J. Phycol.

19: 306–313.

and Trüper, H. G., 1978, Proposal to place nomenclature of cyanobacteria (blue-green

algae) under the rules of the International Code of Nomenclature of Bacteria, Int. J. Syst.

Bact. 28: 335–336.

Steinberg, C. E. W., Schäfer, H., and Beisker, W., 1998, Do acid-tolerant cyanobacteria

exist?, Acta Hydrochim. Hydrobiol. 26: 13–19.

Tan, L. T., Okino, T., and Gerwick, W. H., 2000, Hermitamides A and B, toxic malyngamide-

type natural products from the marine cyanobacterium Lyngbya majuscula, J. Nat.

Products 63: 952–955.

58: 1321–1325.

Van de Water, S. D., and Simon, R. D., 1982, Induction and differentiation of heterocysts in

the filamentous cyanobacterium Cylindrospermum licheniforme, J. Gen. Microbiol. 128:

917–925.

Van der Westhuizen, A. J., and Eloff, J. N., 1985, Effect of temperature and light on the

toxicity and growth of the blue-green alga Microcystis aeruginosa (UV-006), Planta

163: 55–59

Van der Westhuizen, A. J., Eloff, J. N., and Krüger, G. H. J., 1986, Effect of temperature and

light (fluence rate) on the composition of the toxin of the cyanobacterium Microcystis

aeruginosa (UV-006), Arch. Hydrobiol. 108: 145–154.

Van Liere, L., and Walsby, A. E., 1982, Interactions of cyanobacteria with light, in: The

Biology of Cyanobacteria, N. G. Carr, and B. A. Whitton, eds., Blackwell, Oxford, and

Univ. California Press, Berkeley, 655: 9–45.

Vance, B. D., 1965, Composition and succession of cyanophycean water blooms, J. Phycol.

1: 81–86.

Vincent, W. F., 2000, Cyanobacterial in the polar regions, in: The Ecology of Cyanobacteria,

Visser, P. M., Ibelings, B. W., Mur, L. T., and Walsby, A. E., 2005, The ecophysiology of

the harmful cyanobacterium Microcystis, in: Harmful Cyanobacteria, J. Huisman, C. P.

Matthijs, and P. M. Visser, Springer, Dordrecht, 241: 109–142.

Vonshak, A., and Tomaselli, L., 2000, Arthrospira (Spirulina): Systematics and ecophysio-

logy, in: The Ecology of Cyanobacteria, B. A. Whitton and M. Potts, eds., Kluwer

Academic Publishers, Dordrecht, 688: 505–522.

Stanier, R. Y., Sistrom, W. R., Hansen, T. A., Whitton, B. A., Castenholz, R. W., Pfennig, N. G.,

orlenko, V. N., Kondratieva, E. N., Eimhjellen, K. E., Whittenbury, R., Gherna, R. L.,

B. A. Whitton and M. Potts, eds., Kluwer Academic Publishers, Dordrecht, 688: 321–340.

PNAS.0709851105: 1–8.

Utkilen, H., and Gjølme, N., 1992, Toxin production by Microcystis aeruginosa as a function

of light in continuous cultures and its ecological significance, Appl. Environ. Microbiol.

isolated from marine microorganism-invertebrate assemblages. Proc. Natl Acad. Sci USA,

CYANOBACTERIAL DIVERSITY AND ENVIRONMENT

Watanabe, M. F., and Oishi, S., 1985, Effects of environmental factors on toxicity of a

cyanobacterium (Microcystis aeruginosa) under culture conditions, Appl. Environ.

Microbiol. 19: 1342–1344.

Waterbury, J. B., Willey, J. M., Franks, D. G., Valos, F. W., and Watson, S. W., 1985,

A cyanobacterium capable of swimming motility, Science 230: 74–76.

Welch, I. M., Barrett, P. R. F., Gibson, M. T., and Ridge, I., 1990, Barley straw as an

inhibitor of algal growth I: Studies in the Chesterfield Canal, J. Appl. Phycol 2: 231–239.

Whitton, B. A., 1973, Interactions with other organisms, in: The Biology of Blue-green

Algae, N. G. Carr and B. A. Whitton, eds., Blackwell, Oxford, and Univ. California

Press, Berkeley, 655: 415–433.

Whitton, B. A., 1987, The biology of Rivulariaceae. In: The Cyanobacteria – A Compre-

hensive Review, P. Fay and C. Van Baalen, eds., Elsevier, Amsterdam, 543: 513–534.

Whitton, B. A., 1988, Hairs in eukaryotic algae, in: Algae and the Aquatic Environment.

Contributions in Honour of J. W. G. Lund, F. E. Round, ed., 460: 446–460. Biopress,

Bristol.

Whitton, B. A., 2002, Phylum Cyanophyta (Cyanobacteria), in: The Freshwater Algal Flora

of the British Isles, D. M. John, B. A. Whitton and A. J. Brook, eds., Cambridge

University Press, Cambridge, 702: 25–122.

Whitton, B. A., Al-Shehri, A. H., Ellwood, N. T. W., Turner, B. L., 2005. Ecological aspects

of phosphatase activity in cyanobacteria, eukaryotic algae and bryophytes, in: Organic

Phosphorus in the Environment, B. L. Turner, E. Frossard and D. S. Baldwin, eds.,

Commonwealth Agricultural Bureau, Wallingford, UK, 399: 205–241.

Whitton, B. A., and Potts, M., 2000, Introduction to the Cyanobacteria, in: The Ecology

of Cyanobacteria, B. A. Whitton and M. Potts, eds., Kluwer Academic Publishers,

Dordrecht, 688: 1–11.

Whitton, B. A., Yelloly, J. M., Christmas, M., and Hernández, I., 1998, Surface phosphatase

activity of benthic algal communities in a stream with highly variable ambient phosphate

concentrations, Verh. Int. Verein. Limnol. 26: 967–972.

Willey, J. M., and Waterbury, J. B., 1989, Chemotaxis towards nitrogenous compounds by

swimming strains of marine Synechococcus spp., Appl. Environ. Microbiol. 55: 1888–

1894.

Wood, S. A., Selwood, A. I., Rueckert, A., Holland, P. T., Juliet R. Milne, Smith, K. F.,

Smits, B., Watts, L. F., and Cary, C. S., 2007, First report of homoanatoxin-a and

associated dog neurotoxicosis in New Zealand, Toxicon 50: 292–301.

Yelloly, J. M., and Whitton, B. A., 1996. Seasonal changes in ambient phosphate and

phosphatase activities of the cyanobacterium Rivularia atra in intertidal pools at Tyne

Sands, Scotland, Hydrobiologia 325: 201–212.

Zehr, J. P., Bench, S. R., Mondragon, E. A., Mccarren, J., and Delong, E. F., 2007, Low

Zwirglmaier, K., Heywood, J. L., Chamberlain, K., Woodward, E. M. S., Zubkov, M. V.,

and Scanlan, D. J., 2007, Basin-scale distribution patterns of picocyanobacterial lineages

in the Atlantic Ocean, Environ. Microbiol. 99: 1278–1290.

Zwirglmaier, K., Jardillier, L., Ostrowski, M., Mazard, S., Garczarek, L., Vaulot, D., Not, F.,

Massana, R., Utioa, O., and Scanlan, D. J., 2008, Global phylogeography of marine

Synechococcus and Prochlorococcus reveals a distinct partitioning of lineages among

oceanic blooms, Environ. Microbiol. 10: 147–161.

genomic diversity in tropical oceanic N -fixing cyanobacteria, Proc. Nat. Acad. Sci. 104:

17807–17812.

V. Evangelista et al. (eds.), Algal Toxins: Nature, Occurrence, Effect and Detection. 45

TOXICITY OF FRESH WATER ALGAL TOXINS TO HUMANS

AND ANIMALS

ANNALISA ZACCARONI*, DINO SCARAVELLI

Department of Veterinary Public Health and Animal

Pathology,Veterinary School, University of Bologna

in fresh waters. Algae are considered less dangerous than cyanobacteria,

because even if they can proliferate quite intensively in eutrophic fresh

waters, they rarely accumulate to form dense surface blooms like blue-green

algae do. Thus the toxins they produce do no accumulate to levels high

enough to become hazardous to human and animals health.

Cyanobacteria both planktonic and benthic species, can instead form huge

agglomeration close to the shore, which can become very dense and con-

centrated. This material can take a long time to disperse and so become a

risk for human health and mainly for animals, which can easely enter in

contact with poisoned water. Lots of blue-green algae species have been

found to produce toxins, and some authors assume that it could be prudent

to assume that any cyanobacterial population can have a toxic potential. At

present known toxins are classified as neurotoxins (anatoxin-a, anatoxin-

a(s) and saxitoxin), cytotoxin or cylindrospermopsin and microcystins or

nodularins. Anyway, starting from existing studies, it seems likely that

other unidentified toxins exists.

Neurotoxins act by blocking neuronal signal transmission with two main

mechanisms: anatoxins act as acetylcholine mimic (anatoxin-a) or as choline-

sterase inhibitor (anatoxin-a (s)), causing an organophosphate like syndrome,

______

*To whom correspondence should be addressed. Annalisa Zaccaroni, Viale Vespucci 2, 47042

Cesenatico (FC), Italy. Email: annalisa.zaccaroni@unibo.it

Abstract: Algae and cyanobacteria are responsible of the presence of toxins

A. ZACCARONI AND D. SCARAVELLI

while saxitoxin acts by blocking the sodium channel, thus disrupting sodium

balance into nerve cells. Despite their high toxicity, their only occasionally

are responsible of human intoxication, while neurotoxicity may be experi-

enced by livestock and pets, that can drink polluted water or ingest scum

material.

Cytotoxin is an alkaloid that blocks protein synthesis by binding to DNA or

RNA. It’s responsible for cytogenetic damages via DNA strand breaks and

loss of whole chromosomes (aneuploidy) and has proved to be potentially

carcinogenetic. Finally, it was found that cylindrospermopsin toxicity is

associated with significant losses of glutathione and depletion of glutathione

results in cell death. The fall in glutathione levels is due to an inhibition of

the final common pathway of glutathione synthesis, and this in turn contri-

butes to cylindrospermopsin cytotoxicity, as lower cell glutathione levels

predispose to cylindrospermopsin toxicity. Numerous reports involving the

poisoning of farm and wild animals following drinking water from lakes

and ponds containing surface scum from cyanobacterial blooms exist, most

have been documented in Australia. Australia was also interested by human

poisoning episodes via drinking water, with patients escaping death only

through skilled and intensive hospital care.

Microcystins are the most frequently occurring and widespread of the cyano-

toxins; they act by blocking protein phosphatases 1 and 2a, causing toxicity

at the hepatic level, as they use bile carrier to pass through cell membranes.

Microcystins toxicity is greater after intraperitoneal injection, but also in-

tranasal exposure showed high toxicity, being this uptake route relevant for

water sports activities (i.e. waterskiing). Nodularins toxicity has shown to be

cumulative, as a single oral dose resulted in no hepatic damage, while the same

dose applied daily over several days caused hepatic injury. Microcystins have

also shown to be tumor-promoting agents, as they can increase the incidence of

hepatic tumors in human too.

Concerning Fresh Water Algae, their toxicity is considerably lower than

that of cyanobacteria, because algae do not have effective mechanism of

accumulation and the toxic potency of their toxins is several order of magni-

tude lower than that of cyanotoxins. Available data reports about dino-

flagellates within or related to the Peridinium genus as potential producers

of toxins (ichtyotoxins).

Ichtyotoxins caused fish kills and have shown to

have an algicidal effect on the cyanobacteria Microcystis aeruginosa. It is

FRESH WATER TOXINS

possible that toxic blooms of dinoflagellates in freshwater occur more

frequently than reported and that they affect the biota in those habitats.

after Uroglena spp. and Gonyostomum semen exposure, but clear toxic

episode was reported.

1. General Characteristics of Fresh Water Toxins Producing

Organisms

Freshwater algal toxins are produced by both algae and cyanobacteria (also

called blue-green algae). Toxins are secondary metabolites of normal meta-

bolism of the algae and of cyanobacteria, which present a different degree

of toxicity: the less toxic induce dermatitis, the most dangerous are hepato-

toxic. Generally speaking, algae produce less potent toxins and are rarely

responsible of toxic episodes (WHO, 2003).

The algae that produce toxins are small unicellular autotroph organisms,

which perform photosynthesis and organication. Cyanobacteria are orga-

nisms which have intermediate characteristics between algae and bacteria.

So they are photosynthetic, but their cellular structure is similar to that of

bacteria, i.e. they lack a cellulose outer wall, do not reproduce sexually and

do not have membrane-bound nuclei or specialized organelles. They posses

an accessory pigment, phycocyanin, unique to cyanobacteria, which has a

bluish color, thus cyanobacteria are also called blue-green algae (Echlin,

1966; Kotak et al., 1995; Rapala and Sivonen, 1998).

Bloom formation is eased by a stable water column, warm waters, high

nutrient concentrations, high pH, low CO

and low grazing rate by zoo-

plankton (Zurawell et al., 2005).

Usually algae do not produce blooms, while blue-green algae produce

important blooms. This differential behavior is partly responsible of the

different toxicity and dangerousness of the two groups. Indeed, by not acc-

umulating in the environment to form blooms, algae do not produce toxins

amounts high enough to threaten human, livestock or wildlife health. On the

contrary, blooms formed by cyanobacteria produce not only cells accu-

humans or livestock (WHO, 2003).

Main exposure way is through recreational and drinking waters, and ab-

sorption ways are ingestion, contact and inhalation. Human activities, causing

from fish larvae preying. In human some allergic reaction has been reported

Toxins production is considered as a defensive strategy for dinoflagellates

mulation, but also an increase in toxins concentrations to levels hazardous to

Keywords: Cyanobacteria, toxins, syndromes, therapy

A. ZACCARONI AND D. SCARAVELLI

eutrophication, are among causes responsible for the increase in proliferation

of both algae and cyanobacteria, by increasing the concentration of nutrients

necessary for their development and growth. Cells proliferation highly impacts

the quality of waters even when no evident bloom is formed.

At present little knowledge is available on toxins of algal origin, even if

some evidence exists of toxicity of algae to humans and fish, due to ex-

posure to Peridium polonicum (WHO, 2003).

Much more information exist on cyanobacteria toxins, which have been

chemically characterized and for which producing organisms have been

identified. At present 46 species of toxins producing blue-green algae have

been identified, and 60% of studied strains have proved to contain toxins.

First evidence of cyanobacterial intoxications dates up to 1878, when a

livestock poisoning in Australia was attributed to blue-green algae presence

and to toxin production. “…Symptoms-stupor and unconsciousness, falling

and remaining quiet, as if asleep, unless touched, when convulsions come

on, with head and neck drawn back by rigid spasm, which subsides before

death. Time- sheep, from one to six or eight hours; horses, eight to twenty-

four hours; dogs, four to five hours; pigs, three or four hours” (Francis,

1878).

All this considering, present chapter will focus on cyanobacteria toxins.

Cyanobacteria include both pelagic and benthic species, which form two

different kind of aggregates.

Pelagic species can float in water column, vertically migrating depending

on temperature, light and nutrient availability. These species contain intra-

cellular gas vesicles which help the cells in buoyancy and in maintaining

their position at desired depth in water column. In order to move through

water column, blue-green algae change the dimensions and the number of

vesicles. It has been observed that positive buoyancy is obtained by forming

proteinaceous gas containing vesicle. Conversely, reduction of buoyancy

result from polysaccharide accumulation and increased cellular turgor pres-

sure; polysaccharide act as ballast molecules, while increased pressure indu-

ces collapse of vesicles (Reynolds and Walsby, 1975; Kromkamp, 1987;

Humphries and Lyne, 1988; Walsby, 1994; WHO, 2003).

Vesicles dimensions are also adapted to atmospheric conditions, in parti-

cular to wind and waves, and are slowly adapted to weather changes. This

can lead to an increase of surface concentration of cells and to the formation

of floating scums when weather condition turn to less windy (Chorus and

These scums can be redispersed by wind and waves action, which can

also lead to persistence of scums themselves, by accumulating them to the

Bartram, 1999; WHO, 2003) (Fig. 1).

FRESH WATER TOXINS

Figure 1. Scums formation. A: cyanobacteria float in calm water; B: water conditions change

and cells concentrate on water surface; C: wind accumulate cyanobacteria to the shore.

shore. Wind and waves can also produce a slow dispersal by shore washing

or cell disintegration, causing the release of toxins in the environment and

Benthic species growth on different substrates (as mud or rocks) and

form mats on it, which can then be washed by waves to the shore. When

reaching the shore, they can be scavenged by dogs, livestock and wildlife,

thus causing toxicity. These cyanobacteria species have a smaller impact on

human health with respect to pelagic species, because they have a smaller

chance to be ingested, as they can be easily seen and avoided by man

(Edwards et al., 1992; Mez et al., 1997; Mez et al., 1998).

A major hazard for humans occurs when mats do not reach the surface.

Mats form when water is extremely clear, as light should reach the bottom

in order for blue-green algae to replicate, and thus water is perceived by

users as safe because it does not present “floating pollution” (WHO, 2003).

potentially increasing toxicity of water (WHO, 2003) (Fig. 2).

A. ZACCARONI AND D. SCARAVELLI

Three main classes of cyanotoxins exist:

Microcystins or nodularins

Neurotoxins

Cytotoxin or cylindrospermopsin.

Figure 2. Scums movements depending on weather conditions. A: wind accumulate cells in

two different, discontinuous parts of the pond; B: wind direction changes and a uniform

scum forms on the other side of the pond.

–

FRESH WATER TOXINS

Laboratory studies have underlined that probably other unidentified

toxins exist, starting from the toxic effects observed in cells cultures and

fish eggs exposure trials, which could not be ascribed to know toxins.

Most species have been found to produce both microcystins and neuro-

toxins; wild populations have been proved to be a mixture of toxic and

non-toxic strains, so that not always the presence of a potentially toxin-

These toxins have different mechanisms of action, which will be de-

scribed in following sections. Briefly, they can be resumed as follow:

Microcystins block protein phosphatases thus acting as cytotoxic com-

pound, being liver their main target (they are indeed considered as

HEPATOTOXIC compounds);

Neurotoxins act by blocking neuronal signalling;

2. Effect of Cyanobacteria on other Species

Cyanobacteria have a potential impact zooplankton, invertebrates and verte-

2.1. ZOOPLANKTON

Herbivorous plankton feeds on phytoplankton, including blue-green algae.

If any accumulation of toxins or toxic effect occurs at this level, causing

an alteration in planktonic populations, a disruption in trophic food chain

can occur.

A direct inhibition on zooplankton growth has been observed after ex-

posure to toxic cyanobateria or their toxins. Lots of studies have focused

copepods. This inhibition lead to a reduction of grazing and an increased

rate of rejection of food. A reduction of reproductive capacity, of growth, of

et al., 1986; Vanderploeg et al., 1990; Reinikainen et al., 1994; DeMott and

Dhawale, 1995; Weithoff and Walz, 1995; Kurmayer and Jüttner, 1999;

Thostrup and Christoffersen, 1999).

The intensity of the effect depends on the species and the strain studied,

on the stage of development of zooplankton and on environmental condi-

tions, like temperature or food. The inhibitory effect produce a reduction

of competitive capacity of affected species with respect to more resistant

on mycrocystins, which block phosphatases activity in cladocerans and

individuals’ dimensions and of survivor was observed (Arnold, 1971; Nizan

producing species coincides with real presence of the toxin(s).

Cytotoxin blocks protein and glutathione synthesis.

–

brates, man included (Fig. 3).

A. ZACCARONI AND D. SCARAVELLI

species (Lampert, 1982; Fulton and Paerl, 1988; DeMott, 1989; DeMott

et al., 1991; Hietala et al., 1995; Sartonov, 1995; Weithoff and Walz, 1995;

Gilbert, 1996b; Gilbert, 1996a; Hietala et al., 1997; Claska and Gilbert, 1998;

DeMott, 1999).

Some adaptive mechanism to cyanobacteria presence have been ob-

served in zooplankton species, i.e. the selective grazing on phytoplankton,

avoiding toxic species, registered in copepods. In these species a certain

degree of inhibition in feeding rate and a high physiological sensitivity

to the toxins have been observed, while no such mechanisms seems to exist

in daphnids, which completely stop feeding and which seem to be more

resistant to toxins (DeMott and Moxter, 1991; DeMott et al., 1991; Larson

and Dodson, 1993).

Some “passive selection” mechanism have also been observed, i.e. a strict

correspondence between mouth and prey size in rotifers and cladocerans,

which impede these species to feed on colonial and filamentous blue-green

algae, having them bigger dimensions (Hanazato, 1991; Kirk and Gilbert,

1992; Weithoff and Walz, 1995).

Other defensive mechanisms observed are the modulation of filtrating

rate depending on presence or absence of toxic strains and the modification

of the range of vertical migrations, in order to avoid the areas where toxic

species are present (Forsyth et al., 1990; Berthon and Brousse, 1995).

Indirect effect have also been observed, directed to an alteration of

zooplankton’s habitat, thus reducing its fitness. The algicides property of

cyanobacterial toxins can indeed destroy the algae zooplankton feeds on.

This pesticide-like action of toxins acts on both micro- and macro algae,

reducing food availability and the quality of zooplankton’s habitat (Kirpenko,

1986; Bagchi et al., 1990; Chauhan et al., 1992; Gilbert, 1994; Schriver

et al., 1995).

Direct or indirect effect of cyanotoxins on zooplankton can disrupt also

the structure and the dynamic of planktonic and higher communities. Indeed,

a reduction or an alteration of planktonic population can cause a deficit

or an unbalance in food availability for higher levels of trophic chain

(i.e. fingerling, whose first developmental stages are highly food-selective),

increasing physiological stress and sensitivity to toxins themselves (Gilbert,

1990; Kotak et al. 1996b; Mayer and Wahl, 1997; Thostrup and Christof-

fersen, 1999; Thompson et al., 2000; Jarvis et al., 2006).

By feeding on cyanobacteria, zooplankton can accumulate toxins in

their body and start the bioaccumulation process along food chain. Indeed,

in many cases the amount present in their body is not high enough to cause

direct toxicity for predators, but this residues can be accumulated in target

FRESH WATER TOXINS

organs and reach, at higher trophic levels, toxic concentrations (Watanabe

et al., 1992; Laurén-Määttä et al., 1995; Kotak et al., 1996b). Thostrup and

Christoffersen (1999) have shown that Daphnia can accumulate up to 24.5

ȝg/l of toxin/g dry weight; this amount is not toxic to fish which prey on

Daphnia, but they can accumulate the toxins in their body.

Finally, it has been observed that selective filtering activity by zoo-

plankton can induce a selection of blue-green algae present in a pond, cau-

sing an increase and dominance of toxins strain and species with respect to

non toxic ones. Kurmayer and Jüttner (1999) consider that some co-evolutive

biochemical phenomenon could exist between cyanobacteria and grazing

zooplankton, which allows blue-green algae to “use” the selective pressure

exerted by zooplankton to eliminate other primary producers competitors.

2.2. MOLLUSKS AND CRUSTACEAN

In an exposure study in pulmonate mollusks it was observed that toxins

concentration was dependent on the levels of cyanotoxin in phytoplankton

and not on that in water, thus demonstrating that tissue content originates

from food consumption more than from water filtration (Zurawell et al.,

1999).

Lots of species have proved to be able to concentrate toxins in their

body, i.e. Anodonta spp., demonstrating how these organisms represent a

first and fundamental step for the accumulation and transfer of cyanotoxins

along food chain. Indeed, mollusks present main food source for crustacean,

amphibian, birds and human (Andrasi, 1985; Eriksson et al., 1989; Novaczek

et al., 1991; Falconer et al., 1992; Prepas et al., 1997; Watanabe et al., 1997;

Williams et al., 1997; Amorim and Vasconcelos, 1999).

Crustacean can accumulate cyanotoxins in their tissues too, in parti-

cular in hepatopancreas, by both food ingestion and water filtering. These

species have proved to be little or no sensitive to the toxins, thus they can

accumulate high amounts of these metabolites and become, like mollusks,

an important source of pollution and of intoxication for higher levels of

trophic chain, man included (Liras et al., 1998; Saker and Eaglesham, 1999;

Humbert et al., 2001).

2.3. FISH SPECIES

Effect of cyanotoxins on fish species are both indirect and direct. Indirect

effects are those acting on zooplankton, thus reducing food availability, as

already mentioned.

A. ZACCARONI AND D. SCARAVELLI

Direct actions of blue-green algae toxins includes the anoxia induced by

blooms proliferations, which can cause massive fish deaths.

Direct toxicity have been described in various fresh water species,

i.e. carp and trout, where liver, kidney and gills were the target organs,

following controlled conditions exposure (Carbis et al., 1996; Kotak et al.,

1996a; Bury et al., 1997). Little information is available concerning toxicity

in field condition, even if some gills lesions have been described in trout,

Abramis brama and Rutilus rutilus (Eriksson et al., 1986; Rodger et al., 1994).

Anyway these lesion are quite general, and can not be directly related to

toxins exposure.

In one case only a direct correspondence between toxin exposure and

toxic syndrome has been proved; indeed, salmon exposed to microcystin

develop the so called Net Pen Liver Disease (NLPD), which have a certain

importance because of the huge economical loss it can cause (Andersen

et al., 1993; Humbert et al., 2001).

2.4. TERRESTRIAL VERTEBRATES

Lots of toxic episodes have been described in pet and livestock, as well as

in wildlife.

As already said, the first report about livestock intoxication dates up

to 1878, in Australia (Francis, 1878). After this report, lots of episodes

were registered, mainly interesting dog, sheep and cows. These intoxica-

tion are worldwide distributed, as cases were registered in Australia, USA,

South Africa and Europe. Most of reports are concerning domestic animals,

also because of their economical value, but some case has been registered

also in wildlife, like white rhinoceros, birds, skunks, minks (Soll and Williams,

1985; Carmichael and Falconer, 1993; Bell and Codd, 1996; Chorus and

Bartram, 1999; Saker et al., 1999; Carmichael, 2001; Pitois et al., 2001; Briand

et al., 2003; Codd et al., 2003; Krienitz et al., 2003; van Apeldoorn et al.,

2007).

2.5. HUMANS

Symptoms and toxicity of each single toxin to human will be described in

more detail in following paragraphs.

In this section, a rapid overview of some important toxic episodes will

be given, in order to give an idea of how diffuse and dangerous these toxins

can be. Generally speaking, human intoxication are due to ingestion of toxic

cyanobacteria or of water contaminated with the toxins (Table 1).

FRESH WATER TOXINS

TABLE 1. Possible exposure routes for cyanotoxins (from Codd et al., 1997).

Way of exposure Kind of exposure

Skin contact Toxic scum or mat material

Raw water containing toxic blooms or free toxins

Treated water containing toxic blooms or free toxins

Drinking water Accidental ingestion of toxic scum

Raw water containing toxic blooms or free toxins

Treated water containing toxic blooms or free toxins

Inhalation Toxins during water-sports, showering or work practices

Food consumption Shellfish or finfish if containing toxins

Plant products if containing toxins

Haemodialysis Using water containing free toxins

First report on human intoxication by cyanotoxins dates up to 1931,

when in Ohio (USA) drinking water treatment with copper sulphate in order

to destroy an algal bloom caused the death and lysis of cyanobacterial cells,

thus releasing toxins INTO water. Water consumption caused the intoxic-

ation of thousands of people (Tisdale, 1931).

In following years other episodes were reported in Zimbabwe (1966)

were children were affected, Australia (1983), Brazil (1993), where more

than 2000 people were affected and close to 100 died (mainly children).

In 1996 a serious and deadly episode occurred in Brazil, where more than

100 dialysed persons were affected, and 47 of them died due to the use

of contaminated water for dialysis (Zilberg, 1966; Bourke et al., 1983;

Falconer et al., 1983; Teixeira et al., 1993).

All these findings and reports made the OMS fix a maximum tolerable

level in water of 1ȝg microcystin equivalent/L for the hepatotoxic toxins.

Allergic reactions to algae and cyanobacteria are frequently reported on

the level of anecdotal evidence from eutrophic bathing waters and they are

considered relatively common but are little studied (Yoo et al., 1995).

Pronounced skin reactions in response to a bloom of Uroglena spp. were

observed in a small number of bathers, especially under bathing suits where

cells accumulated and partially disrupted during swimming (Chorus, 1993).

Frequently, divers complain of dermal reactions to algal material accumu-

lating under their wet suits, which tend to act as a strainer which lets out

water, but collects algae between skin and suit. Pressure and friction bet-

ween fabric and skin leads to cell disruption, liberation of content, and in-

tensified dermal exposure not only to algal cell wall material, but also to

substances otherwise largely confined within the cells.

A. ZACCARONI AND D. SCARAVELLI

CAUSES

Insufficient treated

sewage

runoff from

fertilized agricultural

areas

manure, effluent

from livestock

runoff from

roads in urban

areas

EFFECT

FERTILISATION OF WATER

(MAINLY WITH PHOSPHORUS )

CONSEQUENCES

MASS DEVELOPMENTS

OF POTENTIALLY TOXIC CYANOBACTERIA

IMPACTS

Water quality:

x Toxicity

x Allergenic effects

x Increased turbidity

x Nuisance odors

NHANCING FACTORS

Shallow waters -Long retention times (>1–2 month)

Figure 3. Scheme of the effects of cyanotoxins in aquatic organisms.

It is important to note that allergic reactions are not confined to cyano-

bacteria. The substances which provoke these reactions are likely to be

others than the cyanobacterial toxins. However, allergic reactions require

elevated cell densities in bathing water, and in freshwaters, mass deve-

lopments are most frequently due to cyanobacteria. Further, other groups of

algae do not accumulate as surface scums and therefore their metabolites

will not occur in comparably high concentrations.

FRESH WATER TOXINS

Algae have caused irritative coughs in personnel and patients of a

physiotherapeutic unit supplied with coarsely filtered surface water with

which it performed underwater massage treatment. As an example, in

October 1986, a water body was found to contain 4600 to 58000 cells/ml

of the desmid Staurastrum gracile, a species that was not effectively

eliminated by the filter, and has strong cell walls lined with spine and hook-

(Naglitsch, 1988). Whilst this incident may be more a curiosity than a serious

health threat, it does highlight the benefit for management of regular

microscopic examination of bathing and therapeutical waters in order to

recognize algae as a potential cause of health reactions.

3. Microcystins/Nodularins

Microcystins and nodularins are among the most frequently occurring and

widespread cyanotoxins.

They are produced by various species, like Microcystis aeruginosa,

Figure 4. Microcystins and nodularins producing cyanobacteria (A Microcystin, B Anabaena,

C Nostoc, D Planktothrix).

like structures which may well cause irritations of mucous membranes

Anabaena spp., Nodularia spp., Planktothrix and Nostoc (Fig. 4).

A. ZACCARONI AND D. SCARAVELLI

3.1. CHEMICAL STRUCTURE

These toxins are classified as cyclic peptides with low molecular weight.

Microcystins are cyclic heptapeptides characterized by a molecular

weight of 800–1100 and by the presence of particular amino acids, which

N-methyldehydroalanine (Mdha)

3-amino-9-methoxy-2,6,8-trimethyldeca-4,6-dienoic acid (Adda)

The most common amino acidic sequence observed is the following:

(D) Ala- (L) X- (D) MeAsp- (L) Z- Adda- (D) Glu- Mdha

Nodularins are cyclic pentapeptides whose molecular formula is:

dhBut- (D) MAsp- (L) Arg- Adda- (D) Glu

Due to all possible amino acidic combinations more than 60 different

microcystins exist, while only 6 variants of nodularins have been identified

(Table 2).

The analysis of different cyanobacterial microcystins producing strains

revealed that in many cases a single strain can produce more than a single

toxin. On the contrary nodularins producing strains usually synthesizing only

one variant of the toxin.

The molecular structure of microcystins and nodularins make them very

stable and resistant to many eukaryotic and bacterial peptidases. Anyway

they can be broken by aquatic bacteria living in the rivers and reservoirs

where cyanobacteria develop. The degradation of toxins requires a lag phase,

where little or no loss of cyanotoxin occurs, lasting from two days up to

three weeks, followed by an active degradation process, which lead to the

removal of up to 90% of total toxins within 2–10 days. Environmental con-

ditions and initial microcystins concentrations have proved to condition the

duration of these two phases. Generally speaking, bacteria can degrade with

high efficiency microcystins, but not nodularin (Jones et al., 1994; Rapala

et al., 1994; Cousins et al., 1996; Lahti et al., 1997a; Lahti et al., 1997b).

______

MeAsp: D-erythro-ȕ-methylaspartic acid

dhBut: N-methyldehydrobuthyrine

–

can be only found in these toxins (Fig. 5):

FRESH WATER TOXINS

Figure 5. Chemical structure of microcystins (a) and nodularins (b).

A. ZACCARONI AND D. SCARAVELLI

TABLE 2. List of identified variants of microcystins, their molecular weight and toxin

producing species (Chorus and Bartram (1999) modified).

Microcystin M.W. Cyanobacterium

Mcyst-LA 909 M. aerug., M.vir.

Mcyst-LAba 923 M. aerug.

Mcyst-LL 951 M. aerug.

Mcyst-AR 952 M. spp.

Mcyst-YA 959 M. aerug.

[D-AspDha]Mcyst-LR 966 M. aerug., Anab.

[D-AspDha]Mcyst-EE(OMe) 969 Anab.

Mcyst-VF 971 M. aerug.

[D-Asp]Mcyst-LR 980 A. flos-aq., M. aerug., M.vir., O. agard.

[Dha]Mcyst-LR 980 M. aerug., Anab., O. agard.

[DMAdda]Mcyst-LR 980 M. spp., Nostoc

[Dha]Mcyst-EE(OMe) 983 Anab.

[D-AspDha]Mcyst-E(OMe)E(OMe) 983 Anab.

Mcyst-LF 985 M. aerug.

Mcyst-LR 994 M. aerug., A. flos-aqu., M. vir.

[D-AspD-Glu(OCH

)]Mcyst-LR 994 A. flos-aq.

[(6Z)-Adda]Mcyst-LR 994 M. vir.

[Dha]Mcyst- E(OMe)E(OMe) 997 Anab.

[L-Ser]Mcyst-LR 998 Anab.

Mcyst-LY 1001 M. aerug.

[L-Ser]Mcyst-EE(OMe) 1001 Anab.

[D-AspSer]Mcyst-E(OMe)E(OMe) 1001 Anab.

Mcyst-HiIR 1008 Microcystis

[D-AspADMAdda]Mcyst-LR 1008 Nostoc

[D-Glu(OCH

)]Mcyst-LR 1008 A. flos-aq., M. spp.

[D-AspDha]Mcyst-RR 1009 M. aerug., M.vir., O. agard.

[D-AspADMAddaDhb]Mcyst-LR 1009 Nostoc

[L-MeSer]Mcyst-LR 1012 M. spp.

[Dha]Mcyst-FR 1014 M. spp.

[L-Ser]Mcyst-E(OMe)E(OMe) 1015 A. spp.

[ADMAdda]Mcyst-LR 1022 Nostoc

[D-Asp]Mcyst-RR 1023 M. aerug., Anab., O. agard.

[Dha]Mcyst-RR 1023 M. aerug., Anab., O. agard.

Mcyst-LW 1024 M. aerug.

Mcyst-FR 1028 M. spp.

Mcyst-M(O)R 1028 M. spp.

[Dha]Mcyst-HphR 1028 Anab.

[D-AspADMAdda]Mcyst-LHar 1022 Nostoc

(Continued)

FRESH WATER TOXINS

[D-AspDha]Mcyst-HtyR 1030 Anab.

[Dha]Mcyst-YR 1030 M. aerug.

[D-Asp]Mcyst-YR 1030 M. spp.

Mcyst-YM(O) 1035 M. aerug.

[ADMAdda]Mcyst-LHar 1036 Nostoc

Mcyst-RR 1037 M. aerug., M.vir., Anab.

[(6Z)-Adda]Mcyst-RR 1037 M.vir.

[D-Ser 1 ADMAdda]Mcyst-LR 1038 Nostoc

[ADMAddaMeSer]Mcyst-LR 1040 Nostoc

[L-Ser]Mcyst-RR 1041 Anab., M. aerug.

[D-AspMeSer]Mcyst-RR 1041 O. agard.

Mcyst-YR 1044 M. aerug., M.vir.

[D-Asp]Mcyst-HtyR 1044 A. flos-aq.

[Dha]Mcyst-HtyR 1044 Anab.

Mcyst-(H4)YR 1048 M. spp.

[D-Glu-OC

(CH

)OH]Mcyst-LR 1052 M. spp.

[D-AspADMAdda.Dhb]Mcyst-RR 1052 Nostoc

Mcyst-HtyR 1058 A. flos-aq.

[L-Ser]Mcyst-HtyR 1062 Anab.

Mcyst-WR 1067 M. spp.

[D-Asp.ADMAdda.Dhb]Mcyst-HtyR 1073 Nostoc

[L-MeLan]Mcyst-LR 1115 M. spp.

3.2. MECHANISM OF ACTION

Microcystins and nodularins enter the organism by using bile acid transport

system of hepatic and intestinal cells; they can be thus accumulated in liver,

An alternative way of absorption for these toxins is intranasal way, which

is particularly important when microcystins and nodularins are released in the

environment after cell lyses. This way of absorption gives great concern for

recreational waters: inhalation of droplets and spray formed by water sport

activities can lead to a high absorption of toxins by human.

They mainly effect hepatocytes, where they inhibit protein phosphatases

(PP) by covalently binding to the enzyme in the case of microcystins, and

with a non-covalent bond for nodularin. This binding blocks proteins

dephosphorilation, affecting cytoskeleton proteins too. As a consequence

of PP inhibition, the most affected cytoskeleton components are polymers

known as intermediate filaments and microfilaments. Their formation and

gut and kidney (Fig. 6).

A. ZACCARONI AND D. SCARAVELLI

structure is a balance between addition and loosing of subunit in intermediate

filaments and of association and dissociation in microfilaments. This balance

is controlled by the action of PP, which remove phosphate groups, and

protein kinases (PK) which add phosphate groups. Thus the inhibition of PP

increase the rate of phosphorilation and consequently of subunit loss and

dissociation (Carmichael, 1994).

As a consequence of exposure to hepatotoxins, intermediate filaments,

at first, and microfilaments loose their organization and cytoskeleton shrinks.

This causes the withdrawal of fingerlike projections which allow hepatocyte

to interact with neighboring cells, breaking the cell’s contact with the other

hepatocytes and with sinusoidal capillaries. Thus induced alterations causes

a reorganization of cells structure, with the appearance of swallowing of

cells, cells retraction and overposition. Cells detach from vessels and vessels

An additional target of microcystin is ȕ-subunit of ATP synthase, caus-

ing mitochondrial apoptotic signaling, but only at high concentrations.

Finally, it has been proved that microcystins enhance oxidative stress.

The exposure to the toxins induces formation of reactive oxygen species, loss

of mitochondrial membrane potential, mitochondria permeability, transition

and activation of calpain and Ca

/calmodulin-dependent protein kinase II.

All of these effects lead to cells apoptosis (Mikhailov et al., 2003).

Radicals formation induces alteration of cytoskeleton structures and

LDH leakage.

A protective role was defined for glutathione: binding to glutathione in-

crease water solubility and excretion of the toxins. Protective action is exerted

by linking to the same microcystin molecule moiety which binds to protein

phosphatases, namely at the Mdha. Thus any phenomena which causes

glutathione depletion limits the detoxifying capacity of the organism and/or

the prevention of oxidative damage (Runnegar et al., 1987; Hermansky

et al., 1991; Pace et al., 1991; Gehringer, 2003).

On the long term, microcystins and nodularins have proved to act as

tumor promoters. Indeed, PP and PK not only influence cell structure, but

also regulate cell proliferation, by promoting cell division cycle (PK) and

inhibiting cell division (PP). Thus PP blocking stimulate cell division; if such

a phenomena appears after carcinogenic mutation, it facilitates the develop-

ment of tumors, by enhancing mutated cells proliferation; thus cyanotoxins

should be classified as tumor PROMOTORS and not as tumor INDUCERS

(Carmichael, 1994; Sivonen and Jones, 1999).

themselves loose their organization (Fig. 6). This general alteration lead to

blood accumulation in liver, hemorrhage and death of the organism within

a few hours up to a few days (Carmichael, 1994).

FRESH WATER TOXINS

Figure 6. Mechanism of action of microcystins.

Toxicity has proved to be cumulative, due to the irreversible covalent

bond microcystin-PP, which increase in number following a higher and/or

longer exposure to the toxin. Thus the cells damage becomes more severe

with increasing dose and/or exposure time.

It has been observed that microcystins and nodularins, once solubilised

in water, adopt a chemical shape that is fundamental for the interaction of

the toxins with PP. Indeed, the molecule maintains a saddle-shaped motif,

with the free carboxyl groups of D-MAsp and D-Glu projecting laterally

and the Adda moiety extending posteriorly from the rigid cyclic backbone.

This structure allows the Adda moiety to fit to the hydrophobic groove at

the active site; the two carboxylate group and a carbonyl oxygen at the

metal-binding site; the L-Leu side chain at a tyrosine at the edge of the

C-terminal groove near the active site (Bagu et al., 1995; Goldberg et al.,

1995).

A. ZACCARONI AND D. SCARAVELLI

3.3. SYMPTOMS AND TREATMENT OF TOXICOSES IN HUMANS

Syndromes observed after ingestion (via drinking or recreational waters) or

breathing of cyanotoxins vary depending on the amount of toxin introduced

(Carmichael, 2001)

Observed symptoms following the ingestion of small amounts of micro-

cystins and/or nodularins can be ascribed to hepatitis, renal and intestinal

failure. They include weakness, anorexia, headache, gastric ache, pallor of

mucous membranes, vomiting, painful hepatomegaly, urinary bleeding, cold

extremities, diarrhea. This syndrome requires hospitalization of affected

people in order to recover (Turner et al., 1990; Carmichael, 1992; Carmichael,

1994; Carmichael, 1997; Carmichael, 2001).

Chronic exposure to low levels of toxins induces chronic alteration

of liver and digestive tract, with necrosis, progressive cellular fibrosis and

leucocytes infiltration of damaged tissues (Carmichael et al., 1988; Yu, 1989;

Carmichael and Falconer, 1993; Carmichael, 1994; Harada et al., 1996; Ueno

et al., 1996).

In more severe cases, where exposure is to high levels of toxins, death

can occur, due to intrahepatic hemorrhage and hypovolaemic shock, within

few hours after exposure (Carmichael, 1992; Carmichael and Falconer,

1993; Carmichael, 1994; Carmichael, 1997; Carmichael, 2001).

As already explained, chronic and sub-chronic exposure to hepatotoxins

seems to be tumor promoting, as has been proved in China by an epi-

demiological study. In that research a elevated correlation between liver

hepatocellular carcinoma incidence and microcystins presence in drinking

water was observed. Microcystins were considered as a co-factor for tumor

appearance, together with Aflatoxins B1 and hepatitis B virus. The remo-

val of both three co-factors reduced liver cancer incidence (Yeh, 1989; Yu,

1989; Zhu et al., 1989).

Direct contact with blue-green algae blooms induces gastritis (due to

occasional ingestion of cyanobacteria), acute dermatitis and hay-fever-like

symptoms, i.e. rhinitis, conjunctivitis and asthma, following skin and nasal

contact. Many of affected people give positive skin test against algal extracts,

suggesting an allergic mechanism at the base of the adverse reaction

(Billings, 1981; Carmichael et al., 1985; Codd and Bell, 1985).

Lots of episodes have been reported concerning exposure to hepato-

toxins by drinking or recreational waters.

The first case reports dates up to 1844 in London, when a woman pre-

senting severe abdominal pain eliminated Oscillatoria shred per rectum

(Farre, 1844).

The first case of massive intoxication due to microcystins was reported

by Tisdale (1931) and refers to a bloom of Microcystis sp. in Ohio and

FRESH WATER TOXINS

Potomac rivers, which caused the intoxication of thousands of persons

consuming rivers’ waters.

In following years, lots of episodes were reported in USA, Australia,

South America and Africa.

In 1966 gastroenteritis was observed in children living in Harare,

Zimbabwe, following Microcystis blooms in a water supply reservoir

(Zilberg, 1966).

In 1974, pyrogenic reactions, i.e. chills, fever, myalgia, nausea, vomiting

and hypotension, were observed in 23 patients of a private dialysis clinic

near Washington, USA. High levels of toxins were detected in potable

water supply and coincided with a blue-green algae bloom. The outbreak

stopped when the cyanobacteria count declined (Hindman et al., 1975).

In 1983 in Armindale, Australia, water supply ponds were treated with

copper sulphate (1 ppm) in order to eliminate a Microcystis bloom. Follo-

wing the termination of the bloom a toxic episode characterized by in-

creased liver enzyme activity, namely c-glutamyl-transferase, was observed

(Gilroy et al., 2000; Rao et al., 2002).

The two most lethal poisonings attributed to cyanobacteria in drinking

water occurred in Brazil. The first one occurred in 1993 and concerned a

massive Anabaena and Microcystis bloom in Itaparica Dam, where 2000

cases of gastroenteritis resulting in 88 deaths, mostly children, were re-

ported (Rao et al., 2002).

In 1996, an second outbreak of acute liver failure at a haemodialysis

centre in Caruaru occurred. 116 out of 131 patients experienced visual dis-

turbances, nausea and vomiting after routine haemodialysis treatment.

Subsequently, 100 patients developed acute liver failure, and of these 76

died. Following studies led to the conclusion that the major contributing factor

to death of the dialysis patients was intravenous exposure to microcystins,

specifically microcystin-YR, -LR and -AR with dialysis water (Carmichael

et al., 2001; Azevedo et al., 2002).

Man can also be exposed orally via algal health food products.

These products are potentially hazardous if they contain any of the toxi-

genic species or strains of cyanobacteria. Many of these products contain

Aphanizomenon flos-aquae, a blue-green alga that is harvested from Upper

Klammath Lake in southern Oregon, USA. Because M. aeruginosa coexists

with A. flos-aquae, it can be collected inadvertently resulting in microcystin

contamination of blue-green algae health products.

Dermal exposure may occur during recreational use of water bodies and

during showering and can cause blistering of lips and allergic reactions, like

contact dermatitis, asthma, hay fever and conjunctivitis (Rao et al., 2002).

In the UK in 1989, 10 out of 20 army recruits developed vomiting, diarrhoea,

A. ZACCARONI AND D. SCARAVELLI

central abdominal pain, blistering of the lips and sore throats after swimming

and canoe training in water with a dense bloom of Microcystis spp. Two of

the recruits developed pneumonia attributed to the aspiration of Microcystis

toxin and needed hospitalization and intensive care. The severity of the illness

appeared to be related to the swimming skills and the amount of water in-

gested (Chorus and Bartram, 1999).

Epidemiological evidence of adverse health effects after recreational water

contact was established in a prospective study involving 852 participants.

Results showed an elevated incidence of diarrhoea, vomiting, flusymptoms,

skin rashes, mouth ulcers, fevers, eye or ear irritation within 7 days follo-

wing exposure. Symptoms increased significantly with the duration of water

contact and cell density of cyanobacteria (Chorus and Bartram, 1999).

Twenty-six cases with skin diseases and multiple systemic symptoms

associated with exposure (some via drinking water) to river water or rain

water were reported in Australia during 1991–1992. The water was stored

in open tanks and contained Anabaena blooms (WHO, 1998). Illness in

humans associated with inhaling microcystins had been reported. The

intranasal route appeared to be as toxic as the intraperitoneal route. There-

fore, the risk posed by inhaling microcystins during showering should be of

concern (Duy et al., 2000).

No specific treatment exists for cyanobacteria intoxications.

Therapy is basically symptomatic, aimed at maintaining and restoring

organism functions. In some occasions antihistaminic drugs and cortisone

have been proved to be helpful in allergic reactions following skin contact

with blooms or scum.

In mice antioxidant administration, i.e. carotenoids, seems to have a pro-

tective role against more severe intoxication. Anyway, this protective action

was seen only if antioxidants were administered BEFORE microcystin ex-

posure, thus this treatment seems to have no therapeutic application (Negri

and Jones, 1995).

An inhibition of microcystins action on cell cultures, namely on mor-

phological alterations, has been proved by cyclosporine A and rifampicine

(Dawson, 1998). No application to humans is actually considered.

3.4. TOXICOSES IN ANIMALS

Microcystin are responsible for intermittent, but repeated cases of poi-

soning in wild and domestic animals. They were attributed as the cause of

death of cattle, geese, sheep, pigs, horses, dogs, cats, squirrels, poultry,

waterfowl and birds. In both wild and domestic animals, hepatoxicosis was

seen. The signs of hepatoxicosis included weakness, reluctance to move

about, anorexia, pallor of extremities and mucous membranes, and mental

FRESH WATER TOXINS

derangement. Death occurs within a few hours to a few days and is often

preceded by coma, muscle tremors and general distress. Death is believed

to be the result of intrahepatic haemorrhage and hypovolemic shock (Duy

et al., 2000).

A water bloom of N. spumigena in Lake Alexandrina, Australia, which

is a shallow lake at the termination of the River Murray, caused numerous

livestock deaths in 1878 and was the first scientifically documented case of

cyanobacterial intoxication (Falconer, 2001).

In 1963 in Rugen, Germany, 400 ducks were affected by toxins from N.

spumigena; in 1974–1975, 34 sheep and 52 lambs in South Western and

Western Australia were affected and in 1975 30 dogs became sick and 20

died at the Danish coast of the Baltic Sea. At the Swedish, German and

Finnish coast of the Baltic Sea, nine dogs, 16 young cattle and one dog plus

three puppies, respectively, were affected by toxins from N. spumigena in

1982, 1983 and 1984. In 1990 in Wilhelmshafen, Germany, two dogs

became sick by toxins from N. spumigena and were sacrificed (Duy et al.,

2000).

Lots of Flamingos die-off have been reported in both Europe and Africa.

Over the 1990s, episodic mass mortalities of Lesser Flamingos (Pho-

eniconaias minor) have occurred at Kenya’s Rift Valley saline, alkaline

lakes. Causative agents were three cyanobacterial toxins: microcystin-LR,

microcystin-RR and anatoxin-a. These toxins were present at concentrations

high enough to have caused the bird’s death. The presence of anatoxin-a

was consistent with observations of staggering and convulsions in the fla-

mingos before death and with opisthotonus postmortem (Codd et al., 1999).

In 2001, flamingos mass mortalities in southwest Spain have involved

wild and captive birds; at least 579 of 943 greater flamingo (Phoenicopterus

ruber) chicks died, together with a mixed population of other water birds at

the Doñana National Park lagoon. Microcystins were identified as the likely

cause of this death event in Spain, based on the presence of microcystin-

producing cyanobacteria and microcystins in the water and crop contents,

postmortem examination of livers and the elimination of alternatives (Codd

et al., 2003).

An acute mortality of ten adult captive Chilean flamingos (P. chilensis)

occurred at SeaWorld, Orlando, Florida, USA, in 2001. The P. chilensis

deaths were also attributed to microcystin-LR and microcystin-LA, based

on poisoning signs, postmortem examination of organs, toxin concentrations

in gastrointestinal contents and pond water and elimination of alternatives

(Codd et al., 2003).

Other wildlife species affected by hepatotoxins are white rhinoceros,

skunks and mink, as well as waterfowl, fish and muskrats (Soll and Williams,

1985; Eriksson et al., 1986; Carmichael, 1992; Bury et al., 1997).

A. ZACCARONI AND D. SCARAVELLI

4. Neurotoxins

Neurotoxins are alkaloids typical of cyanobacteria, produced by the genera

These toxins are divided in two main classes, anatoxins and saxitoxins.

Being saxitoxins produced also by marine algae, they will be discussed in

the chapter concerning marine algal toxins, and present section will focus

only on anatoxins.

4.1. CHEMICAL STRUCTURE

Among anatoxins, three molecules are known: anatoxins-a, omoanatoxin-a

and anatoxin-a(s), which, despite similar names, are chemically unrelated.

Anatoxin-a is a low molecular alkaloid, a secondary anime,

Omoanatoxin-a is an anatoxin-a homologue, characterized by a pro-

Figure 7. Neurotoxins producing algae (A – Anabaena, B – Planktothrix, C – Aphanizomenon).

Anabaena, Planktothrix and Aphanizomenon (Fig. 7).

(Fig. 8).

2-acetyl-9-azabicyclo(4-2-1)non-2-eme, with a molecular weight of 165 Da

pionyl group at C-2 instead of acetyl group, weighting 179 Da (Fig. 8).

FRESH WATER TOXINS

Figure 8. Chemical structure of neurotoxins.

Anatoxin-a was the first cyanotoxin to be chemically and functionally

characterized and is at present well known.

Its ionization state is pH-dependent and exists in the protonated form at

neutral and acidic pH. It is highly soluble in water and is polar, and easily

degraded by sunlight to non-toxic compounds. Omoanatoxin-a presents

similar characteristics.

Anatoxin-a(s) is considered a unique phosphate ester of a cyclic N-

hydroxyguanidine structure, with a molecular weight of 252 Da.

4.2. MECHANISM OF ACTION

Neurotoxins target the neuromuscular system, paralysing peripheral, skeletal

and respiratory muscles with different mechanisms.

Anatoxin-a is a cholinergic agonist binding to nicotinic receptors, causing

a depolarizing neuromuscular blockade (Carmichael et al., 1975; Spivak

et al., 1980; Aronstam and Witkop, 1981; Spivak et al., 1983).

When acetylcholine is released by neurons that impinge on muscle cells,

it binds to postsynaptic receptor. As it attaches to the receptor the Na

ion

channel opens, triggering the ionic movement that induces muscle cells to

contract. Soon after the enzyme acetylcholinesterase degrades acetylcholine,

preventing an overstimulation of the muscle cells and allowing the channel

to close and the receptor to get ready to respond to new signals (Fig. 9)

(Carmichael, 1992).

Anatoxin-a binds in an irreversible way to nicotinic acetylcholine re-

ceptor behaving as agonist of acetylcholine, but it can not be degraded by

acetylcholinesterase. Thus the binding induces a permanent opening of Na

channels, which causes inflowing of the ion and a continued action potential

generation, overstimulating muscle cells (Fig. 10).

A. ZACCARONI AND D. SCARAVELLI

Anatoxin-a(s) is at present one of the few naturally occurring organic

phosphate which acts like synthetic organophosphorous insecticides (OP).

Briefly, the toxin interacts with acetylcholinesterase and blocks the en-

zyme by irreversibly binding to esterasic active site, impeding cleavage and

recycling of acetylcholine (Fig. 11).

Its toxicity to mice is 10 times higher than that of anatoxin-a and about

20 times that of some very potent synthetic OP, i.e. di-isopropyl-fluoro-

phosphate (DFP) (Carmichael et al., 1990).

4.3. SYMPTOMS AND TREATMENT OF TOXICOSES IN HUMANS

No acute intoxication have been reported in humans, because aspect and

odor of waters affected by blooms makes them undesirable for consumption.

A possible way of exposure is through recreational and water-sport use, via

occasional ingestion or inhalation. In these occasions, exposure to suble-

thal amounts can be expected. Following these exposures, recovery appears

to be complete and with no chronic effects following recovery (Kuiper-

Goodman et al., 1999; WHO, 2003).

By interfering with acetylcholine metabolism all neurotoxins induce a

constant opening of sodium channel and a persistent stimulation of post-

synaptic neurons. Consequently symptoms which appears following intoxic-

ation are similar.

Figure 9. Scheme of action of acetylcholine.

FRESH WATER TOXINS

Figure 10. Scheme of action of anatoxin-a.

Figure 11. Scheme of mechanism of action of anatoxin-a(s).

A. ZACCARONI AND D. SCARAVELLI

Staggering, muscle fasciculation, reduced movement, gasping respi-

ration, bruxism, cyanosis and convulsions appear (Carmichael, 1992; Hunter,

1998; van Apeldoorn et al., 2007).

The distinguishing symptoms between the two group of neurotoxins are:

Rigid neck contracture in birds for anatoxin-a

Intense salivation (from which the “s” of the toxins comes from) and

mucous nasal discharge for anatoxin-a(s).

Symptoms are similar to those observed in OP intoxication, due to the

anticolinesterasic activity.

No specific treatment exists for anatoxin-a intoxication, even if it has

been proved in mice and rats that artificial respiration can help in reco-

vering animals, together with lavage and instillation of activated charcoal

(Carmichael et al., 1975; Beasley et al., 1989).

On the contrary, treatment of anatoxin-a(s) intoxication can be effici-

ently performed by applying the same drugs used for OP intoxication, i.e.

atropine (Mahmood and Carmichael, 1986; Beasley et al., 1989).

4.4. TOXICOSES IN ANIMALS

Animals as livestock have a high probability of getting intoxicated by neuro-

toxins, as they can drink high amounts of contaminated water and gather

scum material in their fur and ingest it through grooming with the tongue.

Anatoxin-a causes death within minutes to a few hours depending on the

species, the amount of toxin ingested, and the amount of food in the stomach.

Clinical signs of poisoning follow a progression of muscle fasciculations,

decreased movement, abdominal breathing, cyanosis, convulsions and death.

In addition, opisthotonus (rigid, “s”-shaped neck) is observed in avian species.

In the wild larger animals collapse and sudden death is observed (Carmichael,

2001).

Documented cases of animal fatalities due to the consumption of water

with anatoxin-a included cattle in Finland and Canada, and dogs in the

USA, New Zealand, Scotland and Ireland. The onset of the symptoms is

very rapid (Chorus and Bartram, 1999; Duy et al., 2000; Hamill, 2001;

Briand et al., 2003; Furey et al., 2003).

Over the 1990s, episodic mass mortalities of Lesser Flamingos (P. minor)

have occurred at Kenya’s Rift Valley saline, alkaline lakes. Analyses of

flamingo carcass livers and cyanobacterial samples from Lakes Bogoria

and Nakuru demonstrated three cyanobacterial toxins in dead flamingo

livers: microcystin-LR and microcystin-RR and anatoxin-a.

Toxins were present at concentrations sufficient alone to have caused

the birds death, that of anatoxin-a being consistent with observations of

–

FRESH WATER TOXINS

staggering and convulsions in the flamingos before death and with opistho-

tonus postmortem (Codd et al., 2003). Further research with materials from

Lake Bogoria Lesser Flamingos has identified also the microcystins and

anatoxin-a in bird stomach, intestine contents and faecal pellets (Krienitz

et al., 2003).

Anatoxin-a(S) was responsible for the death of dogs, pigs and ducks in

the USA (Briand et al., 2003). Animal poisoning due to anatoxin-a(s) was

seen in Denmark (Kaas and Henriksen, 2000).

5. Cylindrospermopsin

Cylindrospermopsin is the only representative of the toxin class of cytotoxin.

It is produced by Cylindrospermopsis raciborskii, a tropical cyanobac-

teria, Anabaena bergii, Aphanizomenon sp., Umezakia natans, Raphidiopsis

cyanobacteria are filamentous organisms closely genetically related. Most

known organism is Cylindrospermopsis raciborskii, who is worldwide

distributed. It has been observed that this blue-green alga is spreading in

cooler areas of the Northen Emisphere; whether this is a result of global

warming or of the distribution of more cold-tolerant strains is not yet

clarified (Padisak, 1997; Lagos et al., 1999; Griffiths and Saker, 2003;

Figure 12. Cylindrospermopsis.

C. raciborskii does not form surface scums, while it forms dense bands

well below the lake surface in clear stratified lakes during summer. Thus it

is not perceived as a danger by reservoir managers. When present in shallow

Falconer, 2005; Gugger et al., 2005) (Fig. 12).

curvata and, for German waters, Aphanizomenon flos-aquae. All of these

A. ZACCARONI AND D. SCARAVELLI

mixed lakes, filaments distribute throughout the water column, which assu-

mes a general discoloration. In any case, the toxin content is high, as it leaks

from cells in normal conditions; i.e. in A ovalisporum blooms around 80%

of toxin was in free solution. Thus normal treatment procedure does not

satisfactorily remove the toxins (Shaw et al., 1999; Fabbro and Andersen,

2003; Falconer and Humpage, 2006).

5.1. CHEMICAL STRUCTURE

different epimers, cylindrospermopsin and 7-epicylindrospermopsin, which

are both two naturally occurring and equally toxic. The molecule, because

of its negatively charged sulfatic group and of the positively charged

guanidine group, is highly water soluble (Banker et al., 2001; Looper et al.,

2005; White and Hansen, 2005; Falconer and Humpage, 2006).

An additional, naturally occurring variant is 7-deoxy-cylindrospermopsin,

co-existing with cylindrospermopsin in drinking waters. Its toxicity is still

under evaluation, but it is probably as toxic as cylindrospermopsin (Banker

et al., 2001; Looper et al., 2005; White and Hansen, 2005; Falconer and

Humpage, 2006).

Basic for toxicity seems to be the uracil group: the loss of this group,

indeed, effectively removes toxicity (Banker et al., 2001).

5.2. MECHANISM OF ACTION

Cylindrospermopsin is a general cytotoxin that blocks protein synthesis, and

the first clinical symptoms of poisoning are kidney and liver failure (Chorus

and Bartram, 1999; Carmichael, 2001). By the oral route, cylindrospermopsin

Cylindrospermopsin is an alkaloid containing a tricyclic guanidine combined

with hydroxymethyl uracyl (Fig. 13). The hydroxyl bridge can bring two

Figure 13. Chemical structure of cylindrospermopsins.

FRESH WATER TOXINS

can cause gastroenteritis through injury to the gut lining, hepatitis from

injury to liver cells, renal malfunction from cell injury to the kidneys and

haemorrhage from blood vessel injury (Duy et al., 2000).

One of the effects induced by cylindrospermopsin is the activation of

cytochrome P-450 (CYP450), mechanism considered of primary impor-

tance for toxicity.

A study in rat hepatocytes cultures revealed that protein synthesis in-

hibition is rapid and irreversible. Indeed, no synthetic activity was obser-

ved up to 18 hours after suspension of exposure of cells.

This observation lead to consider protein synthesis inhibition unlikely

to be the major toxic insult, as cytochrome P-450 inhibitors that attenuated

cylindrospermopsin toxicity, did not protect against the impairment of

protein synthesis (Froscio et al., 2003).

Further studies had underlined four main steps in the toxic process, all

depending on cytochrome P-450 activation. In the initial phase, ribosomes

detach from the membranes of the rough-surfaced ER and accumulate into

the cytoplasm of hepatocytes. This process is accompanied by condensation

and reduction in the size of nucleoli.

The second phase, which begins 24 h after exposure, is correlated with

membrane proliferation. In this phase the amount of total P-450 is greatly

decreased in hepatic microsomes.

The third phase is characterized by fat droplets accumulation in the

central portion of hepatic lobules, probably induced by free radicals induced

by liver injury.

Finally severe liver necrosis occurs (Duy et al., 2000).

Protein synthesis inhibition affects also glutathione synthesis, which is

under CYP450 control, but this does not lead to an increase in oxidative

stress, thus suggesting that this should not be considered a primary toxicity

mechanism (Runnegar et al., 1995).

CYP450 seems to be important also for genotoxic and carcinogenic effect

associated to toxin exposure.

Indeed, DNA fragmentation observed in a number of in vitro assay sys-

tems seems to require metabolism of the toxin, which is regulated by

CYP450 activity. Indeed, active oxidation operated by CYP450 produces

genotoxic compounds which induce DNA breaking.

In vitro results seems to be confirmed by epidemiological studies: follo-

wing a poisoning which occurred in 1979 affecting a group of children, a

monitoring study began aimed at verifying any increase in cancer incidence.

After more than 20 years of follow-up, a trend toward an increase in

gastrointestinal cancer was observed, even thought results obtained were

not statistically significant, due to the small number of cases followed

(Humpage et al., 2005; Falconer and Humpage, 2006).

A. ZACCARONI AND D. SCARAVELLI

5.3. SYMPTOMS AND TREATMENT OF TOXICOSES IN HUMANS

Toxicity symptoms are characterized by hepatitis, renal and intestinal lesions,

vomiting, headache, abdominal pain, hematuria, glycosuria and proteinuria,

constipation followed by bloody diarrhea and electrolytic unbalance (Bourke

et al., 1983).

As for microcystin, treatment is symptomatic and aimed at sustaining

and restoring body functioning. It should be remembered, anyway, that pro-

tein inhibition is irreversible, thus recovery require long, intensive and

specialized hospital cares.

In Australia, in 1979 a cyanobacterial bloom in the drinking water re-

servoir resulted in complaints from the water consumers of bad taste and

odour from the drinking water. Controlling water authorities terminated the

bloom by copper sulphate addition to the reservoir. Shortly after copper

dosing of the reservoir, children were brought into the hospital with an

unusual hepatoenteritis, initially showing acute tender liver enlargement,

constipation, vomiting and headache. This was followed by bloody diarrhea

and loss of protein, electrolytes, glucose and ketones through the urine, with

varying severity of dehydration. Severe cases were flown to the regional

hospital, where they received intensive care with intravenous therapy.

A total of 140 children and 10 adults received hospital treatment. The clini-

cally most serious cases occurred among the Aboriginal population of Palm

Island, off the Queensland coast of Australia in 1979. The intoxication was

firstly named “Palm Island Mystery Disease”, because no aetiological agent

was identified. Further investigations allowed the isolation of cylindro-

spermopsin derived from C. raciborskii, in water, which showed similar

toxicity in animal studies to that in the children reported above (Byth, 1980;

Hawkins et al., 1985; Falconer, 2001; Falconer and Humpage, 2006).

5.4. TOXICOSES IN ANIMALS

In August 1997, a farm dam at McKinlay in northwest Queensland,

Australia, contained an algal bloom which was identified as a monoculture

of C. raciborskii. Cylindrospermopsin was detected in material harvested

from the dam and in a pure culture of an isolate from the bloom. An extract

of this material was lethal to mice 24 h after an i.p injection of 153 mg/kg

bw. On a cattle property near the dam three cows and ten calves died. One

animal showed signs of staggering and weakness before its death. Abdo-

minal and thoracic hemorrhagic effusion, hyperemic mesenteries and pale

and swollen liver were found at necropsy, with nothing abnormal observed

in the brain, lungs, spleen or kidney. Histopathology of the liver from a calf

FRESH WATER TOXINS

carcass showed signs similar to the known toxicological effects of cylindro-

spermopsin in mice, i.e. extensive areas of hepatic degeneration and necrosis,

with only isolated areas of intact hepatocytes remaining; deposits of fibrous

tissue were common throughout the liver (Saker et al., 1999; Briand et al.,

2003).

6. Lipopolysaccharides (LPS)

Endotoxic lipopolysaccharides (LPS) are common compounds of the outer

cell walls of cyanobacteria and Gram negative bacteria. They have been

well characterized in Gram-negative, pathogenic bacteria, but their chemi-

cal structure is known for cyanobacteria too.

They consist of lipid A, core polysaccharides and of an outer poly-

saccharide chain. This chain is composed by a great variety of log chain

unsaturated fatty acids and hydroxyl fatty acids and lacks phosphate.

The backbone sugar seems to be glucosamine, presenting variable

amounts of 2-keto 3-deoxyoctonate (KDO), galactoses and heptoses (Martin

LPS cause fever in mammals and are involved in septic shock synd-

rome, which can aggravate toxicant-induced liver injury.

Figure 14. Lipopolysaccharides chemical structure.

et al., 1989) (Fig. 14).

A. ZACCARONI AND D. SCARAVELLI

This irritating action is mainly due to the fatty acid component of the

molecule and is achieved by the releasing of inflammatory mediators, i.e.

tumor necrosis-factor Į, interferon-Ȗ, interleukin 1 and 6, leukotrienes, pro-

stanoids, nitric oxide. Antibody production is induced by the O-antigen.

They can also alter the detoxification systems of the organisms by

inhiboting the glutathione S-transferase genes and in fish they induce an

osmotic imbalance by stimulation of water ingestion.

Cyanobacteria LPS are less toxic than those of pathogenic Gram-negative

bacteria, but could be implicated in human health problems encountered as

a result of bathing for example.

7. Bioactive Compounds

Cyanobacteria not only produce toxic compounds which can be lethal to

humans and animals, but are known to produce several other bioactive

compounds, some of which are of medical interest. These molecules have

proved to be active against algae, bacteria, fungi and mammalian cell lines,

thus can potentially have a wide range of applications (Carmichael, 1992).

Cyanobacteria have been found to be a rich source of biomedi-

cally interesting compounds and therefore screening programmes for new

bio-activities are underway (Kashiwagi et al., 1980; Rinehart et al., 1981;

Mason et al., 1982; Patterson et al., 1984; Flores and Wolk, 1986; Cannell

et al., 1988; Gerwick et al., 1989; Schwartz et al., 1990).

Cyanobacteria are known to produce antitumour, antiviral, antibiotic

and antifungal compounds. Of the cyanobacterial extracts screened by a

Hawaiian research group, 0.8 per cent showed solid tumour selective cyto-

toxicity (Moore et al., 1991). Depsipeptides (peptides with an ester linkage)

called cryptophycins isolated from a cyanobacterium, Nostoc sp. strain GSV

224, are promising candidates for an anticancer drug (Trimurtulu et al., 1994).

Recently, several new cyclic or linear peptides and depsipeptides from cya-

nobacteria have been characterised. Some are protease inhibitors, but the

biological activity of the others remains to be characterised (Namikoshi and

Rinehart, 1996). Many of the cyanobacterial bioactive compounds possess

structural similarities to natural products from marine invertebrates.

It has been observed that bioactive compounds discovered in cyano-

bacteria are not duplicate structures of known “natural” drugs, as the rate of

rediscovery in blue-green algae is very low, as compared with that in acti-

nomycete, rating up to 95% (Patterson et al., 1991; Carmichael, 1992).

Chemically, these compounds include acutiphycins, indolcarbazoles,

mirabilene isonitriles, paracyclophanes, scytophycins, tantazoles, tolytoxin,

toyocamycin and tubercidin, which have mainly extracted from freshwater

and terrestrial cyanobacteria (Patterson et al., 1991; Carmichael, 1992).

FRESH WATER TOXINS

8. Cyanobacteria as Food Supplements: Problems Related

Cyanobacteria are at present considered as good food supplements, as they

can increment the amount of vital nutrients intake, i.e. amino acids, tace

minerals, omega-3 and -6 fatty acids, ȕ-carotene and vitamins. This supple-

mentation seems to improve memory and attention, increase energy and

immune status and give relief to exhaustion nervousness, depression and

premenstrual syndrome. Blue-green algae extracts are also used in the treat-

ment of Attention Deficit Disorder in children (Dittmann and Wiegand,

2006).

Anyway, such products should be carefully checked, as the species

which are used for their production, i.e. Spirulina and Aphanizomenon, can

be contaminated by toxin producing strains and species, or can themselves

produce the toxins, as has been proved for Spirulina, wich can produce

anatoxin-a (Kozlowsky-Suzuki et al., 2003). Gilroy et al. (2000) showed for

example that 72% of blue-green algae products analysed presented levels of

microcystins higher than safe level fixed by WHO.

Great attention should be paid in using such products, especially in

children, as the risk increases depending on doses and duration of exposure

to contaminating toxins. Children, due to their lower body weight, are ex-

posed to higher amount of toxins/kg b.w., so they are particularly at risk.

Additionally, the established WHO limit for microcystin has been based

on acute testing in animals and does not considers the tumor-promoting

capacities of the toxin. An additional uncertainty factor was included, lead-

ing to a lower guideline value of 0.3 ȝg/l (Kankaanpaa et al., 2002).

References

Amorim, A. and Vasconcelos, V., 1999, Dynamics of Microcystins in the Mussel Mytilus

Galloprovincialis, Toxicon 37: 1041–1052.

Andersen, R. J., Luu, H. A., Chen, D. Z. X., Holmes, C. F. B., Kent, M. L., Le Blanc, M.,

Taylor, F. J. R. M. and Williams, D. E., 1993, Chemical and Biological Evidence Links

Microcystins to Salmon ‘Netpen Liver Disease’, Toxicon 31: 1315–1323.

Andrasi, A., 1985, Uptake of Dissolved Gonyaulax Catenella Toxins from Seawater by

Mytilus Edulis Linne, in: Toxic Dinoflagellates, D. M. Anderson, A. W. White and D. G.

Baden, Elsevier. Amsterdam, pp. 401–406.

Arnold, D. E., 1971, Ingestion, Assimilation, Survival, and Reproduction by Daphnia Pulex

Fed Seven Species of Blue-Green Algae, Limnology and Oceanography 16: 906–920.

Aronstam, R. S. and Witkop, B., 1981, Anatoxin-a Interactions with Cholinergic Synaptic

Molecules, Proceedings of the National Academy of Sciences of the United States of

America 78: 4639–4643.

A. ZACCARONI AND D. SCARAVELLI

Azevedo, S. M. F. O., Carmichael, W. W., Jochimsen, E. M., Rinehart, K. L., Laud, S.,

Shawe, G. R. and Eaglesham, G. K., 2002, Human Intoxication by Microcystins During

Renal Dialysis Treatment in Caruaru-Brazil, Toxicology 181–182: 441–446.

Bagchi, S. N., Palod, A. and Chauhan, V. S., 1990, Algicidal Properties of a Bloom-Forming

Blue-Green Alga, Oscillatoria Sp., Journal of Basic Microbiology 30: 21–29.

Bagu, J. R., Sonnichsen, F. D., Williams, D. E., Andersen, R. J., Sykes, B. D. and Holmes,

C. F. B., 1995, Comparison of the Solution Structures of Microcystin-Lr and Motuporin,

Nature Struct Biol 2: 114–116.

Banker, R., Carmeli, S., Werman, M., Teltsch, B., Porat, R. and Sukenik, A., 2001, Uracil

Moiety Is Required for Toxicity of the Cyanobacterial Hepatotoxin Cylindrospermopsin,

J Toxicol Environ Health A 62: 281–288.

Beasley, V. R., Cook, W. O., Dahlem, A. M., Hooser, S. B., Lovell, R. A. and Valentine, W. M.,

1989, Algae Intoxication in Livestock and Waterfowl, Vet Clin North Am Food Anim

Pract 5: 345–361.

Bell, S. G. and Codd, G. A., 1996, Detection, Analysis and Risk Assessment of Cyano-

bacterial Toxins, in: Agricultural Chemicals and the Environment, Issues in Environ-

mental Science and Technology, R. E. Hester and R. M. Harrison, Royal Society of

Chemistry. Cambridge, pp. 109–122.

Berthon, J. L. and Brousse, S., 1995, Modification of Migratory Behavior of Planktonic

Crustacea in the Presence of a Bloom of Microcystis Aeruginosa (Cyanobacteria),

Hydrobiologia 300–301: 185–193.

Billings, W. H., 1981, Water Associated Human Illness in Northeast Pennsylvania and Its

Suspected Association with Blue-Green Algal Blooms, in: Algal Toxins and Health,

W. Carmichael, Plenum Press. New Yrok, pp. 243–255.

Bourke, A. T. C., Hawes, R. B., Neilson, A. and Stallman, N. D., 1983, An Outbreak of

Hepato-Enteritis (the Palm Island Mystery Disease) Possibly Caused by Algal Intoxi-

cation, Toxicon 21: 45–48.

Briand, J. F., Jacquet, S., Bernard, C. and Humbert, J. F., 2003, Health Hazards for

Terrestrial Vertebrates from Toxic Cyanobacteria in Surfacewater Ecosystems, Vet. Res.

34: 361–377.

Bury, N. R., McGeer, J. C., Eddy, F. B. and Codd, G. A., 1997, Liver Damage in Brown

Trout, Salmo Trutta L., and Rainbow Trout, Oncorhynchus Mykiss (Walbaum),

Following Administration of the Cyanobacterial Hepatotoxin Microcystin-Lr Via the

Dorsal Aorta, Journal Fish Diseases 20: 209–215.

Byth, S., 1980, Palm Island Mystery Disease, Med. J. Aust. 2: 40–42.

Cannell, R. J. P., Kellam, S. J., Owsianka, A. M. and Walker, J. M., 1988, Results of a Large

Scale Screen of Microalgae for the Production of Protease Inhibitors, Planta Medica 54:

10–14.

Carbis, C. R., Rawlin, G. T., Mitchell, G. F., Anderson, J. W. and McCauley, I., 1996, The

Histopathology of Carp, Cyprinus Carpio L., Exposed to Microcystins by Gavage,

Immersion and Intraperitoneal Administration, Journal Fish Diseases 19: 199–207.

Carmichael, W. W., Biggs, D. F. and Gorham, P. R., 1975, Toxicology and Pharmacological

Action of Anabaena Flos-Aquae Toxin, Science

187: 542–544.

Carmichael, W. W., Jones, C. L. A., Mahmood, N. A. and Theiss, W. C., 1985, Algal Toxins

and Water-Based Diseases, CRC Critical Reviews in Environmental Contrology 15: 275–

313.

Carmichael, W. W., Yu, M. J., He, Z. R., He, J. W. and Yu, J. L., 1988, Occurrence of the

Toxic Cyanobacterium (Blue-Green Alga) Microcystis Aeruginosa in Central China,

Arch Hydrobiol 114: 21–30.

FRESH WATER TOXINS

Carmichael, W. W., Mahmood, N. A., Eschedor, J. H. and Yu, M. J., 1990, Natural Toxins

from Cyanobacteria, in: Marin Toxins: Origin, Structure and Molecular Pharmacology,

S. Hall and G. Striehartz, American Chemical Society. Washington, D.C., pp. 87–106.

Carmichael, W. W., 1992, Cyanobacteria Secondary Metabolites–the Cyanotoxins, Journal

of applied bacteriology 72: 445–459.

Carmichael, W. W. and Falconer, I. R., 1993, Diseases Related to Freshwater Blue-Green

Algal Toxins, and Control Measures, in: Algal Toxins in Seafood and Drinking Water, I.

Falconer, Academic press. London, UK, pp. 187–209.

Carmichael, W. W., 1994, The Toxins of Cyanobacteria, Scientific American 270: 78–86.

Carmichael, W. W., 1997, The Cyanotoxins, Adv. Bot. Res. 27: 1–256.

Carmichael, W. W., 2001, Health Effects of Toxin-Producing Cyanobacteria, “the Cyanohabs”,

Hum. Ecol. Risk Assessement 7: 1393–1407.

Carmichael, W. W., Azevedo, S., An, J. S., Molica, R. J. R., Jochimsen, E. M., Lau, S.,

Rinehart, K. L., Shaw, G. R. and Eaglesham, G. K., 2001, Human Fatalities from

Cyanobacteria: Chemical and Biological Evidence for Cyanotoxins, Environ Health

Perspect 109: 663–668.

Chauhan, V. S., Marwah, J. B. and Bagchi, S. N., 1992, Effect of an Antibiotic from

Oscillatoria Sp. On Phytoplankters, Higher Plants and Mice, New Phytologist 120: 251–257.

Chorus, I., 1993, Algal Metabolites and Water Quality: Toxins, Allergens, and Taste-and

Odor-Substances. Proceedings of the Ilec-Symposium ‘Strategies for Lakes Beyond

2000’, Mem. Ist. Ital. Idrobio. 52: 257–280.

Chorus, I. and Bartram, J., 1999, Toxic Cyanobacteria in Water: A Guide to Their Public

Health Consequences, Monitoring and Management, Spon, E. Spon, F.N., London, UK,

416 pp.

Claska, M. E. and Gilbert, J. J., 1998, The Effect of Temperature on the Response of

Daphnia to Toxic Cyanobacteria, Freshwater Biology 39: 221–232.

Codd, G. A. and Bell, S. G., 1985, Eutrophication and Toxic Cyanobacteria, Journal Water

Pollution Contrology 21: 1–13.

Codd, G. A., Ward, C. J. and Bell, S. G., 1997, Cyanobacterial Toxins: Occurrence, Modes

of Action, Health Effects and Exposure Routes, Arch Toxicol Suppl 19: 399–410.

Codd, G. A., Metcalf, J. S. and Beattie, K. A., 1999, Retention of Microcystis Aeruginosa

and Microcystin by Salad Lettuce (Lactuca Sativa) after Spray Irrigation with Water

Containing Cyanobacteria, Toxicon 37: 1181–1185.

Codd, G. A., Metcalf, J. S., Morrison, L. F., Krienitz, L., Ballot, A., Pflugmacher, S.,

Wiegand, C. and Kotut, K., 2003, Susceptibility of Flamingos to Cyanobacterial Toxins

Via Feeding, Vet. Rec. 152: 722–723.

Cousins, I. T., Healing, D. J., James, H. A. and Sutton, A., 1996, Biodegradation of

Microcystin-Lr by Indigenous Mixed Bacterial Populations., Wat. Res. 30: 481–485.

Dawson, R. M., 1998, The Toxicology of Microcystins, Toxicon 36: 953–962.

DeMott, W. R., 1989, Optimal Foraging Theory as a Predictor of Chemically Mediated Food

Selection by Suspension-Feeding Copepods,

Limnology and Oceanography 34: 140–154.

DeMott, W. R. and Moxter, F., 1991, Foraging Cyanobacteria by Copepods: Responses to

Chemical Defense and Resource Abundance, Ecology 72: 1820–1834.

DeMott, W. R., Zhang, Q. X. and Carmichael, W. W., 1991, Effects of Toxic Cyanobacteria

and Purified Toxins on the Survival and Feeding of a Copepod and Three Species of

Daphnia, Limnology and Oceanography 36: 1346–1357.

DeMott, W. R. and Dhawale, S., 1995, Inhibition of in Vitro Protein Phosphatase Activity in

Three Zooplankton Species by Microcystin-Lr, a Toxin from Cyanobacteria, Archiv

Hydrobiologie 134: 417–424.

A. ZACCARONI AND D. SCARAVELLI

DeMott, W. R., 1999, Foraging Strategies and Growth Inhibition in Five Daphnids Feeding

on Mixtures of a Toxic Cyanobacterium and a Green Alga, Freshwater Biology 42:

263–274.

Dittmann, E. and Wiegand, C., 2006, Cyanobacterial Toxins- Occurrence, Biosynthesis and

Impact on Human Affairs, Mol. Nutr. Food Res. 2006: 7–17.

Duy, T. N., Lam, P. K., Shaw, G. R. and Connell, D. W., 2000, Toxicology and Risk

Assessment of Freshwater Cyanobacterial (Blue-Green Algal) Toxins in Water, Rev.

Environ. Contam. Toxicol. 163: 113–185.

Echlin, P., 1966, The Blue-Green Algae, Sci. Am. 214: 75–81.

Edwards, W., Gregory, D. and Vanhooser, S., 1992, Heavy Metal Poisoning in Ostriches

from Proventricular Foreign Bodies., Vet. Hum. Toxicol. 34: 254–255.

Eriksson, J. E., Meriluoto, J. A. O. and Lindholm, T., 1986, Can Cyanobacterial Peptide

Toxins Accumulate in Aquatic Food Chains, in: Perspectives in Microbial Ecology.

Proccedings of the 4th International Symposium on Microbial Ecology, F. Megusar and

M. Gantar. Ljubliana, pp. 655–658.

Eriksson, J. E., Meriluoto, J. A. O. and Lindholm, T., 1989, Accumulation of a Peptide

Toxin from the Cyanobacterium Oscillatoria Agardhii in the Freshwater Mussel

Anadonta Cygnea, Hydrobiologia 183: 211–216.

Fabbro, L. and Andersen, L. E., 2003. Baseline Assessment of Water Column Stratification

and the Distribution of Blue-Green Algae in Lake Awoonga, Gladstone, Queensland,

Centre for Environmental Management, Central Queensland University, Queensland,

22 pp.

Falconer, I. R., Beresford, A. M. and Runnegar, M. T., 1983, Evidence of Liver Damage by

Toxin from a Bloom of the Blue-Green Alga, Microcystis Aeruginosa, Med. J. Aust.

1: 511–514.

Falconer, I. R., Choice, A. and Hosja, W., 1992, Toxicity of Edible Mussels (Mytilus Edulis)

Growing Naturally in an Estuary During a Water Bloom of the Blue-Green Alga

Nodularia Spumigena, Toxicol. Water Qual. 7: 119–123.

Falconer, I. R., 2001, Toxic Cyanobacterial Bloom Problems in Australian Waters, Risk and

Impacts on Human Health, Phycologia 40: 228–233.

Falconer, I. R., 2005, Cyanobacterial Toxins of Drinking Water Supplies: Cylindrospermopsins

and Microcystins, CRC Press, Boca Raton, Florida, 304 pp.

Falconer, I. R. and Humpage, A. R., 2006, Cyanobacterial (Blue-Green Algal) Toxins in

Water Supplies: Cylindrospermopsins, Environ. Toxicol. 21: 299–304.

Farre, A., 1844, On the Minute Structure of Certain Substances Expelled from the Human

Intestine, Having the Ordinary Appearace of Shred of Lymph, but Consisting Entirely of

Filaments of a Confervoid Type, Probably Belonging to the Genus Oscillatoria,

Transactions Royal Microscopical Society London 1: 92–98.

Flores, E. and Wolk, C. P., 1986, Production, by Filamentous, Nitrogen-Fixing Cyanobacteria, of

a Bacteriocin and of Other Antibiotics That Kill Related Strains, Archives of Micro-

biology 145: 215–219.

Forsyth, D. J., James, M. R. and Cryer, M., 1990, Alteration of Seasonal and Diel Patterns in

Vertical Migration of Zooplankton by Anabaena and Planktivorous Fish, Arch Hydrobiol

117: 385–404.

Francis, G., 1878, Poisonous Australian Lake, Nature 18: 11–12.

Froscio, S. M., Humpage, A. R., Burcham, P. C. and Falconer, I. R., 2003, Cylindrospermopsin-

Induced Protein Synthesis Inhibition and Its Dissociation from Acute Toxicity in Mouse

Hepatocytes, Environ. Toxicol. 18: 243–251.

Fulton, R. S. and Paerl, H. W., 1988, Effects of the Blue-Green Alga Microcystis Aeruginosa

on Zooplankton Competitive Relations, Oecologia 76: 383–389.

FRESH WATER TOXINS

Furey, A., Crowley, J., Shuilleabhain, A. N., Skulberg, O. M. and James, K. J., 2003, The

First Identification of the Rare Cyanobacterial Toxin, Homoanatoxin-a, in Ireland,

Toxicon. 41: 297–303.

Gehringer, M., 2003, Microcystin-Lr and Okadaic Acid Induced Intracellular Effects: A

Dualistic Response, FEBS Letters 557: 1–8.

Gerwick, W. H., Mrozek, C., Moghaddam, M. F. and Agarwal, S. K., 1989, Novel Cytotoxic

Peptides from the Tropical Marine Cyanobacterium Hormothamnion Enteromorphoides

1. Discovery, Isolation and Initial Chemical and Biological Characterization of the

Hormothamnins from Wild and Cultured Material, Cellular and Molecular Life Sciences

45: 115–121.

Gilbert, J. J., 1990, Differential Effects of Anabaena Affinis on Cladocerans and Rotifers:

Mechanisms and Implications, Ecology 71: 1727–1740.

Gilbert, J. J., 1994, Susceptibility of Planktonic Rotifers to a Toxic Strain of Anabaena Flos-

Aquae, Limnology and Oceanography 39: 1286–1297.

Gilbert, J. J., 1996a, Effect of Food Availability on the Response of Planktonic Rotifers to a

Toxic Strain of the Cyanobacterium Anabaena Flos-Aquae, Ecology 41: 1565–1572.

Gilbert, J. J., 1996b, Effect of Temperature on the Response of Planktonic Rotifers to a

Toxic Cyanobacterium, Ecology 77: 1174–1180.

Gilroy, D. J., Kauffman, K. W., Hall, R. A., Huang, X. and Chu, F. S., 2000, Assessing

Potential Health Risks from Microcystin Toxins in Blue-Green Algae Dietary

Supplements, Environ. Health Perspect. 108: 435–439.

Goldberg, J., Huang, H. B., Kwon, Y. G., Greengard, P., Nairn, A. C. and Kuriyan, J., 1995,

Three-Dimentional Structure of the Catalytic Subunit of Protein Serine/Threonine

Phosphatase-1, Nature 376: 745–753.

Griffiths, D. J. and Saker, M. L., 2003, The Palm Island Mystery Disease 20 Years On: A

Review of Research on the Cyanotoxin Cylindrospermopsin, Environmental Toxicology

18: 78–93.

Gugger, M., Molica, R., Le Berre, B., Dufour, P., Bernard, C. and Humbert, J. F., 2005,

Genetic Diversity of Cylindrospermopsis Strains (Cyanobacteria) Isolated from Four

Continents, Appl. Environ. Microbiol. 71: 1097.

Hamill, K. D., 2001, Toxicity in Benthic Freshwater Cyanobacteria (Blue-Green Algae),

First Observations in New Zealand, N. Z., J. Mar. Freshwater Res 35: 1057 –1059.

Harada, K., Oshikata, M., Uchida, H., Suzuki, M., Kondo, F., Sato, K., Ueno, Y., Yu, S. Z.,

Chen, G. and Chen, G. C., 1996, Detection and Identification of Microcystins in the

Drinking Water of Haimen City, China, Nat. Toxins 4: 277–283.

Hawkins, P., Runnegar, M., Jackson, A. and Falconer, I., 1985, Severe Hepatotoxicity

Caused by the Tropical Cyanobacterium (Blue-Green Alga) Cylindrospermopsis

Raciborskii (Woloszynska) Seenaya and Subba Raju Isolated from a Domestic Water

Supply Reservoir, Appl. Environ. Microbiol. 50: 1292–1295.

Hermansky, S. J., Stohs, S. J., Elden, T. M., Roche, v. F. and Mereish, K. A., 1991,

Evaluation of Potential Chemoprotectents against Microcystin-Lr Hepatotocixity in

Mice, J. Appl. Toxicol. 11: 65–74.

Hietala, J., Reinikainen, M. and Walls, M., 1995, Variation in Life History Responses of

Daphnia to Toxic Microcystis Aeruginosa, Journal of Plankton Research 17: 2307–

2318.

Hietala, J., Lauren-Maatta, C. and Walls, M., 1997, Sensitivity of Daphnia to Toxic

Cyanobacteria: Effects of Genotype and Temperature, Freshwater Biology 37: 299–306.

Hanazato, T., 1991, Interrelations between Microcystis and Cladocera in the Highly Eutrophic

Lake Kasumigaura, Japan, Internationale Revue der Gesamten Hydrobiologie 76: 21–36.

A. ZACCARONI AND D. SCARAVELLI

Hindman, S. H., Favero, M. S., Carson, L. A., Petersen, N. J., Schonberger, L. B. and

Solano, J. T., 1975, Pyrogenic Reactions During Haemodialysis Caused by Extramural

Endotoxin, Lancet 2: 732–734.

Humbert, J. F., Bérard, A. and Leboulanger, C., 2001, Impact Écologique Des Cyanobactéries

Des Eaux Douces Et Saumatres, in: Toxines D’algues Dans L’alimentation, J. M. Frémy

and P. Lassus, Ifremer.

Humpage, A. R., Fontaine, F., Froscio, S., Burcham, P. and Falconer, I. R., 2005, Cylindro-

spermopsin Genotoxicity and Cytotoxicity: Role of Cytochrome P-450 and Oxidative

Stress, Journal of Toxicology and Environmental Health, Part A, 68: 739–753.

Humphries, S. E. and Lyne, V. D., 1988, Cyanophyte Blooms: The Role of Cell Buoyancy,

Limnology and Oceanography 33: 79–91.

Hunter, P. R., 1998, Cyanobacterial Toxins and Human Health, Journal of Applied Micro-

biology Symposium Supplement 84: 35–40.

Jarvis, A. C., Hart, R. C. and Combrink, S., 2006, Zooplankton Feeding on Size Fractionated

Microcystis Colonies and Chlorella in a Hypertrophic Lake (Hartbeespoort Dam, South

Africa): Implications to Resource Utilization and Zooplankton Succession, Journal of

Plankton Research 9: 1231–1249.

Jones, G. J., Blackburn, S. I. and Parker, N. S., 1994, A Toxic Bloom of Nodularia

Spumigena Mertens in Orielton Lagoon, Tasmania, Australian J. Mar. Freshwat. Res.

45: 787–800.

Kaas, H. and Henriksen, P., 2000, Saxitoxins (Psp Toxins) in Danish Lakes, Water Res.

34: 2089–2097.

Kankaanpaa, H., Vuorinen, P. J., Sipia, V. and Keinanen, M., 2002, Acute Effects and

Bioaccumulation of Nodularin in Sea Trout (Salmo Trutta M. Trutta L.) Exposed Orally

to Nodularia Spumigena under Laboratory Conditions, Aquat. Toxicol. 61: 155–168.

Kashiwagi, M., Mynderse, J. S., Moore, R. E. and Norton, T. R., 1980, Antineoplastic

Evaluation of Pacific Basin Marine Algae, J. Pharm. Sci. 69: 735–738.

Kirk, K. L. and Gilbert, J. J., 1992, Variation in Herbivore Response to Chemical Defenses:

Zooplankton Foraging on Toxic Cyanobacteria, Ecology 73: 2208–2217.

Kotak, B. G., Lam, A. K. Y., Prepas, E. E., Kenefick, S. L. and Hrudey, S. E., 1995,

Variability of the Hepatotoxin Microcystin-Lr in Hypereutrophic Drinking Water Lakes,

Journal of Phycology 31: 248–263.

Kotak, B. G., Semalulu, S., Fritz, D. L., Prepas, E. E., Hrudey, S. E. and Coppock, R. W.,

1996a, Hepatic and Renal Pathology of Intraperitoneally Administered Microcystin-Lr in

Rainbow Trout (Oncorhynchus Mykiss), Toxicon. 34: 517–525.

Kotak, B. G., Zurawell, R. W., Prepas, E. E. and Holmes, C. F. B., 1996b, Microcystin-Lr

Concentration in Aquatic Food Web Compartments from Lakes of Varying Trophic

Status, Canadian Journal of Fisheries and Aquatic Sciences 53: 1974–1985.

Krienitz, L., Ballot, A., Kotut, K., Wiegand, C., Puetz, S., Metcalf, J. S., Codd, G. A. and

Pflugmacher, S., 2003, Contribution of Hot Spring Cyanobacteria to the Mysterious

Deaths of Lesser Flamingos at Lake Bogoria, Kenya, FEMS Microbiol Ecol. 43: 141–148.

Kromkamp, J., 1987, Formation and Functional Significance of Storage Products in

Cyanobacteria, New Zealand Journal of Marine and Freshwater Research

21: 457–465.

Kuiper-Goodman, T., Falconer, I. and Fitzgerald, J., 1999, Human Health Aspects, in: Toxic

Cyanobacteria in Water, I. Chorus and J. Bartram, Spon, E. Spon, F.N. London.

Carlsson, P., 2003, Reproduction and Toxin Accumulation by the Copepods Acartia

Spumigena, Mar. Ecol. Prog. Ser. 249: 237–249.

22: 44–47.

Kirpenko, N. I., 1986, Phytopathic Properties of Blue-Green Algae Toxin, Hydrobiol. J.

Kozlowsky-Suzuki, B., Karjalainen, M., Lehtiniemi, M., Engstrom-Ost, J., Koski, M. and

Bifilosa and Eurytemora Affinis in the Presence of the Toxic Cyanobacterium Nodularia

FRESH WATER TOXINS

Kurmayer, R. and Jüttner, F., 1999, Strategies of the Co-Existence of Zooplankton with the

Toxic Cyanobacterium Planktothrix Rubescens in Lake Zürich, J. Plankton Res 21:

659–683.

Lagos, N., Onodera, H., Zagatto, P. A., Andrinolo, D., Azevedo, S. and Oshima, Y., 1999,

The First Evidence of Paralytic Shellfish Toxins in the Freshwater Cyanobacterium

Cylindrospermopsis Raciborskii, Isolated from Brazil, Toxicon 37: 1359–1373.

Lahti, K., Niemi, M. R., Rapala, J. and Sivonen, K., 1997a, Biodegradation of Cyano-

bacterial Hepatotoxins – Characterization of Toxin Degrading Bacteria, Proceedings

of the VII International Conference on Harmful Algae.

Lahti, K., Rapala, J., Färdig, M., Niemelä, M. and Sivonen, K., 1997b, Persistence of Cyano-

bacterial Hepatotoxin, Microcystin-Lr, in Particulate Material and Dissolved in Lake

Water, Wat. Res. 31: 1005–1012.

Lampert, W., 1982, Further Studies on the Inhibitory Effect of the Toxic Blue-Green

Microcystis Aeruginosa on the Filtering Rate of Zooplankton, Arch Hydrobiol 95:

207–220.

Larson, P. and Dodson, S., 1993, Chemical Communication in Planktonic Animals, Arch

Hydrobiol 129: 129.

Laurén-Määttä, C., Hietala, J., Reinikainen, M. and Walls, M., 1995, Do Microcystis

Aeruginosa Toxins Accumulate in the Food Web: A Laboratory Study, Hydrobiologia

304: 23–27.

Liras, V., Lindberg, M., Nystrom, P., Annadotter, H., Lawton, L. A. and Graf, B., 1998, Can

Ingested Cyanobacteria Be Harmful to the Signal Crayfish (Pacifastacus Leniusculus)?,

Freshwater Biology 39: 233–242.

Looper, R. E., Runnegar, M. T. C. and Williams, R. M., 2005, Synthesis of the Putative

Structure of 7-Deoxycylindrospermopsin: C7 Oxygenation Is Not Required for the

Inhibition of Protein Synthesis, Angewandte Chemie International Edition 44: 3879–3881.

Mahmood, N. A. and Carmichael, W. W., 1986, The Pharmacology of Anatoxin-a (S), a

Neurotoxin Produced by the Freshwater Cyanobacterium Anabaena Flos-Aquae Nrc

525-17, Toxicon 24: 425–434.

Martin, C., Codd, G. A., Siegelman, H. W. and Weckesser, J., 1989, Lipopolysaccharides

and Polysaccharides of the Cell Envelope of Toxic Microcystis Aeruginosa Strains,

Archives of Microbiology 152: 90–94.

Mason, C. P., Edwards, K. R., Carlson, R. E., Pignatello, J., Gleason, F. K. and Wood, J. M.,

1982, Isolation of Chlorine-Containing Antibiotic from the Freshwater Cyanobacterium

Scytonema Hofmanni, Science 215: 400–402.

Mayer, C. M. and Wahl, D. H., 1997, The Relationship between Prey Selectivity and Growth

and Survival in a Larval Fish, Canadian Journal of Fisheries and Aquatic Sciences

54: 1504–1512.

Mez, K., Beattie, K. A., Codd, G. A., Hanselmann, K., Hauser, B., Naegeli, H. and Preisig,

H. R., 1997, Identification of a Microcystin in Benthic Cyanobacteria Linked to Cattle

Deaths on Alpine Pastures in Switzerland, European Journal of Phycology 32: 111–117.

Mez, K., Hanselmann, K. and Preisig, H., 1998, Environmental Conditions in High Moun-

tain Lakes Containing Toxic Benthic Cyanobacteria, Hydrobiologia 368: 1–15.

Mikhailov, A., Harmala-Brasken, A. S., Hellman, J., Meriluoto, J. and Eriksson, J., 2003,

Identification of Atp-Synthase as a Novel Intracellular Target for Microcystin-Lr, Chem.

Biol. Interact. 142: 223–237.

Moore, R. E., Chen, J. L., Moore, B. S., Patterson, G. M. L. and Carmichael, W. W., 1991,

Biosynthesis of Microcystin-Lr. Origin of the Carbons in the Adda and Masp Units,

Journal of the American Chemical Society 113: 5083–5084.

A. ZACCARONI AND D. SCARAVELLI

Naglitsch, F., 1988, Algen Als Ursache Von Reizhusten. (Algae Caused Irritation-Cough),

Zentralbl. Mikrobiol. 143: 331–334.

Namikoshi, M. and Rinehart, K. L., 1996, Bioactive Compounds Produced by Cyano-

bacteria, Journal of Industrial Microbiology and Biotechnology 17: 373–384.

Negri, A. P. and Jones, G. J., 1995, Bioaccumulation of Paralytic Shellfish Poisoning (Psp)

Toxins from the Cyanobacterium Anabaena Circinalis by the Freshwater Mussel

Alathyria Condola, Toxicon 33: 667–678.

Nizan, S., Dimentman, C. and Shilo, M., 1986, Acute Toxic Effects of the Cyanobacterium

Microcystis Aeruginosa on Daphnia Magna, Limnology and Oceanography 31: 497–

502.

Novaczek, I., Madhyastha, M. S., Ablett, R. F., Johnson, G., Nijjar, M. S. and Sims, D. E.,

1991, Uptake, Disposition and Depuration of Domoic Acid by Blue Mussels (Mytilus

Edulis), Aquat. Toxicol. 21: 103–118.

Pace, J. G., Robinson, N. A., Miura, G. A., Matson, C. F., Geisbert, T. W. and White, J. D.,

1991, Toxicity and Kinetics of

h-Microcystin-Lr in Isolated Perfused Rat Livers,

Toxicol. Appl. Pharm. 107: 391–401.

Padisak, J., 1997, Cylindrospermopsis Raciborskii (Woloszynska) Seenayya Et Subba Raju,

an Expanding, Highly Adaptive Cyanobacterium: Worldwide Distribution and Review of

Its Ecology, Arch Hydrobiol 107: 563–593.

Patterson, G. M. L., Norton, T. R., Furusawa, E., Furusawa, S., Kashiwagi, M. and Moore,

R. E., 1984, Antineoplastic Evaluation of Marine Algal Extracts, Botanica marina 27:

485–487.

Patterson, G. M. L., Baldwin, C. L., Bolis, C. M., Caplan, F. R., Karuso, H., Larsen, L. K.,

Levine, I. A., Moore, R. E., Nelson, C. S. and Tschappat, K. D., 1991, Antineoplastic

Activity of Cultured Blue-Green Algae (Cyanophyta), Journal of phycology 27: 530–

536.

Pitois, S., Jackson, M. H. and Wood, B. J. B., 2001, Sources of the Eutrophication Problems

Associated with Toxic Algae, an Overview, J. Environ. Health 64: 25–32.

Prepas, E. E., Kotak, B. G., Campbell, L. M., Evans, J. C., Hrudey, S. E. and Holmes,

C. F. B., 1997, Accumulation and Elimination of Cyanobacterial Hepatotoxins by the

Freshwater Clam Anodonta Grandis Simpsoniana, Canadian Journal of Fisheries and

Aquatic Sciences 54: 41–46.

Rao, P. V. L., Gupta, N., Bhaskar, A. S. B. and Jayaraj, R., 2002, Toxins and Bioactive

Compounds from Cyanobacteria and Their Implications on Human Health, J. Environ.

Biol. 23: 215–224.

Rapala, J., Lahti, K., Sivonen, K. and Niemelä, S. I., 1994, Biodegradability and Adsorption

on Lake Sediments of Cyanobacterial Hepatotoxins and Anatoxin-A, Applied Microbiol.

19: 423–428.

Rapala, J. and Sivonen, K., 1998, Assessment of Environmental Conditions That Favor Hepa-

totoxic and Neurotoxic Anabaena Spp. Strains Cultured under Light Limitation at Diff-

erent Temperatures, Microbial Ecology 36: 181–192.

Reinikainen, M., Ketola, M. and Walls, M., 1994, Effects of the Concentrations of Toxic

Microcystis Aeruginosa and an Alternative Food on the Survival of Daphnia Pulex,

Limnology and Oceanography 39: 424–432.

Reynolds, C. S. and Walsby, A. E., 1975, Water Blooms, Biol. Rev. 50: 7–48.

Rinehart, K. L., Shaw, P. D., Shield, L. S., Gloer, J. B., Harbour, G. C., Koker, M. E. S.,

Samain, D., Schwartz, R. E., Tymiak, A. A. and Weller, D. L., 1981, Marine Natural

Products as Sources of Antiviral, Antimicrobial, and Antineoplastic Agents, Pure Appl.

Chem. 53: 795–817.

FRESH WATER TOXINS

Rodger, H. D., Turnbull, T., Edwards, C. and Codd, G. A., 1994, Cyanobacterial (Blue-

Green Algal) Bloom Associated Pathology in Brown Trout, Salmo Trutta L, Journal

Fish Diseases 17: 177–181.

Runnegar, M., Andrews, J., Gerdes, R. G. and Falconer, I., 1987, Injury to Hepatocytes

Induced by a Peptide Toxin from the Cyanobacterium Microcystis Aeruginosa, Toxicon

25: 1235–1241.

Runnegar, M. T., Kong, S. M., Zhong, Y. Z. and Lu, S. C., 1995, Inhibition of Reduced

Glutathione Synthesis by Cyanobacterial Alkaloid Cylindrospermopsin in Cultured Rat

Hepatocytes, Biochem Pharmacol 49: 219–225.

Saker, M. L. and Eaglesham, G. K., 1999, The Accumulation of Cylindrospermopsin from

the Cyanobacterium Cylindrospermopsis Raciborskii in Tissues of the Redclaw Crayfish

Cherax Quadricarinatus, Toxicon 37: 1065–1077.

Saker, M. L., Thomas, A. D. and Norton, J. H., 1999, Cattle Mortality Attributed to the

Toxic Cyanobacterium Cylindrospermopsis Raciborskii in an Outback Region of North

Queensland, Environ. Toxicol. 14: 179–182.

Sartonov, A., 1995, Effects of Microcystis Aeruginosa on Interference Competition between

Daphnia Pulex and Keratella Cochlearis, Hydrobiologia 307: 117–126.

Schriver, P., Bogestrand, J., Jeppesen, E. and Sondergaard, M., 1995, Impact of Submerged

Macrophytes on Fish-Zooplankton-Phytoplankton Interactions: Large-Scale Enclosure

Experiments in a Shallow Eutrophic Lake, Freshwater Biology 33: 255–270.

Schwartz, R. E., Hirsch, C. F., Sesin, D. F., Flor, J. E., Chartrain, M., Fromtling, R. E.,

Harris, G. H., Salvatore, M. J., Liesch, J. M. and Yudin, K., 1990, Pharmaceuticals from

Cultured Algae, Journal of Industrial Microbiology and Biotechnology 5: 113–123.

Shaw, G. R., Sukenik, A., Livne, A., Chiswell, R. K., Smith, M. J., Seawright, A. A., Norris,

R. L., Eaglesham, G. K. and Moore, M. R., 1999, Blooms of the Cylindrospermopsin

Containing Cyanobacterium, Aphanizomenon Ovalisporum (Forti), in Newly Constructed

Lakes, Queensland, Australia, Environ. Toxicol. 14: 167–177.

Sivonen, K. and Jones, G. J., 1999, Cyanobacterial Toxins, in: Toxic Cyanobacteria in

Water, I. Chorus and J. Bartram, Spon, E. Spon, F.N. London.

Soll, M. D. and Williams, M. C., 1985, Mortality of a White Rhinoceros (Ceratotherium

Simum) Suspected to Be Associated with the Blue-Green Alga Microcystis Aeruginosa,

Journal of the South African Veterinary Association 56: 49–51.

Spivak, C. E., Witkop, B. and Albuquerque, E. X., 1980, Anatoxin-A: A Novel, Potent

Agonist at the Nicotinic Receptor, Mol. Pharmacol 18: 384–394.

Spivak, C. E., Waters, J., Witkop, B. and Albuquerque, E. X., 1983, Potencies and Channel

Properties Induced by Semirigid Agonists at Frog Nicotinic Acetylcholine Receptors,

Mol. Pharmacol 23: 337–343.

Teixeira, M. G., Costa, M. C., de Carvalho, V. L., Pereira, M. S. and Hage, E., 1993,

Gastroenteritis Epidemic in the Area of the Itaparica Dam, Bahia, Brazil, Bull. Pan. Am.

Health Organ 27: 244–253.

Thompson, S., Tilton, F., Schlenk, D. and Benson, W. H., 2000, Comparative Vitellogenic

Responses in Three Teleost Species: Extrapolation to in Situ Field Studies, Mar.

Environ. Res. 50: 185–189.

Thostrup, L. and Christoffersen, K., 1999, Accumulation of Microcystin in Daphnia Magna

Feeding on Toxic Microcystis, Arch Hydrobiol 145: 447–467.

Tisdale, E. S., 1931, Epidemic of Intestinal Disorders in Charleston, W. Va., Occurring

Simultaneously with Unprecedented Water Supply Conditions, American Journal of

Public Health 21: 198–200.

A. ZACCARONI AND D. SCARAVELLI

Trimurtulu, G., Ohtani, I., Patterson, G. M. L., Moore, R. E., Corbett, T. H., Valeriote, F. A. and

Demchik, L., 1994, Total Structures of Cryptophycins, Potent Antitumor Depsipeptides

from the Blue-Green Alga Nostoc Sp. Strain Gsv 224, Journal of the American Chemical

Society 116: 4729–4737.

Turner, P. C., Gamie, A. J., Hallinrake, K. and Codd, G. A., 1990, Pneumonia Associated

with Contact with Cyanobacteria, Br. Med. J. 300: 1440–1441.

Ueno, Y., Nagata, S., Tsutsumi, T., Hasegawa, A., Watanabe, M. F., Park, H.-D., Chen,

G. -C., Chen, G. and Yu, S. -Z., 1996, Detection of Microcystins, a Blue-Green Algal

Hepatotoxin, in Drinking Water Sampled in Haimen and Fusui, Endemic Areas of

Primary Liver Cancer in China, by Highly Sensitive Immunoassay, Carcinogenesis

17: 1317–1321.

Van Apeldoorn, M. E., van Egmond, H. P., Speijers, G. J. A. and Bakker, G. J. I., 2007,

Toxins of Cyanobacteria, Mol. Nutr. Food Res. 51: 7 – 60.

Vanderploeg, H. A., Paffenhöfer, G. A. and Liebig, J. R., 1990, Concentration-Variable

Interactions between Calanoid Copepods and Particles of Different Food Quality:

Observations and Hypotheses, in: Behavioral Mechanisms of Food Selection, R. N.

Hughes, Springer. New York, USA, pp. 595–613.

Walsby, A. E., 1994, Gas Vesicles, Microbiol. Rev. 58: 94–144.

Watanabe, M. F., Park, H. D., Kondo, F., Harada, K., Hayashi, H. and Okino, T., 1997,

Identification and Estimation of Microcystins in Freshwater Mussels, Nat. Toxins 5:

31–35.

Watanabe, M. M., Kaya, K. and Takamura, N., 1992, Fate of the Toxic Cyclic Heptapeptides,

the Microcystins, from Blooms of Microcystis (Cyanobacteria) in a Hypertrophic Lake,

Journal of Phycology 28: 761–767.

Weithoff, G. and Walz, N., 1995, Influence of the Filamentous Cyanobacterium Planktothrix

Agardhii on Population Growth and Reproductive Pattern of the Rotifer Brachionus

Calyciflorus, Hydrobiologia 313–314: 381–386.

White, J. D. and Hansen, J. D., 2005, Total Synthesis of (-)-7-Epicylindrospermopsin, a

Toxic Metabolite of the Freshwater Cyanobacterium Aphanizomenon Ovalisporum, and

Assignment of Its Absolute Configuration, Journal Organic Chemistry 70: 1963–1977.

WHO, 1998, Guidelines for Drinking-Water Quality. Addendum to Volume 2, Health Criteria and

Other Supporting Information.

WHO, 2003, Algae and Cyanobacteria in Fresh Water, in: Guidelines for Safe Recreational

Water Environments. Coastal and Fresh Waters World Health Organization. Geneva.

Williams, D. E., Dawe, S. C., Kent, M. L., Andersen, R. J., Craig, M. and Holmes, C. F. B.,

1997, Bioaccumulation and Clearance of Microcystins from Salt Water Mussels, Mytilus

Edulis, and in Vivo Evidence for Covalently Bound Microcystins in Mussel Tissues,

Toxicon 35: 1617–1625.

Yeh, F. F., 1989, Primary Liver Cancer in Guangxi, in: Primary Liver Cancer

, Z. Y. Tang,

M. C. Wu and S. S. Xia, China Academic Publisher. Beijing, pp. 223–236.

Yoo, S., Carmichael, W., Hoehn, R. and Hrudey, S. E., 1995, Cyanobacterial (Blue-Green

Algal) Toxins: A Resource Guide, AWWA Research Foundation, Denver, 229 pp.

Yu, S. Z., 1989, Drinking Water and Primary Liver Cancer, in: Primary Liver Cancer, Z. Y.

Tang, M. C. Wu and S. S. Xia, China Academic Publishers-Springer. New York, USA,

pp. 30–37.

Zhu, Y. R., Chen, J. G. and Huang, X. Y., 1989, Hepatocellular Carcinoma in Qidong

County, in: Primary Liver Cancer, Z. Y. Tang, M. C. Wu and S. S. Xia, China Academic

Publisher. Beijing, pp. 204–222.

FRESH WATER TOXINS

Zilberg, B., 1966, Gastroenteritis in Salisbury European Children- a Five Year Study, Cent.

Afr. J. Med. 12: 264–168.

Zurawell, R., Chen, H., Burke, J. and Prepas, E., 2005, Hepatotoxic Cyanobacteria: A

Review of the Biological Importance of Microcystins in Freshwater Environments,

J. Toxicol. Environ. Health 8: 1–37.

Zurawell, R. W., Kotak, B. G. and Prepas, E. E., 1999, Influence of Lake Trophic Status on

the Occurrence of Microcystin-Lr in the Tissue of Pulmonate Snails, Freshwater Biology

42: 707.

V. Evangelista et al. (eds.), Algal Toxins: Nature, Occurrence, Effect and Detection. 91

TOXICITY OF SEA ALGAL TOXINS TO HUMANS AND ANIMALS

ANNALISA ZACCARONI*, DINO SCARAVELLI

Department of Veterinary Public Health and Animal

Pathology,Veterinary School, University of Bologna

intoxication/year, with an overall mortality of about 1.5%. Human

intoxications are due to consumption of seafood and respiratory exposure to

aerosolized toxins. Algal toxins are also responsible for extensive die-offs

of fish and shellfish, as well as mortality in seabirds, marine mammals and

other animals depending on marine food web. Lots of information are

available concerning acute intoxications, while little is known about

environmental health effects of chronic exposure to low levels of algal

toxins. Toxins are produced by two algal groups, dinoflagellates and

diatoms, representing about 2% of known phytoplankton species (60–80

species out of 3400–4000) and can reach humans directly (via consumption

of shellfish) or through food web transfer to higher trophic levels

(zooplankton and herbivorous fish). Most toxins are neurotoxins and all are

temperature stable, so cooking does not ameliorate toxicity in contaminated

seafoods; five seafood poisoning syndromes exists: paralytic shellfish

diarrhetic shellfish poisoning, and amnesic shellfish poisoning.

Paralytic Shellfish Poisoning (PSP) is caused by the consumption of

molluscan shellfish contaminated with a suite of heterocyclic guanidines

collectively called saxitoxins (STXs), causing almost 2,000 cases of human

poisonings per year, with a 15% mortality rate. In addition to human intoxi-

cations, PSP has been implicated in deaths of birds and humpback whales.

STX elicits its effects by inhibiting sodium channel conductance and

______

*To whom correspondence should be addressed. Annalisa Zaccaroni, Viale Vespucci 2, 47042

Cesenatico (FC), Italy. Email: annalisa.zaccaroni@unibo.it

there-by causing blockade of neuronal activity, mainly at the peripheral

poisoning, neurotoxic shellfish poisoning, ciguatera fish poisoning,

Abstract: Marine algal toxins are responsible of more than 60000

A. ZACCARONI AND D. SCARAVELLI

nervous system level, where its binding results in rapid onset of symptoms

(less than 1 hr) that are classic for PSP: tingling and numbness of the peri-

oral area and extremities, loss of motor control, drowsiness, incoherence, and

in the case of high doses, respiratory paralysis.

Neurotoxic Shellfish Poisoning (NSP) generally results from consumption

of molluscan shellfish contaminated with brevetoxins (PbTx), a suite of

nine structurally related ladderlike polycyclic ether toxins. Brevetoxins bind

with high affinity sodium channel altering the voltage sensitivity of the

channel, resulting in inappropriate opening of the channel under conditions

in which it is normally closed, and inhibiting channel inactivation, resulting

in persistent activation or prolonged channel opening. Symptoms of NSP

include nausea, tingling and numbness of the perioral area, loss of motor

control, and severe muscular ache. NSP has not been documented as a fatal

intoxication in humans. Gymnodinium breve red tides are also frequently

associated with massive fish kills. The extreme sensivity of fish may result

from lysis of cells passing through the gills, with direct transfer of toxin

across the gill epithelium. G. breve was also responsible of a manatees die-

off in Florida concurrent with a persistent red tide. The demonstration of

brevetoxin immunoreactivity in lymphoid tissue of the manatees raises the

possibility of immunosuppression as a second mode by which brevetoxin

exposure may affect human health, particularly in individuals with chronic

exposure to aerosolized toxin during prolonged red tide incidents.

Ciguatera Fish Poisoning (CFP) is another seafood intoxication caused by

ladderlike polyether toxins, primarily attributed to the dinoflagellate,

Gambierdiscus toxicus, which produces a precursors to ciguatoxin which is

biotransformed to ciguatoxins and bioaccumulated in the highest trophic

levels. Large carnivorous fishes associated with coral reefs are a frequent

source of ciguatera. Baracuda, snapper, grouper, and jacks are particularly

notorious for their potential to carry high toxin loads; however, smaller

herbivorous fishes may also be ciguatoxic, particularly when viscera are

consumed. CFP is estimated to affect over 50,000 people annually and is no

longer a disease limited to the tropics because of travel to the tropics and

shipping of tropical fish species to markets elsewhere in the world; out-

breaks are sporadic and unpredictable at others. The symptoms of ciguatera

vary somewhat geographically as well as between individuals and inci-

dents and may also vary temporally within an area, but they generally include

SEA WATER TOXINS

early onset (2–6 hr) gastrointestinal disturbance–nausea, vomiting, and

diarrhea–and may be followed by a variety of later onset (18 hr) neurologic

sequelae such as numbness of the perioral area and extremities, reversal of

temperature sensation, muscle and joint aches, headache, itching, tachycardia,

hypertension, blurred vision, and paralysis. Ciguatera on rare occasions can

be fatal. A chronic phase may follow acute intoxication and can persist for

weeks, months, or even years.

Diarrhetic Shellfish Poisoning (DSP) is a comparatively milder seafood

intoxication that consists of rapid onset (3 hr) gastrointestinal symptoms

such as vomiting and diarrhea that generally resolve within 2–3 days. The

diarrhetic shellfish toxins (DTX) are a class of acidic polyether toxins

consisting of at least eight congeners including the parent compound,

okadaic acid. Okadaic acid, DTX-1, and DTX-2 are the primary congeners

involved in shellfish poisoning, with the other congeners believed to be

either precursors or shellfish metabolites of the active toxins. The DTXs are

inhibitors of ser/thr protein phosphatases. Ser/thr protein phosphatases

are critical components of signaling cascades in eukaryotic cells that re-

gulate a diverse array of cellular processes involved in metabolism, ion

balance, neurotransmission, and cell cycle regulation. Diarrhea associated

with DSP is most likely due to the hyperphosphorylation of proteins, in-

cluding ion channels, in the intestinal epithelia, resulting in impaired water

balance and loss of fluids. Okadaic acidlike polyether toxins have been

identified as tumor promotors, thus raising the question of what effect low

levels of chronic exposure to DSP toxins may have on humans as well as

wildlife such as marine turtles.

Amnesic Shellfish Poisoning (ASP) is the only shellfish intoxication

caused by a diatom (Pseudo-nitzschia spp.). The first recorded occurrence

of ASP was in Prince Edward Island, Canada in 1987 when approximately

100 people became ill and several died after consuming contaminated

mussels. The toxic agent involved in the outbreak was identified as domoic

acid. Domoic acid is a water-soluble tricarboxylic amino acid that acts as an

analog of the neurotransmitter glutamate and is a potent glutamate receptor

agonist. The symptoms of ASP include gastrointestinal effects (e.g. nausea,

vomiting, diarrhea) and neurologic effects such as dizziness, disorientation,

lethargy, seizures, and permanent loss of short-term memory. Persistent

activation of the kainate glutamate receptor results in greatly elevated intra-

cellular Ca

through cooperative interactions with N-methyl-d-aspartate

A. ZACCARONI AND D. SCARAVELLI

and non-N-methyl-d-aspartate glutamate receptor subtypes followed by

activation of voltage dependent calcium channels. Neurotoxicity due to

domoic acid results from toxic levels of intracellular calcium, which leads to

neuronal cell death and lesions in areas of the brain where glutaminergic

hippocampus, an area responsible for learning and memory processing, are

those causing structural damage. Domoic acid has been identified as the

causative agent in the mass mortality of pelicans and cormorants in Mon-

terey Bay, California, in 1991 and in the extensive die-off of California sea

lions in the same region in 1998. In both instances the vector for toxin

transfer was anchovy.

Pfiesteria Piscicida, a fish-killing dinoflagellate first identified in aquaculture

tanks in North Carolina, has been linked to fish kills in the mid-Atlantic

region of the United States and is characterized by the presence of open,

ulcerative lesions. Pfiesteria has been termed an “ambush predator” because

it is believed to release a toxin that narcotizes or kills fish and then phago-

cytizes the sloughed tissue from its prey. Pfiesteria has been linked to a

human intoxication syndrome, with symptoms that include fatigue, head-

ache, respiratory irritation, skin lesions or burning sensations on contact, dis-

orientation, and memory loss. The toxins responsible for fish lethality or

neurologic symptoms have not yet been identified. There is currently no

evidence that toxicity is transferred through food.

In conclusion we can state that marine algal toxins impact human health

through seafood consumption and respiratory routes. The apparent increase

in their occurrence over the past three decades has raised alarm and lead to

the establishment of algal and toxin monitoring programs which will assist

in providing time series needed to assess interannual and long-term varia-

bility in algal and toxin occurrence.

1. General Characteristics of Producing Organisms

Marine algal toxins are produced by phytoplankton, phytobenthos and bacteri

and are also called phycotoxins.

particularly susceptible. However, memory deficits occur at doses below

pathways are heavily concentrated. The CA1 and CA3 regions of the

Keywords: Algae, toxins, syndromes, treatment

SEA WATER TOXINS

Phycotoxins are secondary metabolites produced by dinoflagellates and

diatoms, which present pharmacologically active compounds which can be

harmful to aquatic flora and fauna. Their role is both important for normal

physiology of the cell and for the defense against external environmental

insults, namely predators (Amzil et al., 2001; Quod et al., 2001).

Marine toxins are not dangerous per se, but they became an hazard

when dinoflagellates and diatoms proliferate, under particular environmen-

tal conditions, i.e. eutrophication, and toxins can accumulate along different

steps of trophic chains, particularly mollusks and fish. In these case, the

so called HARMFUL ALGAL BLOOMS (HABs) occur, causing a great

increase in cells and toxins concentrations (Smayda, 1997; van Dolah, 2000).

Phycotoxins have an great and important toxicological role as they

produce a huge number of human illness linked to seafood consumption and

contaminated aerosol inhalation. They are also responsible for massive die-

off of fish, shellfish and marine vertebrates (van Dolah, 2000).

Generally speaking they are responsible for acute intoxications, which

are well known from the toxicological, chemical and etiological point of

view, while little is known concerning chronic exposure to low levels of

toxins (Landsberg, 1996; Burkholder, 1998; Edmunds et al., 1999; Landsberg

et al., 1999).

More than 3000 dinoflagellates and diatoms species are known at pre-

sent, but only 2% of then (about 60–80 species) have proved to be toxic or

harmful. This little group of species, anyway, is responsible for about 60000

human intoxication/year, 1.5% of them fatal. Fatalities are generally linked

to ingestion of saxitoxins, tetrodotoxin and, in rare cases, ciguatera and

domoic acid (Landsberg, 1996; Burkholder, 1998; Edmunds et al., 1999;

Landsberg et al., 1999).

Incidence of HABs has increased in recent years, both in frequency and

and include on one side the increased awareness concerning the issue and

the establishment of monitoring, surveillance and research programs on

toxins. This lead to a faster and more detailed identification of blooms and

toxic episodes (Anderson, 1989; Smayda, 1990; Hallegraeff, 1993).

On the other side, human activities can directly and indirectly contribute

to this expansion. Ballast waters transport or shellfish transplantation can

directly act by easing the transfer of toxic, non indigenous species from side

to the other of the world. Local and regional environmental changes, i.e.

eutrophication and pollution, and/or climate variations at the local or global

scale can indirectly act by inducing algae proliferation, thus increasing

toxins concentrations (van Dolah, 2000)

in geographical distribution (Fig. 1). Causes of this expansion are various,

A. ZACCARONI AND D. SCARAVELLI

Figure 1. Time changes in HABs distribution (from van Dolah (2000), modified).

Algal blooms can be classified following various criteria: 1) the kind of

bloom formed; 2) the chemical structure of the toxin; 3) the solubility in

solvents; 4) the syndrome they induce.

SEA WATER TOXINS

Starting from the kind of bloom formed, 4 groups have been identified,

which are more or less dangerous to humans and /or animals (Andersen,

1996):

Blooms of species which produce basically harmless water discolor-

ations, with the result that the recreational value of the area decreases

due to low visibility of the water and eventually, under exceptionally

weather conditions in sheltered bays, the blooms can grow so dense that

they cause escape reactions and indiscriminate fish kills and kills of

benthic invertebrates due to oxygen depletion. Species forming this kind

of bloom are Noctiluca scintillans, Ceratium spp, Prorocentrummicans,

Heterocapsa triquetra, Skeletonema costatum, Trichodesmiumeryth-

raeum, Eutreptiella spp., Phaeocystis pouchetii, Emiliania Huxley,

Mesodinium rubrum.

Blooms of species which produce potent toxins which accumulate in

food chains and cause a variety of gastrointestinal and neurological ill-

nesses m humans and other higher animals such as. Alexandrium

tamarense, Alexandrium funndyense, Gymnodinium catenatum, Pyro-

dinium bahamense var. compressum, Dinophysis fortii, Dinophysis

acuminata, Dinophysis acuta, Dinophysis norvegica, Pseudo-nitzschia

multiseries, Pseudo-nitzschia pseudodelicatissima, Pseudo-nitzschia aust-

ralis, Gambierdiscus toxicus, Gymnodinium breve, Anabaena flos-aquae,

Nodularia spumigena can produce these blooms.

Blooms of species which, in most cases are non-toxic to humans but

harmful to fish and invertebrates (especially in intensive aquiculture sys-

tems) e.g. by intoxication, damaging or clogging of the gills or other

means. Examples of producing species: Alexandrium tamarense, Chaeto-

ceros convolutus, Gyrodinium aureolum, Chrysochromulina polylepis,

Prymnesium parvum, Heterosigma akashiwo, Chattonella antiqua, Aureo-

coccus anophagefferens, Phiesteria piscimortuis, Nodularia spumigena.

Blooms of species which produces toxins which are toxic to humans

and which are transported by air in aerosols from the bloom area to the

coast. Gymnodinium breve, Pfiesteria piscicida.

There is no general rule to define harmful concentrations of cells in an

algal bloom, the concentration in a HAB is species specific.

Some algae cause harm at low concentrations, with no discoloration in

the water, e.g. Alexandrium tumarense where PSP toxins are detected in

–

A. ZACCARONI AND D. SCARAVELLI

shellfish at concentrations below 10

cells/L, whereas other algae cause

harmful effects when they occur in higher in higher concentrations, with

discoloration of the water as a result, a “red tide”. For example Gyrodinium

aureolum kills fish and benthic animals at concentrations higher than 10

cells/L (Andersen, 1996).

Five main classes of toxins have been identified starting from their

chemical structure:

1. Amino acid-like compounds (domoic acid and derivatives)

2. Purine derivatives (saxitoxins and derivatives)

3. Cyclic imines (spirolides, gymnodines and pinnatoxin A)

4. Linear and macrocyclic non-azotated polyethers (okadaic acid, pectene-

toxins, azaspiracid, primnesines)

5. Trasfused polyehters (brevetoxins, yessotoxins, ciguatoxins).

All the toxins can be classified starting from their solubility in water

and organic solvents:

1. Hydrophilic compounds (saxitoxins, domoic acid, tetrodotoxin)

2. Lipophilic compounds (okadaic acid, brevetoxins, ciguatoxins)

Finally, most known classification is that starting from the syndrome

they induce. Starting from this principle 5 different syndromes can be iden-

tified:

1. Diarrhetic Shellfish Poisoning (DSP) is caused by a group of

toxins, represented by okadaic acid, and is characterized by gas-

trointestinal symptoms (nausea, diarrhea, vomiting, abdominal pain)

which following chronic exposure can evolve in digestive system

tumors.

2. Paralytic Shellfish Poisoning (PSP) is caused by saxitoxins and is

characterized by gastrointestinal and neurological symptoms, with nausea,

vomiting, diarrhea, tingling or numbness around lips, gradual and more

and more severe paralysis, respiratory difficulty, death through respiratory

paralysis. It can cause death in humans.

3. Amnesic Shellfish Poisoning (ASP) toxin is domoic acid, and main

sign of this syndrome is loss of short term memory, accompanied by

gastrointestinal and neurological symptoms.

SEA WATER TOXINS

4. Neurotoxic Shellfish Poisoning (NSP) toxin is brevetoxin, and typical

signs of toxicity are tingling and numbness of perioral area, loss of motor

control and severe muscular ache. It is also responsible for some irritative

episodes following exposure through contaminated aerosol.

5. One last syndrome is named ciguatera and is due to ciguatoxin. Together

with tetrodotoxin, this is the only toxin transmitted by fish and not

by shellfish. Typical symptoms are diarrhea, abdominal pain, nausea,

vomiting, and lots of neurological signs. It can rarely cause death in

humans.

When describing a syndrome, different toxins can be included as etiolo-

gical agent, and that’s the criteria followed in present chapter; it should be

noted anyway that in some cases these toxins have only chemical similarity

to the main toxin, causing the syndrome, and nay have a different action on

humans and animals. So in the group of diarrheic toxins yessotoxins is in-

cluded, even if its main action is at the neurological level.

Many other toxins have been studied and new ones are discovered in

recent years, ut they are not included in a precise syndrome: tetrodotoxin,

palitoxin, Pfiesteria toxins among the others. These toxins will be described

in next sections.

Lots of studies have been conducted to define ideal conditions for algal

growth and toxin production, but no clear scenario has been identified

(Quod et al., 2001).

One of main question concerning phycotoxins is if they are produced by

algae themselves or by symbiotic bacteria. In some species the production

of toxins seems to be independent of bacteria presence, i.e. in Prorocentrum

lima, producing okadaic acid. Studies conducted on saxitoxins production

lead to no conclusive result, as these toxins have been found in autotrophous

dinoflagellates, fresh water cyanobacteria, macrophytes and some bacteria.

Finally it has been proved that tetrodotoxin is produced by symbiotic bacte-

ria, which can be found in various aquatic and terrestrial organisms (Oshima

et al., 1984; Scheuer, 1996; Shimitzu, 1996; Dantzer and Levin, 1997;

Gallacher and Smith, 1999; Ritchie et al., 2000; Quod et al., 2001).

2. Role of Phycotoxins in Marine Environment

Lots of toxins producing algae contain very potent active principles, showing

specific biological activity, which are thought to have a physiological or

a defensive role. Indeed a certain correlation was observed between the

A. ZACCARONI AND D. SCARAVELLI

100

production of diarrhetic toxin and photosynthetic activity. Finally, a positive

correlation was found between chlorophyll and diarrhetic toxins. An addi-

tional factor in favor of this hypothesis is the fact that almost all species are

strict of facultative photosynthetic organisms. Okadaic acid has been found

to be located into chloroplasts of some dinoflagellates (Zhou and Fritz,

1994; Morton and Tindall, 1995; Wright and Cembella, 1998; Barbier et al.,

1999; Quod et al., 2001).

All these data lead to the hypothesis that at least some phycotoxins can

modulate photosynthesis.

Other toxins are thought to have a physiological role: saxitoxins seem to

be important n chromosome organization, due to their localization close to

the nucleus and paralyzing toxins are thought to act also ad pheromones

(Anderson and Cheng, 1988; Wyatt and Jenkinson, 1997; Cembella, 1998).

Phycotoxins have proved to have some antibacterial and antifungal

activity; these activities are thought to allow dinoflagellates to inhibit growth

of competitors like bacteria and fungi, as well as other algal species deve-

lopment. This inhibitory action was observed in various species of Proro-

centrum, Amphidinium and in Gambierdiscus toxicus (Nagai et al., 1990;

Lewis and Holmes, 1993; Nagai et al., 1993).

A defensive role of phycotoxins against herbivores has also been consi-

dered, acting through the alteration of ionic channel functioning , as shown

with some studies demonstrating a reduction in grazing activity from macro-

and micro- zooplankton.

This inhibiting activity, called allelopathy, has been studied and

observed in vitro against other dinoflagellates or microalgae, even if no real

evidence exist witnessing an allopathic action in the wild (Elbrächter, 1976;

Kayser, 1979; de Jong and Admiraal, 1984; Yasumoto et al., 1987; Gentien

and Arzul, 1990; Scheuer, 1990; Rausch de Traubenberg and Morlaix,

1995; Windust et al., 1996; Paul, 1997; Windust et al., 1997; Wright and

Cembella, 1998; Sugg and Van Dolah, 1999).

The impact of toxins on and their bioaccumulation along food chains

depends on the characteristics of trophic chains themselves and on environ-

mental conditions (Fig. 2).

Thus temperate and tropical ecosystems differ greatly. Indeed, tropical

reduced as, affecting very complex ecosystems. These blooms can form a

mosaic in close areas: so some zones are toxic, and a close one is not. In

these ecosystem fish species, feeding on algae, are responsible for toxicity

waters are generally olygotrophic and blooms which develop are usually

(Bourdeau et al., 2001) (Fig. 3).

SEA WATER TOXINS

101

Figure 2. Blooms formation in coastal areas.

Figure 3. Transfer of phycotoxins along tropical food chains.

In temperate waters, which are more eutrophic, basic step of trophic

chain are filtering organisms, like mussels. Only in some case fish, at dif-

ferent levels of trophic chain, can be directly interested by toxicity and

accumulation of toxins, for direct contact with the poison or by ingestion of

producing algae. These fish species are generally planktophagous species,

living in packs (Bourdeau et al., 2001).

In these areas, phycotoxins can affect all levels of food chains.

A. ZACCARONI AND D. SCARAVELLI

102

It is recognized that harmful algae and their toxins can influence

ecosystems from both the top-down (i.e. affecting predators and influencing

grazing) and from the bottom-up (i.e. affecting plankton and benthic com-

munities). Acute or chronic exposure to HABs and their toxins, either directly

or through the food web, puts these populations at increased risk (White,

1980; White, 1981; Ives, 1985; Geraci et al., 1989; Gosselin et al., 1989).

Figure 4. Accumulation and transfer of phycotoxins along food chain. The example of PSP.

Acute or chronic exposure to HABs and their toxins, either directly or

through the food web, place certain populations at increased risk (Fig. 4).

Microalgal toxins and their chronic effects need to be recognized as major

systems. Long-term effects of biotoxins on the health of aquatic animals

threats to animal health, sustained fisheries, endangered species, and eco-

include increased susceptibility to disease, immunosuppression, abnormal

development, and the induction of tumors. Animals at all trophic levels that

impaired feeding and immune function, avoidance behavior, physiological

dysfunction, reduced growth and reproduction, or pathological effects.

are exposed to biotoxins in the long term through their diet may die or display

SEA WATER TOXINS

103

2.1. ZOOPLANKTON

In many occasions zooplankton can feed on toxic dinoflagellates without

any adverse effect.

When some effect occurs, it is usually a sub-lethal one, like a reduction

in feed consumption. This alteration can be seen as the appearance of an

avoiding behavior, so that some species avoid grazing on toxic dinoflag-

ellates, while others feed on them without any problem.

Other effects observed are regurgitation of food, tachycardia, uncont-

rolled motor activity or reduced motility. Some authors think that long

term exposure to low levels of toxins can induce reduction of growth rate

and motor inhibition, which make copepods more sensible to predation,

also easing accumulation along food chain (White, 1981; Hayashi et al.,

1982; Boyer et al., 1985; Watras et al., 1985; Huntley et al., 1986; Gill and

Harris, 1987; Ives, 1987; Sykes and Huntley, 1987; Uye and Takamatsu,

1990; Anderson and White, 1992).

2.2. FISH SPECIES

Phycotoxins can have a direct effect on fish species, causing larval and

adult massive death. Anyway they can also have some important effect

linked to long term accumulation of the toxins, turning them poisonous for

consumers, being them humans or animals.

A real accumulation of toxins hardly occurs, as the toxicity of phy-

cotoxins to fish is quite high, so in many cases fish die before they can

accumulate discrete amounts of toxins. When accumulation occurs, liver

and digestive tract are main target of accumulation. In the case of paraly-

zing toxins, altered swimming, equilibrium loss and complete immobility

have been observed; if fish survive, recovery is complete (White, 1980;

White, 1984; Carreto et al., 1993).

Being toxins stored in liver and digestive tract, consumption of whole

fish, as happens in Borneo and Philippines, can produce deadly episodes, as

registered in past years (Maclean, 1979; Maclean, 1989).

Many fish species have proved to accumulate toxins in their body:

mackerels, Sardinella sp., Mugil and Sillago; one of the most known

species which are able to accumulate toxins are puffer fish, which can

stock tetrodotoxin in their viscera. Some doubt exist regarding brevetoxins

capacity of accumulate; poisoning episodes in marine mammals seems to

confirm the transfer of brevetoxins via plankton-eating fish (Beales, 1976;

Estudillo and Gonzales, 1984; Bourdeau et al., 2001).

A. ZACCARONI AND D. SCARAVELLI

104

All specie able to accumulate toxins seems to have some adaptation to

the poison; it the case of puffer fish and tetrodotoxin. Indeed, puffer fish

have developed resistance to the toxin by a mutation of proteic sequence of

sodium channel, which is the target of the toxin (Nakamura et al., 1984).

2.3. SEABIRDS

Lots of reports exist regarding seabirds die-off following contaminated fish

eating.

Cormorants, terns, pelicans are among species more frequently affected

by paralyzing toxins and domoic acid. Interestingly, different sensitivity

was observed among species, cormorants being more sensible than others.

In a toxic episode concerning pelicans and cormorants, anchovy, which

were responsible for the transfer of domoic acid to birds, showed no toxic

symptoms, showing how in many cases blooms con be underestimated, if

not correctly monitored (Coulson et al., 1968; Armstrong et al., 1978;

Anderson and White, 1992; Fritz et al., 1992; Anderson, 1994b).

2.4. MARINE MAMMALS

Various episodes, reported since ‘80s, witness for toxicity of phycotoxins to

marine mammals and their transfer along food chains. Whales die-off was

observed in USA following an Alexandrium tamarense bloom, transfer

agent being mackerel who fed on the dinoflagellates and who accumulated

saxitoxins in liver and kidney. Interestingly, no toxin was found in muscle

of contaminated fish. Some concern exist regarding saxitoxins as real causa-

tive agent of the die-off, as the levels found were below the toxic threshold

defined for humans. Anyway, it has been thought that chronic exposure to

lower doses could lead to accumulation of toxic levels (Geraci et al., 1989;

Anderson, 1994a; Anderson. 1994b).

Brevetoxins have been considered responsible for a die-off of dolphin in

USA during 1987–88. Two possible way of absorption have been consi-

dered: 1) intoxication following toxic aerosol inhalation; 2) continuous

absorption of low levels of toxin accumulated by natural preys of dolphins

(menhadens and mackerels). Absorbed doses were considered as non toxic

per se, but they probably caused a defedation of animals, which then experi-

enced bacterial or viral secondary infections (Gerlach, 1989; Anderson and

White, 1992; Van Dolah et al., 2003).

SEA WATER TOXINS

105

The toxin was also responsible for some important die-off of manatees

following Gymnodium breve blooms. Again, contaminated aerosol inhal-

ation or toxin ingestion have been considered as death cause. In a case

reported in 1982, tunicates were considered as transfer organisms, while in

a second case, dating 1996, little or no tunicates were found in gastric con-

tent of manatees (Freitas et al., 1996; Bossart et al., 1998; Landsberg and

Steidinger, 1998).

Domoic acid was responsible of sea lions intoxication in California in

1998, anchovies being the transfer organisms. Anchovies contained the

highest amounts of toxin in their internal organs, while sea lions had highest

levels in faeces (Lefebvre et al., 1999; Scholin et al., 2000).

Not all marine mammals experience accidental or passive intoxication

by phycotoxins. Indeed, it has been observed that sea otter seems to be able

to distinguish between contaminated and non contaminated parts of preys,

as they discard flesh and siphon of contaminated animals. The observation

that sea otters are absent in areas containing saxitoxins at level higher than

toxic threshold seems to confirm this hypothesis (Kvitek et al., 1991;

Patyten, 1999).

3. Diarrhetic Shellfish Poisoning

Diarrhetic toxins include various toxins: dynophisistoxins, whose principal

compound is okadaic acid (OA), which is responsible for the syndrome,

pectenotoxins (PTX) and yessotoxins (YTX).

This group is an example of a set of molecules grouped together because

of their physico-chemical characteristics, even if biological effects are

completely different. Due to these toxicological differences, it is now consi-

dered the possibility of modifying their classification, using toxicological

criteria (Amzil et al., 2001).

DSP is a relatively recent discovered syndrome, but it is considered that

it should exist since long time: gastroenteric symptoms indeed could have

lead to the attribution of the syndrome to bacterial or viral infections, leading

to ad underestimation of its incidence.

Poisoning follows ingestion of mussels containing Dynophisis spp. and

Prorocentrum spp.; it has been observed that very low Dynophisis concent-

rations (50 cells/L) could lead to mussels contamination and toxicity (Kat,

1983; Marcaillou-Le Baut et al., 2001) (Fig. 5).

A. ZACCARONI AND D. SCARAVELLI

106

Figure 5. Diarrhetic toxins producing organisms (A Dynophisis spp. and B Prorocentrum spp).

3.1. CHEMICAL STRUCTURE

3.1.1. Okadaic acid

Some more toxins have been identified, originating from the acylation

of the okadaic acid molecule, leading to the formation of DTX3, named,

acyl-ester. These acyl-esters probably are metabolic derivatives, as they are

only found in mussels’ digestive gland (Hu et al., 1995c; Windust et al.,

1997; Barbier et al., 1999).

Figure 6. Okadaic acid and its derivatives molecular structure.

of OA structure: DTX1 is a methyl derivatives, and DTX2 is an isomer

Okadaic acid is a liposoluble cyclic polyether with a carboxylic function

(Fig. 6). Various derivatives exists of OA, which originate by modification

of OA (Draisci et al., 1996; Quilliam, 1998; Van Egmond et al., 2004).

SEA WATER TOXINS

107

3.1.2. Yessotoxins

These toxins are sulphated polyether compounds; two main molecules have

been identified; yessotoxin and 45-hydroxy-yessotoxin.

YTX is main toxin in Adriatic Sea mussels, other homologues were

identified: homo-YTX, 45-hydroxyhomo-YTX, carboxy-YTX and adriatoxin

(Lee et al., 1989; Ciminiello et al., 1997; Satake et al., 1997a; Satake et al.,

1997b; Ciminiello et al., 1998; Tubaro et al., 1998; Yasumoto and Satake,

Figure 7. Yessotoxins chemical structure.

Figure 8. Chemical structure of pectenotoxins.

3.1.3. Pectenotoxin

Pectenotoxins (PTXs) are a group of cyclic polyether macrolide sharing the

same basic structure. Actually, eight different PTXs (PTX1 to 7 and PTX10)

and two new derivatives of PTX2 (PTX2 seco-acid and 7-epi-PTX2 seco-

acid) have been described and characterized mainly in shellfish. PTX2 is

suspected to be the precursor toxin of the whole PTXs through biotrans-

formation processes which take place in the digestive glands of bivalves

1998; Ciminiello et al., 2000) (Fig. 7).

A. ZACCARONI AND D. SCARAVELLI

108

3.2. MECHANISM OF ACTION

3.2.1. Okadaic acid

Okadaic acid is an inhibitor of protein phosphatases (PP), which induce

dephosphorylation of proteins by protein kinases (PK). The accumulation of

phosphorilated proteins lead to tumor promotion and contraction of smooth

muscles. This last effect is responsible for diarrhea and abdominal pain

which are among principal symptoms (Puiseaux-Dao et al., 2001).

It has been observed that only some PP are inhibitied, namely serine/

threonin PPs 1, 2A, 4, 5 and 6, while it seems that the different confor-

mation of PP 2B and 7 makes them particularly resistant: the binding to

these PP is probably partially obstructed by the catalytic part of the.

For the non-competitive interaction of OA with PP chemical structure

maintenance is mandatory, as loss of carboxyl group, esterification or reduc-

tion to okadaol make the toxin no more toxic enzyme (Bialojan and Takai,

1988; Walter and Mumby, 1993; Honkanen et al., 1994; Takai et al., 1995;

Dawson and Holmes, 1999).

Binding to catalytic unit is reversible, but break of the bound is very

slow.

Hyperphosphorilation induced by okadaic acid occurs in any kind of cell

and targets not only serine and threonin, but also tyrosine. Proteins affected

are those of cytoskeleton, those involved in signal transduction, transcrip-

tion and in gene expression (Afshari, 1994; Sawa et al., 1999; Puiseaux-Dao

et al., 2001).

Okadaic acid can also alter cell morphology, induce apoptosis and cell

death and modify cell physiology: alteration of ions current across membrane,

of glucose balance, of resorption of glucocorticoids receptors, increase in

T3 secretion (Shibata et al., 1982; Hescheler et al., 1988; Haystead et al.,

1989; Ozaki and Haraki, 1989; Mironov and Lux, 1991; Chiavaroli et al.,

1992; Neumann et al., 1993; Wang et al., 1993; Arufe et al., 1999; Galigniana

et al., 1999).

(Lee et al., 1989; Yasumoto et al., 1989; Draisci et al., 1996; Suzuki et al.,

Diarrhea, one of the main symptoms of DSP, is due to hyperphos-

phorilation of intestinal epithelia, with the loss of intestinal structure and of

villi; this expose superior part of intestinal crypt cells and produce an

important loss of water (Edebo et al., 1988; Lange et al., 1990; Yuasa et al.,

1994; Tripuraneni et al., 1997; Puiseaux-Dao et al., 2001).

1998; Suzuki et al., 2001) (Fig. 8).

SEA WATER TOXINS

109

depletion and extra-cellular calcium use. This effect, coupled with cardiac

lesions linked to degeneration of capillary endothelial cells, mitochondria

and swelling of cardiac cells, make these toxins more similar to maitotoxins

than to domoic acid (Aune, 1989; Alfonso et al., 2000; Puiseaux-Dao et al.,

2001).

3.2.3. Pectenotoxin

PTXs do not inhibit protein phosphatases nor induce diarrhea in mammals.

Most toxicological data available on PTXs (both in vivo and

in vitro) have been obtained with PTX1, showing liver damage following

intraperitoneal injection in mice and morphological changes in freshly

prepared hepatocytes. Highest lethality for PTX2 with respect to all other

PTXs further supports the hypothesis of PTX2 as the parental compound of

PTX group. Thus, successive oxidation of substituent in C18 in the dige-

stive glands of bivalves would diminish the toxicity of PTXs. PTX2 has

been proven to induce lethality of brine shrimp (Artemia salina), as well as

cytotoxic activity against several human cell lines, although significant

differences were observed in the relative LC

values obtained for each of

them (Terao et al., 1986; Sasaki et al., 1998; Suzuki et al., 1998; Hori et al.,

1999; Eaglesham et al., 2000).

Apoptosis induction by PTXs has also been proved. Primary cultures of

rat and salmon hepatocytes exposed to PTX1 in the micromolar range

showed rapid apoptotic changes, but no further studies concerning apoptotic

activity of PTXs have been carried out in human cells. No additional data

are available on acute and chronic effects of PTXs, and the exact mecha-

nism of action of these toxins is currently unknown.

3.3. SYMPTOMS AND TREATMENT IN HUMANS

3.3.1. Okadaic acid

Symptoms of DSP appear within 4 hours after ingestion of contaminated

mussels and include vomiting, diarrhea, abdominal pain. More rarely neuro-

logical appears.

3.2.2. Yessotoxins

Mechanism of action of these toxins is not known. Toxicological studies

have shown that YTXs do not induce sodium channel activation, while and

increase in intracellular calcium following intra-cytoplasmatic reserves

A. ZACCARONI AND D. SCARAVELLI

110

3.3.3. Pectenotoxins

Pectenotoxins poisoning have been reported in human since 1997. Symp-

toms registered are nausea, vomiting and diarrhea. Treatment of toxicosis is

similar to that of DSP (Marcaillou-Le Baut et al., 2001).

4. Paralytic Shellfish Poisoning (PSP)

This syndrome is caused by saxitoxins (STX), a group of toxins including

about 20 different molecules.

STX was one of the first marine toxins recognized as responsible for

human intoxications, the first report dating up to 1798, even if PSP symp-

toms were attributed to saxitoxins only after 1920.

Saxitoxins are responsible for about 2000 human cases/year, with a

mortality rate ranging from 15 to 50% (van Dolah, 2000; Marcaillou-Le

Baut et al., 2001).

The name of the toxin comes from the mollusk in which it was firstly

identified, Saxidomus giganteus. It is produced by both temperate and tropi-

A B C

Figure 9. Saxitoxins producing organisms A. Alexandrium sp., B. Gymnodium sp C. Pyrodi-

nium sp.

Recovery is complete within 3 days and there seems to be no long term

effect and no deadly episodes (Marcaillou-Le Baut et al., 2001).

3.3.2. Yessotoxins

Yessotoxins have not been associated with human poisoning, but only in

animals (Marcaillou-Le Baut et al., 2001).

(Fig. 9).

cal dinoflagellates of the genera Alexandrium, Gymnodium and Pyrodinium

SEA WATER TOXINS

111

4.1. CHEMICAL STRUCTURE

Saxitoxins are tricyclic, substituted alkali, hydro-soluble, thermo-stable and

saxitoxin and neosaxitoxin, which undergo sulphatation at different sites of

their molecules; the chemical characteristics of these molecules are resumed

in Table 1 (Amzil et al., 2001).

At physiological pH, to functional groups, the 1,2,3- and the 7,8,9-

guanidinic group, present a positive charge, which give the molecules their

water solubility characteristics.

Figure 10. Saxitoxins and neosaxitoxins molecular structure.

Saxitoxins are grouped in 3 classes, based on their toxicity:

N-sulphocarbamoyl derivatives: B1, B2, C1-C4;

Decarbamoyl derivatives (dc-derivatives)

Decarbamoyl derivatives have an intermediate toxicity between car-

bamate (highly toxic) and N-sulphocarbamoyl compounds.

This is one of the few toxins which are produced by both marine and

fresh water (cyanobacteria) organisms, even if no report of intoxication

exists for fresh water sources.

The major transvector for the toxins are bivalve mollusks, even if also

crabs and snails feeding on coral reef seaweeds seem to be able to accu-

mulate them (Fig. 4).

Carbamates derivatives: saxitoxin, neosaxitoxin, GTX1-GTX4;

–

resistant to acidic environment (Fig. 10). Alkaline pH or oxidizing compounds

can inactivate the toxins, which are all derivatives of two basic molecules,

A. ZACCARONI AND D. SCARAVELLI

112

TABLE 1. Structure of saxitoxins (from Amzil et al. (2001), modified).

R1 R2 R3 R4 Carbamates

toxins

N-sulphocarbamoyl

toxins

Decarbamoyl

toxins

H H H STX B1 dcSTX

H H OSO3 GTX2 C1 dcGTX2

H OSO

H GTX3 C2 dcGTX3

OH H H NEO B2(GTX6) dcNEO

OH H OSO3 GTX1 C3 dcGTX1

OH OSO

H GTX4 C4 dcGTX4

4.2. MECHANISM OF ACTION

Being polar molecules, STX can not cross blood-brain barrier and thus they

affect peripheral nervous system by targeting voltage-dependent sodium

1993; Gessner et al., 1997; Andrinolo et al., 1999).

Sodium channel is composed by 3 sub-unit, Į, ȕ-1 and ȕ-2, Į sub-unit

presenting most of the functional properties.

Sub-unit Į is composed by 4 repeated domains, numbered I to IV, eah

containing 6 membrane-spanning regions, labeled S1 to S6. S4 is a highly

conserved region acting as voltage sensor. When transmembrane voltage

stimulates S4, it moves towards the extracellular side of the membrane,

opening the channel. Another important part of the channel is the amino

acidic sequence connecting domains III and IV, which is responsible for

channel inactivation (closure) after prolonged activation (West et al., 1992;

Catterall, 2000; Goldin et al., 2000; Yu and Catterall, 2004 ).

Saxitoxins binds to site 1 of the channel, an amino acid sequence nega-

tively charged placed in the external part of the membrane connecting S5

and S6. Specific amino acids have been identified as responsible of the

binding of the toxin to the channel. This binding cause a complete block of

the sodium channel preventing the ions from passing into the neurons. The

block of inward flow of sodium impedes the release of neurotransmitters at

the synaptic level, and this causes paralysis of muscle cells (Evans, 1972;

Catterall et al., 1986; Kao, 1986; Puiseaux-Dao et al., 2001).

A first hypothesis considered the toxin acting like a stopper on the pore.

More recent studies anyway have clarified that there in no direct action on

the pore; the toxin binds to an external site to the channel, close but not

Indeed, these trans-membrane proteins, responsive to membrane potential,

channels, which regulate action potential propagation along neurons (Fig. 11).

control ions movement across the membrane of nervous cells (Hines et al.,

SEA WATER TOXINS

113

Figure 11. Sodium channel functioning.

Figure 12. Saxitoxins mechanism of action of sodium channel.

inside the pore (Fig. 12). The interaction of only part of the toxin molecule

and/or an alteration of the channel structure induced by the toxin are con-

sidered more probable (Puiseaux-Dao et al., 2001).

A. ZACCARONI AND D. SCARAVELLI

114

4.3. SYMPTOMS AND TREATMENT IN HUMANS

PSP, s the oldest known intoxication and one of the most dangerous for

humans, with a high rate of mortality.

Native populations of Canada perfectly knew the existence of the toxin

and prohibited consumption of mussels coming from contaminated areas,

which were considered as a food taboo (Marcaillou-Le Baut et al., 2001).

It is a worldwide distributed poisoning, with cases reported for North

and South America, Europe, Africa and Asia. It is commonly thought that it

is indeed more probable that the toxin or the dinoflagellates have not been

detected or searched for.

Symptoms observed during PSP poisoning are characteristic, easy to

recognized and impossible to be confused with allergy and viral or bacterial

pathologies.

First symptoms appear 5 to 30 minutes after ingestion of mussels and

develop following a precise sequence in few hours. The severity of signs

depends on the dose ingested and on individual sensitivity.

Usually, recovery is complete in few days, even if in more severe

intoxication death can occur following respiratory paralysis. Symptoms

have been classified following the severity of intoxication, and are resumed

in Table 2.

Even if it is a well known toxin, no antidote has been found for its

treatment.

Most efficient treatment is a symptomatic one, including gastric lavage

and active charcoal or alkaline dinks administration, which favor the inacti-

vation of the toxins and their elimination with urine. Indeed, their clearance

via kidney is rapid, close to 24 hours (Hines et al., 1993; Gessner et al.,

1997; Andrinolo et al., 1999).

Forced ventilation is useful in more severe intoxications, when res-

piratory paralysis occurs, as it can counteract paralysis.

4.4. TOXICOSES IN ANIMALS

Saxitoxins have been implicated in a mass mortality episode of humpback

whales which occurred during late 1987-beginning of 1988 in Massa-

chusetts. During an A. tamarense bloom, whales were forced to feed on

mackerels, as their natural preys, sand lance, was largely absent from the

affected area. Mackerels fed on A. tamarense and were found to contain a

mean concentration of 80 ȝg/100 g tissue, which were deadly toxic for

whales. Indeed, short after feeding on fish, humpback whales were found

SEA WATER TOXINS

115

3.2 ȝg/kg b.w., well below toxic threshold defined for humans. Geraci et al.

(1989) consider two possible mechanisms as responsible for apparent higher

sensitivity of cetaceans to saxitoxins: 1) approximately 30% of the whales

body weight is blubber, into which the water-soluble STXs would not

partition, thus being more highly concentrated in metabolically sensitive

tissues; 2) the diving physiology of whales concentrates blood to the heart

and brain and away from those organs required for detoxification, further

concentrating neurotoxins in sensitive tissues (Ridgway and McCormick,

1971; Geraci et al., 1989; Haya et al., 1989; Levin, 1992; Haulena and

Heath, 2001; Van Dolah et al., 2003).

TABLE 2. PSP signs classification.

Severity of intoxication Symptoms

Mouth paresthesia which can expand to the whole face and

neck, to fingers and ears.

Nausea, headache, vomiting

Severe Paresthesia expand to arms and legs. General sensation of

numbness, muscular weakness and floating sensation.

Altered speech, dysarthria, severe ataxia, motory

incoordination.

Some respiratory problem appears.

Extreme Peripheric paralysis, including respiratory paralysis which

can lead to death if not rapidly trated.

Another important episode, which had a great importance also from the

conservation point of view, is the one affecting a monk seal (Monachus

monachus) population in Mauritania during 1997. Close to 70% of the total

population of monk seals died following an A. minutum, G. catenatum and

D. acuta bloom. Affected seals showed lethargy, motor incoordination,

paralysis, symptoms who could be ascribed to STX intoxication. Lungs of

dead animals showed severe respiratory distress and congestion, and viscera

of the animals contained up to 12 ȝg/100 g liver and 3 ȝg/100 g brain of

decarbamoyl saxitoxins. Again, observed levels were below the toxic thre-

shold for humans, but a higher sensitivity should be considered also in this

species (Osterhaus et al., 1997; Hernandez et al., 1998; Osterhaus et al.,

1998; Forcada et al., 1999).

Long term effect of STX were also considered, as toxin presence con

alter the distribution of predator species, as hypothesized for sea otters

(Enhydra lutris).

dead, without any sign of emaciation (blubber was abundant) or starvation

(stomachs contained digested fish). Estimated dos absorbed by whales was

A. ZACCARONI AND D. SCARAVELLI

116

Butter clams can highly accumulate STX in the siphon and can retain it for

more than 1 year, probably as a defensive system against predation.

Sea otters seems capable of distinguish between toxic and non-toxic

thesis was confirmed by a feeding study on caged sea otters. If animals

were fed with contaminated clams, they reduced the rate of consumption

Seabirds were also affected by saxitoxins: Nisbet (1983) reported of a

massive die-off of common terns in Massachusetts which occurred in 1978.

Transfer species was found to be sand-launce, the terns’ principal food.

Interestingly, it was observed that almost all tens that died were pre-laying

females, while all other animals recovered after vomiting. No breeding

alteration was observed, while an apparent age-dependent sensitivity was

observed, as highest mortality was for 3 years-old females.

5. Neurotoxic Shellfish Poisoning

Neurotoxic Shellfish Poisoning is a little common intoxication, which has

not been documented as a fatal intoxication in humans, and results from

consumption of molluscan shellfish contaminated with brevetoxins. Intere-

stingly, intoxications have been observed not only as a consequence of

mussels ingestion, but also after inhalation of contaminated aerosol. Its toxi-

cological importance is more related to massive fish death.

The producing organism is Gymnodium breve, which differs from other

dinoflagellates because it is an unarmored dinoflagellates; the lack of an

Figure 13. Gymnodium breve.

Alaskan populations of sea otters, consuming 20–30% of their body

weight as bivalves, avoid eating butter clams during Alexandrium blooms.

and selectively discarded most of toxic tissues, i.e. siphons and kidney, thus red-

ucing the risk of intoxication (Kvitek and Beitler, 1991; Kvitek et al., (1991).

clams and areas, and feed only on healthy mussels in safe areas. This hypo-

external shell make this microalga easily lysed in turbulent waters (Fig. 13).

The lysis allows the toxin to be released IN water, making aerosol and

droplets potentially toxics (Amzil et al., 2001).

SEA WATER TOXINS

117

5.1. CHEMICAL STRUCTURE

Brevetoxins (PbTX) are liposoluble, ladder-like polycyclic ether toxins,

classified into two types based on their backbone structure: PbTXB and

PbTXA, counting up to 12 different molecules (McFarren et al., 1965; Lin

The two families are composed by molecules counting 10 or 11 cycles.

Some of these compounds are thought to be produced in mussels by

Figure 14. Molecular structure of PbTXA and B.

TABLE 3. Different molecular structure of type A and type B brevetoxins derivative.

Type A R Type B R

revetoxins-1 CH

C(=CH

)CHO Brevetoxins-2 CH

C(=CH

)CHO

revetoxins-7 CH

C(=CH

)CH

OH Brevetoxins-3 CH

C(=CH

)CH

revetoxins-10 CH

C(CH

)CH

OH Brevetoxins-9 CH

C(CH

)CH

Brevetoxin-8 CH

COCH

et al., 1981) (Fig. 14).

metabolic processes (Table 3).

A. ZACCARONI AND D. SCARAVELLI

118

5.2. MECHANISM OF ACTION

PbTX acts by binding with high affinity to voltage-dependent sodium

channel. Brevetoxins bind to site 5 of the channel (for sodium channel de-

scription see PSP paragraph), altering bio-physic properties of the channel

itself (Bidard et al., 1984; Poli et al., 1986; Lombet et al., 1987; Baden,

1989; Dechraoui et al., 1999; Puiseaux-Dao et al., 2001).

They induce and increase in membrane sodium permeability and a shift

of activation potential toward more negative values.

It has been supposed that this action results from the intercalation of

brevetoxins backbone (whose length is similar to that of membrane lipidic

double layer) between transmembrane domains of nervous and muscular

cells, provoking spontaneous and/or repeated discharges which appears at

very low action potential levels. Discharges are generally followed by a

block of excitation, due to important and prolonged membrane depolari-

zation (Huang et al., 1984; Atchison et al., 1986; Sheridan and Adler, 1989;

Gawley et al., 1995; Jeglitsch et al., 1998).

Hyperexcitation lead to an initial increase in neurotransmitters secretion,

followed by a decrease and an inhibition due to overstimulation, Ca

being

not essential for the release: it has been observed that Na

alone can activate

neurotransmitters liberation (Molgo et al., 1990; Molgo et al., 1991; Molgo

et al., 1993; Meunier et al., 1997).

Finally, an increase in cell volume was observed. Two different mecha-

nism have been considered:

6. In mielinic nervous fibers sodium ions entrance alters osmotic balance,

causing water entrance into the cell and swallow of cell itself. A 50%

hyperosmotic external solution can counteract this increase in volume.

7. In motor neurons terminal synaptic vesicles fuse with terminal axon

body, allowing vesicular membrane incorporation after neurotransmitter

release induced by the toxin. Hyperosmotic solutions only partially

counteract this effect (Puiseaux-Dao et al., 2001).

5.3. SYMPTOMS AND TREATMENT IN HUMANS

Two different poisoning have been identified in humans: “indirect” intoxi-

cation by ingestion of contaminated mussels and poisoning for direct contact.

In the first one symptoms are both neurological and gastro-intestinal and

appear within 1–3 hours after mussels ingestion.

SEA WATER TOXINS

119

Neurological syndrome includes paresthesia of area around the mouth,

the face and throat, muscular ache, ataxia, inversion of thermal perception,

bradycardia, midriasis.

Gastro-intestinal syndrome includes abdominal pain, nausea, diarrhea.

Recovery is complete within 24 and 48 hours and no fatality has ever

been recorded.

It has been observed that local anaesthetics, calcium administration and

hyperosmotic solutions are useful in poisoning treatment, as they counteract

brevetoxins action on membrane.

Following direct contact with contaminated aerosol, respiratory tract

inflammation (cough, burning sensation) and conjunctivitis appear (Pierce,

1986; Morris, 1991; Marcaillou-Le Baut et al., 2001).

5.4. TOXICOSES IN ANIMALS

Brevetoxins were considered as responsible agent in many poisoning of

cetaceans, like manatees and bottlenose dolphin but also of sea turtles

(Landsberg and Steidinger, 1998; Van Dolah et al., 2003).

Die-off on manatees have been linked to NSP since 1965 in Florida, but

various episodes have occurred in following years (1982 and 1996) in the

same area. Timing of mortality events coincided with the presence of K

brevis blooms and was often associated with fish and seabirds die-off.

Affected animals showed disorientation, inability to submerge or to

maintain horizontal position, listlessness, flexing of the back, lip flaring and

labored breathing. The only histological lesions observed were cerebral

ones, while no other lesion was observed. The analysis of stomachs content

showed a high amount of seagrasses and filter feeding tunicates; no mea-

surable PbTX levels were found in tunicates (Layne, 1965; O’Shea et al.,

1991).

In 1996 histopathological analysis of tissues showed consistent, severe

congestion of nasopharyngeal tissues, bronchi, lungs, kidney and brain; he-

morrhage of lungs, liver, kidney and brain were observed, whereas gast-

rointestinal tract showed no lesions. The presence of PbTX in lymphocytes

and macrophages of affected tissues support the hypothesis that toxic

effects in manatees is not due to acute neurotoxic effects alone, but rather

may have resulted from chronic inhalation (Bossart et al., 1998).

First report of dolphin die-off due to NSP dates up to 1947, in Florida.

Brevetoxins were also proposed as a causative agent in an unpreceden-

ted mortality of over 740 bottlenose dolphins in 1987 in New Jersey. Most

A. ZACCARONI AND D. SCARAVELLI

120

infections associated with immune suppression (Gunter et al., 1948; Geraci,

1989; Tester et al., 1991; Mase et al., 2000).

Another bottlenose dolphin poisoning occurred in 2000, involving 120

animals, in Florida, coinciding with episodic peak of K. brevis. Stranded

animals were in good physical condition, but histopathological examination

showed significant upper respiratory tract lesions, with lymphoplasmacy-

tic oropharyngitis and tracheitis, as well as lymphoplasmacytic interstitial

pneumonia and lymphoid tissue depletion. PbTX was not found in spleen or

lung, differently from what observed in manatees, whereas it was found in

stomach content and liver. In these two organs PbTX3 was found; consi-

dering that PbTX2 is main product of K. brevis, it is thought that it is meta-

bolized in the fish or that this metabolite is selectively retained by dolphins.

At present no lethal dose for dolphins and marine mammals has been

determined, nor an acute or chronic adverse effect level (Van Dolah et al.,

2003).

6. Amnesic Shellfish Poisoning (ASP)

Amnesic Shellfish Poisoning is a singular intoxication, as it is the only one

not caused by dinoflagellates, but by a diatom, namely Pseudo-nitzschia

pungens, which produce domoic acid. It is one of the deadly poisoning

Figure 15. Domoic acid producing Pseudo-nitzschia pungens.

of stranded dolphins showed a wide range of pathological signs, involving

chronic physiological stress, including fibrosis of the liver and lung, adhe-

sion of abdominal and thoracic viscera, and secondary fungal and microbial

even if fatalities are more rare than with STX and tetrodotoxin (Fig. 15).

SEA WATER TOXINS

121

6.1. CHEMICAL STRUCTURE

Domoic acid (DA) is a tricarboxylic amino acid which was firstly isolated

by red alga Chondria armata domoi. Side chain of the molecule contains

Domoic acid is thermo-stable, water soluble and instable in acidic envi-

ronment; it has been shown that temperatures higher than 50°C (cooking

temperatures) can transform domoic acid in epidomoic acid, which is the

Figure 16. Chemical structure of domoic acid and its derivatives.

two ethylenic bounds (Takemoto and Daigo, 1958; Amzil et al., 2001) (Fig. 16).

real responsible, together with isodomoic acid D, E and F, of ASP (Fig. 16).

Anyway, several congeners of DA have been identified (Amzil et al., 2001).

A. ZACCARONI AND D. SCARAVELLI

122

Chemical structure of domoic acid is similar of that of the endogenous

neurotransmitter glutamate and of the excitatory neurotoxin kainic acid; this

similarity is responsible for the mechanism of action of the toxin.

6.2. MECHANISM OF ACTION

Domoic acid acts at the central nervous system level. It is absorbed by

gastrointestinal tract and slowly reaches CNS. As already said, it shares

chemical similarity with glutamate and kainic acid, and its mechanism of

action is based on binding to kainate and Į-amino-3-hydroxy-5-methyl-4-

isoxazole propionic acid (AMPA) subtypes of glutamate receptors, while it

does not interact with N-methyl-D-aspartate (NMDA) receptors (Debonnel

et al., 1989).

Interestingly, the binding affinity of domoic acid to kainate receptor is

higher than that of endogenous agonists (domoic acid>glutamate>AMPA).

Main difference among domoic and kainate acid and glutamate is the

fact that while the action of glutamate rapidly disappears, avoiding over-

stimulation of nervous cells, desensitation of receptors following exogenous

agonist binding is negligible or absent, and when it occurs it is very slowly,

that causing a continuous stimulation of the nervous cells (Puiseaux-Dao

et al., 2001).

The interaction with the receptor lead to the opening of voltage-dependent

calcium channels, allowing entrance of Ca

in the cell, as well as of other

ions, i.e. Na

The toxic effect resulting from this influx is at first an increase in ner-

vous cells excitation. This effect is due to the disinhibition of some neural

circuits, as domoic acid can inhibit GABA (inhibiting mediator) liberation

in hippocampal areas through the activation of protein kinase (PK) C.

Subsequently, high levels of calcium cause cell death and lesion in various

cerebral areas, especially in areas where glutaminergic pathways are heavily

concentrated. These receptors are preferentially distributed in CA1 and CA3

areas of hippocampus, which are responsible for learning and memory.

These lesions can be responsible of main effect of domoic acid, complete

and permanent loss of short-term memory. Anyway, it has been observed tat

memory deficits occur at levels well below those causing structural damage

(Cunha et al., 2000; Quintela et al., 2000; Puiseaux-Dao et al., 2001).

In vivo and in vitro studies have shown that DA activates AMPA/kainate

receptors in striatum system, which cause release of excitatory amino acids

activating NMDA receptors, finally leading to cell death (Larm et al., 1997;

Puiseaux-Dao et al., 2001).

SEA WATER TOXINS

123

6.3. SYMPTOMS AND TREATMENT IN HUMANS

Diatoms were recognized as causative agents of ASP only in recent times,

as they were not considered as an hazard for human health.

In 1987, over 100 people showed poisoning sings which could not be

ascribed to any of known syndromes. Following researches made it possible

to identify DA as active principle and P. pungens as producing organism.

Interestingly, both two were already known, as domoic acid was used in

Japan as vermifuge and the diatom was known, but no correlation among

the two was ever seen before.

Poisoning symptoms appears rapidly, from 15 minute to 38 hours from

mussels ingestion. After close to two days, some neurological alteration

appears, presenting a different degree of severity.

Symptoms include gastrointestinal signs, e.g. nausea (77% of cases),

vomiting (76%), diarrhea (42%), abdominal pain (51%), and neurological

signs: dizziness, disorientation, lethargy, seizures, permanent loss of short-

term memory.

Recovery occurs in a period ranging from one day to 4 months.

In 1987 outbreak, 4 out of the 100 people affected died after seizures

appeared.

The analysis of brain of dead people revealed necrotic lesions and/or

neuronal loss mainly at the hippocampal and amigdala areas, confirming the

toxic effect of DA.

At present, no antidote exist for the treatment of poisoning, and all cares

are symptomatic (Marcaillou-Le Baut et al., 2001).

6.4. TOXICOSES IN ANIMALS

Domoic acid has been identified as causative agent in pelicans and cor-

morants mass mortality in California in 1991 and in various and extensive

die-offs of sea lions in the same region in 1998, 2000, 2006 and 2007.

Affected birds exhibited neurological symptoms similar to those reported

in experimental animals, i.e. scratching and head weaving. In all instances

the vector for toxins transfer was anchovy, but the toxin producing organism

was a different member of Pseuda-nitzschia genus. At present, more than

seven species are recognized as domoic acid producers (Work et al., 1993).

The first confirmed domoic acid poisoning in marine mammals occurred

in sea lions in California in 1998. All animals were in good nutritional

condition and displayed clinical symptoms, predominantly neurological:

head weaving, scratching, tremors and convulsions. Affected animals were

mainly adult females, 50% of them pregnant. Abortion was observed and

A. ZACCARONI AND D. SCARAVELLI

124

urine and feces. Sea lions which died within 24 hours of stranding presented

histologic lesions of brain, mainly neuronal necrosis, more severe in hip-

pocampus and dentate gyrus. Heart was also affected, presenting myofiber

necrosis and edema. Another similar episode occurred in 2000. In the same

area and the same periods a die-off of sea otters was observed as well

(Lefebvre et al., 1999; Gulland, 2000; Scholin et al., 2000; Bargu et al.,

2002; Silvagni et al., 2005; California Wildlife Center, 2006).

Exposure to domoic acid has been proved also for whales, even if no

clear toxic event was reported in these species. Lefebvre et al., 2002) found

domoic acid in faeces and food (krill, anchovies and sardines) of whales.

7. Ciguatera Fish Poisoning (CFP)

Ciguatera Fish Poisoning is a well known poisoning linked to fish con-

sumption, which was firstly described in 1555 by sailors in Caribbean areas.

In 1866 Poey defined this intoxication “ciguatera” from the Cuban common

name of a mussel known to cause the intoxication, “cigua” (Marcaillou-Le

Baut et al., 2001; Puiseaux-Dao et al., 2001).

At present, the term ciguatera is used to describe both the poisoning and

the phenomena affecting marine environment and leading to the poisoning

itself, namely coral reef degradation.

ciguatoxins, namely maitotoxins (MTX), which anyway have never been

linked to toxic episodes in humans. Like ciguatoxins, maitotoxins are pro-

duced by G. toxicus.

Figure 17. Gambierdiscus toxicus.

some pups born during the episode died. Highest levels of DA was found in

Producing organism was found to be Gambierdiscus toxicus which pro-

duce ciguatoxins (CTX) (Fig. 17). Other toxins are included in the group of

SEA WATER TOXINS

125

7.1. CHEMICAL STRUCTURE

7.1.1. Ciguatoxins

Ciguatoxins are highly stable toxins, as cooking, freezing and salting do not

The study of molecular structure of the toxins lead to the identification

of two different toxins, one from the Pacific area (P-CTX1) and one from

the Caribbean (C-CTX1), which differ for the number of C in the mole-

cules (60 in P-CTX1 and 62 in C-CTX1) and stability in acidic environ-

ment: P-CTX1 is acid labile, while C-CTX1 is stable in acidic pH (Vernoux,

Both two groups of toxins belong to polycyclic polyethers.

Figure 18. Molecular structure of CTXs: a) P-CTX; b) P-CTX3; c) C-CTX.

reduce their toxicity. They are soluble in organic polar solvents and in

1988) (Table 4).

water (Fig. 18).

A. ZACCARONI AND D. SCARAVELLI

126

TABLE 4. Comparison of some characteristics of CTXs.

C-CTX PCTX

ector fish Caranx latus Gymnothorax javanicus

olecular formula C62H92O19 C60H86O19

LD50 3,6 ȝg/kg 0,35 ȝg/kg

umber of cyclic ethers 14 13

Terminal cycle C56 hemyacetal

C52 spiroacetal

These polyethers are chemically little reactive, and it has been found

that side chains not involved in cycles formation are the reactive part of the

molecules. A reduction in toxicity has been observed following chemical

binding of hydroxyl function with various compounds or the formation of

double bonds (Yasumoto and Oshima, 1979).

Among Pacific toxins, 9 different structure have been found, while 2

only have been identified for Caribbean group.

These 11 toxins are grouped in 3 types, and it has been found that some

of them are conformation epimers at the spyro-acetalic or hemiacetalic asym-

TABLE 5. Known chemical structure of CTXs divided by type.

Type Toxins with known structure

I P-CTX1

P-CTX2 and P-CTX3 C52 epimers

P-CTX4A and P-CTX4B C52 epimers

II P-CTX3c and P-CTX3B C49 epimers

P-CTX2A1

51 hydroxy-CTX3C

III C-CTX1 and C-CTX2

C56 epimers

One probable explanation for this huge variability in structural charac-

teristics is metabolism: the accumulation along one or more steps of food

chains of “basic” toxins make them experience some biotransformation

which oxidize the molecule and make it more polar. Although metabolism

is conceived to reduce toxicity, it has been seen that oxidized ciguatoxins

are more toxic than parent compounds (Puiseaux-Dao et al., 2001).

7.1.2. Maitotoxins

Maitotoxins are another group of toxins produced by G. toxicus which have

never been associated to CFP, as they have never been isolated in flesh

metric carbon (Table 5).

SEA WATER TOXINS

127

of fish, but only in viscera of herbivorous fish (Yasumoto et al., 1976;

Yasumoto et al., 1984).

They are highly hygroscopic polycyclic polyethers, characterized by the

Despite molecular similarity with CTXs, their effects are different and

no spontaneous or chemical transformation produced CTXs starting from

MTXs (Puiseaux-Dao et al., 2001).

Figure 19. Chemical structure of maitotoxins.

7.2. MECHANISM OF ACTION

7.2.1. Ciguatoxins

Ciguatoxins share their mechanism of action with brevetoxins, because they

bind to site 5 of voltage-dependent sodium channels. They activate the

sodium channel, alter the selectivity of the channel for Na

, delay or block

channel inactivation and activate the channel at more negative membrane

potential. This last action persistently increases membrane permeability to

sodium.

All the aspects of mechanism of action have already been described in

brevetoxins section.

7.2.2. Maitotoxins

Maitotoxins can not cross cell membrane and act by hydrolyzing membrane

phosphoinositides and phospholipids, inducing calcium influx and the con-

sequent increase in Ca

cytosolic concentration, and depolarizing all neural

absence of 2 sulphated groups (Fig. 19).

A. ZACCARONI AND D. SCARAVELLI

128

and neuroendocrine membranes, causing an increase in neurotransmitters

and hormones Ca-dependant liberation.

Phosphoinositides and phospholipids hydrolysis has proved to be de-

pendant on extracellular calcium and is catalyzed by phospholipase C at

high doses and by phospholipase A at low doses (Sladeczek et al., 1988;

Gusovsky et al., 1989; Choi et al., 1990; Gusovsky and Daly, 1990; Lin

et al., 1990; Meucci et al., 1992; Bressler et al., 1994).

7.3. SYMPTOMS AND TREATMENT IN HUMANS

7.3.1. Ciguatoxins

CFP is characterized by a sequence/association of neurological, gastroin-

testinal and cardio-vascular symptoms, presenting a high variability. Some

occasional fatalities have been observed, following severe intoxications.

Although it can affect all ages, a certain, higher sensitivity seems to exist

for the age range 30–49, interestingly, some occasional episode of toxin trans-

fer through breast feeding was observed (Marcaillou-Le Baut et al., 2001).

In “classical” syndrome incubation lasts from 3 to 8 hours, even if in

severe poisoning the delay time is 1 hour and in mild intoxication it can

reach 12–20 hours (Bagnis, 1967; Bagnis et al., 1979).

The prodromic phase of ciguatera lasts about 2 hours and is characterized

by gastrointestinal alterations involving face congestion, headache, salivation,

and by neural symptoms: numbness of face, tongue and extremities (Pearce

et al., 1983).

In the second phase, digestive symptoms are predominating, while

neurological and, only in more severe cases, cardiac signs are only occasional

(Bourdeau and Bagnis, 1989).

Gastroenteric signs are more intense than in starting phase, precocious

and constant and include:

Abdominal pain

Vomiting

Diarrhea.

Neurological signs are progressive and include:

Tingling

Burning or electric discharge sensation

–

SEA WATER TOXINS

129

Pruritus. This is another frequent and typical sign. It is a tardive sign,

starting from extremities and diffusing to the all body, which is quite

persistent and can also become permanent. A certain increase in the

disturb has been observed at night, causing insomnia in affected people

(Bourdeau and Bagnis, 1989).

Interestingly, pruritus can last for weeks after the poisoning has solved,

and can be re-evoked by fish consumption (Bourdeau and Bagnis, 1989).

Some more occasional neurological signs can be recorded:

Mydriasis or strabismus

Paresis or ataxia of legs

Articular and muscular pain.

These signs too can be re-induced even years after the poisoning by

consumption of reef fish.

Finally, vertigos, teeth pain and cutaneous rashes have been recorded

(Marcaillou-Le Baut et al., 2001).

Cardiovascular signs are recorded only in severe intoxication and include:

Irregular heart beats

Bradycardia

Complete alteration of cardiac regulation.

As a general rule, gastroenteric and cardiovascular signs solve in a few

days, while neurological signs last for weeks or more.

respiratory failure or collapse (Marcaillou-Le Baut et al., 2001).

There seems to be a different trend in clinical symptoms between males

and females, males showing more frequently gastro-intestinal signs and

females muscular pain (Bagnis et al., 1979).

There is also a different profile in symptoms presentation between

Pacific and Caribbean toxins, P-CTX being more neurological and C-CTX

more gastroenteric.

Thermal sensation inversion, which is an indicative, even if not specific,

sign of the intoxication.

–

CFP has a very low mortality rate (0,1–4,5 %) and death occurs after

A. ZACCARONI AND D. SCARAVELLI

130

A certain spontaneous detoxification has been observed in humans, but

it is assumed to take long time, even if it has never been estimated. This can

easily lead to accumulation phenomena in humans, and continuous con-

sumption of little toxic fish can thus induce poisoning, similarly to consump-

tion of one single, highly toxic fish (Lawrence et al., 1980; Chan, 1998).

Diagnostic of intoxication is based on clinical signs and on epidemio-

logical data as well as on information obtained from the patient (recent fish

consumption, species eaten, etc.) and on exclusion of other pathologies, i.e.

bacterial and viral infections, other toxins, allergies (Marcaillou-Le Baut

et al., 2001).

The treatment is symptomatic and includes:

Gastroenterical symptoms

Spasmolitics

Anti-diarrhoic drugs

Anti emetics

Gastric lavage

Neurological symptoms

Calcium gluconate

Vitamin B

Cardiovascular signs

Atropine

Cardiovascular analeptics

Pruritus

Corticoids

Anti histaminic drugs.

treatment of poisoning, the most rapidly it is administered the best the

effect. It probably acts by counteracting neuronal edema induced by Na

entrance in neurons, followed by water influx in the cell (Palafox et al., 1998).

Mannitol has proved to have some efficacy against nervous signs in the

7.3.2. Maitotoxins

Maitotoxins poisoning is characterized mainly by neurological symptoms,

including, in order of importance:

–

SEA WATER TOXINS

131

Altered thermal perception

Muscular pain

Pruritus

Urinary problems

Articular pain

Increased transpiration.

Gastrointestinal signs are quite rare (Marcaillou-Le Baut et al., 2001).

7.4. TOXICOSES IN ANIMALS

Evidence of the involvement on CTX in the morbidity and/or mortality of

marine mammals remains speculative.

One interesting case is that concerning decline in population of monk

seal in Hawaii. Population decline occurred has been primarily attributed to

the poor survival rates among juveniles and pups and to slower growth rate

of juvenile. It is yet unclear which are the reasons of this mortality rate, but

it has been hypothized that ciguatera could play a role.

Indeed, preliminary survey of known prey fish species showed some

positivity to the toxin; anyway no clear connection between CTX presence

and population decline (Craig and Ragen, 1999; Van Dolah et al., 2003).

8. Tetrodotoxin

Consumption of fish contaminated by tetrodotoxin (TTX) or its derivatives

is responsible for one of the most severe intoxication, as close to 60% of

affected people die within 4 to 6 hours after ingestion.

Recent researches have provided strong evidence of the bacteriological

origins of TTX:

Puffer fish grown in culture do not produce tetrodotoxin until they are

fed tissues from a toxin producing fish.

The blue-ringed octopus found in Australian waters accumulates tetro-

dotoxin in a special salivary gland and infuses its prey with toxin by

bite. This octopus contains tetrodotoxin-producing bacteria.

Xanthid crabs collected from the same waters contain tetrodotoxin and

paralytic shellfish toxin.

–

A. ZACCARONI AND D. SCARAVELLI

132

It is now clear that marine bacteria have long been in mutualistic sym-

biosis with marine animals and it is now known that the related toxins tetro-

dotoxin and anhydrotetrodotoxin are synthesized by several bacterial species,

including strains of the family Vibrionaceae, Pseudomonas sp., and Photo-

bacterium phosphoreum. Puffer fish took advantage of a single point

mutation in their sodium channel receptors which rendered these fish

immune from the effects of TTX. Following herbivores grazing, marine

invertebrates and vertebrates accumulate these bacteria, provide them with a

suitable host environment, and in return receive the protection of marine

biotoxins, compliments of the prokaryotes (Johnson, 2002).

8.1. CHEMICAL STRUCTURE

TTX is a positively charged guanidinium group and a pyrimidine ring with

additional fused ring systems, which contain hydroxyl groups which must

certainly help stabilize the TTX-sodium channel binding complex at the

Figure 20. Chemical structure of TTX.

8.2. MECHANISM OF ACTION

TTX is an especially potent neurotoxin, specifically blocking voltage-gated

sodium channels on the surface of nerve membranes. The TTX-Na Channel

binding site is extremely tight (K

= 10

–10

nM). It is proposed that this

binding results from the interaction of the positively charged guanidino

group on the tetrodotoxin and negatively charged carboxylate groups on

side chains in the mouth of the channel. TTX mimics the hydrated sodium

cation, enters the mouth of the Na

-channel peptide complex, binds to a

peptide glutamate side group, among others, and then further tightens it

aqueous interface (Johnson, 2002) (Fig. 20).

SEA WATER TOXINS

133

hold when the peptide changes conformation in the second half of the

binding event. Following complex conformational changes, TTX is further

electrostatically attached to the opening of the Na

gate channel (2d event

occurs in vivo as the dehydration of the aqueo-sodium complex).

TTX’s tenacious hold on the Na

-channel complex is further demon-

strated by the occupancy time of TTX v. hydrated-Na

at the complex.

Hydrated sodium reversibly binds on a nanosecond time-scale, whereas

TTX binds and remains on the order of tens of seconds. With the bulk of the

TTX molecule denying sodium the opportunity to enter the channel, sodium

movement is effectively shut down, and the action potential along the nerve

membrane ceases. A single milligram or less of TTX is enough to kill an

adult.

It has been proved that TTX does it not poison the host as the sodium

ion channel in the host is different than that of the victim and is not sus-

ceptible to the toxin. Indeed it has been demonstrated for one of the puffer

fish that the protein of the sodium ion channel has undergone a mutation

that changes the amino acid sequence making the channel insensitive to

tetrodotoxin. The spontaneous mutation that caused this structural change

is beneficial to the puffer fish because it allowed it to incorporate the

symbiotic bacteria and utilize the toxin it produces to its best advantage. A

single point mutation in the amino acid sequence of the sodium-ion channel

in this species renders it immune from being bound and blockaded by TTX

(Johnson, 2002).

8.3. SYMPTOMS AND TREATMENT IN HUMANS

The first symptom of intoxication is a slight numbness of the lips and

tongue, appearing between 20 minutes to three hours after eating poisonous

pufferfish. The next symptom is increasing paraesthesia in the face and

extremities, which may be followed by sensations of lightness or floating.

Headache, epigastric pain, nausea, diarrhea, and/or vomiting may occur.

Occasionally, some reeling or difficulty in walking may occur. The second

stage of the intoxication is increasing paralysis. Many victims are unable to

move; even sitting may be difficult. There is increasing respiratory distress.

Speech is affected, and the victim usually exhibits dyspnea, cyanosis, and

hypotension. Paralysis increases and convulsions, mental impairment, and

cardiac arrhythmia may occur. The victim, although completely paralyzed,

may be conscious and in some cases completely lucid until shortly before

death. Death usually occurs within 4 to 6 hours, with a known range of

about 20 minutes to 8 hours.

A. ZACCARONI AND D. SCARAVELLI

134

From 1974 through 1983 there were 646 reported cases of fugu (pufferfish)

poisoning in Japan, with 179 fatalities. Estimates as high as 200 cases per

year with mortality approaching 50% have been reported. Only a few cases

have been reported in the United States, and outbreaks in countries outside

the Indo-Pacific area are rare. Sushi chefs who wish to prepare fugu,

considered a delicacy by many in Japan, must be licensed by the Japanese

government.

The comparative toxicity of TTX is summarized by William H. Light.

“Weight-for-weight, tetrodotoxin is ten times as deadly as the venom of the

many-banded krait of Southeast Asia. It is 10 to 100 times as lethal as black

widow spider venom (depending upon the species) when administered to

mice, and more than 10,000 times deadlier than cyanide. It has the same

toxicity as saxitoxin which causes paralytic shellfish poisoning A recently

discovered, naturally occurring congener of tetrodotoxin has proven to be

four to five times as potent as TTX. Except for a few bacterial protein

toxins, only palytoxin, a bizarre molecule isolated from certain zoan-

thideans (small, colonial, marine organisms resembling sea anemones) of

the genus Palythoa, and maitotoxin, found in certain fishes associated with

ciguatera poisoning, are known to be significantly more toxic than TTX. Paly-

toxin and maitotoxin have potencies nearly 100 times that of TTX and Saxi-

toxin, and all four toxins are unusual in being non-proteins. Interestingly,

there is also some evidence for a bacterial biogenesis of saxitoxin, palytoxin,

and maitotoxin....[i]n living animals the toxin acts primarily on myelinated

(sheathed) peripheral nerves and does not appear to cross the blood-brain

barrier” (Johnson, 2002).

9. Pfiesteria and Estuary-Associated Syndrome

Possible estuary-associated syndrome (PEAS) is known to occur in brackish

coastal waters along the mid-Atlantic coast of the U.S. and has been

reported in a few scattered locations worldwide as well. This syndrome

Pfiesteria cultures.

seems to be associated to Pfiesteria and Pseudopfiesteria exposure (Fig. 21),

even if no clear connection between algae and syndrome have been found

yet (Duncan et al., 2005).

At present the toxins responsible for fish lethality or neurologic sym-

ptoms has not yet been identified. Anyway, Moeller et al., 2001 have iso-

lated and partially purified water soluble toxins contained in water from toxic

SEA WATER TOXINS

135

Figure 21. Pfiesteria piscicida.

As well as for the toxins chemical structure, the exact mechanism of

action of Pfiesteria has not been identified.

Exposure to Pfiesteria toxins in the air, water, or fish at the site of an

outbreak can cause skin and eye irritation as well as short-term memory

loss, confusion, and other cognitive impairments in people. No toxic activity

has been detected in shellfish harvested from sites of Pfiesteria blooms.

The reported human health effects (e.g. respiratory irritation, skin

rashes, and possible neurocognitive disorders) from exposure to natural

waters in the mid-Atlantic states are still being assessed. Illness from con-

suming shellfish and fish in areas of Pfiesteria and Pseudopfiesteria oc-

currence are unknown.

Pfiesteria and Pseudopfiesteria are associated with fish kills in mid-

Atlantic states. Recent studies suggest that fish kills are due to: 1) motile

cells attaching to fish and feeding on fish skin cells which could allow

invasion of pathogens or weaken the animal’s immunity; and/or 2) un-

described, water-soluble and lipid-soluble bioactive fractions being released

to the environment. There are published studies purporting different causes

and different pathways.

Interestingly, in the laboratory, toxicity of water in an aquarium is

rapidly lost within a day if the fish that were provided as food are removed.

Pfiesteria piscicida has a very complex life cycle, and at certain stages

of this cycle has a lethal toxic effect on fish, as demonstrated by massive

fish kills in North Carolina estuaries and in the Chesapeake Bay (Birkhauser

et al., 1975; Ashton et al., 1977; Andersen et al., 1993; Burkholder et al.,

2001a; Samet et al., 2001). The organism’s polymorphic life cycle (Figure 22)

consists of three distinct life-form stages—flagellated, amoeboid, and

encysted—that live in bottom sediment s or as free-swimming organisms in

A. ZACCARONI AND D. SCARAVELLI

136

the water column. These stages involve at least 24 size, shape and morp-

hotypic variants, ranging from 5 to 450 ȝm in size. The stages include rhizo-

podial, filose and lobose amoebae; toxic and non-toxic zoospores (asexual

flagellated spore); cysts of various structure; and gametes (mature sexual

reproductive cells having a single set of unpaired chromosomes). Under

laboratory conditions in the presence of live fish, its sediment-dwelling

amoeboid and resting stages transform rapidly into free-swimming

flagellate stages in response to unknown chemical cues secreted or excreted

by fish. The induced (excysted) flagellate stages swarm into the water

column and become toxic during their continued exposure to the fishderived

(sometimes shellfish-derived) chemical stimulants.

The toxic zoospores gather together, alter their random swimming pattern

into directed movement, doubling their swimming speed in the process, and

commence predatory behavior directed toward targeted fish. The toxic

zoospores produce a neurotoxin of unknown structure, soluble in water, and

which may be liberated as an aerosol under some conditions. Fish are first

narcotized by the toxin, die suddenly, and slough off tissues, which the

attacking zoospores consume by sucking out the cell contents through the

attached peduncle. The zoospores sometimes ingest other microscopic plant

and animal prey at the same time. During this killing period, the zoospores

reproduce both asexually (mitotic division) and by producing gametes that

fuse to produce toxic planozygotes (actively swimming offspring formed by

sexual reproduction, i.e. the union of two gametes). The presence of live

fish is required both for completion of the sexual cycle and for toxin

induction. Upon fish death or their retreat, the toxic zoospores and plano-

zygotes transform into (mostly) nontoxic amoeboid stages that gather onto

the floating fish carcasses on which they feed for extended periods, and

follow the sinking fish remains to the bottom sediments. Not all toxic

zoospores and planozygotes transform into amoebae. Some encyst and sink

into bottom sediments; a lesser number revert to non-toxic zoospores that

remain in the water column. The proposed 24 stages of the complex life

cycle are based on laboratory observation (Samet et al., 2001).

It has been observed that the morbidity of Pfiesteria is dependent on

food availability: Pfiesteria blooms were stimulated by inorganic nutrient

enrichment (Burkholder et al., 1992; Glasgow et al., 1995; Burkholder

et al., 2001b), and transition to a toxic stage was associated with the presence

of fish tissues or secretions (Burkholder and Glasgow, 1997; Marshall et al.,

2000). The fish appeared narcotized, displaying lethargic behavior, a poor

fright response, lesions, hemorrhage, and ultimately death. Water samples

SEA WATER TOXINS

137

indicated that P. piscicida was present at concentrations ranging from

600–35,000 cells/ml in waters ranging in temperature from 9–31°C and in

salinity from 0–30 psu during fish kills. Much lower concentrations of

P. piscicida were found only hours after fish kills due to P. piscicida’s

encystment following lack of food (due to fish death) and settlement into

sediment (Burkholder et al., 1992).

Figure 22. Pfiesteria piscicida life cycle. The pathways indicate the presence (+) versus the

absence (–) of live finfish; AL = presence of cryptomonads and certain other algal prey; N =

nutrient enrichment as organic and/or inorganic N and P; S = environmental stressor such

as sudden shift in temperature or salinity, physical disturbance, or prey depletion. Dashed

lines = hypothesized pathways. Stages have been conservatively numbered to facilitate

description. TOX-B: zoospores temporarily non-toxic in the absence of live fish prey; TOX-

A: zoospores which produce toxin when sufficient live fish are added. Zoospores can

transform to filose and lobose amoebae. Planozygotes can transform to larger filose and

lobose amoebae. Small filose and lobose amoebae can also be produced by gametes

(Burkholder et al. (2001a), modified).

A. ZACCARONI AND D. SCARAVELLI

138

10. New toxins

10.1. AZASPIRACIDS

Azaspiracids are polycyclic polyethers molecules with 40 carbon atoms,

with a different level of methylation, presenting a carboxylic acid and a

cyclic imine function and a unique cyclic structure (Satake et al., 1998;

Ofuji et al., 1999). Some human intoxication has been reported in France,

Netherland and Italy (McMahon and Silke, 1998). The producing organism

Poisoning is characterized by symptoms similar to DSP (diarrhea,

nausea and vomiting) and recovery occurs in 3–5 days.

Figure 23. Protoperidinium crassipes.

Figure 24. Chemical structure of azaspiracids.

is Protoperidinium crassipes, which distributes uniformly in the mussels

body (Figs. 23 and 24).

SEA WATER TOXINS

139

In animals a neurotoxic syndrome is observed, causing death at low

doses in two to three days due to progressive paralysis; high doses are lethal

in few minutes, and death occurs for paralysis and violent seizures.

Histopathological analysis of rats administered oral or intraperitoneal

toxin showed degeneration and desquamation of gut. This phenomena can

recover after exposure ends, but recovery times are longer that for OA.

Some pancreatic, thymus and cardiac necrosis has been observed, as well as

lipidic accumulation in liver (Ito et al., 2000).

10.2. SPIROLIDES

Spirolides (from A to F) are macrocyclic polyethers produced by Alexandrium

Figure 25. Spirolides chemical structure.

10.3. GIMNODINE

An ichthyotoxic toxin is gymnodine, produced by Gymnodium mikimotoi;

its mechanism of action is not known, but the toxin is not haemolytic,

cytotoxic and does not activate ionic channels (Seki et al., 1995; Miles

et al., 1999).

ostenfeldii (Fig. 25). At present their mechanism of action has not yet been

clarified, but they seems to affect central nervous system (Hu et al., 1995a;

Hu et al., 1995b; Hu et al., 1996a; Cembella, 1998; Cembella et al., 2000).

A. ZACCARONI AND D. SCARAVELLI

140

10.4. PROROCENTROLIDES

Prorocentrum lima and P. maculosum produce not only okadaic acid, but

other macrocyclic polyethers named prorocentrolides and prorocentrolides

B, more polar than OA. The toxicological and pharmacological activities

are not well defined, but it is clear that they have no inhibiting activity on

phosphatases (Torigoe et al., 1988; Hu et al., 1996b).

10.5. COOLIATOXIN

Cooliatoxin is produced by Coolia monotis; it is a polyether considered as a

monosulphated analogue of yessotoxins. The effect of cooliatoxin in animal

is similar to that of yessotoxins, even if the delay time for symptoms ap-

pearance is longer (Holmes et al., 1995).

The respiratory distress responsible for animal’s death is not a result of

direct inhibition of phrenic nerve or of diaphragm activity, but is caused by

an initial stimulation followed by block of non-myelized nerves activity,

which induce a transitory contraction of smooth muscles and a positive

inotrope effect on cardiac muscle (Holmes et al., 1995).

10.6. ZOOXANTELLATOXINS

Zooxantellatoxins are macrocyclic polyethers produced by symbiotic

dinoflagellates Symbiodinium. Their cellular effects are similar to those of

maitotoxins and are controlled by extracellular calcium:

Increase in cytosolic concentration of calcium

Hydrolysis of phoshoinositide via phospholipase C and of phospholipids,

leading to arachidonic acid liberation

Muscular contraction

Sodium influx and potassium efflux from cell (Rho et al., 1995; Rho

et al., 1997; Moriya et al., 1998)

As for maitotoxins, two mechanisms of action have been considered for

zooxantellatoxins:

Calcium channels activation dependent on membrane potential

Activation of non-selective cationic channels

–

SEA WATER TOXINS

141

11. Toxicoses Due to “Unsual” Vectors

Some fish and marine vertebrate species are responsible for “unusual”

syndromes, generally called “sarcotoxisms”, which sometimes are caused

by a combination of two or more toxins. Toxic compounds produced by

benthic and/or epiphytes can affect various trophic pathways, depending on

the complexity of affected ecosystem; this effect is thus maximal in tropical

areas, where biodiversity if very high (fig. 4).

A summary of poisoning is given in table 6.

TABLE 6. General characteristics of sarcotoxisms.

ame Species

Clinical

characteristics

Toxin

Clupeotoxism Herrings,

anchovies, sardines

Short incubation

time, digestive

syndrome,

pruritus,

tachycardia,

vertigos,

cyanosis.

Coma and death

are not so rare

Palitoxine?

Mixed toxins?

llucinatory

episodes

Acanthuridae

Mugilidae,

Mullidae,

Estraciontidae,

Pomacentridae,

Serranidae,

Siganidae, Sparidae

Short incubation

time.

Allucinations,

vertigos,

behaviour

alterations,

motory

incoordination

Various,

unknown

toxins

Charca

otoxisms Various shark

species

Both nervous and

digestive signs

Mixed toxins

Scombroidotoxism Scrombridae, tuna,

bonitos, mackerel

Short incubation

time, rapid

evolution,

nervous and

digestive signs.

Regression within

8-12 hours

Histamine and

biogenic

amines

Chelonitoxism Sea turtles Digestive

syndrome which

can also be fatal

Unknown

toxins

Lyngbyatoxin?

Some of these poisoning are described in following paragraphs.

A. ZACCARONI AND D. SCARAVELLI

142

11.1. LYNGBYATOXIN AND APLYSIATOXIN

The marine cyanobacterium Lyngbya majuscula has been implicated in

acute adverse health effects in humans over the last forty years with

symptoms including dermatitis involving itching, rash, burning blisters and

deep desquamation and, respiratory irritation and burning of the upper

gastrointestinal tract on ingestion. It has been shown that the toxins

lyngbyatoxin A (LA) and debromoaplysiatoxin (DAT) isolated from

L. majuscula samples in Australia and USA are at least partially responsible

for these symptoms. It should be noted that L. majuscula has been found to

grow in more than 98 locations around the world in tropical, sub-tropical and

temperate climates (Grauer and Arnold, 1961; Mynderse et al., 1977; Solomon

and Stoughton, 1978; Cardellina et al., 1979; Fujiki et al., 1985; Izumi and

Moore, 1987; Anderson et al., 1988; Marshall and Vogt, 1998; Osborne

et al., 2001a; Osborne et al., 2001b).

An association was found between the level of water exposure and

reporting of symptoms. Those with higher exposures were more likely to

report skin and eye symptoms, which previously have been implicated with

exposure to L. majuscula. Toxins of L. majuscula have been demonstrated

both anecdotally and experimentally to be fast acting, thus eliminating the

variable of duration of exposure (Grauer and Arnold, 1961; Solomon and

Stoughton, 1978; Serdula et al., 1982; Izumi and Moore, 1987; Marshall

and Vogt, 1998).

Episodes of human intoxications due to sea turtles consumption have

been known in some Indo-Pacific areas (Halstead, 1970; Champetier De

Ribes et al., 1998). The detection of lyngbyatoxin A in meat of turtles lead

to the identification of this toxin as the causative agent of intoxication

(Yasumoto (1998). Symptoms were characterized by inflammation of oral

and esophageal area, difficulty of swallowing, acute gastritis, papule of the

tongue, mouth ulcers, weakness, tachycardia, headache, dizziness, fever,

salivation, stinking breath. In Madagascar some death in youth and newborn

(due to ingestion of toxins with breast milk) were observed. Lyngbya

majuscola has been proved to produce also aplysiatoxin, which induce

hypersecretion of mucous from the caecum and large intestine, bleeding

from the small intestine and death; the toxin has proved to be a tumor

promoter by activating protein kinase C (Mynderse et al., 1977; Fujiki et al.,

1981; Ito and Nagai, 1998; Ito and Nagai, 2000).

Lyngbiatoxin has been considered as a promoting agent for fibro-

papillomatosis in sea turtles: tumor promoting agents have been shown to

enhance viral synthesis, to enhance oncogene-induced transformation of

SEA WATER TOXINS

143

cells and to reduce immune responses by suppression of the immune-

surveillance mechanism. All these actions ease the occurrence of fibro-

papillomatosis (Arthur et al., 2008).

11.2. CARCHAROTOXIN

The consumption of sharks’ flesh can sometime be the origin of human

intoxications, which are recorded since 1993. These intoxications are charac-

terized by neurological signs, mainly ataxia, while gastro enteric symp-

tomatology is quite rare. This poisoning was for long time considered a

form of ciguatera. Recent identification of carcharotoxins proved that

these toxins have no similarity to ciguatoxins (Habermehl et al., 1994;

Boisier et al., 1995).

It should be remembered that sharks can anyway contain more than one

toxin, ciguatoxins included in Table 7.

TABLE 7. Shark intoxication: syndromes, sources and species involved.

Syndroms

Source

Species involved

Sarcotoxismes Ciguatera Carcharinus galeocerdo

Isurus sp.

Prionace glauca

eurosensorial

disturbs

Not known Somniosus

Squalus

Carcharotoxisme Not known Carcharinus leucas

Carcharinus ambonensis

Toxicoses Pollutants

Ciguatera

Neurosensorial

problem

Vitamin A

Prionace

Sclyliorhinus

Sphyrna

Carcharhinus

Carcharodon

11.3. PALITOXINS

Clupeotixism is a poisoning characterized by a high rate of fatalities follo-

wing to sardines, herrings and anchovies consumption. Causative agent for

the poisoning was found to palitoxin, a toxins produced by Ostreopsis spp.;

indeed, the dinoflagellates was found in viscera of toxic fish (Usami et al.,

1995; Molgò et al., 1997).

A. ZACCARONI AND D. SCARAVELLI

144

Being palitoxin isolated from other organisms than dinoflagellates, i.e.

marine coelenterates, sea anemones, crabs and other marine invertebrates,

the algal origin of the toxin is under discussion (Moore and Scheuer, 1971;

Hirata et al., 1979; Beress et al., 1983; Mahnir and Kozlovskaja, 1992;

Gleibs et al., 1995; Yasumoto et al., 1997).

Palitoxin is a polyhydroxylated complex molecules which is constant

despite the producing organism (Quod et al., 2001).

Palitoxin was for long time considered as a form of ciguatera, but

nowadays clinical symptoms allows to differentiate among the two poisoning

(Puiseaux-Dao et al., 2001).

References

Afshari, C. A., 1994, Disruption of G0-G1 Arrest in Quiescent and Senescent Cells Treated

with Phosphatase Inhibitors, Cancer Res 54: 2317–2321.

Alfonso, A., De la Rosa, L. A., Vieytes, M. R. and Botana, L. M., 2000, Yessotoxin: A

Powerful New Tool for the Study of Signal Transduction, in: Proc 9th International

Conference on Harmful Algae Blooms “Hab 2000”. 7–11 February 2000. Hobart,

Australia.

Amzil, Z., Vernoux, J. P. and Pottier, I., 2001, Les Principales Classes De Phycotoxines, in:

Toxines D’algues Dans L’alimentation, J. M. Frémy and P. Lassus, Ifremer, pp. 159–188.

Andersen, P., 1996. Design and Implementation of Some Harmful Algal Monitoring

Systems. Ioc Technical Series, UNESCO, 44 pp.

Andersen, T., Andersen, J. R., Tvede, M. and Franzmann, M. B., 1993, Collagenous Colitis:

Are Bacterial Cytotoxins Responsible?, Am. J. Gastenterol. 88: 375– 377.

Anderson, B., Sims, J., Liang, A. and Minette, H., 1988, Outbreak of Eye and Respiratory

Irritation in Lahaina, Maui, Possibly Associated with Microcoleus Lyngbyaceus, J

Environ Health 50: 205–209.

Anderson, D., 1994a, Eaux Colorées Et Phytoplancton Toxique, Pour la science 204: 68–76.

Anderson, D. M. and Cheng, T. P. O., 1988, Intracellular Localization of Saxitoxins in the

Dinoflagellate Gonyaulax Tamarensis, J Phycol 24: 17–22.

Anderson, D. M., 1989, Toxic Algal Blooms and Red Tides: A Global Perspective, in: Red

Tides: Biology, Environmental Science and Toxicology, T. Okaichi, D. M. Anderson and

T. Nemoto, Elsevier. New York, pp. 11–16.

Anderson, D. M. and White, A. W., 1992, Marine Biotoxins at the Top of the Food Chain,

Oceanus 35: 55–61.

Anderson, D. M., 1994b, Red Tides, Sci Am 271: 52–58.

Andrinolo, D., Michea, L. F. and Lagos, N., 1999, Toxic Effects, Pharmacokinetics and

Clearance of Saxitoxin, a Component of Paralytic Shellfish Poison (Psp), in Cats,

Toxicon 37: 447–464.

Armstrong, I. H., Coulson, J. C., Hawkey, P. and Hudson, M. J., 1978, Further Mass Seabird

Deaths from Paralytic Shellfish Poisoning, Brit Birds 71: 58–68.

SEA WATER TOXINS

145

Promoting Compounds Produced by the Cyanobacterium Lyngbya Majuscula and Their

Potential Role in the Aetiology of Fibropapillomatosis, Harmful Algae 7: 114–125.

Arufe, M. C., Beckett, G. J., Durán, R. and Alfonso, M., 1999, Effect of Okadaic Acid and

Calyculin-a, Two Protein Phosphatase Inhibitors, on Thyrotropin-Stimulated Triio-

dothyronine Secretion in Cultured Sheep Thyroid Cells, Endocrine 11: 235–240.

Ashton, H., Millman, J. E., Telford, R., Thompson, J. W., Davies, T. F., Hall, R., Schuster, S.,

Thody, A. J., Coy, D. H. and Kastin, A. J., 1977, Psychological and Endocrinological

Effects of Melanocyte Stimulating Hormones in Normal Man, Psychopharmacology 55:

165–172.

Atchison, W. D., Luke, V. S., Narahashi, T. and Vogel, S. M., 1986, Nerve Membrane

Sodium Channels as the Target Site of Brevetoxins at Neuromuscular Junctions, British

journal pharmacology 89: 731–738.

Aune, T., 1989, Toxicity of Marine and Freshwater Algal Biotoxins Towards Freshly

Preparated Hepatocytes, in: Mycotoxins and Phycotoxins, S. Natori, K. Hashimoto and

Y. Ueno, Elsevier. Amsterdam, pp. 461–468.

Baden, D. G., 1989, Brevetoxins: Unique Polyether Dinoflagellate Toxins, The FASEB

journal 3: 1807–1817.

Bagnis, R., 1967, Les Impoisonnement Per Le Poisson En Polynésie Francaise: Étude

Clinique Et Èpidémiologique, Rev Méd Soc 15: 619–646.

Bagnis, R., Kuberski, T. and Laugier, S., 1979, Clinical Observations on 3,009 Cases of

Ciguatera (Fish Poisoning) in the South Pacific, American Journal Tropical Medicine

Hygiene 28: 1067.

Barbier, M., Amzil, Z., Mondeguer, F., Bhaud, Y., Soyer-Gobillard, M. O. and Lassus, P.,

1999, Okadaic Acid and Pp 2 a Cellular Immunolocalization in Prorocentrum Lima

(Dinophyceae), Phycologia 38: 41–46.

Bargu, S., Powell, C. L., Coale, S. L., Busman, M., Doucette, G. J. and Silver, M. W., 2002,

Krill: A Potential Vector for Domoic Acid in Marine Food Webs, Mar Ecol 237:

209–216.

Beales, R. W., 1976, A Red Tide in Brunei’s Coastal Waters, Brunei Mus J 3: 167–182.

Beress, L., Zwick, J., Kolkenbrock, H. J., Kaul, P. N. and Wassermann, O., 1983, A Method

for the Isolation of the Caribbean Palytoxin (C-Ptx) from the Coelenterate (Zooanthid)

Palythoa Caribaeorum, Toxicon 21: 285–290.

Bialojan, C. and Takai, A., 1988, Inhibitory Effect of a Marine-Sponge Toxin, Okadaic Acid,

on Protein Phosphatases. Specificity and Kinetics, J Biochem 256: 283–290.

Bidard, J. N., Vijverberg, H. P. M., Frelin, C., Chungue, E., Legrand, A. M., Bagnis, R. and

Lazdunski, M., 1984, Ciguatoxin Is a Novel Type of Sodium Channel Toxin, J Biol

Chem 259: 8353–8357.

Birkhauser, M., Gaillard, R., Riondel, A. M. and Zahnd, G. R., 1975, Influence of Acute

Administration of Human Growth Hormone and Alpha-Msh on Plasma Concentrations

of Aldosterone, Cortisol, Corticosterone and Growth Hormone in Man, Acta Endocrinol

79 :16–24.

Boisier, P., Ranaivoson, G., Rasolofonirina, N., Andriamahefazafy, Roux, J., Chanteau, S.,

Satake and Takeshi, Y., 1995, Fatal Mass Poisoning in Madagascar Following Ingestion

of a Shark (Carcharhinus Leucas): Clinical and Epidemiological Aspects and Isolation

of Toxins, Toxicon 33: 1359–1364.

Arthur, K., Limpus, C., Balazs, G., Capper, A., Udy, J., Shaw, G., Keuper-Bennett, U. and

Bennett, P., 2008, The Exposure of Green Turtles (Chelonia Mydas) to Tumour

A. ZACCARONI AND D. SCARAVELLI

146

Bourdeau, P., Lassus, P., Turquet, J. and Quod, J. P., 2001, Role Écologique Et Transfert

Des Phycotoxines Dans Les Chaines Alimentaires, in: Toxines D’algues Dans L’alimentation,

J. M. Frémy and P. Lassus, Ifremer, pp. 251–295.

Boyer, G. L., Sullivan, J. J., Andersen, R. J., Harrison, P. J. and Taylor, F. J. R., 1985, The

Effect of Zooplankton Grazing on Estuarine Blooms of the Toxic Dinoflagellate

Gonyaulax Tamarensis, J. Plankton Res 7: 891–908.

Bressler, J., Forman, S. and Goldstein, G. W., 1994, Phospholipid Metabolism in Neural

Microvascular Endothelial Cells after Exposure to Lead in Vitro, Toxicol Appl

Pharmacol 126: 352–360.

Burkholder, J. A. M., 1998, Implications of Harmful Microalgae and Heterotrophic Dino-

flagellates in Management of Sustainable Marine Fisheries, Ecological Applications 8:

37–62.

Burkholder, J. M., Noga, E. J., Hobbs, C. H. and Glasgow, H. B. J., 1992, New Phantom

Dinoflagellate Is the Causative Agent of Major Estuarine Fish Kills, Nature 358: 407–410.

Burkholder, J. M. and Glasgow, H. B. J., 1997, Trophic Controls on Stage Transformations

of a Toxic Ambush-Predator Dinoflagellate, J. Eukaryot Microbiol 44 200–205.

Burkholder, J. M., Glasgow, H. B., Deamer-Melia, N. J., Springer, J., Parrow, M. W., Zhang,

Importance of Functional Type in Data Interpretation Environmental Health Perspectives

Supplements 109: 667–679.

California Wildlife Center, 2006, Responses from a to Sea. How California Wildlife Center’s

Marine Mammal Response Team Cares for Animals Afflicted with Domoic Acid Toxicity.

http://www.californiawildlifecenter.org/cwc_concept_site/viewNews/cwctSpecialEventLATi

mes.htm.

Cardellina, J. H., Marner, F. J. and Moore, R. E., 1979, Seaweed Dermatitis: Structure of

Lyngbyatoxin A, Science 204: 193–195.

Carreto, J. I., Elbusto, C., Sancho, H., Carignan, M., Cucchi Colleoni, A. D., de Marco, S.

and Fernandez, A., 1993, An Exploratory Analysis of the Mar Del Plata Shellfish

Toxicity Area (1980–1990), in: Toxic Phytoplankton Blooms in the Sea, T. J. Smayda

and Y. Shimizu, Elsevier. New York, pp. 377–382.

Catterall, W. A., Schmidt, J. W., Messner, D. J. and Structure, D. J. F., 1986, Tetrodotoxin,

Saxitoxin, and the Molecular Biology of the Sodium Channel, Ann NY Acad Sci 479:

113–132.

Catterall, W. A., 2000, From Ionic Currents to Molecular Mechanisms: The Structure and

Function of Voltage-Gated Sodium Channels, Neuron 26: 13–25.

Cembella, A. D., 1998, Ecophysiology and Metabolism of Paralytic Shellfish Toxins in

Marine Microalgae, in: Physiological Ecology of Harmful Algal Blooms, D. M.

Anderson, Cembella A. D. and Hallegraeff G. M., Springger. Berlin, Heidelbrg, pp.

381–403.

Cembella, A. D., Lewis, N. I. and Quilliam, M. A., 2000, The Marine Dinoflagellate

Alexandrium Ostenfeldii (Dinophyceae) as the Causative Organism of Spirolide Shellfish

Toxins, Phycologia 39: 67–74.

Bourdeau, P. and Bagnis, R., 1989, Risk Factors of Ciguatera in the French West Indies in

Saint-Barthelemy, Saint-Martin and Anguilla, Rev Elev Med Vet Pays Trop 42: 393–410.

Bossart, G. D., Baden, D. G., Ewing, R. Y., Roberts, B. and Wright, S. D., 1998,

Brevetoxicosis in Manatees (Trichechus Manatus Latirostris) from the 1996 Epizootic:

Gross, Histologic, and Immunohistochemical Features, Toxicol Pathol. 26: 276–282.

C. and Cancellieri, P. J., 2001, Species of the Toxic Pfiesteria Complex, and the

SEA WATER TOXINS

147

Champetier De Ribes, G., Ranaivoson, G., Ravaonindrina, N., Rakotonjanabelo, A. L.,

Rasolofonirina, N., Roux, J. F. and Yasumoto, T., 1998, Un Problème De Santé Publique

Réémergent À Madagascar: Les Intoxications Collectives Par Consommation D’animaux

Marins. Aspects Épidémiologiques, Cliniques Et Toxicologiques Des Épisodes Notifiés

De Janvier 1993 À Janvier 1998, Archives de l’Institut Pasteur de Madagascar 64: 71–76.

Chan, T. Y. K., 1998, Lengthy Persistence of Ciguatoxin in the Body, Transactions Royal

Society Tropical Medicine Hygiene 92: 662–662.

Chiavaroli, C., Vacher, P. and Schlegel, W., 1992, Modulation of Ca

Influx by Protein

Phosphorylation in Single Intact Clonal Pituitary Cells, European journal pharmacology

227: 173–180.

Choi, O. H., Padgett, W. L., Nishizawa, Y., Gusovsky, F., Yasumoto, T. and Daly, J. W.,

1990, Maitotoxin: Effects on Calcium Channels, Phosphoinositide Breakdown, and

Arachidonate Release in Pheochromocytoma Pc12 Cells, Mol. Pharmacol 37: 222–230.

Ciminiello, P., Fattorusso, E., Forino, M., Magno, S., Poletti, R., Satake, M., Viviani, R. and

Yasumoto, T., 1997, Yessotoxin in Mussels of the Northern Adriatic Sea, Toxicon 35:

177–183.

Ciminiello, P., Fattorusso, E., Forino, M., Magno, S., Poletti, R. and Viviani, R., 1998,

Isolation of Adriatoxin, a New Analogue of Yessotoxin from Mussels of the Adriatic

Sea, Tetrahedron Letters 39: 8897–8900.

Ciminiello, P., Fattorusso, E., Forino, M., Poletti, R. and Viviani, R., 2000, A New Analogue

of Yessotoxin, Carboxyyessotoxin, Isolated from Adriatic Sea Mussels, European

Journal Organic Chemistry 2000: 291–295.

Coulson, J. C., Potts, G. R., Deans, I. R. and Fraser, S. M., 1968, Exceptional Mortality of

Shags and Other Seabirds Caused by Paralytic Shellfish Poison, Brit Birds 61: 381–404.

Cunha, R. A., Malva, J. O. and Ribeiro, J. A., 2000, Pertussis Toxin Prevents Presynaptic

Inhibition by Kainate Receptors of Rat Hippocampal [(3) H] Gaba Release, FEBS Letters

469: 159–162.

Dantzer, W. R. and Levin, R. E., 1997, Bacterial Influence on the Production of Paralytic

Shellfish Toxins by Dinoflagellated Algae, J Appl Microbiol 83: 464–469.

Dawson, J. F. and Holmes, C. F., 1999, Molecular Mechanisms Underlying Inhibition of

Protein Phosphatases by Marine Toxins, Front. Biosci 4: 646–658.

de Jong, L. and Admiraal, W., 1984, Competition between Three Estuarine Benthic Diatom

Species in Mixed Cultures, Mar Ecol Prog Ser 18: 269–275.

Debonnel, G., Weiss, M. and de Montigny, C., 1989, Reduced Neuroexcitatory Effect of

Domoic Acid Following Mossy Fiber Denervation of the Rat Dorsal Hippocampus:

Further Evidence That Toxicity of Domoic Acid Involves Kainate Receptor Activation,

Can J Physiol Pharmacol 67: 904–908.

Dechraoui, M. Y., Naar, J., Pauillac, S. and Legrand, A. M., 1999, Ciguatoxins and

Brevetoxins, Neurotoxic Polyether Compounds Active on Sodium Channels, Toxicon 37:

125–143.

Draisci, R., Lucentini, L., Giannetti, L., Boria, P. and Poletti, R., 1996, First Report of

Pectenotoxin-2 (Ptx-2) in Algae (Dinophysis Fortii) Related to Seafood Poisoning in

Europe, Toxicon 34: 923–935.

Duncan, P. M., Parris, B., Schultz, S., Jones, J., Gordon, A., Dyer, B. and Marshall, H.,

2005, Behavioral Effects and Drug Vulnerability in Rats Exposed to Pfiesteria Toxin,

Neurotoxicology and Teratology 27: 701–710.

Eaglesham, G. B., Brett, S. J., Davis, B. C. and Holling, N., 2000, Detection of Percte-

notoxins-2 and Pctenotoxins-2 Seco-Acid in Phytoplankton and Shellfish from the

A. ZACCARONI AND D. SCARAVELLI

148

Ballina Region of New South Wales, Australia, in: Conference Proceedings of the X

International Iupac Mycotoxins and Phycotoxins. Sao Paolo, Brazil.

Edebo, L., Lange, S., Li, X. P., Allenmark, S., Lindgren, K. and Thompson, R., 1988,

Seasonal, Geographic and Individual Variation of Okadaic Acid Content in Cultivated

Mussels in Sweden, APMIS 96: 1036–1042.

Edmunds, J. S. G., McCarthy, R. A. and Ramsdell, J. S., 1999, Ciguatoxin Reduces Larval

Survivability in Finfish, Toxicon 37: 1827–1832.

Elbrächter, M., 1976, Population Dynamic Studies on Phytoplankton Cultures, Mar Biol 35:

201–209.

Estudillo, R. A. and Gonzales, C. L., 1984, Red Tides and Paralytic Shellfish Poisoning in

the Philippines, in: Toxic Red Tides and Shellfish Toxicity in Southeast Asia, A. W.

White, M. Anraku and K. K. Hooi, Southeast Asian Fisheries Development Center,

Singapore, International Development Research Center, Ottawa. Singapore, Ottawa,

pp. 52–91.

Evans, M. H., 1972, Tetrodotoxin, Saxitoxin, and Related Substances: Their Applications in

Neurobiology, Int Rev Neurobiol 15: 83–166.

Forcada, J., Hammond, P. S. and Aguilar, A., 1999, Status of the Mediterranean Monk Seal

Monachus Monachus in the Western Sahara and the Implications of a Mass Mortality

Event, Mar Ecol Prog Ser 188: 249–261.

Freitas, J. C., Ogata, T., Veit, C. H. and Kodama, M., 1996, Occurrence of Tetrogotoxin and

Paralytiv Shellfish Toxins in Phallusia Nigra (Tunicata, Ascidiacea) from the Brazilian

Coast, J Venom Anim Toxins 2: 28–38.

Fritz, L., Quilliam, M. A., Wright, J. L. C., Beale, A. M. and Work, T. M., 1992, An

Outbreak of Domoic Acid Poisoning Attributed to the Pennate Diatom Pseudonitzschia

Australis, Journal of Phycology 28: 439–442.

Fujiki, H., Mori, M., Nakayasu, M., Terada, M., Sugimura, T. and Moore, R. E., 1981,

Indole Alkaloids: Dihydroteleocidin B, Teleocidin, and Lyngbyatoxin a as Members of a

New Class of Tumor Promoters, Proc Natl Acad Sci USA 78: 3872–3876.

Fujiki, H., Ikegami, K., Hakii, H., Suganuma, M., Yamaizumi, Z., Yamazato, K., Moore, R. E.

and Sugimura, T., 1985, A Blue-Green Alza from Okinawa Contains Aplysiatoxins, the

Third Class of Tumor Promoters, Japanese journal cancer research 76: 257–259.

Galigniana, M. D., Housley, P. R., DeFranco, D. B. and Pratt, W. B., 1999, Inhibition of

Glucocorticoid Receptor Nucleocytoplasmic Shuttling by Okadaic Acid Requires Intact

Cytoskeleton, Journal Biological Chemistry 274: 16222–16227.

Gallacher, S. and Smith, E. A., 1999, Bacteria and Paralytic Shellfish Toxins, Protist 150:

245–255.

Gawley, R. E., Rein, K. S., Jeglitsch, G., Adams, D. J., Theodorakis, E. A., Tiebes, J.,

Nicolaou, K. C. and Baden, D. G., 1995, The Relationship of Brevetoxin ‘Length’and

a-Ring Functionality to Binding and Activity in Neuronal Sodium Channels, Chemistry

Biology 2: 533–541.

Gentien, P. and Arzul, G., 1990, Exotoxin Production by Gyrodinium Cf. Aureolum (Dino-

phyceae), J Mar Biol Assoc UK 70: 571–581.

Geraci, J. R., 1989, Clinical Investigation of the 1987-88 Mass Mortality of Bottlenose

Dolphins Along the Us Central and South Atlantic Coast. Final Report to National

Marine Fisheries Service, Washington, DC.

Geraci, J. R., Anderson, D. M., Timperi, R. J., St. Aubin, D. J., Early, G. A., Prescott, J. H.

and Mayo, C. A., 1989, Humpback Whales (Megaptera Novaeangliae) Fatally Poisoned

by Dinoflagellate Toxin, Can J Fish Res Aquat Sci

46: 1895–1898.

SEA WATER TOXINS

149

Gerlach, S. A., 1989, Eine Toxische Phytoplankton-Blute Als Mutamssliche Ursache Fur

Das Massensterben Von Tuemmlern, Und Bericht Uber Marines Aerosol Als Vektor Fur

Brevetoxins, Proc. Food Sci Advis Board Ger Fish, 33 Ann. Meet. 19: 95–102.

Gessner, B. D., Bell, P., Doucette, G. J., Moczydlowski, E., Poli, M. A., Van Dolah, F. and

Hall, S., 1997, Hypertension and Identification of Toxin in Human Urine and Serum

Following a Cluster of Mussel-Associated Paralytic Shellfish Poisoning Outbreaks,

Toxicon 35: 711–722.

Gill, C. W. and Harris, R. P., 1987, Behavioural Responses of the Copepods Calanus

Helgolandicus and Temora Longicornis to Dinoflagellate Diets, J Mar Biol Assoc UK

67: 785–801.

Glasgow, H. B. J., Burkholder, J. M., Schmechel, D. E., Tester, P. A. and Rublee, P. A.,

1995, Insidious Effects of a Toxic Estuarine Dinoflagellate on Fish Survival and Human

Health, J Toxicol Environ Health 46: 501– 522.

Gleibs, S., Mebs, D. and Werding, B., 1995, Studies on the Origin and Distribution of

Palytoxin in a Caribbean Coral Reef, Toxicon 33: 1531–1537.

Goldin, A. L., Barchi, R. L., Caldwell, J. H., Hofmann, F., Howe, J. R., Hunter, J. C., Kallen,

R. G., Mandel, G., Meisler, M. H., Netter, Y. B., Noda, M., Tamkun, M. M., Waxman, S. G.,

Wood, J. N. and Catterall, W. A., 2000, Nomenclature of Voltage-Gated Sodium

Channels, Neuron 28: 365–368.

Gosselin, S., Fortier, L. and Gagné, J. A., 1989, Vulnerability of Marine Fish Larvae to the

Toxic Dinoflagellate Protogonyaulax Tamarensis, Mar Ecol Prog Ser 57: 1–10.

Grauer, F. H. and Arnold, H. L., 1961, Seaweed Dermatitis: First Report of Dermatitis-

Producing Marine Algae, Arch Dermatol 84: 720–732.

Gulland, F., 2000, Domoic Acid Toxicity in California Sea Lions (Zalophus Californianus)

Stranded Along the Central California Coast, May-October 1998, NOAA Technical

Memorandum, NMFS-OPR-17, 45 pp.

Gunter, G., Williams, R. H., Davis, C. C. and Smith, F. G. W., 1948, Catastrophic Mass

Mortality of Marine Animals and Coincident Phytoplankton Bloom on the West Coast of

Florida, November 1946 to August 1947, Ecological Monographs 18: 309–324.

Gusovsky, F., Yasumoto, T. and Daly, J. W., 1989, Calcium-Dependent Effects of Maito-

toxin on Phosphoinositide Breakdown and on Cyclic Amp Accumulation in Pc12 and

Ncb-20 Cells, Mol. Pharmacol 36: 44–53.

Gusovsky, F. and Daly, J. W., 1990, Maitotoxin: A Unique Pharmacological Tool for

Research on Calcium-Dependent Mechanisms, Biochem Pharmacol 39: 1633–1639.

Habermehl, G. G., Krebs, H. C., Rasoanaivo, P. and Ramialiharisoa, A., 1994, Severe

Ciguatera Poisoning in Madagascar: A Case Report, Toxicon 32: 1539–1542.

Hallegraeff, G. M., 1993, A Review of Harmful Algal Blooms and Their Apparent Global

Increase, Phycologia 32: 79–99.

Halstead, B., 1970, Poisonous and Venomous Marine Aminals of the World, List of Marine

Turtles Reported as Poisonous, N.J. Darwin Press, Princeton.

Haulena, M. and Heath, R. B., 2001, Marine Mammal Anesthesia, in: Crc Handbook of

Marine Mammal Medicine, L. Dierauf and F. Gulland, CRC Press. Ohio, pp. 655–688.

Haya, K., Martin, J. L., Waiwood, B. A., Burridge, L. E., Hungerford, J. and Zitko, V., 1989,

Identification of Paralytic Shellfish Toxins in Mackerel from Southwest Bay of Fundy,

Canada, in: 4th Int Conf Toxic Marine Phytoplankton. Lund, Sweden, pp. 45–46.

Hayashi, T., Shimizu, Y. and White, A. W., 1982, Toxin Profile of Herbivorous Zooplankton

During a Gonyaulax Bloom in the Bay of Fundy, Bull Jap Soc Sci Fish 48: 1673.

A. ZACCARONI AND D. SCARAVELLI

150

Hernandez, M., Robinson, I., Aguilar, A., Gonzalez, L. M., Lopez-Jurado, L. F., Reyero, M. I.,

Cacho, E., Franco, J., Lopez-Rodas, V. and Costas, E., 1998, Did Algal Toxins Cause

Monk Seal Mortality?, Nature 393: 28–29.

Hescheler, J., Mieskes, G., Rüegg, J. C., Takai, A. and Trautwein, W., 1988, Effects of a

Protein Phosphatase Inhibitor, Okadaic Acid, on Membrane Currents of Isolated Guinea-

Pig Cardiac Myocytes, Pflügers Archiv European Journal Physiology 412: 248–252.

Hines, H. B., Naseem, S. M. and Wannemacher, R. W., 1993,

h-Saxitoxinol Metabolism

and Elimination in the Rat, Toxicon 31: 905–908.

Hirata, Y., Uemura, D., Ueda, K. and Takano, S., 1979, Several Compounds from Palythoa

Tuberculosa (Coelenterata), Pure Appl. Chem. 51: 1875–1883.

Holmes, M. J., Lewis, R. J., Jones, A. and Hoy, A. W., 1995, Cooliatoxin, the First Toxin

from Coolia Monotis (Dinophyceae), Nat. Toxins 3: 355–362.

Honkanen, R. E., Codispoti, B. A., Tse, K., Boynton, A. L. and Honkanan, R. E., 1994,

Characterization of Natural Toxins with Inhibitory Activity against Serine/Threonine

Protein Phosphatases, Toxicon 32: 339–350.

Hori, M., Matsuura, Y., Yoshimoto, R., Ozaki, H., Yasumoto, T. and Karaki, H., 1999, Actin

Depolymerizing Action by Marine Toxin, Pectenotoxin-2, Nippon Yakurigaku Zasshi

114: 225P–229P.

Hu, T., Curtis, J. M., Oshima, Y., Quilliam, M. A., Walter, J. A., Watson-Wright, W. M. and

Wright, J. L. C., 1995a, Spirolides B and D, Two Novel Macrocycles Isolated from the

Digestive Glands of Shellfish, Journal of the Chemical Society, Chemical Communi-

cations 1995: 2159–2161.

Hu, T., Curtis, J. M., Walter, J. A., McLachlan, J. L. and Wright, J. L. C., 1995b, Two New

Water-Soluble Dsp Toxin Derivatives from the Dinoflagellate Prorocentrum Macu-

losum: Possible Storage and Excretion Products, Tetrahedron Letters 36: 9273–9276.

Hu, T., Curtis, J. M., Walter, J. A. and Wright, J. L. C., 1995c, Identification of Dtx-4, a

New Water-Soluble Phosphatase Inhibitor from the Toxic Dinoflagellate Prorocentrum

Lima, J Chem Soc, Chem Commun 1995: 597–599.

Hu, T., Curtis, J. M., Walter, J. A. and Wright, J. L. C., 1996a, Characterization of

Biologically Inactive Spirolides E and F: Identification of the Spirolide Pharmacophore,

tetrahedron Letters 37: 7671–7674.

Hu, T., DeFreitas, A. S. W., Curtis, J. M., Oshima, Y., Walter, J. A. and Wright, J. L. C.,

1996b, Isolation and Structure of Prorocentrolide B, a Fast-Acting Toxin from Proro-

centrum Maculosum, J Nat Prod 59: 1010–1014.

Huang, J. M., Wu, C. H. and Baden, D. G., 1984, Depolarizing Action of a Red-Tide

Dinoflagellate Brevetoxin on Axonal Membranes, J Pharmacol Exp Ther 229: 615–621.

Huntley, M., Sykes, P., Rohan, S. and Marin, V., 1986, Chemically-Mediated Rejection of

Dinoflagellate Prey by the Copepods Calanus Pacificus and Paracalanus Parvus:

Mechanism, Occurrence and Significance, Mar Ecol Prog Ser 28: 105–120.

Ito, E. and Nagai, H., 1998, Morphological Observations of Diarrhea in Mice Caused by

Aplysiatoxin, the Causative Agent of the Red Alga Gracilaria Coronopifolia Poisoning

in Hawaii, Toxicon 36: 1913–1920.

Ito, E. and Nagai, H., 2000, Bleeding from the Small Intestine Caused by Aplysiatoxin, the

Causative Agent of the Red Alga Gracilaria Coronopifolia Poisoning, Toxicon 38:

123–132.

Haystead, T. A. J., Sim, A. T. R., Carling, D., Honnor, R. C., Tsukitani, Y., Cohen, P. and

Hardie, D. G., 1989, Effects of the Tumour Promoter Okadaic Acid on Intracellular

Protein Phosphorylation and Metabolism, Nature 337: 78–81.

SEA WATER TOXINS

151

Ives, J. D., 1985, The Relationship between Gonyaulax Tamarensis Cell Toxin Levels and

Copepod Ingestion Rates, in: Toxic Dinoflagellates, D. M. Anderson, A. W. White and

D. G. Baden, Elsevier. New York, pp. 413–418.

Ives, J. D., 1987, Possible Mechanisms Underlying Copepod Grazing Responses to Levels of

Toxicity in Red Tide Dinoflagellates, J Exp Mar Biol Ecol 112: 131–145.

Izumi, A. K. and Moore, R. E., 1987, Seaweed (Lyngbya Majuscula) Dermatitis, Clin

Dermatol 5: 92–100.

Jeglitsch, G., Rein, K., Baden, D. G. and Adams, D. J., 1998, Brevetoxin-3 (Pbtx-3) and Its

Derivatives Modulate Single Tetrodotoxin-Sensitive Sodium Channels in Rat Sensory

Neurons, J Pharmacol Exp Ther 284: 516–525.

Johnson, J., 2002. Tetrodotoxin, http://www.chm.bris.ac.uk/motm/ttx/ttx.htm.

Kao, C. Y., 1986, Structure-Activity Relations of Tetrodotoxin, Saxitoxin, and Analogues,

Ann NY Acad Sci 479: 52–67.

Kat, M., 1983, Dinophysis Acuminata Blooms in the Dutch Coastal Area Related to

Diarrhetic Mussel Poisoning in the Dutch Waddensea, Sarsia 68: 81–84.

Kayser, H., 1979, Growth Interactions between Marine Dinoflagellates in Multispecies

Culture Experiments, Mar Biol 52: 357–369.

Kvitek, R. G. and Beitler, M. K., 1991, Relative Insensitivity of Butter Clam Neurons to

Saxitoxin: A Pre-Adaptation for Sequestering Paralytic Shellfish Poisoning Toxins as a

Chemical Def Ense, Mar Ecol Prog Ser 69: 47–54.

Kvitek, R. G., DeGange, A. R. and Beitler, M. K., 1991, Paralytic Shellfish Poisoning

Toxins Mediate Feeding Behavior in Otters, Limnol Oceanogr 36: 393–404.

Landsberg, J. H., 1996, Neoplasia and Biotoxins in Bivalves: Is There a Connection?, J

Shellfish Res 15: 203–230.

Landsberg, J. H. and Steidinger, K. A., 1998, A Historical Review of Gymnodinium Breve

Red Tides Implicated in Mass Mortalities of the Manatee (Trichechus Manatus

Latirostris) in Florida, USA, in: Proc. 8th Int Conf Harmful Algae, B. Reguera, J.

Blanco, M. Fernandez and T. Wyatt, Xunta de Galicia-IOC/Unesco. Vigo, Spain, pp.

97–100.

Landsberg, J. H., Balazs, G. H., Steidinger, K. A., Baden, D. G., Work, T. M. and Russel, D. J.,

1999, The Potential Role of Natural Tumor Promotors in Marine Turtle Fibro-

papillomatosis, J Aquat Anim Health 11: 199–210.

Lange, S., Andersson, G. L., Jennische, E., Loennroth, I., Li, X. P. and Edebo, L., 1990,

Okadaic Acid Produces Drastic Histopathologic Changes of the Rat Intestinal Mucosa

and with Concomitant Hypersecretion, in: Toxic Marine Phytoplankton, E. Granéli,

B. Sundstrom, L. Edler and D. M. Anderson, Elsevier. New York, pp. 356–361.

Larm, J. A., Beart, P. M. and Cheung, N. S., 1997, Neurotoxin Domoic Acid Produces

Cytotoxicity Via Kainate-and Ampa-Sensitive Receptors in Cultured Cortical Neurones,

Neurochemistry International 31: 677–682.

Lawrence, D. N., Enriquez, M. B., Lumish, R. M. and Maceo, A., 1980, Ciguatera Fish

Poisoning in Miami, JAMA 244: 254–258.

Layne, J. N., 1965, Observations on Marine Mammals in Florida Waters, Bull Fl State Mus

9: 131–181.

Lee, J. S., Igarashi, T., Fraga, S., Dahl, E., Hovgaard, P. and Yasumoto, T., 1989,

Determination of Diarrhetic Shellfish Toxins in Various Dinoflagellate Species, Journal

Applied Phycology 1: 147–152.

Ito, E., Satake, M., Ofuji, K., Kurita, N., McMahon, T., James, K. and Yasumoto, T., 2000,

Multiple Organ Damage Caused by a New Toxin Azaspiracid, Isolated from Mussels

Produced in Ireland,

Toxicon 38: 917–930.

A. ZACCARONI AND D. SCARAVELLI

152

Lefebvre, K. A., Bargu, S., Kieckhefer, T. and Silver, M. W., 2002, From Sanddabs to Blue

Whales: The Pervasiveness of Domoic Acid, Toxicon 40: 971–977.

Levin, R. E., 1992, Paralytic Shellfish Toxins: Their Origins, Characteristics, and Methods

of Detection: A Review, J Food Biochem 15: 405–417.

Lewis, R. J. and Holmes, M. J., 1993, Origin and Transfer of Toxins Involved in Ciguatera,

Comp Biochem Physiol C 106: 615–628.

Lin, W., Lee, C., Yasumoto, T. and Chuang, D. M., 1990, Maitotoxin Induces Phosphoi-

nositide Turnover and Modulates Glutamatergic and Muscarinic Cholinergic Receptor

Function in Cultured Cereballar Neuron, Journal of neurochemistry 55: 1563–1568.

Lin, Y. Y., Risk, M., Ray, S. M., Van Engen, D., Clardy, J., Golik, J., James, J. C. and

Nakanishi, K., 1981, Isolation and Structure of Brevetoxin B from The “Red Tide”

Dinoflagellate Ptychodiscus Brevis (Gymnodinium Breve), Journal American Chemical

Society 103: 6773–6775.

Lombet, A., Bidard, J. N. and Lazdunski, M., 1987, Ciguatoxin and Brevetoxins Share a

Common Receptor Site on the Neuronal Voltage-Dependent Na? + ? Channel, FEBS

letters 219: 355–359.

Maclean, J. L., 1979, Indo-Pacific Red Tides, in: Toxic Dinoflagellates Blooms, Taylor

D. L., and Seliger H. H., Elsevier. New York, pp. 173–178.

Maclean, J. L., 1989, Indo-Pacific Red Tides, 1985–1988, Mar Pollut Bull 20: 304–310.

Mahnir, V. M. and Kozlovskaja, E. J., 1992, Isolation of Palytoxin from the Sea Anemone

Radianthus Macrodactylus, Bioorg. Chim 18: 751–752.

Marcaillou-Le Baut, C., Krys, S. and Bourdeau, P., 2001, Syndromes Observés Et Données

Épidémiologiques, in: Toxines D’algues Dans L’alimentation, J. M. Frémy and P. Lassus,

Ifremer, pp. 371–399.

Marshall, H. G., Gordon, A. S., Seaborn, D. W., Dyer, B., Dunstan, W. M. and Seaborn, A. M.,

2000, Comparative Culture and Toxicity Studies between the Toxic Dinoflagellate

Pfiesteria Piscicida and a Morphologically Similar Cryptoperidiniopsoid Dinoflagellate,

J Exp Mar Biol Ecol 255: 51– 74.

Marshall, K. L. and Vogt, R. L., 1998, Illness Associated with Eating Seaweed, Hawaii,

1994, West J Med 169: 293–295.

Mase, B., Jones, W., Ewing, R., Bossart, G., Van Dolah, F., Leighfield, T., Busman, M.,

Litz, J., Roberts, B. and Rowles, T., 2000, Epizootic in Bottlenose Dolphins in the

Florida Panhandle: 1999–2000, Proc Am Ass Zoo Vet and Intern Ass Aquat Anim Med

Joint Conf, New Orleans, 522–525.

McFarren, E. F., Silva, F. J., Tanabe, H., Wilson, W. B., Campbell, J. E. and Lewis, K. H.,

1965, The Occurrence of a Ciguatera-Like Poison in Oysters, Clams, and Gymnodinium

Breve Cultures, Toxicon 3: 111–123.

McMahon, T. and Silke, J., 1998, Re-Occurrence of Winter Toxicity, Harmful Algae News

17: 12.

Meucci, O., Maurizio, G., Scorziello, A., Govoni, S., Bergamaschi, S., Yasumoto, T. and

Schettini, G., 1992, Maitotoxin-Induced Intracellular Calcium Rise in Pc12 Cells:

Involvement of Dihydropyridinesensitive and-Conotoxin-Sensitive Calcium Channels

and Phosphoinositide Breakdown, J Neurochem 59: 679–688.

Lefebvre, K. A., Powell, C. L., Busman, M., Doucette, G. J., Moeller, P. D. R., Silver, J. B.,

Miller, P. E., Hughes, M. P., Singaram, S. and Silver, M. W., 1999, Detection of Domoic

Acid in Northern Anchovies and California Sea Lions Associated with an Unusual

Mortality Event, Nat. Toxins 7: 85–92.

SEA WATER TOXINS

153

Miles, C. O., Hawkes, A. D., Mackenzie, A. L., Munday, R., Towers, N. R. and Prinsep, M. R.,

1999, Chemistry and Toxicity of Gymnodine, in: 12th Marine Biotoxin Science

WorkshopMinistry of Agriculture and Forestry. Wellington, New Zealand, pp. 94–98.

Mironov, S. L. and Lux, H. D., 1991, Calmodulin Antagonists and Protein Phosphatase

Inhibitor Okadaic Acid Fasten the Run-up of High-Voltage Activated Calcium Current in

Rat Hippocampal Neurones, Neuroscience letters 133: 175–178.

Moeller, P., Morton, S., Mitchell, B., Sivertsen, S., Fairey, E., Mikulski, T., Glasgow, H. J.,

Deamer-Melia, N., Burkholder, J. and Ramsdell, J. S., 2001, Current Progress in

Isolation and Characterization of Toxins Isolated from Pfiesteria, Environ Health

Perspect 109: 739–743.

Molgo, J., Comella, J. X. and Legrand, A. M., 1990, Ciguatoxin Enhances Quantal

Transmitter Release from Frog Motor Nerve Terminals, Br J Pharmacol 99: 695–700.

Molgo, J., Comella, J. X., Shimahara, T. and Legrand, A. M., 1991, Tetrodotoxin-Sensitive

Ciguatoxin Effects on Quantal Release, Synaptic Vesicle Depletion, and Calcium

Mobilization, Ann NY Acad Sci 635: 485–488.

Molgo, J., Shimahara, T. and Legrand, A. M., 1993, Ciguatoxin, Extracted from Poisonous

Morays Eels, Causes Sodium-Dependent Calcium Mobilization in Ng108-15 Neuro-

blastoma X Glioma Hybrid Cells, Neurosci Lett 158: 147–150.

Molgò, J., Benoit, E., Legrand, A. M. and Kreger, A. S., 1997, Bioactive Agents Involved in

Fish Poisoning:An Overview, in: Proc. 5th Indo-Pacific Fish Conf Soc Fr Ichtyol.

Noumea, New Caledonia, pp. 721–738.

Moore, R. E. and Scheuer, P. J., 1971, Palytoxin: A New Marine Toxin from a Coelenterate,

Science 172: 495–498.

Moriya, T., Ishida, Y., Nakamura, H., Asari, T., Murai, A. and Ohizumi, Y., 1998,

Vasoconstriction Induced by Zooxanthellatoxin-B, a Polyoxygenated Long-Chain Pro-

duct from a Marine Alga, European Journal Pharmacology 350: 59–65.

Morris, P. D., 1991, Clinical and Epidemiological Features of Neurotoxic Shellfish Poi-

soning in North Carolina, Am Public Health Assoc 81: 471–474.

Morton, S. L. and Tindall, D. R., 1995, Morphological and Biochemical Variability of the

Toxic Dinoflagellate Prorocentrum Lima Isolated from Three Locations at Heron Island,

Australia, J Phycol 31: 914–921.

Mynderse, J. S., Moore, R. E., Kashiwagi, M. and Norton, T. R., 1977, Antileukemia

Activity in the Osillatoriaceae: Isolation of Debromoaplysiatoxin from Lyngbya, Science

196: 538–540.

Nagai, H., Satake, M. and Yasumoto, T., 1990, Antimicrobial Activities of Polyether

Compounds of Dinoflagellate Origins, J Appl Microbiol 2: 305–308.

Nagai, H., Mikami, Y., Yazawa, K., Gonoi, T. and Yasumoto, T., 1993, Biological Activities

of Novel Polyether Antifungals, Gambieric Acids a and B from a Marine Dinoflagellate

Gambierdiscus Toxicus, J Antibiot 46: 520–522.

Nakamura, M., Oshima, Y. and Yasumoto, T., 1984, Occurrence of Saxitoxin in Puffer Fish,

Toxicon 22: 381–385.

Neumann, J., Boknik, P., Herzig, S., Schmitz, W., Scholz, H., Gupta, R. C. and Watanabe,

A. M., 1993, Evidence for Physiological Functions of Protein Phosphatases in the Heart:

Evaluation with Okadaic Acid, American Journal Physiology 265: 257–266.

Meunier, F. A., Colasante, C. and Molgo, J., 1997, Sodium-Dependent Increase in Quantal

Secretion Induced by Brevetoxin-3 in Ca2

-Free Medium Is Associated with Depletion

of Synaptic Vesicles and Swelling of Motor Nerve Terminals in Situ, Neuroscience 78:

883–893.

A. ZACCARONI AND D. SCARAVELLI

154

Ofuji, K., Satake, M., McMahon, T., Silke, J., James, K. J., Naoki, H., Oshima, Y. and

Yasumoto, T., 1999, Two Analogs of Azaspiracid Isolated from Mussels, Mytilus Edulis,

Involved in Human Intoxication in Ireland, Nat. Toxins 7: 99–102.

Osborne, N. J. T., Webb, P. M., Moore, M. R. and Shaw, G. R., 2001a, Environmental

Toxicology of the Cyanobacterium Lyngbya Ssp., Toxicol Ind Health. 164: 203.

Osborne, N. J. T., Webb, P. M. and Shaw, G. R., 2001b, The Toxins of Lyngbya Majuscula

and Their Human and Ecological Health Effects, Environ Int 27: 381–392.

Oshima, Y., Kotaki, Y., Harada, T. and Yasumoto, T., 1984, Paralytic Shellfish Toxins in

Tropical Waters, in: Seafood Toxins, E. Ragelis, Amer Chem Soc. Washington DC, p

161–170.

Osterhaus, A., Groen, J., Niesters, H., van de Bildt, M., Martina, B., Vedder, L., Vos, J., van

Egmond, H., Abou-Sidi, B. and Barham, M. E., 1997, Morbillivirus in Monk Seal Mass

Mortality, Nature 388: 838–839.

Osterhaus, A., van de Bildt, M., Vedder, L., Martina, B., Niesters, H., Vos, J., van Egmond, H.,

Liem, D., Baumann, R. and Androukaki, E., 1998, Monk Seal Mortality: Virus or

Toxin?, Vaccine 16: 979–981.

Ozaki, H. and Haraki, H., 1989, Effect of Marine Sponge Toxin, Okadaic Acid, on Smooth

Muscle Contractility, in: Mycotoxins and Phycotoxins, S. Natori, K. Hashimoto and

Y. Ueno, Elsevier. Amsterdam, pp. 445–452.

Palafox, N. A., Jain, L. G., Pinano, A. Z., Gulick, T. M., Williams, R. K. and Schatz, I. J.,

1988, Successful Treatment of Ciguatera Fish Poisoning with Intravenous Mannitol,

JAMA 259: 2740–2742.

Patyten, M., 1999, Alaskan Sea Otters and Toxic Algae Blooms: Researching Marine

Predator-Prey Interactions, J Young Invest 1: 1–6.

Paul, G. K., 1997, Chemical Structures of Amphidinols 5 and 6 Isolated from Marine

Dinoflagellate Amphidinium Klebsii and Their Cholesterol-Dependent Membrane Dis-

ruption, J Mar Biotechnol 5: 124–128.

Pearce, R., Hines Jr, C., Burns, T. W. and Clark, C. E., 1983, Ciguatera (Fish Poisoning),

South Med J 76: 560–561.

Pierce, R. H., 1986, Red Tide (Ptychodiscus Brevis) Toxin Aerosols: A Review, Toxicon 24:

955–965.

Poli, M. A., Mende, T. J. and Baden, D. G., 1986, Brevetoxins, Unique Activators of

Voltage-Sensitive Sodium Channels, Bind to Specific Sites in Rat Brain Synaptosomes,

Molecular Pharmacology 30: 129–135.

Puiseaux-Dao, S., Molgò, J., Benoit, E., Fessard, V., Puech, L. and Ten-Hage, L., 2001,

Toxicologie, in: Toxines D’algues Dans L’alimentation, J. M. Frémy and P. Lassus,

Ifremer, pp. 302–367.

Quilliam, M. A., 1998, General Referee Reports. Committee on Natural Toxins. Phyco-

toxins., J AOAC Int 81: 142–151.

Quintela, B. A., Durán, R. and Alfonso, M., 2000, Mediation of Ionotropic Glutamate

Receptors in Domoic Acid-Induced Striatal Dopamine Release in Rats, European

Journal Pharmacology 401: 173–177.

Nisbet, I. C., 1983, Paralytic Shellfish Poisoning: Effects on Breeding Terns, Condor 85:

338–345.

O’Shea, T. J., Rathburn, G. B. and Bonde, R. K., 1991, An Epizootic of Florida Manatees

Associated with a Dinoflagellate Bloom, Marine Mammal Science

7: 165–179.

SEA WATER TOXINS

155

Rho, M. C., Nakahata, N., Nakamura, H., Murai, A. and Ohizumi, Y., 1995, Activation of

Rabbit Platelets by Ca

Influx and Thromboxane A2 Release in an External Ca

(2+)

Dependent Manner by Zooxanthellatoxin-a, a Novel Polyol, Br J Pharmacol 115: 433–440.

Rho, M. C., Nakahata, N., Nakamura, H., Murai, A. and Ohizumi, Y., 1997, Involvement of

Phospholipase C-Gamma 2 in Activation of Mitogen-Activated Protein Kinase and

Phospholipase A2 by Zooxanthellatoxin-a in Rabbit Platelets, Journal Pharmacology

Experimental Therapeutics 282: 496.

Ridgway, S. H. and McCormick, J. G., 1971, Anesthesia of the Porpoise, in: Textbook of

Veterinary Anesthesia L. R. Soma, Williams and Wilkinson. Baltimore, pp. 394–403.

Ritchie, K. B., Nagelkerken, I., James, S. and Smith, G. W., 2000, A Tetrodotoxin-Producing

Marine Pathogen, Nature 404: 354.

Samet, J., Bignami, G. S., Feldman, R., Hawkins, W., Neff, J. and Smayda, T., 2001,

Pfiesteria: Review of the Science and Identification of Research Gaps. Report for the

National Center for Environmental Health, Centers for Disease Control and Prevention,

Environmental Health Perspectives Supplements 109: 639–659.

Sasaki, K., Wright, J. L. and Yasumoto, T., 1998, Identification and Characterization of

Pectenotoxin (Ptx) 4 and Ptx7 as Spiroketal Stereoisomers of Two Previously Reported

Pectenotoxins, J Org Chem 63: 2475–2480.

Satake, M., MacKenzie, L. and Yasumoto, T., 1997a, Identification of Protoceratium

Reticulatum as the Biogenetic Origin of Yessotoxin, Nat. Toxins 5: 164–167.

Satake, M., Tubaro, A., Lee, J. S. and Yasumoto, T., 1997b, Two New Analogs of

Yessotoxin, Homoyessotoxin and 45-Hydroxyhomoyessotoxin, Isolated from Mussels of

the Adriatic Sea, Nat. Toxins 5: 107–110.

Satake, M., Ofuji, K., James, K. J., Furey, A. and T., Yasumoto, 1998, New Toxic Event

Caused by Irish Mussels, in: Proc 8th Int Conf Harmful Algae, Reguera B., Blanco, J.

Fernandez M. and T. Wyatt, Xunta de Galicia-IOC/Unesco. Vigo, Spain, p 468–469.

Sawa, T., Sasaoka, T., Hirai, H., Ishihara, H., Ishiki, M., Wada, T. and Kobayashi, M., 1999,

Intracellular Signalling Pathways of Okadaic Acid Leading to Mitogenesis in Rat1 Fibro-

blast Overexpressing Insulin Receptors Okadaic Acid Regulates Shc Phosphorylation by

Mechanisms Independent of Insulin, Cellular Signalling 11: 797–803.

Scheuer, P. J., 1990, Some Marine Ecological Phenomena: Chemical Basis and Biomedical

Potential, Science 248: 173–177.

Scheuer, P. J., 1996, Marine Toxin Research- an Historical Overview, J Nat Toxins 5: 181–189.

Scholin, C. A., Gulland, F., Doucette, G. J., Benson, S., Busman, M., Chavez, F. P., Cordaro, J.,

DeLong, R., De Vogelaere, A., Harvey, J., Haulena, M., Lefebvre, K., Lipscomb, T.,

Loscutoff, S., Lowenstine, L. J., Marin Iii, R., Miller, P. E., McLellan, W. A., Moeller,

P. D. R., Powell, C. L., Rowles, T., Silvagni, P., Silver, M., Spraker, T., Trainer, V. and

Van Dolah, F. M., 2000, Mortality of Sea Lions Along the Central California Coast

Linked to a Toxic Diatom Bloom, Nature 403: 80–84.

Quod, J. P., Ten-Hage, L., Molgò, J., Benoit, E., Turquet, J. and Bourdeau, P., 2001, La

Singularité Des Phycotoxines Par Rapport Aux Autres Toxines Marines, in: Toxines

D’algues Dans L’alimentation, J. M. Frémy and P. Lassus, Ifremer, pp. 231–247.

Rausch de Traubenberg, C. and Morlaix, M., 1995, Evidence of Okadaic Acid Release into

Extracellular Medium in Cultures of Prorocentrum Lima (Ehrenberg) Dodge, in: Harm-

ful Marine Algal Blooms, P. Lassus, G. Arzul, E. Erard-Le Denn, P. Gentien and C.

Marcaillou-Le Baut, Lavoisier-Intercept Ltd. Paris, pp. 493–498.

A. ZACCARONI AND D. SCARAVELLI

156

Black Sponge, on Isolated Smooth Muscles under the Condition of Ca Deficiency,

J Pharmacol Exp Ther 223: 135–143.

Shimitzu, Y., 1996, Microalgal Metabolites: A New Perspective, Annu Rev Microbiol 50:

431–465.

Silvagni, P. A., Lowenstine, L. J., Spraker, T., Lipscomb, T. P. and Gulland, F. M. D., 2005,

Pathology of Domoic Acid Toxicity in California Sea Lions (Zalophus Californianus),

Veterinary Pathology 42: 184–191.

Sladeczek, F., Schmidt, B. H., Alonso, R., Vian, L., Tep, A., Yasumoto, T., Cory, R. N. and

Bockaert, J., 1988, New Insights into Maitotoxin Action, FEBS Journal 174: 663–670.

Smayda, T. J., 1990, Novel and Nuisance Phytoplankton Blooms in the Sea: Evidence for a

Global Epidemic, in: Toxic Marine Phytoplankton, E. Graneli, B. Sundstrom, L. Edler

and D. M. Anderson, Elsevier. New York, pp. 29–40.

Smayda, T. J., 1997, Harmful Algal Blooms: Their Ecophysiology and General Relevance to

Phytoplankton Blooms in the Sea, Limnol Oceanogr 42: 1137–1153.

Solomon, A. E. and Stoughton, R. B., 1978, Dermatitis from Purified Sea Algae Toxin

(Debromoaplysiatoxin), Arch Dermatol 114: 1333–1335.

Sugg, L. M. and Van Dolah, F. M., 1999, No Evidence for an Allelopathic Role of Okadaic

Acid among Ciguatera-Associated Dinoflagellates, J Phycol 35: 93–103.

Suzuki, T., Mitsuya, T., Matsubara, H. and Yamasaki, M., 1998, Determination of Pecte-

notoxin-2 after Solid-Phase Extraction from Seawater and from the Dinoflagellate

Dinophysis Fortii by Liquid Chromatography with Electrospray Mass Spectrometry and

Ultraviolet Detection: Evidence of Oxidation of Pectenotoxin-2 to Pectenotoxin-6 in

Scallops, Journal Chromatography A 815: 155–160.

Suzuki, T., Mackenzie, L., Stirling, D. and Adamson, J., 2001, Pectenotoxin-2 Seco Acid: A

Toxin Converted from Pectenotoxin-2 by the New Zealand Greenshell Mussel, Perna

Canaliculus, Toxicon 39: 507–514.

Sykes, P. F. and Huntley, M. E., 1987, Acute Physiological Reactions of Calanus Pacificus

to Selected Dinoflagellates: Direct Observations, Marine Biology 94: 19–24.

Takai, A., Sasaki, K., Nagai, H., Mieskes, G., Isobe, M., Isono, K. and Yasumoto, T., 1995,

Inhibition of Specific Binding of Okadaic Acid to Protein Phosphatase 2a by Micro-

cystin-Lr, Calyculin-a and Tautomycin: Method of Analysis of Interactions of Tight-

Binding Ligands with Target Protein, Biochem J. 306: 657–665.

Takemoto, T. and Daigo, K., 1958, Constituents of Chondria Armata Chemical Phar-

maceutical Bulletin 6: 578–580.

Terao, K., Ito, E., Yanagi, T. and Yasumoto, T., 1986, Histopathological Studies on

Experimental Marine Toxin Poisoning. 1. Ultrastructural Changes in the Small Intestine

and Liver of Suckling Mice Induced by Dinophysistoxin-1 and Pectenotoxin-1, Toxicon

24: 1141–1151.

Seki, T., Satake, M., Mackenzie, L., Kaspar, H. F. and Yasumoto, T., 1995, Gymnodimine, a

New Marine Toxin of Unprecedented Structure Isolated from New Zealand Oysters and

the Dinoflagellate, Gymnodinium Sp, Tetrahedron Letters 36: 7093–7096.

Serdula, M., Bartilini, G., Moore, R. E., Gooch, J. and Wiebenga, N., 1982, Seaweed Itch on

Windward Oahu, Hawaii Med J 41: 200–201.

Sheridan, R. E. and Adler, M., 1989, The Actions of a Red Tide Toxin from Ptychodiscus

Brevis on Single Sodium Channels in Mammalian Neuroblastoma Cells, FEBS Letters

247: 448–452.

Shibata, S., Ishida, Y., Kitano, H., Ohizumi, Y., Habon, J., Tsukitani, Y. and Kikuchi, H.,

1982, Contractile Effects of Okadaic Acid, a Novel Ionophore-Like Substance from

SEA WATER TOXINS

157

Conf Harmful Algae, B. Reguera, J. Blanco, M. Fernandez and T. Wyatt, Xunta de

Galicia-IOC/Unesco. Vigo, Spain, pp. 470–472.

Usami, M., Satake, M., Ishida, S., Inoue, A., Kan, Y. and Yasumoto, T., 1995, Palytoxin

Analogs from the Dinoflagellate Ostreopsis Siamensis, Journal American Chemical

Society 117: 5389–5390.

Uye, S. and Takamatsu, K., 1990, Feeding Interactions between Planktonic Copepods and

Red-Tide Flagellates from Japanese Coastal Waters, Mar Ecol Prog Ser 59: 97–107.

Van Dolah, F. M., 2000, Marine Algal Toxins: Origins, Health Effects, and Their Increased

Occurrence, Environ Health Perspect 108: 133–141.

Van Dolah, F. M., Doucette, G. J., Gulland, F. M. D., Rowlesand, T. L. and Bossart, G. D.,

2003, Impacts of Algal Toxins on Marine Mammals, in: Toxicology of Marine Mammals,

J. G. Vos, G. D. Bossart, M. Fournier and T. J. O’Shea, Taylor & Francis. London, New

york, pp. 247–269.

Van Egmond, H. P., Jonker, K. M., Poelman, M., Scherpenisse, P., Stern, A. G., Wezenbeek, P.,

Bergwerff, A. A. and Van den Top, H. J., 2004, Proficiency Studies on the Determi-

nation of Paralytic Shellfish Poisoning Toxins in Shellfish in the Netherlands, Food

Addit. Contam. 21: 331–340.

Vernoux, J. P., 1988, La Ciguatera Dans L’île De Saint-Barthélémy: Aspects Épidé-

miologiques, Toxicologiques Et Préventifs, Oceanologica acta 11: 37–46.

Walter, G. and Mumby, M., 1993, Protein Serine/Threonine Phosphatases and Cell Trans-

formation, Biochim Biophys Acta 1155: 207–226.

Wang, Y., Townsend, C. and Rosenberg, R. L., 1993, Regulation of Cardiac L-Type Ca

Channels in Planar Lipid Bilayers by G Proteins and Protein Phosphorylation, American

Journal Physiology 264: 1473–1479.

Watras, C. J., Garcon, V. C., Olson, R. J., Chisholm, S. W. and Anderson, D. M., 1985, The

Effect of Zooplankton Grazing on Estuarine Blooms of the Toxic Dinoflagellate

Gonyaulax Tamarensis, J Plankton Res 7: 891–908.

West, J. W., Patton, D. E., Scheuer, T., Wang, Y., Goldin, A. L. and Catterall, W. A., 1992,

A Cluster of Hydrophobic Amino Acid Residues Required for Fast Na (+)-Channel

Inactivation, Proc Natl Acad Sci USA 89: 10910–10914.

White, A. W., 1980, Recurrence of Kills of Atlantic Herring (Clupea Harengus Harengus)

Caused by Dinoflagellate Toxins Transferred through Herbivorous Zooplankton, Can J

Fish Aquat Sci 37: 2262–2265.

White, A. W., 1981, Marine Zooplankton Can Accumulate and Retain Dinoflagellate Toxins

and Cause Fish Kills, Limnology and Oceanography 26: 103–109.

White, A. W., 1984, Paralytic Shellfish Toxins and Finfish, in: Seafood Toxin, E. Ragelis,

pp. 171–180.

Tester, P. A., Stumpf, R. P., Vukovich, F. M., Fowler, P. K. and Turner, J. T., 1991, An

Expatriate Red Tide Bloom: Transport, Distribution, and Persistence, Limnol Oceanogr

36: 1053–1061.

Torigoe, K., Murata, M., Yasumoto, T. and Iwashita, T., 1988, Prorocentrolide, a Toxic

Nitrogenous Macrocycle from a Marine Dinoflagellate, Prorocentrum Lima, Journal

American Chemical Society 110

: 7876–7877.

Tripuraneni, J., Koutsouris, A., Pestic, L., De Lanerolle, P. and Hecht, G., 1997, The Toxin

of Diarrheic Shellfish Poisoning, Okadaic Acid, Increases Intestinal Epithelial Para-

cellular Permeability, Gastroenterology 112: 100–108.

Tubaro, A., Sidari, L., Della Loggia, R. and Yasumoto, T., 1998, Occurrence of Yessotoxin-

Like Toxins in Phytoplankton and Mussels from Northern Adriatic Sea, in: Proc 8th Int

A. ZACCARONI AND D. SCARAVELLI

158

A. D. Cembella and G. M. Hallegraeff, Springer-Verlag. Berlin, Heidelberg, pp. 427–

451.

Wyatt, T. and Jenkinson, K., 1997, Notes on Alexandrium Population Dynamics, J. Plankton

Res 19: 551–575.

perties of the Principal Water Soluble Toxin, Bulletin Japanese Society Scientific

Yasumoto, T. and Oshima, Y., 1979. Chemical Studies on Ciguatoxins and Other Toxins

Involved in Ciguatera, Progr Rep South Pacific Comm, 6 pp.

Yasumoto, T., Raj, U. and Bagnis, R., 1984, Seafood Poisonings in Tropical Regions,

Laboratory of Food Hygiene, Faculty of Agriculture, Tohoku University, Tohoku, 74 pp.

Yasumoto, T., Seino, N., Murakami, Y. and Murata, M., 1987, Toxins Produced by Benthic

Dinoflagellates, Biol Bull 172: 128–131.

Yasumoto, T., Murata, M., Lee, J. S. and Torigoe, K., 1989, Polyether Toxins Produced by

Dinoflagellates, in: Mycotoxins and Phycotoxins, S. Natori, K. Hashimoto and Y. Ueno,

Elsevier. Amsterdam, pp. 375–382.

Yasumoto, T., Satake, M., Onuma, Y. and Roux, J., 1997, Toxins Involved in Ciguatera,

Clupeotoxism, and Shark Poisoning, in: Proc. 5th Indo-Pacific Fish Conf Soc Fr Ichtyol.

Noumea, New Caledonia, 114 pp.

Yasumoto, T., 1998, Fish Poisoning Due to Toxins of Microalgal Origins in the Pacific,

Toxincon 36: 1515–1518.

Yasumoto, T. and Satake, M., 1998, New Toxins and Their Toxicological Evaluations, in:

Proc 8th Int Conf Harmful Algae, B. Reguera, J. Blanco, M. Fernandez and T. Wyatt,

Xunta de Galicia-IOC/Unesco. Vigo, Spain, pp. 461–464.

Yu, F. H. and Catterall, W. A., 2004 The Vgl-Chanome: A Protein Superfamily Specialized

for Electrical Signaling and Ionic Homeostasis, Sci STKE 253: re15.

Yuasa, H., Yoshida, K., Iwata, H., Nakanishi, H., Suganuma, M. and Tatematsu, M., 1994,

Increase of Labeling Indices in Gastrointestinal Mucosae of Mice and Rats by

Compounds of the Okadaic Acid Type, Journal Cancer Research Clinical Oncology

120: 208–212.

Zhou, J. and Fritz, L., 1994, Okadaic Acid Antibody Localizes to Chloroplasts in the Dsp-

Toxin-Producing Dinoflagellates Prorocentrum Lima and Prorocentrum Maculosum,

Phycologia 33: 455–461.

Windust, A. J., Wright, J. L. C. and McLachlan, J. L., 1996, The Effects of the Diarrhetic

Shellfish Poisoning Toxins, Okadaic Acid and Dinophysistoxin-1, on the Growth of

Microalgae, Mar Biol 126: 19–25.

Windust, A. J., Quilliam, M. A., Wright, J. L. C. and McLachlan, J. L., 1997, Comparative

Toxicity of the Diarrhetic Shellfish Poisons, Okadaic Acid, Okadaic Acid Diol-Ester and

Dinophysistoxin-4, to the Diatom Thalassiosira Weissflogii, Toxicon 35: 1591–1603.

Work, T. M., Barr, B., Beale, A. M., Fritz, L., Quilliam, M. A. and Wright, J. L. C., 1993,

Epidemiology of Domoic Acid Poisoning in Brown Pelicans (Pelecanus Occidentalis)

and Brandt’s Cormorants (Phalacrocorax Penicillatus) in California, J Zoo Wildl Med

24: 54–62.

Wright, J. L. C. and Cembella, A. D., 1998, Ecophysiology and Biosynthesis of Polyether

Marine Biotoxins, in: Physiological Ecology of Harmful Algal Blooms, D. M. Anderson,

Yasumoto, T., Bagnis, R. and Vernoux, J. P., 1976, Toxicity of the Surgeon Fishes-II: Pro-

Fisheries 42: 359–365.

V. Evangelista et al. (eds.), Algal Toxins: Nature, Occurrence, Effect and Detection. 159

THE ROLE OF ALLELOPATHY FOR HARMFUL ALGAE BLOOM

FORMATION

EDNA GRANÉLI*, PAULO S. SALOMON

University of Kalmar, Dept. of Marine Sciences, S-391 82

Kalmar, Sweden

GIOVANA O. FISTAROL

Dept. of Agriculture Engineering, UFSC, Florianópolis,

Brazil

algal species are able to kill not only their grazers but also other algal

species, a process called allelopathy. Killing the nutrient-competing phytop-

lankton species enable these species to freely utilize limiting resources such

as nitrogen and phosphorus. While for some algal species, like e.g. the

flagellate Prymnesium sp., the allelochemicals seem to be the same sub-

stances as their toxins, for some other algal species they are not. Alexandrium

spp. are among the latter case: their internal toxins (such as saxitoxins) are

not able to inhibit the growth of other algal species. However, these species

by producing other substances than their internal toxins also cause allelo-

pathic effects. Emphasis is placed here on the flagellate species Prymnesium

parvum; which is not only able of allelopathy but mixotrophy as well.

Mixotrophy, i.e. the capability to ingest bacteria, other algae and even poten-

tial grazers, also contributes to the bloom-forming ability of Prymnesium

spp. Allelopathy, mixotrophy and grazer deterrence increase dramatically

when Prymnesium spp. cells are grown under N or P deficiency, and so

does toxicity, but decrease in intensity or cease completely if cells are grown

with high amounts of N and P in balanced proportions. Prymnesium filtrates

from nutrient deficient cultures have almost the same strong effect on

grazers and other plankton cells as Prymnesium cells grown together with

their target. It seems that toxin production in Prymnesium spp. works not

only as a defense mechanism, but also, by killing competitors, improve the

algae competitive ability under conditions of severe nutrient depletion. We

______

*To whom correspondence should be addressed. Edna Graneli, University of Kalmar, Dept. of Marine

Sciences, S-391 82 Kalmar, Sweden. Email: edna.graneli@hik.se

Abstract: Strong evidence has accumulated on the last years that some

E. GRANÉLI, P. S. SALOMON AND G. O. FISTAROL

can assume thus that a consequence of the increased input of N and P to

aquatic ecosystems is provoking an unbalanced nutrient situation for

Prymnesium spp., as well as many of the other HAB species producing

toxins, to growth but ideal to produce toxins instead.

1. Defining Allelopathy

Harmful effects of plants on other plants or crops dates back at least 2

millennnia, while experimental work, testing allelopathy, started in the late

eighteenth century (Willis, 1985). Phytoplankton allelopathy was probably

first observed in 1917 by Harder (Inderjit and Dakshini, 1994) when he

reported auto-inhibition in the freshwater cyanobacteria Nostoc punctiforme.

In 1937 the term allelopathy was coined by Molisch (Rizvi et al., 1992) to

describe both detrimental and beneficial biochemical interaction between all

classes of plants (including microorganisms). The term has evolved since

then, including and excluding organisms. We propose to use a definition of

allelopathy that is based on Rice’s concept (Rice, 1984), but updating the

definition along with the taxonomic classification to: “any direct or indirect,

harmful or beneficial effect by plants, protists (e.g. microalga, ciliates),

bacteria, or viruses on another trough the production of chemical compounds

that leak into the environment”. Keating (1999) has also suggested using the

term allelochemistry, which we believe is more appropriate, since allelopathy

evokes only negative effects (pathos = to suffer). In this paper we use the

term allelopathy in the context of the negative/positive effect of allelo-

chemicals produced by certain algae on other algal groups/species; i.e.

grazer deterrence and or predator avoidance are not discussed. We consider

allelopathy as competition strategy, while grazer deterrence and or predator

avoidance are toxic effects.

2. Allelopathy in Aquatic Environments

Although phytoplankton allelopathy was observed nearly a 100 years ago

by Harder (Inderjit and Dakshini, 1994), only in recent years research on the

subject has gained momento (Fistarol et al., 2003; Granéli and Johansson,

2003; Gross, 2003; Legrand et al., 2003; Skovgaard et al., 2003; Fistarol

et al., 2004a, 2004b; Suikkanen et al., 2004; Kubanek et al., 2005; Granéli

and Pavia, 2006; Granéli and Hansen, 2006; Tillmann et al., 2007; Granéli

160

Keywords: HABs, allelopathy, phytoplankton, nutrients, toxins

and Weberg, 2008). It seems that the main reason for the increase in the

ALLELOPATHY IN HARMFUL ALGAE

interest on phytoplankton allelopathy isbecause most of the phytoplankton

species producing allelochemicals are harmful to the marine ecosystems

where they occur.

Harmful algal blooms (HABs) have increased worldwide in waters

ranging from fresh to coastal estuarine and marine waters (Anderson, 1989;

Smayda, 1990; Hallegraeff, 1993; Van Dolah, 2000), causing enormous

impacts in the aquatic ecosystems they occur (Maestrini and Granéli, 1981;

Granéli and Hansen, 2006). Fish kills are usually the first direct effect seen

from the impact of such blooms. The most deleterious impacts occur when

they affect entire ecosystems, causing death of phytoplankton, zooplankton

seaweeds, and shellfish. The toxins produced by such blooms are secondary

metabolites released in the water with capability to punctuate holes in the

cells membranes of the target. Blooms caused by high discharges of nitrogen

and phosphorus to the coastal areas, which produces high algal biomass that

when decomposing causes oxygen depletion in the water column and mostly

in the bottom waters, also cause devastating consequences to the benthic

community (Allen et al., 2006). However, the difference between these two

types of bloom affecting the aquatic ecosystems is that, in the first case, the

cause of the deleterious effect on the flora and fauna is the result of a direct

action of the chemicals liberated by the HA-species into the water on the

other organisms, and not oxygen deficiency provoked by the decomposing

bloom. It seems logical to assume that the effect on the entire ecosystem

from the action of released chemicals is a secondary effect, while the main

purpose of these chemicals would be to kill/inhibit the growth of the other

phytoplankton species competing with the HA-species (allelopathy) and also

to decrease losses by killing their grazers (grazer deterrence).

Both laboratory and filed work have demonstrated allelopathic effects of

several phytoplankton groups. Here we are going to discuss some of the

most important findings of the latest works, emphasizing the results of our

group, and also the allelopathic effect of the flagellate species Prymnesium

parvum which is not only able of allelopathy but mixotrophy as well.

3. Testing Allelopathy in Aquatic Systems

To mimic natural conditions when testing phytoplankton allelopathy, an

important detail that should be considered is the amount of allelochemicals

to which the target species will be exposed. This can be done by having the

allelopathic species at natural cell concentrations, and by exposing the target

organisms to a continuous addition allelochemicals. Experiments involving

just a single addition of allelopathic filtrate to a target species have de-

monstrated that the allelopathic effect may be lost some time after the

exposure, either due to the degradation of the chemicals by light or bacteria,

161

E. GRANÉLI, P. S. SALOMON AND G. O. FISTAROL

or the recovery of the target species (Gleason and Paulson, 1984; Windust

et al., 1997; Suikkanen et al., 2004; Fistarol et al., 2005). Several studies

demonstrated that the toxins produced by some microalgae (e.g. prymnesins

produced by Prymnesium parvum and nodularin produced by Nodularia)

can be inactivated, for example by light through photodynamic and/or pho-

tooxidative processes, and are sensitive to temperature (Reich and Parnas,

1962; Twist and Codd, 1997; Kvernstuen, 1993 cited in Larsen and Bryant,

1998; Fistarol et al., 2003). Some toxins can also be degraded by bacteria

(e.g. microcystin, Christoffersen et al., 2002, Hagström et al., 2007). The

same degradation processes could occur to allelochemicals. Alleloche-

micals may also be removed from the system by, for example, binding to

cell membranes (Tillmann, 2003). All these results indicate that alleloche-

micals are not persistent, and thus, one filtrate addition may not be rep-

resentative of natural conditions. Under natural conditions, allelochemicals are

presumably constantly released to the environment. Therefore, experiments

using repeated filtrate additions probably give a better representation of

natural conditions. In most studies on phytoplankton allelopathy, only one

filtration addition is usually employed, and thus the allelopathic effect may

have been underestimated. Repeated filtrate additions demonstrate an in-

crease in the allelopathic effect compared to one filtrate addition (Suikkanen

et al., 2004; Fistarol et al., 2005).

4. Allelochemicals – Which Substances are they?

The allelochemicals are for the great majority of the algal species unknown,

however some allelochemicals have been identified (see Table 1) (Granéli

and Weberg, in press). The strongest allelochemicals however, have hae-

molytic capacity, perforating holes on the cell membranes of other algal

species, as in the case of C. polylepis and P. parvum (Johansson and

Graneli, 1999a, 1999b; Schmidt and Hansen, 2001; Fistarol et al., 2003;

Fistarol et al., 2004a). As a consequence, there are associated fish-kills, as

the delicate gills cell membranes are affected as well by the action of the

haemolytic compounds (Igarashi et al., 1995, 1999). The majority of the

allelochemicals however, have a mild mode of action, as e.g. inhibition of

some known algal toxins (e.g. okadaic acid –OA, paralitic shelfish posion –

PSPs- toxins, nodularin) caused allelopathic effects have shown a negative

result, i.e. the algal toxins were not the compounds causing allelopathy

(Sugg and Van Dolah, 1999; Tillmann and John, 2002; Fistarol et al., 2003;

Suikkanen et al., 2004, 2006).

photosynthesis and growth (Legrand et al., 2003). Studies that have tested if

162

ALLELOPATHY IN HARMFUL ALGAE

TABLE 1. Allelopathic harmful algae species, their allelochemicals and allelopathic effect.

Species Allelochemicals

Reference

Bacillariophyceae

Pseudo-nitzschia pungens U (Legrand et al., 2003)

Skeletonema costatum U (Yamasaki et al., 2007)

Coscinodiscophyceae

Rhizosolenia alata U (Legrand et al., 2003)

Cyanophyceae

Anabaena sp. U (Suikkanen et al., 2005)

A. cylindrica EP (Legrand et al., 2003)

A. flos-aquae HX, A, M, U

(Murphy et al., 1976; Kearns and

Hunter, 2001; Legrand et al., 2003)

A. lemmermannii U (Suikkanen et al., 2004)

Aphanizomenon sp. U (Suikkanen et al., 2005)

A. flos-aquae U

(de Figueiredo et al., 2004; Suikkanen

et al., 2004; Suikkanen et al., 2006)

A. gracile U (Legrand et al., 2003)

Cylindrospermopsis

raciborskii

U (Figueredo et al., 2007)

Gomphosphaeria aponina U (Legrand et al., 2003)

Hapalosiphon fontinalis Hapalindole A (Moore et al., 1984)

Fischerella sp. U (Bagchi and Marwah, 1994)

Fischerella muscicola Fischerellin

(Gross et al., 1991; Legrand et al.,

2003)

Microcystis sp. U, Microcystin

(Sukenik et al., 2002; Vardi et al.,

2002)

Nodularia spumigena U

(Suikkanen et al., 2004; 2005;

Suikkanen et al., 2006)

Nostoc sp. U

(Schagerl et al., 2002; Legrand et al.,

2003)

Nostoc spongiaeforme Nostocine A (Hirata et al., 1996; Hirata et al., 2003)

Oscillatoria sp. FA (Chauhan et al., 1992)

Oscillatoria spp. U (Legrand et al., 2003)

Oscillatoria laetevirens U (Ray and Bagchi, 2001)

Dinophyceae

Alexandrium catenella U (Arzul et al., 1999)

A. minutum U

(Arzul et al., 1999; Fistarol et al.,

2004b)

163

(Continued)

E. GRANÉLI, P. S. SALOMON AND G. O. FISTAROL

Species Allelochemicals

Reference

A. ostenfeldii U (Tillmann et al., 2007)

A. tamarense U

(Arzul et al., 1999; Fistarol et al.,

2004a; Fistarol et al., 2004b; Wang

et al., 2006)

Amphidinium klebsii U (Sugg and VanDolah, 1999)

Ceratium sp. U (Legrand et al., 2003)

Coolia monotis U

(Sugg and VanDolah, 1999; Legrand

et al., 2003)

Gambierdiscus toxicus U (Sugg and VanDolah, 1999)

Karenia brevis

(Gymnodinium breve)

U (Kubanek et al., 2005)

K. mikimotoi

(Gymnodinium mikimotoi)

(Uchida et al., 1999; Fistarol et al.,

2004a)

Ostreopsis lenticularis U (Sugg and VanDolah, 1999)

Peridinium aciculiferum U (Rengefors and Legrand, 2001)

Prorocentrum lima U (Sugg and VanDolah, 1999)

Prymnesiophyceae

Chrysochromulina

polylepis

(Myklestad et al., 1995; Schmidt and

Hansen, 2001; Fistarol et al., 2004a)

Phaeocystis pouchetii U, PUA

(Hansen et al., 2004; Hansen and

Eilertsen, 2007; van Rijssel et al.,

2007)

Prymnesium parvum U, Prymnesin (Igarashi et al., 1998; Fistarol et al.,

2003; Granéli and Johansson, 2003;

Barreiro et al., 2005; Fistarol et al.,

2005)

Raphidophyceae

Chattonella antiqua U

(Matsuyama et al., 2000 cited in Gross,

2003)

Heterosigma akashiwo U

(Matsuyama et al., 2000 (cited in

Gross, 2003; Pratt, 1966; Yamasaki

et al., 2007)

a) A anatoxin, EP extracellular peptides, F fatty acids, HX hydroxamates chelators, M

microcystin, OA okadaic acid, PUA polyunsaturated aldehyde, U unknown. Source: Granéli

and Weberg, (in press)

5. Abiotic and Biotic Factors Regulating Allelopathy

Many abiotic and biotic factors have been investigated in the context of toxin

production, however, as allelopathy is a relatively new topic of research in

164

TABLE 1. (Cont.)

ALLELOPATHY IN HARMFUL ALGAE

aquatic ecosystems, fewer studies and information exists. There are to our

knowledge only a handful of published studies showing how the production

of an allelochemical is influenced by abiotic or biotic factors. This is no

surprise since most allelochemicals have not yet been isolated and struc-

turally determined (Table 1) (Granéli and Weberg, in press). Furthermore,

potentially allelopathic compounds have been characterized from intracellular

extracts but these cannot be regarded as a allelochemicals until a mode of

release into the surrounding environment and a correlation to allelopathic

effect have been shown (Willis, 1985). However, some work on factors

affecting allelopathic effects rather than quantifying the produced allelo-

chemicals has been done and are presented.

5.1. INFLUENCE OF ABIOTIC FACTORS

5.1.1. Light

Allelopathic compounds released by some phytoplankton species seem to be

effective only in a relative short time period. Cell-free filtrates of Prym-

nesium parvum added to cultures of Thalassiosira weissflogii, Rhodomonas

cf. baltica and Prorocentrum minimum had a great negative impact on cell

numbers, but within a few days the exposed species’ began to recover (Graneli

and Johansson, 2003; Suikkanen et al., 2004; Fistarol et al., 2005). How-

ever, when exposed to repeated additions of cell-free filtrate no recovery

was possible (Fistarol et al., 2003; Suikkanen et al., 2004; Fistarol et al.,

2005). Similar findings were observed for the dinoflagellate Scrippsiella

trochoidea which managed to recover from Alexandrium ostenfeldii exu-

dates (Tillmann et al., 2007). These findings suggest that one or several me-

chanisms reduce the allelopathic effect. Exposure from UV light at 255 nm

and visible light between 400 and <520 nm completely inactivated extra-

cellular ichthyotoxins from P. parvum within 90 min (Parnas et al., 1962).

activity when incubated at higher light intensities (van Rijssel et al., 2007),

thus showing a positive stimulation from light.

5.1.2. Temperature

Not much is known how changes in temperature affect phytoplankton al-

lelopathy. An example is that the haemolytic activity of Phaeocystis

pouchetii increased in higher temperatures going from 4°C to 15°C (van

Rijssel et al., 2007). On the other hand, raising the culturing temperature

from 14°C to 20°C of Alexandrium tamarense gave no difference in allelo-

pathic effect to Scrippsiella trochoidea or Heterocapsa triquetra (Fistarol

et al., 2004a).

Another prymnesiophyte, Phaeocystis pouchetii, enhanced its haemolytic

165

E. GRANÉLI, P. S. SALOMON AND G. O. FISTAROL

5.1.3. pH

Coastal surface waters may reach high pH levels (Pegler and Kempe, 1988;

Emery, 1969 cited in Hinga, 1992, Hansen, 2002) and the high pH can be

confounded with the effect seen from allelopathic interactions. For exam-

ple, raised pH level reduced motility of the dinoflagellate H. triquetra when

mixed with low cell densities of C. polylepis (Schmidt and Hansen, 2001).

Increasing the pH from 8 to 9 resulted in more than double numbers of non-

motile H. triquetra cells. The toxicity of high-density cultures of C. polylepis

increased from pH 6.5 and leveled out at pH 8 rendering circa 90 percent of

the H. triquetra cells non-motile. So, in these studies the authors found that

high pH have a negative effect on the motility of H. triquetra, and together

with the allelochemicals increased allelopathy even further (Schmidt and

Hansen, 2001). Similar results have also been found for the freshwater

cyanobacterium Oscillatoria laetevirens, i.e. the production of algicides

almost four folded when pH was elevated from 8 to 9 and at neutral or

lower pH the algicide was found in lower concentrations (Ray and Bagschi,

2001).

5.1.4. Nutrients

Toxicity in phytoplankton usually increases under nutrient limitation

(Edvardsen et al., 1990; Reguera and Oshima, 1990; Granéli and Johansson,

2003; Granéli and Flynn, 2006). If the algae need nitrogen in their toxins (as

saxitoxins, nodularin, domoic acid e.g.), this will happen only under pho-

sphorus limitation (excess nitrogen in the medium). For the algae which

toxins do neither contain P nor N, toxicity increases under both P and

N limitation (Johansson and Granéli, 1999a, 1999b; Granéli and Flynn,

2006). This indicates that the motive behind the increased toxicity is

actually stress, for not having enough of the limiting nutrient to provide for

cell division.

There are very few studies on allelopathy in aquatic systems dealing

with nutrient limitation. Granéli and Johansson (2003) found that starved

Prymnesium parvum cells from N or P increased dramatically their pro-

duction of allelochemicals while and NP sufficient conditions allelopathy

was nearly nil. Thus, this results support the assumption that production of

allelochemicals by algae is similar to their production of toxins, i.e. physio-

logical stress is the cause for it.

The target species also respond differently to the allelochemicals if they

are grown under nutrient sufficient or deficient conditions. Thalassiosira

weissflogii grown under N and P limitation was significantly more sensitive

to Prymnesium parvum allelochemicals than when it was grown under

sufficient nutrient conditions. (Fistarol et al., 2005). Target organisms would

166

be sharing the same stress environment as the allelopathic species, and it

has been suggested that stress would make them more sensitive to allelo-

chemicals (Einhellig, 1995; Tang et al., 1995; Reigosa et al., 1999; Fistarol

et al., 2005; Granéli and Pavia, 2005; Granéli and Hansen, 2006). Thus,

under stress conditions the allelopathic effect may be higher due to both the

increase in the production of allelochemicals and in the sensitivity of the

target species, increasing the competitive advantaged of allelopathic algae.

5.2. INFLUENCE OF BIOTIC FACTORS

5.2.1. The organisms involved

The main factor influencing allelopathic interactions are the organisms in-

volved. The allelopathic effect depends on both the allelopathic (i.e. donor)

species and the target species (Figure 1). Usually, allelopathic species affect

several, but not all target species, and target species are sensitive to several,

but not to all allelochemicals (Fistarol et al., 2003; Fistarol et al., 2004;

Suikkanen et al., 2004; Fistarol et al., 2005). Furthermore, the allelopathic

effect also depends on the cell concentration of the donor and the target species

(Schmidt and Hansen, 2001; Tillmann and John, 2002; Tillmann, 2003).

The different effect of allelopathic species on different target organisms,

as well as the different responses of target organisms to allelochemicals

from different allelopathic algae are reported in Fistarol et al. (2003, 2004a

and 2005), Suikkanen et al. (2005). For example, in Fistarol et al. (2003 and

2004a), it was found that diatoms (in Figure 1, it could be, e.g. target 1)

can be highly inhibited by P. parvum (e.g. allelopathic species, AS, 1),

but they are only moderately inhibited by A. tamarense filtrate (e.g. AS 2).

A. tamarense, on the other hand, has a higher effect on nanoflagellates (e.g.

target 2) than on diatoms. The differentiated effect of allelopathic species

on different targets, as well as the resistance shown by some target species,

might have implications for the evolution of aquatic microalgae. Evolu-

tionary constrains will be discussed further along in the text.

Since allelopathy is mediated by chemicals released into the medium, its

effect depends on the cell concentration of the allelopathic organism. In-

creasing the allelopathic effect with increase in the cell concentrations has

been shown for some phytoplankton groups, e.g. prymnesiophytes, and dino-

flagellates (Schmidt and Hansen, 2001; Tillmann and John, 2002; Tillmann,

2003). Tillmann (2003) also demonstrated that an increase in the cell con-

centration of the target organism decreases the effect (in this case death of

Oxyrrhis marina). Since the death is caused by lysis of O. marina, the

author suggests that the toxic compounds are removed from the system

when they bind to the cell membrane of the target organism.

167

ALLELOPATHY IN HARMFUL ALGAE

E. GRANÉLI, P. S. SALOMON AND G. O. FISTAROL

AS Target

Most affected

organism

1 A, B, C, D A

2 A, B, C, D B

3 A, B, C, D C

Different AS,

anddifferent

targets

4 A, B, C, D D

The most

affected

organism

by each

varies,

i.e., AS

seem to

have

specific

targets

AS Target

Effect on each

target

highly affected

1 A, B, C, D

B moderately

affected

C not affected

One AS,

different

targets

D stimulated

Different

target

species

have

different

sensitivity

to one AS

AS Target Effect of each AS

1 A

1 caused a strong

effect

2 A

2 caused a

moderate effect

3 A

3 no effect

the response of

one target to

different AS

4 A

4 stimulates

Each AS

has a

different

effect on

the target.

Specificity

between

target and

donor (may

indicate co-

evolution)

Figure 1. Comparison between the effects caused by different allelopathic species (AS) on one

or several target organisms. The most affected organism by different allelopathic species varies

(a). An allelopathic species will have different effects on each target (b). The same target

organism can be highly affected by one allelopathic species and stimulated by another (c).

There are about 40 harmful phytoplankton species known to exhibit

allelopathy (see Table 1). While in marine end estuarine waters the majority

of the allelopathic species are found among the dinoflagellates, in fresh-

water they are found among the cyanobacteria (Table 1). Nevertheless, it is

among the flagellates that are found the allelopathic species producing the

allelochemicals with the strongest negative impact on the other algal groups.

Blooms of species such as Chrysochromulina polylepis and Prymnesium

parvum are known for killing fauna and flora on the places they occur

(Granéli and Johansson, 2003; Legrand et al., 2003).

168

ALLELOPATHY IN HARMFUL ALGAE

5.2.2. Effect of the growth phase

The intensity of the allelopathic effect depends on the growth phase of the

allelopathic species. Schmidt and Hansen (2001) and Suikkanen et al. (2004)

demonstrated that allelopathic effect is caused by cells that are growing ex-

ponentially, that these effects decrease in the stationary phase, and that

senescent cells do not cause allelopathic effects. Since allelopathy is a form

of interference competition, it makes sense that the allelopathic species would

be more allelopathic during exponential growth, while the cells can benefit

from their effects, indicating that these compounds are important to the eco-

logy of allelopathic species.

5.2.3. Influence of bacteria

Although most experiments on allelopathy of phytoplankton species were

done with non-axenic cultures, it has been demonstrated that the bacteria

present in the cultures are probably not responsible for the observed allelo-

pathic effects (Suikkanen et al., 2004; Tillmann and John, 2002).

Tillmann and John (2002) eliminated the influence of bacteria present

on Alexandrium spp. cultures by removing the bacteria through 0.2 µm

membrane filters. They observed that the allelopathic effect of Alexandrium

spp. did not alter, eliminating therefore the possible bacterial effect.

Suikkanen et al. (2004), tested if bacteria present in the non-axenic

cultures of Nodularia spumigena, Anabaena lemmermannii and Aphani-

zomenon flos-aquae caused any allelopathic effect. The authors found that

bacteria alone caused no effect on the target organism, indicating that the

allelopathic effects they observed were indeed caused by cyanobacteria.

Although specific tests should be done for each allelopathic species, the

examples above suggest that are indeed the phytoplankton species that

cause the allelopathic effects and not bacteria.

6. Ecological Implications of Phytoplankton Allelopathy

Allelochemicals have been suggested to influence phytoplankton compete-

tion, succession, and bloom formation or maintenance (Pratt, 1966; Keating,

1977; Rice, 1984 and references within; Lewis, 1986; Wolfe, 2000; Renge-

fors and Legrand, 2001; Vardi et al., 2002; Legrand et al., 2003; Fistarol et

al., 2003, 2004; Suikkanen et al., 2005). It has been proposed that changes

in plankton community structure are caused by the differential effect of

allelochemicals on different targets (Mulderij et al., 2003). Target organisms

may be completely eliminated, inhibited, resistant to the allelo-chemicals,

or be stimulated (Fistarol et al., 2003, 2004a; Suikkanen et al., 2004).

169

E. GRANÉLI, P. S. SALOMON AND G. O. FISTAROL

Figure 2. Different stages of cells of Thalassiosira weissflogii exposed to P. parvum

filtrate. The first picture of the sequence shows a normal cell that has not been exposed to

filtrate. The pictures are from different cells. Pictures 2 and 3 were after 1 h exposure, picture

4 and 5 after 5 h, and pictures 6 and 7 after 20 h. However, cells completely lyzed could

already be observed after 5 h of exposure.

170

ALLELOPATHY IN HARMFUL ALGAE

Figure 3. Different stages of cells of Rhodomonas sp. exposed to P. parvum filtrate. The first

picture of the sequence shows a normal cell that has not been exposed to filtrate. The

pictures are from different cells, except

the three last Rhodomonas sp. picture that are all

from the same cell. Except for the first Rhodomonas sp. picture, all other pictures were taken

after 20 h of exposure, and the last three pictures were taken in an interval shorter that 2 min.

However, as in the case of T. weissflogii, cells completely lysed could be found after 5 h of

exposure. Thus, although observations have shown that one cell goes through all the stages

depicted in the pictures, some cells are affected before the others.

171

E. GRANÉLI, P. S. SALOMON AND G. O. FISTAROL

It is hypothesized that the basic function of allelopathy is to give the do-

nor organism a competitive advantage (Legrand et al., 2003), and the direct

effect of allelopathy is shown by killing possible competitors. The fact that

Prymnesium parvum (Fistarol et al., 2003) had a higher effect on diatoms

(predecessor group under natural succession) than over cyanobacteria (group

that usually blooms after the highest densities of P. parvum) indicates the

potential competitive use of allelochemicals. The effect of P. parvum on a

natural plankton community (Fistarol et al., 2003) shows how allelopathy

can give a competitive advantage to an allelopathic species. The compounds

excreted by P. parvum completely eliminated some of the competing phytop-

lankton groups and kept the biomass of the other groups at low levels (i.e.

organisms that were not killed had a lower growth rate, and phytoplankton

the ones remaining would show a deficient physiological state.

Usually the lethal effect of allelochemicals involves the lysis of the target

organism. This is especially striking when the allelopathic algae caused a

strong negative effect, as in Prymnesium parvum. Figure 2 and 3 shows

different stages of cells of the diatom Thalassiosira weissflogii and the cry-

ptophyceae Rhodomonas sp., respectively, after exposure to P. parvum

filtrate. The figures shows how the cells change: how they start to lose pig-

mentation, that the cytoplasm seems to aggregate in vacuoles, that the cells

start to blister, and finally that lyses occurs.

7. Allelopathy and Mixotrophy

Resource competition and grazing are traditionally the main mechanic-

sms used to explain phytoplankton population dynamics, and allelopathy is

rarely taken into account. However, allelopathy, and also mixotrophy, have

been shown to affect aquatic communities (Keating, 1977; Vardi et al.,

2002; Fistarol et al., 2003, 2004a). It is very likely that these two strategies

complement each other. Besides killing possible competitors, alleloche-

micals may give a further advantage to mixotrophic species, which can use

the allelochemicals to help to obtain food mixotrophically, as in the case of

Prymnesium parvum (Skovgaard and Hansen, 2003; Skovgaard et al., 2003;

Tillmann, 2003). Allelochemicals can immobilize the prey, which are then

are attacked, or alternatively the allelochemicals can lyse the cells which

then release organic material (Skovgaard and Hansen, 2003; Skovgaard

et al., 2003; Tillmann, 2003).

Selective promotion or inhibition of the growth of individual species will

influence succession and competition in aquatic environments.

primary production decreased). Extrapolated to a natural situation these re-

sults suggest that P. parvum would have less species to compete with, and

172

ALLELOPATHY IN HARMFUL ALGAE

8. Conclusions: Evolutionary Aspects

Allelopathy affects phytoplankton succession and competition because it

gives a competitive advantage to the allelopathic species and/or the resistant

targets organisms. This fact has evolutionary implications because it may

favor the selection of the resistant organisms, as it occurs with toxins rele-

ased by microalgae species, which cause selective pressure on herbivorous

organisms (by selecting the resistant ones) (Hairston et al., 2001). Both the

tolerance showed by some organisms, and the fact differential effect of alle-

lochemicals on each target species (Fistarol et al., 2003, 2004a; Suikkanen

et al., 2004) suggest that co-evolution must be occurring. Furthermore,

Fistarol et al. (2004b) shows an example of a behavioral strategy that could

be used as a defense mechanism. The tolerance to allelochemicals shown by

some target species is especially significant when it is found in successor

algae, which then can achieve dominance over the allelopathic algae, as in

the case of the resistance of cyanobacteria to Prymnesium parvum (Fistarol

et al., 2003). Keating (1977) also showed that the phytoplankton groups

succeeding the allelopathic species were positively affected, and achieved

dominance over the predecessor allelopathic organisms.

Though allelopathic organisms might be good competitors under chemi-

cal interactions, they often are poor competitors for nutrients (Huntley et al.,

1986). Thus, they will only dominate when their ecophysiological charac-

teristics (Smayda, 1997) make them good competitors, causing a fluctuating

selection, where the best competitor under certain conditions will dominate

when these conditions occur, but it will be replaced when conditions change.

Enough evidence has been provided showing the ecological importance

of phytoplankton allelopathy. The success of a certain microalgae species

and the composition of aquatic communities is dependent on a series of abitic

and biotic factors, and it is important to consider them all when studying

aquatic systems.

References

Allen, J. I., Anderson, D., Burford, M., Dyhrman, S., Flynn, K., Glibert, P. M., Granéli, E.,

Heil, C., Sellner, K., Smayda, T., Zhou, M., 2006, Global ecology and oceanography of

Anderson, D. M., 1989. Toxic algal blooms and red tides: a global perspective. In:

Okaichi, Anderson, D. M. and Nemoto, T., eds., Red Tides: Biology, Environmental

Science and Toxicology. Elsevier. pp. 11–16.

GEOHAB report 4, IOC and SCOR, Paris and Baltimore, pp. 74.

harmful algal blooms, harmful algal blooms in eutrophic systems. P. Glibert, ed.,

173

E. GRANÉLI, P. S. SALOMON AND G. O. FISTAROL

Arzul, G., Seguel, M., Guzman, L., Erard-Le Denn, E., 1999, Comparison of allelopathic

properties in three toxic Alexandrium species, J. Exp. Mar. Biol. Ecol. 232: 285–295.

Bagchi, S. N., and Marwah, J. B., 1994, Production of an algicide from cyanobacterium

Fischerella species which inhibits photosynthetic electron transport, Microbios 79:

187–193.

Chauhan, V. S., Marwah, J. B., Bagchi, S. N., 1992, Effect of an antibiotic from Oscillatoria

sp. on phytoplankters higher plants and mice, New Phytol. 120: 251–257.

Christoffersen, K., Lyck, S., Winding, A., 2002, Microbial activity and bacterial community

structure during degradation of microcystins, Aquat. Microb. Ecol. 27: 125–136.

de Figueiredo, D. R., Azeiteiro, U. M., Goncalves, F., Pereira, M. J., 2004, Aphanizomenon

flos-aquae grown under different nutrient concentrations and the effects of its exudates

on growth of two green algae. Freshen. Environ, Bull. 13: 657–664.

Edvardsen, B., Moy, F., Paasche, E., 1990, Hemolytic activity in extracts of Chrysochromulina

polylepis grown at different levels of selenite and phosphate. In: Toxic marine phyto-

plankton, E. Granéli, B. Sundstöm, L. Edler, and D. M. Anderson, eds., Elsevier, New

York, pp. 284– 289.

Einhellig, F. A., 1995, Allelopathy: Current status and future goals. In: Allelopathy:

organisms, processes and applications. In: Inderjit, K. M. M. Dakshini, F. A. Einhellig,

eds., ACS Symp. Ser. 582: 1–24.

Figueredo, C. C., Giani, A., Bird, D. F., 2007, Does allelopathy contribute to Cylindrospermopsis

raciborskii (cyanobacteria) bloom occurrence and geographic expansion?, J. Phycol.

43: 256–265.

Fistarol, G. O., Legrand, C., Granéli, E., 2003, Allelopathic effect of Prymnesium parvum on

a natural plankton community, Mar. Ecol. Prog. Ser. 255: 115–125.

Fistarol, G. O., Legrand, C., Selander, E., Hummert, C., Stolte, W., Granéli, E., 2004a,

Allelopathy in Alexandrium spp.: effect on a natural plankton community and on algal

monocultures. Aquat. Microb. Ecol. 35: 45–56.

Fistarol, G. O., Legrand, C., Rengefors, K., Granéli, E., 2004b, Temporary cyst formation in

phytoplankton: a response to allelopathic competitors? Environ. Microbiol. 6: 791–798.

Fistarol, G. O., Legrand, C., Granéli, E., 2005, Allelopathic effect on a nutrient-limited

phytoplankton species, Aquat. Microb. Ecol. 41: 153–161.

Gleason, F. K., and Paulson, J. L., 1984, Site of action of the natural algicide, cyanobacterin,

in the blue-green alga, Synechococcus sp., Arch. Microbiol. 138: 273–277.

Granéli, E., and Flynn, K., 2006, Chemical and physical factors influencing toxin content. In:

E. Granéli, and J. Turner, eds., Ecology of harmful algae. Ecological Studies, Springer,

Heidelberg, 189: 229–241.

for resources? In: E. Granéli, and J. Turner, eds., Ecology of harmful algae., Ecological

Studies, Springer, Heidelberg, 189: 189–201.

Granéli, E., and Johansson, N., 2003, Increase in the production of allelopathic substances by

Prymnesium parvum cells grown under N- or P-deficient conditions. Harmful Algae

135–145.

Granéli, E., and Pavia, H., 2006, Allelopathy in marine ecosystems. In: M. J. Reigosa,

N. Pedrol, and L. González, eds., Allelopathy: A Physiological Process With Ecological

Implications. Springer, The Netherlands, pp. 415–431.

of eutrophication, Harmful Algae.

Gross, E. M., 2003, Allelopathy of aquatic autotrophs. Crit. Rev. Plant. Sci. 22: 313–339.

Granéli, E., and Hansen, P. J., 2006. Allelopathy in harmful algae: A mechanism to compete

174

Granéli, E., and Weberg, M., 2008, Harmful algal blooms of allelopathic species: the role

ALLELOPATHY IN HARMFUL ALGAE

Gross, E. M., Wolk, C. P., Jüttner, F., 1991, Fischerellin, a new allelochemical from the

freshwater cyanobacterium Fischerella muscicola, J. Phycol. 27: 686–692.

Hagström, J. A., Granéli, E., Maneiro, I., Barreiro, A., Petermann, A., Svensen, C., 2007,

Release and degradation of amnesic shellfish poison from decaying Pseudo-nitzschia

multiseries in presence of bacteria and organic matter, Harmful Algae 6:175–188.

Hairston, N. G., Holtmeier, C. L., Lampert, W., Weider, L. J., Post, D. M., Fischer, J. M.,

Caceres, C. E., Fox, J. A., Gaedke, U., 2001, Natural selection for grazer resistance to

toxic cyanobacteria: evolution of phenotypic plasticity? Evolution 55: 2203–2214.

Hallegraeff, G. M., 1993, A review of harmful algal blooms and their apparent global

increase. Phycologia 32: 79–99.

Hansen, P. J., 2002, Effect of high pH on the growth and survival of marine phytoplankton:

implications for species succession. Aquat. Microb. Ecol. 28: 279–288.

Hansen, E., Ernstsen, A., Eilertsen, H. C., 2004, Isolation and characterisation of a cytotoxic

polyunsaturated aldehyde from the marine phytoplankter Phaeocystis pouchetii (Hariot)

Lagerheim, Toxicology 199: 207–217.

Hinga, K. R., 1992, Co-occurrence of dinoflagellate blooms and high pH in marine

enclosures. Mar. Ecol. Prog. Ser. 86:181–187.

Hirata, K., Takashina, J., Nakagami, H., Ueyama, S., Murakami, K., Kanamori, T., Miyamoto,

K., 1996, Growth inhibition of various organisms by a violet pigment, Nostocine A,

produced by Nostoc spongiaeforme, Biosci. Biotech. Bioch. 60: 1905–1906.

Hirata, K., Yoshitomi, S., Dwi, S., Iwabe, O., Mahakhant, A., Polchai, J., Miyamoto, K.,

2003, Bioactivities of Nostocine A produced by a freshwater cyanobacterium Nostoc

spongiaeforme TISTR 8169, J. Biosci. Bioeng. 95: 512–517.

Huntley, M., Sykes, P., Rohan, S., Marin, V., 1986, Chemically-mediated rejection of dino-

flagellate prey by the copepods Calanus pacificus and Paracalanus parvus: mechanism,

occurrence and significance. Mar. Ecol. Prog. Ser. 28: 105–120.

Igarashi, T., Oshima, Y., Murata, M., Yasumoto, T., 1995, Chemical studies on prymnesins

isolated from Prymnesium parvum. In: P. Lassus, G. Arzul, E. Erard-Le Denn, P. Gentien,

and C. Marcaillou-Le Baut, eds., Harmful marine algal blooms: proceedings of the Sixth

International Conference on Toxic Marine Phytoplankton, October 1993, Nantes, France.

Lavoisier Publishing, Paris, pp. 303–308.

Igarashi, T., Aritake, S., Yasumoto, T., 1998, Biological activities of Prymnesin-2 isolated

from a red tide alga Prymnesium parvum, Nat. Toxins 6: 35–41.

182–196.

Johansson, N., and Graneli, E., 1999a, Cell density, chemical composition and toxicity of

Chrysochromulina polylepis (Haptophyta) in relation to different N:P supply ratios. Mar.

Biol. 135: 209–217.

Johansson, N., and Graneli, E., 1999b, Influence of different nutrient conditions on cell

density, chemical composition and toxicity of Prymnesium parvum (Haptophyta) in

semi-continuous cultures. J. Exp. Mar. Biol. Ecol. 239: 243–258.

Kearns, K. D., and Hunter, M. D., 2001, Toxin-producing

Anabaena flos-aquae induces

settling of Chlamydomonas reinhardtii, a competing motile alga, Microb. Ecol. 42: 80–86.

Keating, K. I. 1999, Allelochemistry in plankton communities. In: Inderjit, K. M. M.

micals interactions. CRC Press, London, pp. 165–178.

Keating, K. I., 1977, Allelopathic influence on blue-green bloom sequence in a eutrophic

lake. Science 196: 885–887.

Dakshini, and C. L. Foy, (eds.) Principles and Practices in Plant Ecology: alleloche-

175

Inderjit, S., and Dakshini, K. M. M., 1994, Algal allelopathy, The Botanical Review 60:

E. GRANÉLI, P. S. SALOMON AND G. O. FISTAROL

Kubanek, J., Hicks, M. K., Naar, J., Villareal, T. A., 2005, Does the red tide dinoflagellate

Karenia brevis use allelopathy to outcompete other phytoplankton? Limnol. Oceanogr.

50: 883–895.

Larsen, A., and Bryant, S., 1998, Growth and toxicity in Prymnesium parvum and Prymnesium

patelliferum (Haptophyta) in response to changes in salinity, light and temperature, Sarsia

83: 409–418.

Legrand, C., Rengefors, K., Fistarol, G. O., Granéli, E., 2003, Allelopathy in phytoplankton

– biochemical, ecological and evolutionary aspects. Phycologia 42: 406–419.

Lewis, W. M. Jr., 1986, Evolutionary interpretation of allelochemical interactions in

phytoplankton algae. The American Naturalist 127: 184–194.

Mulderij, G., Van Donk, E., Roelofs, G. M., 2003. Differential sensitivity of green algae to

Murphy, T. P., Lean, D. R. S., Nalewajko, C., 1976, Blue-green algae: their excretion of

iron-selective chelators enables them to dominate other algae, Science 192: 900–902.

Myklestad, S. M., Ramlo, B., Hestmann, S., 1995, Demonstration of strong interaction

between the flagellate Chrysochromulina polylepis (Prymnesiophyceae) and a marine

diatom, In: P. Lassus, G. Arzul, E. Erard-Le Denn, P. Gentien, C. Marcaillou-Le Baut,

eds., Harmful marine algal blooms. Lavoisier Pub., Paris, pp. 633–638.

Parnas, I., Reich, K., Bergmann, F., 1962. Photoinactivation of ichthyotoxin from axenic

cultures of Prymnesium parvum Carter. Appl. Microbiol. 10: 237–239.

Pegler, K., and Kempe, S., 1988, The carbonate system of the North Sea: determination of

alkalinity and TCO

and calculation of PCO

and Sl

cal

(spring 1986). Mitt. Geol.-

Paleont. Inst. Univ. Hamburg, 65: 35–87.

Pratt, D. M., 1966, Competition between Skeletonema costatum and Olisthodiscus luteus in

Narragansett Bay and in culture. Limnol. Oceanogr. 11: 447–455.

Ray, S., and Bagchi, S. N., 2001, Nutrients and pH regulate algicide accumulation in cultures

of the cyanobacterium Oscillatoria laetevirens. New Phytol. 149: 455–460.

Reguera, B., and Oshima, Y., 1990, Responses of Gyrodinium catenatum to increasing levels

of nitrate: growth patterns and toxicity, In: E. Granéli, B. Sundström, L. Edler, and

D. M. Anderson, eds., Toxic Marine Phytoplankton, Elsevier, New York, pp. 316–319.

Reich, K., and Parnas, I., 1962, Effect of illumination on ichthyotoxin in and axenic culture

of Prymnesium parvum Carter. J. Protozool. 9: 38–40.

Reigosa, M. J., Sánchez-Moreiras, A., González, L., 1999, Ecophysiological approach in

allelopathy. Critical Reviews in Plant Science 18: 577–608.

Rengefors, K., and Legrand, C., 2001, Toxicity in Peridinium aciculiferum – an adaptative

strategy to outcompete other winter phytoplankton? Limnol. Oceanogr. 46: 1990–1997.

Rizvi, S. J. H., Haque, H., Singh, V. K., Rizvi, V., 1992, A discipline called allelopathy, In:

S. J. H. Rizvi, and V. Rizvi, V., eds., Allelopathy: basic and applied aspects. Chapman

and Hall, London, pp. 1–19.

Schagerl, M., Unterrieder, I., Angeler, D. G., 2002, Allelopathy among cyanoprokaryota and

other algae originating from Lake Neusiedlersee (Austria), Int. Rev. Hydrobiol. 87:

365–374.

Schmidt, L. E., and Hansen, P. J., 2001, Allelopathy in the prymnesiophyte Chrysochromulina

polylepis: effect of cell concentration, growth phase and pH. Mar. Ecol. Prog. Ser. 216:

67–81.

Skovgaard, A., and Hansen, P. J., 2003, Food uptake in the harmful Prymnesium parvum

mediated by excreted toxins. Limnol. Oceanogr. 48: 1161–1166.

allelopathic substances from Chara. Hydrobiologia, 491: 261–271

Rice, E. L., 1984, Allelopathy, 2nd ed. Academic Press, Orlando, Florida, pp. 423.

176

ALLELOPATHY IN HARMFUL ALGAE

Skovgaard, A., Legrand, C., Hansen, P. J., Granéli, E., 2003, Effects of nutrient limitation on

food uptake in the toxic haptophyte Prymnesium parvum. Aquat. Microb. Ecol. 31:

259–265.

Smayda, T. J., 1990, Novel and nuisance phytoplankton blooms in the sea: evidence for a

global epidemic. In: E. Granéli, B. Sundström, L. Edler, and D. M. Anderson, eds., Toxic

Marine Phytoplankton, Elsevier, New York, pp. 29–40.

Smayda, T. J., 1997, Harmful algal blooms: their ecophysiology and general relevance to

phytoplankton blooms in the sea. Limnol. Oceanogr. 42: 1137–1153.

Sugg, L. M., and VanDolah, F. M., 1999, No evidence for an allelopathic role of okadaic

acid among ciguatera-associated dinoflagellates. J. Phycol. 35: 93–103.

Sukenik, A., Eshkol, R., Livne, A., Hadas, O., Rom, M., Tchernov, D., Vardi, A., Kaplan, A.,

2002, Inhibition of growth and photosynthesis of the dinoflagellate Peridinium gatunense

by Microcystis sp. (cyanobacteria): A novel allelopathic mechanism, Limnol. Oceanogr.

47: 1656–1663.

Suikkanen, S., Engström-Öst, J., Jokela, J., Sivonen, K., Viitasalo, M., 2006, Allelopathy of

Baltic Sea cyanobacteria: no evidence for the role of Nodularin. J. Plankton. Res. 28:

543–550.

Suikkanen, S., Fistarol, G. O., Granéli, E., 2004, Allelopathic effects of the Baltic cyanobac-

teria Nodularia spumigena, Aphanizomenon flos-aquae and Anabaena lemmermannii on

algal monocultures. J. Exp. Mar. Biol. Ecol. 308: 85–101.

Suikkanen, S., Fistarol, G. O., Granéli, E., 2005, Effects of cyanobacterial allelochemicals on

a natural plankton community. Mar. Ecol. Prog. Ser. 287: 1–9.

Tang, C. S., Cai, W. F., Kohl, K., Nishimoto, R. K., 1995, Plant stress and allelopathy.

Allelopathy, American Chemical Societ 582: 142–157.

Tillmann, U., 2003, Kill and eat your predator: a winning strategy of the planktonic

flagellate Prymnesium parvum, Aquat. Microb. Ecol. 32: 73–84.

Tillmann, U., and John, U., 2002, Toxic effects of Alexandrium spp. on heterotrophic

dinoflagellates: an allelochemical defence mechanism independent of PSP-toxin content.

Mar. Ecol. Prog. Ser. 230: 47–58.

Tillmann, U., John, U., Cembella, A., 2007, On the allelochemical potency of the marine

dinoflagellate Alexandrium ostenfeldii against heterotrophic and autotrophic protists.

J. Plankton. Res. 29: 527–543.

Twist, H., and Cood, G. A., 1997, Degradation of the cyanobacterial hepatotoxin, nodularin,

under light and dark conditions. FEMS Microbiology Letters

151: 83–88.

Uchida, T., Toda, S., Matsuyama, Y., Yamaguchi, M., Kotani, Y., Honjo, T., 1999, Interactions

between the red tide dinoflagellates Heterocapsa circularisquama and Gimnodinium

mikimotoi in laboratory culture, J. Exp. Mar. Biol. Ecol. 241: 285–299.

Van Dolah, F. M., 2000, Marine algal toxins: origins, health effects, and their increased

occurrence. Environ. Health Persp. 108: 133–141.

molytic activity of live Phaeocystis pouchetii during mesocosm blooms. Biogeochemistry

83: 189–200.

Vardi, A., Schatz, D., Beeri, K., Motro, U., Sukenik, A., Levine, A., Kaplan, A., 2002,

Dinoflagellate-cyanobacteria communication may determine the composition of phytoplan-

Wang, Y., Yu, Z., Song, X., Zhang, S., 2006, Interactions between the bloom-forming

dinoflagellates Prorocentrum donghaiense and Alexandrium tamarense in laboratory

cultures, J. Sea Res. 56: 17–26.

Willis, R. J., 1985, The hystorical bases of the concept of allelopathy. J. Hist. Biol. 18:

71–102.

kton assemblege in a mesotrophic lake. Current Biol. 12: 1767–1772.

van Rijssel, M., Alderkamp, A. -C., Nejstgaard, J. C., Sazhin, A. F., Verity, P. G., 2007, Hae-

177

E. GRANÉLI, P. S. SALOMON AND G. O. FISTAROL

Windust , A. J., Quilliam, M. A., Wright, J. L. C., McLachlan, J. L., 1997, Comparative

toxicity of diarrhetic shellfish poisons, okadaic acid, okadaic acid diol-ester and

dinophysistoxin-4, to the diatom Thalassiosira weissflogii. Toxicon 35: 1591–1603.

Wolfe, G. V., 2000, The chemical defense ecology of marine unicellular plankton:

constraints, mechanisms, and impacts. Biol. Bull. 198: 225–244.

Yamasaki, Y., Nagasoe, S., Matsubara, T., Shikata, T., Shimasaki, Y., Oshima, Y., Honjo, T.,

and the raphidophyte Heterosigma akashiwo, Mar. Ecol. Prog. Ser. 339: 83–92.

2007, Allelopathic interactions between the bacillariophyte Skeletonema costatum and

178

V. Evangelista et al. (eds.), Algal Toxins: Nature, Occurrence, Effect and Detection.

CHECKLIST OF PHYTOPLANKTON ON THE SOUTH COAST

OF MURCIA (SE SPAIN, SW MEDITERRANEAN SEA)

NIEVES BOUZA* AND MARINA ABOAL

Department of Botany. Faculty of Biology, University

of Murcia, Campus de Espinardo, 30100-Murcia, Spain

coast of Murcia region were studied from January 2006 to January 2007.

A total number of 243 taxa were identified: diatom was the most diverse

algal group with 134 taxa (55%), followed by dinoflagellates with 67 (28%)

and coccolithophorids with 33 taxa (14%). The groups represented by lowest

number of species were Chrysophyceae with 6 (2.5%), Eustigmatophyceae

with 1 (0.4%) and Euglenophyceae with 1 (0.4%). Only a floristic report has

been already published fo

r northern part of Murcian region (Ros and

Miracle, 1984) and this is the first report of phytoplankton on the southern

coast of region. A similar qualitative composition of the phytoplankton but

with higher values has been found in a recent study in Alborán Sea (Mercado

et al., 2005).

1. Introduction

Algae play an important role in the ecological balance of marine ecosystems.

The continuity of marine biota depends on the photosynthetic activity of these

organisms. Because of their rapid growth and short, simple life cycles, algae

are potential indicators of water quality. Although diverse studies describe

the structure of the communities of phytoplankton in western Mediterranean

______

*To whom correspondence should be addressed. Nieves Bouza, Phycology Laboratory, Depart-

ment of Botany, Faculty of Biology, University of Murcia, Campus de Espinardo, 30100-Murcia, Spain.

Email: niboca04@yahoo.es

179

Abstract: The taxonomic structure of phytoplankton populations of southern

Keywords: Phytoplankton; checklist; SW Mediterranean Sea; Murcian coast

sea (Margalef, 1969; Delgado, 1990; Claustre et al., 1994; Fiala et al., 1994;

Videau et al., 1994; Estrada et al., 1999; Vila et al., 2001a, 2001b; Vila and

Masó, 2005; Mercado et al., 2005; Reul et al., 2005), only a report about a

point of the Murcian coast located in the northern part of the region has

been published (Ros and Miracle, 1984).

The increase of water demand has promoted the building of several

desalinization plants that may contribute to the rise salinity. The warming

climate with the increase of temperature, salinity, and nutrient concentrations,

will probably change the taxonomic structure of phytoplankton communities

and may favour the formation of HABs (Béthoux, 1989; Gómez, 2003).

The scope of this paper is to present a checklist of phytoplankton on the

southern coast of Murcia region in order to have the reference conditions

prior to the installation of a seawater desalination platform offshore.

2. Materials and Methods

The Mediterranean Sea is an oligotrophic semi-enclosed basin with a natural

eastward decrease in productivity (Sournia, 1973). The studied area is in-

fluenced by Cartagena anticyclonic eddy, characterized by a low chlorophyll

concentration and complex hydrology (Prieur and Sournia, 1994), with high

biodiversity of flora and fauna and with ecosystems considered highly

vulnerable (Calvín et al., 1998).

Monthly samples were collected from January 2006 to January 2007 at

station P2 (Mazarrón 2). The studied station is situated 2,5 Km offshore at

Mazarrón Bay (37º32’55’’N, 4º46’7’’E) in the southern part of the region.

Samples derived from sampling at different seasons were collected in stations

P2 (Mazarrón 2), P3 (Mazarrón 1), P4 (Calnegre) and P5 (Percheles), there

Figure 1. Study area along the Murcian coast showing the sampling stations.

180

N. BOUZA AND M. ABOAL

Mazarró

Spain

Samples were collected with a Niskin bottle (KC Denmark) at 5, 25 and

40 m depth and subsamples were fixed with formaldehyde, glutarahaldehyde

and Lugol’s iodine solution. Fresh and fixed samples were examined by

light (OLYMPUS BX50) and scanning electron (JEOL-6100) microscopy

after critical point drying for qualitative analysis.

The species richness was represented as the total number of taxa presen-

ted within the samples. The taxonomic identification of phytoplankton was

carried out to the highest level possible using floras of Balech (1988), Cros

and Fortuño (2002), Horner (2002), Delgado and Fortuño (1991), Hallegraff

et al. (2003), Matsuoka and Fukuyo (2000), Ojeda (2006), Ricard (1987),

Round et al. (1990), Sournia (1986), Tomas (1997), Witkowski et al. (2000).

3. Results and Discussion

Two hundred forty three taxa (117 genera) were identified in the phyto-

plankton of the south coast of Murcia belonging to Bacillariophyceae, Dino-

phyceae, Haptophyceae, Dictyochophyceae, Chrysophyceae, Cryptophyceae,

Ebriidae, Eustigmatophyceae and Euglenohyceae. Table 1 presents a list of

the identified taxa in samples with optical and electronic microscopy.

Bacillariophyceae were the most diverse algae group with 137 taxa (56%),

followed by Dinophyceae with 64 (26%), Haptophyceae (mainly coccolitho-

phorids) with 33 taxa (13%), and Dictyochophyceae with 4 (2%). The groups

represented by the lower number of species, less than 1%, were Chryso-

phyceae, Cryptophyceae, Ebriidae, Eustigmatophyceae and Euglenohyceae.

The most diversified genera of diatoms were Chaetoceros sp. (27),

Thalassiosira sp. (12) and Ceratium (10), Protoperidinium (7), Prorocentrum

(6) and Gonyaulax (6) of dinoflagellates, while Syracosphaera (6) and

Diatoms have been mostly investigated and thus comparable throughout

the Mediterranean. The number of diatoms determined in different parts of

the Mediterranean mostly varies between 107 and 183 (Viliþiü et al., 2002

and references therein). The greatest number of diatoms (400) is listed in

the northern Mediterranean (Travers and Travers, 1973) and (518) in the

eastern Adriatic Sea. Ros and Miracle (1984) reported 144 diatoms in a

station of the northern coast of Murcia.

The most productive and studied areas on Spanish Mediterranean coasts

are Catalan-Balearic and Alborán Seas that are associated to front and

were not significant differences between them. By this reason we refer only

to P2 station (Mazarrón) (Fig. 1).

181

PHYTOPLANKTON IN SW MEDITERRANEAN SEA

Umbilicosphaera (3) were the most diversified coccolithophorids (Figs. 2–5).

N. BOUZA AND M. ABOAL

Species Number

toc

ero

zsc

sol

ssi

oss

Pro

144 diatoms, 126 dinoflagellates and 17 crysophytes. A common feature on

the south coast of Spain (Alborán Sea) is a gradient of diatoms diversity

from western to eastern related with the ecological gradient between Atlantic

and Mediterranean waters (Delgado, 1990; Rivera, 2004).

Gómez (2003) reported 604 species of free-living planktonic dino-

flagellates in the western Mediterranean Sea where the Algerian sub-basin

(22%) showed the lowest number of species. We found many species of

dinoflagellates that have not been cited in Algerian sub-basin, but this

report considered only studies of African coast to elaborate the checklist of

Algerian subbasin.

Species diversity of phytoplankton is difficult to compare due to differ-

ent methodologies of determination to elaborate the checklist (optical and

Figure 2. Species number of most diversified genera of main taxonomic groups.

eight years on Alborán Sea (Mercado et al., 2005) and on the north coast of

Murcia (Ros & Miracle, 1984). Mercado et al. (2005) described 180 diatoms,

118 dinoflagellates and 31 coccolithophorids. Ros & Miracle (1984) cited

upwelling features respectively. A similar qualitative composition of the

phytoplankton but with higher values have found in a recent study during

182

PHYTOPLANKTON IN SW MEDITERRANEAN SEA

electronic microscopy), sampling periods (days or weeks for single oceano-

graphic surveys versus annual samplings) and the different depths of

samplings.

Figure 3. Scanning electronic microscope photographs of the coccolithophorids: 1. Pont-

osphaera syracusana Lohmann, 2. Calcidiscus leptoporus (Murria et Blackman) Loeblich et

Tappan, 3. Gephyrocapsa oceanica Kampter, 4. Discosphaera tubifera Murria et Blackman,

5. Emiliania huxleyi Hay and Moler, 6. Algirosphaera robusta (Lohmann) Norris. Scale

bars: A, B, D: 10 µm; C, F: 5 µm; E: 2 µm.

183

N. BOUZA AND M. ABOAL

Figure 4. Scanning electronic microscope photographs of the dinoflagellates: A. Gonyaulax

cf. scrippsae Kofoid, B. Dinophysis caudata Saville-Kent, C. Triadinium polyedricum

(Pouchet) Dodge, D. Oxytoxum longiceps Schiller, E. Chain of Ceratium candelabrum

(Ehrenberg) Stein, F: Corythodinium tesselatum (Stein) Loeblich & Loeblich. Scale bars: A:

10 µm; B: 50 µm; C, D, F: 20 µm; E: 100 µm.

184

PHYTOPLANKTON IN SW MEDITERRANEAN SEA

Figure 5. Scanning electronic microscope photographs of the diatoms: A. Thalassiosira

mediterranea (Schröder) Hasle, B. Asteromphalus parvulus Karsten, C. Lauderia annulata

Cleve, D. Chain of Detonula pumila (Cleve) Grunow, E. Amphora cf. coffeaformis (Agardh)

Kützing, F: Nitzschia panduriformis var. continua Grunow. Scale bars: A, E: 5 µm; B, C, D:

20 µm; F: 10 µm.

185

N. BOUZA AND M. ABOAL

TABLE 1. List of taxons of phytoplankton determined on the south coast of Murcia.

HAPTOPHYCEAE

Acanthoica quatrospina Lohmann

Anoplosolenia brasiliensis Lohmann

Algirosphaera robusta (Lohmann) Norris

Alisphaera sp.

Alisphaera unicornis Okada et McIntyre

Calcidiscus leptoporus (Murria et Blackman) Loeblich et Tappan

Calciosolenia murayi Gran

Calytrosphaera sp.

Ceratolithus sp.

Cyrtosphaera lecaliae Kleijne

Daktylethra pirus (Kamptner) Norris

Discosphaera tubifera Murria et Blackman

Emiliania huxleyi Hay & Moler

Florisdosphaera sp.

Garderia corolla (Lecal) Kleijne

Gephyrocapsa oceanica Kampter

Gephyrocapsa ornata Heimdal

Helicosphaera carteri (Wallich) Kamptner

Helladosphaera cornifera (Schiller) Kamptner

Palusphaera vandeli Lecal

Phaeocystis sp.

Pontosphaera syracusana Lohmann

Rhabdosphaera clavigera Murray & Blackman

Syracosphaera anthos (Lohmann) Janin

Syracosphaera histrica Kamptner

Syracosphaera molischii Schiller

Syrascosphaera noroitica Knappertsbusch

Syracosphaera prolongata sensu Heimdal et Gaarder

(Continued)

186

PHYTOPLANKTON IN SW MEDITERRANEAN SEA

Syracosphaera pulchra Lohmann

Umbellosphaera tenuis (Kamptner) Paasche

Umbilicosphaera sp.

Umbilicosphaera sibogae var. sibogae (Weber-van Bose) Gaarder

Umbilicosphaera sibogae var. foliosa (Kamptner) Okada et McIntyre

BACILLARIOPHYCEAE

Achnanthes cf. placentuloides Guslakov

Achnanthes cf. brevipes var. pabula Hustedt

Amphora cf. coffeaformis (Agardh) Kützing

Amphora cf. turgida Gregory

Amphora sp.

Ardissonea cf. cristalina (Agardh) Grunow

Asterionellopsis glacialis (Castracane) Round

Asteromphalus parvulus Karsten

Bacteriastrum cf. elongatum Cleve

Bacteriastrum delicatulum Cleve

Bacteriastrum furcatum Shadbolt

Bacteriastrum hyalinum Lauder

Biddulphia sp.

Biremis sp.

Ceratulina cf. dentata Hasle

Ceratulina cf. pelagica (Cleve) Hendey

Chaetoceros affinis Lauder

Chaetoceros atlanticus Cleve

Chaetoceros cf. brevis Schütt

Chaetoceros cf. lauderi Ralfs in Lauder

Chaetoceros compressus Lauder

Chaetoceros convolutus Castracane

Chaetoceros curvisetus Cleve

Chaetoceros danicus Cleve

(Continued)

187

N. BOUZA AND M. ABOAL

Chaetoceros densus Cleve

Chaetoceros decipiens Cleve

Chaetoceros denticulatus Lauder

Chaetoceros diadema (Ehrenberg) Gran

Chaetoceros holsaticus Schuett

Chaetoceros didymus Ehrenberg

Chaetoceros lorenzianus Grunow

Chaetoceros peruvianus Brightwell

Chaetoceros pseudocurvisetus Mangin

Chaetoceros radicans Schütt

Chaetoceros rostratus Lauder

Chaetoceros similis Cleve

Chaetoceros simplex Ostenfeld

Chaetoceros socialis Lauder

Chaetoceros tenuissimus Meunier

Chaetoceros teres Cleve

Chaetoceros tetrastichon Cleve

Chaetoceros vixvisibilis Schiller

Chaetoceros sp1.

Chaetoceros sp2.

Chaetoceros sp3.

Chamaepinnularia alexandrowiczii Witkowski

Cocconeis cf. scutellum Ehrenberg

Cocconeis cf. haunensis Witkowski

Cyclotella litoralis Lange-Syvertsen

Cyclotella striata (Kützing) Grunow

Cylindrotheca closterium (Ehrenberg) Reimann et Lewin

cf. Cymatosira sp.

Dactyliosolen cf. blavyanus (Peragallo) Hasle

(Continued)

TABLE 1. (Cont)

188

PHYTOPLANKTON IN SW MEDITERRANEAN SEA

Dactyliosolen cf. fragilissimus (Bergon) Hasle

Dactyliosolen cf. phuketensis (Sundström) Hasle

Detonula cf. confervacea (Cleve) Gran

Detonula pumila (Cleve) Grunow

Diploneis sp.

Diploneis bombus Ehrenberg

Diploneis decipiens var. paralella Cleve

Diploneis cf. ovalis-eliptica Hilse

Dytilum brightwellii (West) Grunow

Entomoneis sp.

Eucampia sp.

Eucampia zodiacus Ehrenberg

Eucampia zodiacus cf. cylindricornis Syvertsen

Ethmodiscus sp.

Falcula sp.

Fallacia hyalinula (De Toni) Stickle & Man

Fragilariopsis rhombica (O’Meara) Hustedt

Guinardia delicatula (Cleve) Hasle

Guinardia striata (Stolterfoth) Hasle

Hemiaulus hauckii Grunow

Hemiaulus sinensis Greville

Lauderia annulata Cleve

Leptocilyndrus danicus Cleve

Leptocilyndrus mediterraneus (Peragallo) Hasle

Leptocilyndrus minimus Gran

Licmophora sp.

Lioloma cf. delicatulum (Cupp) Hasle

Mastogloia sp.

Melosira cf. nummuloides Agardh

Meuniera membranacea (Cleve) Silva

(Continued)

189

N. BOUZA AND M. ABOAL

Minidiscus triocularis (Taylor) Hasle

cf. Nanoneis hasleae (Norris)

Navicula sp.

Navicula cf. korzeniewskii Witkowski

Navicula cf. halinae Witkowski

Nitzschia sp.

Nitschia compressa (Bailey) Boyer

Nitschia cf. bicapitata Cleve

Nitzschia closterium (Ehrenberg) Smith

Nitzschia longissima Brébisson

Nitzschia panduriformis var. continua Grunow

Nitzschia cf. sicula (Castracane) Hustedt

Nitzschia cf. reversa Smith

Odontella mobiliensis (Bailey) Grunow

Oestrupia sp.

Placoneis cf. gastrum Cox

Pleurosigma normanii Ralfs in Pritchard

Porosira cf. pentaportula Syvertensen & Lange

Pseudo-nitzschia cf. australis Frenguelli

Pseudo-nitzschia cf. delicatissima (Cleve) Heiden

Pseudo-nitzschia cf. fraudulenta (Cleve) Hasle

Pseudo-nitzschia cf. lineola (Cleve) Hasle

Pseudo-nitzschia subcurvata (Haslle) Fryxell

Pseudo-nitzschia sp.

Pseudosolenia cf. calcar-avis (Schultze) Sundström

Proboscia alata (Brightwell) Sundström

Rhizosolenia castracaeni Peragallo

Rhizosolenia imbricata Brightwell

Rhizosolenia fragilisima Bergon

(Continued)

TABLE 1.

(Cont)

190

PHYTOPLANKTON IN SW MEDITERRANEAN SEA

Rhizosolenia setigera Brightwell

Rhizosolenia sp.

Rhizosolenia striata Greville

Rhopalodia cf. musculus (Kützing) Müller

Skeletonema pseudocostatum (Medlin) Zingone et Sarno

Stephanopyxis sp.

Stephanopyxis palmeriana (Greville) Grunow

Synedropsis hyperborea (Grunow) Hasle

Suriella brebissonii Krammer & Lange-Bertelot

Suriella sp.

Thalassiosira cf. anguste-lineola (Schmidt)

Thalassiosira cf. allenii- diporocyclus Hasle

Thalassiosira cf. oestrupii var. veurickae Fryxell

Thalassiosira binata Fryxell

Thalassiosira cf. ecchinata Semina

Thalassiosira leptopus Grunow

Thalassiosira mediterranea (Schröder) Hasle

Thalassiosira punctigera (Castracane) Hasle

Thalassiosira rotula Meunier

Thalassiosira tenera Proschkina-Lavrenko

Thalassiosira sp1.

Thalassiosira sp2.

Thalassionema nitzschioides (Grunow) Mereschkowsky

DINOPHYCEAE

Achradina pulchra Lohmann

Alexandrium sp.

Alexandrium affine (Inoue & Fukuyo) Balech

Alexandrium cf. concavum (Gaarder) Balech

Amphidinium lacustre Stein

Amphidinium sphenoides Wulff

(Continued)

191

N. BOUZA AND M. ABOAL

TABLE 1.

Amphidinium sp.

Amylax sp.

Centrodinium sp.

Ceratocorys horrida Stein

Ceratium azoricum Cleve

Ceratium candelabrum (Ehrenberg) Stein

Ceratium declinatum (Karsten) Jörgensen

Ceratium furca (Ehrenberg) Claparède & Lachmann

Ceratium fusus (Ehrenberg) Dujardin

Ceratium cf. incisum (Karsten) Jörgensen

Ceratium macroceros (Ehrenberg) Vänhoffen

Ceratium massiliense (Gourret) Jorgensen

Ceratium teres Kofoid

Ceratium trichoceros (Ehrenberg) Kofoid

Corythodinium tesselatum (Stein) Loeblich & Loeblich

Dinophysis acuminata Claparède & Lachmann

Dinophysis caudata Saville-Kent

Heterocapsa sp.

Heterodinium cf. dispar Kofoid & Adamson

Histioneis longicollis Kofoid

Histioneis cf. cymbalaria Stein

Goniodoma polyedricum (Pouchet) Jorgensen

Goniodoma sphaericum Murray & Whitting

Gonyaulax sp.

Gonyaulax pacifica Kofoid

Gonyaulax polygrama Stein

Gonyaulax cf. scrippsae Kofoid

Gonyaulax cf. spinifera (Claparède & Lachmann) Diesing

Gonyaulax cf. verior Sournia

(Continued)

(Cont)

192

PHYTOPLANKTON IN SW MEDITERRANEAN SEA

Gotoius abei Matsuoka

Gymnodinium cf. catenatum Graham

Gymnodinium impudicum Fraga & Bravo

Mesoporos perforatus (Gran) Lillick

Nematodinium sp.

Noctiluca scintillans (Macartney) Kofoid & Swezy

Ornithocercus magnificus Stein

Ostreopsis cf. ovata Fukuyo

Oxytoxum longiceps Schiller

Oxytoxum cf. ovale Schiller

Oxytoxum scolopax Stein

Phalacroma rotundatum (Claparède & Lachmann) Kofoid & Michener

Podolampas spinifera Okamura

Podolampas palmipes Stein

Prorocentrum balticum (Lohmann) Loeblich

Prorocentrum compressum (Bailey) Abé ex Dodge

Prorocentrum micans Ehrenberg

Prorocentrum balticum (Lohmann) Loeblich

Prorocentrum gracile Stein

Prorocentrum triestinum Schiller

Protoceratium aerolatum Kofoid

Protoperidinium sp.

Protoperidinium crassipes Kofoid

Protoperidinium cerasus (Paulsen) Balech

Protoperidinium divergens (Ehrenberg) Balech

Protoperidinium mediterraneum (Kofoid) Balech

Protoperidinium biconicum Dangeard

Roscoffia sp.

Scrippsiella cf. trochoidea (Stein) Loeblich

Spiraulax sp.

(Continued)

193

Triadinium polyedricum (Pouchet) Dodge

N. BOUZA AND M. ABOAL

DICTYOCHOPHYCEAE

Dictyocha fibula Ehrenberg

Dictyocha cf. speculum Ehrenberg

Dictyocha staurodon Ehrenberg

Octatis cf. octanaria (Ehrenberg) Hovasse

EBRIIDEA

Hermesinum adriaticum Zacharias

CHRYSOPHYCEAE

Meringosphaera mediterranea Lohmann

CHRYPTOPHYCEAE

Cryptomonas sp.

EUSTIGMATOPHYCEAE

Nannochloropsis sp.

EUGLENOPHYCEAE

Eutreptiella sp.

4. Acknowledgements

The study was supported by Group M. Torres S.L. with a project: Análisis

del control físico-químico y biológico del proceso de desalación por ósmosis

inversa por energía eólica en plataformas flotantes.

References

Balech, E., 1988, Dinoflagelados del Atlántico sudoccidental, Pub. Esp. Inst. Español de

Oceanogr 1, Madrid. pp. 1–310.

Béthoux, J.P., 1989, Oxygen consumption, new production, vertical advection and environ-

mental evolution in the Mediterranean Sea, Deep Sea Res. 36: 769–781.

Calvin, J.C., Franco-Navarro, I., Martínez-Inglés, A.M., Marín, A., and Belando, A., 1998,

El litoral sumergido de la Región de Murcia. Cartografía bionómica y valores ambientales.

TABLE 1. (Cont.)

194

Consejería de Medio Ambiente, Agricultura y Agua, 127 pp.

PHYTOPLANKTON IN SW MEDITERRANEAN SEA

Claustre, H., Kerhervé, P., Marty, J.C., Prieur, L., Videau C., and Hecq, J.H., 1994, Phyto-

plankton dynamics associated with a geostrophic front: Ecological and biogeochemical

implications, J. Mar. Syst. 52: 711–742.

Cros, L. and Fortuño, J.M., 2002, Atlas of northwestern Mediterranean coccolithophores,

Sci. Mar. 66:(Suppl. 1.): 1–186.

Delgado, M., 1990, Phytoplankton distribution along the Spanish coast of the Alborán Sea,

Sci. Mar. 54: 169–178.

Delgado, M. and Fortuño, J.M., 1991, Atlas de Fitoplancton del Mar Mediterráneo, Sci. Mar.

55(Suppl. 1): 1–33.

Estrada, M., Marrasé, C., Latasa, M., Berdalet, E., Delgado, M., and Riera, T., 1993,

Variability of deep chlorophyll maximum in the Northwestern Mediterranean, Mar. Ecol.

Prog. Ser. 92: 289–300.

Estrada, M., Varela, R.A., Salat, J., Cruzado, A., and Arias, E., 1999, Spatio-temporal

variability of the winter phytoplankton distribution across the Catalan and North Balearic

fronts (NW Mediterranean), J. Plankton Res. 21: 1–20.

Fiala, M., Sournia, A., Claustre, H., Marty, J.C., Prieur, L., and Vétion, G., 1994, Gradients

of phytoplankton abundance, composition and photosynthetic pigments across the

Almería-Oran front (SW Mediterranean Sea), J. Mar. Syst. 5: 223–233.

Gómez, F., 2003, The role of the exchanges through the Strait of Gibraltar on the budget of

elements in the Western Mediterranean Sea: consequences of human-induced modify-

cations, Mar. Pollut. Bull. 46: 685–694.

Hallegraff, G.M., Anderson, D.M., and Cembella, A.D., 2003, Manual on Harmful Marine

Microalgae. Monographs on Oceanographic Methodology, UNESCO Publishing, France,

793 pp.

Horner, R.A., 2002, A taxonomic guide to some common marine phytoplankton, Biopress

Limited, England, 195 pp.

Margalef, R., 1969, Small scale distribution of phytoplankton in Western Mediterranean at

the end of July, Pubbl. Staz. Zool. Napoli. 37: 40–61.

Matsuoka, K. and Fukuyo, Y., 2000, Guía técnica para el estudio de quistes de dino-

flagelados actuales, WESTPAC-HAB/WESTPAC/IOC UNESCO Publishing, France,

30 pp.

Mercado, J.M., Ramírez, T., Cortés, D., Sebastián, M., and Vargas-Yañez, M., 2005, Seasonal

and inter-annual variability of the phytoplankton communities in an upwelling area of

the Alborán Sea (SW Mediterranean Sea), Sci. Mar. 69: 451–465.

Ojeda, A., 2006, Dinoflagelados de Canarias: estudio taxonómico y ecológico, Instituto de

Estudios Canarios, Santa Cruz de Tenerife, 436 pp.

Prieur, L. and Sournia, A., 1994, “Almofront-1”(April-May 1991): an interdisciplinary study

of the Almería-Oran geostrophic front, SW Mediterranean Sea, J. Mar. Syst. 5: 187–203.

Reul, A., Rodríguez, V., Jimenéz-Gómez, F., Blanco, J.M., Bautista, B., Sarhan, T., Guerrero, F.,

size-structure of phytoplankton across an upwelling area in the NW-Alboran Sea (W-

Mediterranean), Cont. Shelf Res. 25

(5–6): 589–608.

Ricard, M., 1987, Atlas du phytoplancton marin. vol II. Diatomophycées, Centre National de

la Recherche Scientifique, Paris, 297 pp.

Rivera, M.C., 2004, Estudio taxonómico de las diatomeas planctónicas del litoral andaluz.

Caracterización de las comunidades potencialmente tóxicas, PhD tesis, Universidad de

Granada, 449 pp.

Ros, M., and Miracle, M.R., 1984, Variación estacional del fitoplancton del Mar Menor y su

relación con la de un punto próximo en el Mediterráneo, Limnética. 1: 32–42.

Ruíz, J., and García-Lafuente, J., 2005, Variability in the spatio-temporal distribution and

195

N. BOUZA AND M. ABOAL

Round, F.E., Crawford, R.M., and Mann, D.G., 1990, The diatoms. Biology and Morphology

of genera, Cambridge University Press, Cambridge, 758 pp.

Sournia, A., 1973, La production primaire planctonique en Méditerranée: Essai de mise a

jour, Bull. Étude Commun. Méditerranée, 5: 1–128.

Tomas, C.R., 1997, Identifying Marine Phytoplankton, Academic Press, San Diego, 858 pp.

Travers, A. and Travers, M., 1975, Catalogue du microplancton du Golfe de Marseille, Int.

Revue. Ges. Hydrobiol. 60: 251–276.

Videau, C., Sournia, A., Prieur, L., Fiala, M., 1994, Phytoplankton and primary production

characteristics at selected sites in the geostrophic Almeria-Oran front system (SW

Mediterranean Sea). J. Mar. Syst. 5: 235–250.

Vila, M. and Masó, M., 2005, Phytoplankton functional groups and harmful algal species in

anthropogenically impacted waters of the NW Mediterranean Sea, Sci. Mar. 69: 31–45.

Vila, M., Camp, J., Garcés, E., Masó, M., and Delgado, M., 2001a, High resolution spatio-

temporal detection of potentially Harmful dinoflagellates in confined waters of the NW

Mediterranean. J. Plankton Res. 23(5): 497–514.

Vila, M., Delgado, M., and Camp, J., 2001b, First detection of widespread toxic events

caused by Alexandrium catenella in the Mediterranean Sea, in: Harmful Algal Blooms

2000, G. Hallegraeff, S. Blackburn, C. Bolch and R. Lewis (Eds.), Intergovernmental

Oceanographic Commision of UNESCO, Paris, pp. 8–11.

Viliþiü, D., Marasovic, I., and Miokovic, D., 2002, Checklist of phytoplankton in the eastern

Adriatic Sea. Acta Bot. Croat. 61(1):57–91.

Witkowski, A., Lange-Bertalot, H., and Metzeltin, D., 2000, Diatom Flora of Marine Coasts

I. Iconographia Diatomologica Vol. 7. A.R.G. Gantner Verlag K.G., Ruggell, Liechtenstein.

196

dinophycees, raphidophycees, Centre National de la Recherche Scientifique, Paris, 219 pp.

Sournia, A., 1986, Atlas du phytoplankton marin. vol I. cyanophycees, dictyochophycees,

V. Evangelista et al. (eds.), Algal Toxins: Nature, Occurrence, Effect and Detection.

TOXIC PSEUDO-NITZSCHIA POPULATIONS

FROM THE MIDDLE TYRRHENIAN SEA (MEDITERRANEAN

SEA, ITALY)

ROBERTA CONGESTRI*, SIMONA POLIZZANO

AND PATRIZIA ALBERTANO

Department of Biology, University of Rome

“Tor Vergata” – Via della Ricerca Scientifica,

00173 Rome, Italy

domoic acid (DA), a neurotoxic aminoacid responsible for Amnesic Shellfish

Poisoning (ASP) in humans and animals worldwide. Pseudo-nitzschia spp.

are widespread along Italian coast, however current knowledge of their

diversity, temporal succession and potential toxicity is limited to restricted

areas. Blooms of these diatoms have been increasingly recorded along the

Latium region coast (Middle Tyrrhenian Sea, Mediterranean Sea) in the last

decades prompting investigation of Pseudo-nitzschia diversity and potential

toxicity in natural communities from coastal stations over one year. Results

of the taxonomical analysis are here reported together with distribution data,

at species complex resolution, that were collected during a regional long-

term program. Transmission electron microscopy on acid cleaned frustules

ascertained the presence and identity of eight Pseudo-nitzschia species, six

of which are known ASP producers. One species, P. inflatula, is reported for

the first time from Italian waters. Distributional data evidenced coexistence

of different species during blooms, seasonal cycles and inter-annual vari-

ability, abundances of the genus reached 10

cell/l

–1

Keywords: Pseudo-nitzschia spp., ultrastructure, domoic acid, distribution, Middle

______

*To whom correspondence should be addressed. Roberta Congestri, Department of Biology,

congestri@uniroma2.it

University of Rome “Tor Vergata” – Via della Ricerca Scientifica, 00173 Rome, Italy. Email:

197

Abstract: Several diatoms of the genus Pseudo-nitzschia are able to produce

Tyrrehnian Sea

R. CONGESTRI, S. POLIZZANO AND P. ALBERTANO

1. Introduction

Needle-shaped, raphid diatoms belonging to the planktonic marine genus

Pseudo-nitzschia H. Peragallo have been shown to be the causative agent of

Amnesic Shellfish Poisoning, ASP, in humans (Bates et al., 1989) and for

extensive sea fauna deaths in the last decades (Scholin et al., 2000; Shumway

et al., 2003). Eleven Pseudo-nitzschia species are currently known to produce

domoic acid, DA, (Lundholm and Moestrup, 2007) a neurotoxic aminoacid

that accumulates through foodweb impacting marine organisms, human

consumers, causing serious neurological disorders, and ultimately ecosystems

and economy. The presence of these widespread, chain forming microalgae

has frequently been recorded in Italian coastal waters, particularly following

2001, when a national environmental monitoring program was started at

500 m offshore stations using light microscopy to identify phytoplankton.

Intense proliferations of Pseudo-nitzschia were also repeatedly observed during

long term programs carried out along Latium, Campania and Apulia region

coasts (Congestri et al., 2004; Caroppo et al., 2005; Congestri et al., 2006;

Zingone et al., 2006). Strains of two species, Pseudo-nitzschia galaxiae and

P. multistriata, isolated from the Gulf of Naples, proved to be toxic (Sarno

and Dahlman, 2000; Cerino et al., 2005). However, DA was never detected

in mussels collected from Italian sites although it has been reported for French

Mediterranean (Amzil et al., 2001) and Greek stocks (Kaniou-Grigoriaou

et al., 2005).

To date, knowledge of Pseudo-nitzschia occurrence, seasonal dynamics

and potential toxicity in Italian waters is restricted to few areas. Spot studies

on Pseudo-nitzschia diversity and sporadic (non-mandatory) control of DA

in seafood contribute to a limited awareness of the real risk of contamination

and human poisoning. This is mostly due to the need of a very high level of

taxonomical expertise to detect the subtle ultrastructural differences between

species and harmful and non-harmful members of this genus. Frustule details

are crucial for identification and only visible with transmission electron

microscopy (TEM), but TEM equipment is not routinely used during algal

surveillance programs. Consequently, monitoring of phytoplankton to pro-

tect human health and fisheries during a Pseudo-nitzschia bloom is time

consuming and this prevents in many cases early warning procedures aimed

to mitigate potential danger. Difficulties in assessing true Pseudo-nitzschia

identity and the considerable interest in having fast and accurate response

on its potential toxicity all over the world has led to the development of

molecular tools to assist identification at the species level. DNA probes,

targeting specific rDNA sequences of DA producers, were designed to dis-

criminate between species of Pseudo-nitzschia (Miller and Scholin, 1996;

1998; Scholin et al., 1996). However this approach gave controversial results

198

when applied to natural communities, preventing a clear-cut separation between

specimens (Parsons et al., 1999; Orsini et al., 2002). It is also known that the

potential to produce DA varies across clones of the same species and with

cell nutrient status and life cycle (Pan et al., 1996; Bates et al., 1998),

leading to a possible lack of correlation between the abundance of potentially

toxic Pseudo-nitzschia registered in the water samples during conventional

that countermeasures may be taken in presence of non-toxic populations or,

alternatively, that very rare but extremely toxic organisms are overlooked.

To meet the need of monitoring Pseudo-nitzschia spp. dynamics and

their potential toxicity along Latium region coast, a 2-phase approach that

coupled fine ultrastructural examination of field samples and “real time”

toxin analysis, using Screen Printed Electrodes (SPEs, Congestri et al., sub-

mitted), was applied on samples collected over one year. Direct detection of

DA presence in “critical” (comprising potential toxin producers) phyto-

plankton matrices with SPEs allow an optimised and reliable monitoring

tool to respond to safe food resources demand, making also possible the

traceability of toxin along the food chain. This approach minimises prob-

ability of seafood contamination by development of prevention strategies

based on early warning measures and contingency plans (Palleschi et al.,

2002, Albertano et al., this volume).

Here we report on the identity of Pseudo-nitzschia populations in samples

collected over the year of study together with Pseudo-nitzschia distribution

data, at species complex resolution, that were gathered during a regional

long term program based on light microscopical analysis of phytoplankton.

submitted).

2. Materials and Methods

The taxonomical investigation was conducted on concentrated phytoplank-

ton collected fortnightly at 6 stations along the Latium region coast over one

year (January 2001–December 2002). Samples were obtained by horizontal

net (20 Pm-mesh) tows. Aliquots were fixed in 2.5% glutaraldehyde for

electron microscopical analysis, others opportunely treated and stored for

DA determination by HPLC and SPEs (Micheli et al., 2004; Congestri

et al., submitted). Measurements of cell and frustule dimensions and evalu-

ation of cell and chain shape were mainly based on light microscopical

(LM) analysis of uncleaned material using a Zeiss Axioskop microscope at

40 and 100 × magnification. Ultrustructural details as density of striae (rows

PSEUDO-NITZSCHIA SPP. ALONG LATIUM COAST

niques gave positive results that are reported elsewhere (Congestri et al.,

Parallel toxin analysis using SPEs and validated by means of HPLC tech-

cell counts, or by means of probes, and their toxicity. This involves the risk

199

R. CONGESTRI, S. POLIZZANO AND P. ALBERTANO

of perforations, poroids, across the valve thickness) and fibulae (bridges of

silica between portions of the valve margin that bears the raphe, adjacent

fibulae are separated by interspaces) presence of a central larger interspace,

poroid structure and arrangement and also girdle band features, were examined

on acid (HNO

and H

) cleaned samples, air-dried on formvar-coated

copper grids, using a Zeiss CEM 902 transmission electron microscope,

TEM, at 80 KV.

3. Results and Discussion

3.1. MORPHOLOGICAL AND ULTRASTRUCTURAL DIVERSITY

OF PSEUDO-NITZSCHIA ALONG THE LATIUM COAST

Morphometric traits as frustule shape, size of apical and transapical axes

(the valve length and width respectively, when measurements are performed

in valve view), and morphology of frustule apices together with the degree

of cell end overlap in the stepped colonies, contributed to primary, gross

distinction of a number of different Pseudo-nitzschia “morphotypes” in the

samples. Analysis of data gathered during LM investigation in the light of

following taxonomical revision of the genus, especially of the Nitzschia

delicatissima complex sensu Hasle (1965), allowed to distinguish between

six different morphospecies with light microscopy.

Colonies of linear cells with rounded apices in valve view and with

distinctive sigmoid valve ends in girdle view, of approximately 50 Pm in

length and 3–3.2Pm in width, were rather easily attributed to Pseudo-

nitzschia multistriata (Takano) Takano (Fig. 1 a, b).

Chains of lanceolate cells of about 20 Pm in length, with a central swelling,

in valve view, visible with LM (Fig. 1 c, d), and formerly attributed to Pseudo-

nitzschia prolongatoides, have been assigned to P. galaxiae Lundholm

et Moestrup following Lundholm and Moestrup (2002). Field specimens

and strains from the Gulf of Naples have been shown to undergo dramatic

mor-phological alternation during the seasonal cycle, with dimension of

apical axis ranging between 10 and 80 Pm and visible change in frustule

shape, from linear cells, typical of the larger stages, to rostrate solitary

smaller individuals (Cerino et al., 2005). We did not observe P. galaxiae in

cleaned material under TEM, but the morphometric features of the colonial

forms observed during cell counts unequivocally point to P. galaxiae. In

any case, the presence of this species could have been overlooked during

monitoring activities based on LM, as the larger stages could be confused

with P. delicatissima sensu Hasle (1965).

200

Gross morphological features revealed during LM analysis allowed to

attribute fusiform cells of about 5–6 Pm in width and 76–114 Pm long to

the Nitzschia seriata complex sensu Hasle (1965). This morphotype, readily

distinguishable in valve view had pointed apices with an overlap of adjacent

cell endings in the colonies of about 1/6–1/8 of cell length (Fig. 1 e, f ).

Figure 1. LM micrographs. Pseudo-nitzschia multistriata in valve, a. and girdle view,

showing valve sigmoid shape, b. Chain detail of P. galaxiae, c. note the central swelling and

overlap of adjacent valve ends, d. Girdle view of two lanceolate cells of P. fraudulenta in

chain, e. the overlap of pointed apices in the close-up, f. Pseudo-nitzschia delicatissima

sensu Hasle (1965) a short overlap of truncated valve apices was visible in girdle view of the

linear valves, g. Chain of linear valves tapering towards pointed apices identified as P.

pseudodelicatissima sensu Hasle (1965), h. Bars =10 Pm.

PSEUDO-NITZSCHIA SPP. ALONG LATIUM COAST

TEM investigation ascertained its identity as Pseudo-nitzschia fraudu-

lenta (Cleve) Hasle. Fibulae and striae were approximately equal in numbers,

19–22 in 10 µm, with fibulae aligned with valve interstriae. Each stria had

two or three rows of poroids, there were 5–6 poroids in 1 µm. Poroid vela

consisted of hymenate sectors variable in number, usually 4 or 5. Mantle

was three poroid high (Fig. 2 a-f).

201

R. CONGESTRI, S. POLIZZANO AND P. ALBERTANO

Figure 2. TEM micrographs of Pseudo-nitzschia fraudulenta, a-f, and P. inflatula, g-l. Tip of

fusiform valve showing bi- and triseriate striae, a. that were clear at a greater magnification,

b. Valve and mantle (proximal) poroid structure in c. mantle poroid detail in e. Girdle band,

with the same pattern of striation as the valve, is shown in d. hymen of girdle band poroids

in f. Central part of the valve showing the central larger interspace and the central nodule, of

which a close up is shown in i. uniseriate striae of the valve and proximal mantle are also

visible as well as a slight swelling in the middle, g. Valve inflation was more evident at the

valve end, h. Variation in hymen structure of round to square poroids are shown in l. Bars = 2

(a, b, g, h) and 1 Pm (c, d, i, l).

Valves of Pseudo-nitzschia inflatula (Hasle) Hasle were only distin-

guished during TEM analysis. The gross morphology of this species is very

similar to that of P. pseudodelicatissima sensu Hasle (1965). During LM

examination of samples, linear cells, 80–100 µm long, with pointed apices

in both views were referred to as P. pseudodelicatissima long morphotype,

although the latter cells were wider, 1.5–2 µm, than those labelled as P.

pseudodelicatissima during LM investigation. TEM analysis clearly revealed

202

the presence of inflations in the middle and close to the apices of the valves

that together with the following features: presence of uniseriate striae, 30–34

in 10 Pm, a number of 16–20 fibulae in 10 Pm, the central larger interspace

and round to square poroids, 4–5 in 1 Pm, with the hymen divided into two

large perforated parts separated by narrow strips of silica, led to ascribe this

morphotype to P. inflatula (Fig. 2 g-l). This is the first report of this species

in Italian waters. P. inflatula has been recently reported from the Mexican

Pacific (Hernandez-Becerril and Diaz-Almeyda, 2006) and formerly by

other authors from different locations, leading to consider its distribution to

be cosmopolitan.

Linear, narrow cells about 50–70 µm long and 0.6–1.8 µm wide, taper-

ing towards the apices that had cut-off ends, with a very short cell overlap

in chains, were attributed to Pseudo-nitzschia delicatissima sensu Hasle

(1965) during LM observation (Fig. 1 g). TEM analysis of cleaned valves

revealed ultrastructural details that fitted the original description of P.

delicatissima by Hasle (1965), as biseriate striae, 32–40 in 10 µm, of tri-

angular to exagonal small poroids, approximately 8–9 in 1 Pm, with finely

hymenate vela along with the presence of the central larger interspace,

18–26 fibulae in 10 Pm and mantles one poroid high (Fig. 3 a-e). In any

case, a degree of variability was observed in our samples concerning poroid

structure and arrangement and this was also recorded for cultured and field

material from the gulf of Naples, in fact combined morphological, mole-

cular and mating studies showed the presence of five distinct lineages

within what was considered to be P. delicatissima (Orsini et al., 2004;

Amato et al., 2005). Following taxonomical re-assessment of this species,

based on ultrastructural features and genetic traits, highlighted the existence

of a complex of three different species that incorporated the variability

registered in populations previously attributed to P. delicatissima from

diverse areas of the world (Lundholm et al., 2006).

The data in our hands, based only on morphology and ultrastructure of

specimens, did not conform unequivocally to any of the two newly des-

cribed species and to the third emended taxon P. delicatissima sensu stricto.

The attribution to P. decipiens Lundholm et Moestrup or to P. delicatissima

sensu stricto remained ambiguous. Latium specimens differed from the two

taxa for the shape of poroids, that were rather irregular, not only exagonal.

The range of the transapical axis and densities of fibulae and poroids of our

material resembled those of P. delicatissima sensu stricto, but the number

of the striae was more similar to P. decipiens.

Linear, to almost linear cells of 60–100 Pm in length and 1.3–2.8 Pm

wide, tapering towards the pointed apices, both in valve and girdle view,

PSEUDO-NITZSCHIA SPP. ALONG LATIUM COAST

203

R. CONGESTRI, S. POLIZZANO AND P. ALBERTANO

Figure 3. TEM micrographs of Pseudo-nitzschia decipiens/delicatissima, a-e, and P.

calliantha, f-m. Part of the linear valve showing cut-off end, a, shown in more detail in b.

Biseriate striae were visible on the valves, c and d, finely hymenate vela of triangular to

exagonal poroids in d. Both mantles are shown in d and the central larger interspace with a

central nodule in e. Tip of one valve, f, showing pointed apex in g. The central larger

interspace and central nodule are visible in i, as the finely structured uniseriate striae, with

hymen sectors arranged in a flower fashion, m and g; the same velum pattern was observed

in the girdle bands, l. Bars = 2 (a, f), 1 (b, d, e, g, h, i, l, m) and 0.5 Pm (c).

204

and with short end overlap in the chains, were ascribed to Pseudo-nitzschia

pseudodelicatissima (Hasle) Hasle during LM observations (Fig. 1 h). TEM

analysis of frustules featuring these morphometry and gross morphology

showed that most of the valves could be attributed to the newly described

species P. calliantha Lundholm, Moestrup et Hasle. Recently, uncertainty

regarding delineation of the species P. pseudodelicatissima and P. cuspidata

(Hasle) Hasle led to the revision, based on ultrastructural and molecular data,

of the complex Pseudo-nitzschia pseudodelicatissima/cuspidata which out-

come was the description of two new species P. calliantha and P. caciantha

Lundholm, Moestrup et Hasle and the emendation of P. pseudodelicatissima

and P. cuspidata (Lundholm et al., 2003). Valves identified as P. calliantha

during TEM investigation were 80–100 Pm long and 1.3–2.0 Pm, with 33–40

striae and 18–23 fibulae in 10 Pm and the central larger interspace corres-

ponding to 5 striae. Striae were uniseriate, round to square poroids, 4–5 in 1

Pm had vela consisted of a central unperforated or hymenate part surround-

ded by five to eight hymenate sectors arranged in a circle, resembling a

flower, valve mantle was one poroid high (Fig. 3 f-m).

Wider lanceolate valves, approximately 2.1–2.8 Pm in width and 60–75 Pm

long were seldom observed in the cleaned material. Morphometry, poroid

structure and cingular band features led to a tentative attribution to P.

caciantha Lundholm, Moestrup et Hasle. The numbers of striae and fibulae

were slightly lower, 28–32 and 16–18 in 10 Pm, respectively in these spe-

cimens and poroid hymen was distinctively different, divided into four-five

sectors. Mantle was 1–2 poroids high and the first cingular band, the valvo-

copula, two poroid wide and three to five poroid high, had 36–40 striae in 10

Pm, the other cingular bands appeared shorter (Fig. 4 a-b’).

A third, rare, lanceolate morphotype, 60–90 Pm long, differed from P.

caciantha in valve width, 1.5–1.9 Pm, with much denser fibulae, 22–23,

and striae 36–40 in 10 Pm. Each stria had one row of poroids, 4–5 in 1 Pm,

and the hymen was distinctively divided in two (bipartite) perforated parts

(Fig. 4 c-e).

This morph was tentatively attributed to P. pseudodelicatissima/cuspidata

complex (Lundholm et al., 2003) as the definitive delineation of the two em-

ended species remained unclear also after detailed morphological and phylo-

genetic analysis. In any case, more recent work reported the two above

mentioned species as separated based on valve morphometry, slight dif-

ferences in valve and band striation and density of fibulae (Lundholm et al.,

2006), our specimens more closely resembled P. cuspidata

(Hasle) Hasle

emend. Lundholm, Moestrup et Hasle.

PSEUDO-NITZSCHIA SPP. ALONG LATIUM COAST

205

R. CONGESTRI, S. POLIZZANO AND P. ALBERTANO

Figure 4. TEM micrographs of Pseudo-nitzschia caciantha, a-b’ and P. pseudodelicatissima/

cuspidata, c-e. Part of valve showing uniseriate striae of poroids showing unperforated

central part of the vela surrounded 4–5 irregular arranged hymenate sectors a. Valve end

with cingular bands, b and b’, striation of the valvocopula and pattern of the other bands is

visible in b’. Central part of the valve, c, poroid structure different from the former

morphospecies is also visible, poroids appeared primarily bipartite, e, although a degree of

variation was observed, d and e. Bars = 2 (b), 1 (a, b’, c, e) and 0.5 Pm (d).

206

3.2. PSEUDO-NITZSCHIA DISTRIBUTION ALONG THE LATIUM REGION

COAST, TOXIC AND DOMINANT TAXA

There were eight different Pseudo-nitzschia morphotypes distinguished by

TEM in the samples collected at the six coastal stations monitored from

January 2001 to December 2002. Six species Pseudo-nitzschia calliantha,

P. inflatula had never been recorded in Italian waters yet.

Long term data of coastal phytoplankton collected from 1997 at the

same stations, except for the one located at the island of Zannone, allowed

to identify a total of 374 taxa, 33 of which are toxic. Distribution patterns

evidenced inter- and intra-annual variability of populations, with sharp temp-

oral fluctuations of total phytoplankton abundances that generally peaked in

summer. This reflected influence from inland input and the anthropogenic

impact (Congestri et al., 2006). In accordance, blooms of Pseudo-nitzschia

as a genus occurred in spring-summer, different species coexisted during

blooms and the more southerly stations exhibited maximum abundances,

at the species/morphotype level, in 2003. P. calliantha and P. decipiens/

delicatissima peaked in March (1.3 and 1.5 × 10

cell l

–1

), P. fraudulenta in

June (4.4 × 10

cell l

–1

) as P. galaxiae (2 × 10

cell l

–1

), but in 2002, while

P. multistriata (6.5 × 10

cell l

–1

) in August.

Further investigation on phytoplankton structure over the long-term study

using the Sanders index (Sanders, 1960) was carried out to test dominance

of individual taxa at the different sampling stations during the year of maxi-

mum abundances (2002–2003). This highlighted a degree of temporal and

spatial variability in the seasonal cycles of the different species. P. galaxiae

was more correlated with the RMB (Ladispoli, Rome) station, largely influ-

enced by the Tiber River run-off while P. decipiens/delicatissima dominated

at south, at LTD (Rio Martino, Latina) and at LTE (Monte D’Argento, Latina).

At this latter station P. decipiens/delicatissima was associated with the com-

plex of morphotypes labelled as P. pseudodelicatissima sensu Hasle (1965)

(Congestri et al., 2006). Rather more diversified patterns of the same

species were recorded in the Gulf of Naples (Zingone et al., 2006), although

higher numbers of P. fraudulenta and P. multistriata were recorded in

Latium. Conversely, in the Southern Adriatic Sea P. calliantha was strongly

correlated to winter water conditions, while the species identified as

P. delicatissima sensu Hasle (1965) had a broader seasonal distribution and

PSEUDO-NITZSCHIA SPP. ALONG LATIUM COAST

appeared independent from major environmental constraints (Caroppo et al.,

2005). Other investigation on Pseudo-nitzschia in the Northern Adriatic

waters confirmed a winter pattern, with occurrence and maximum abun-

dances of the whole genus in winter (Socal et al., 1999).

P. cuspidata, P. decipiens/delicatissima, P. fraudulenta P. galaxiae and P.

multistriata are potential DA producers (Lundholm and Moestrup 2007).

207

R. CONGESTRI, S. POLIZZANO AND P. ALBERTANO

4. Conclusions

Monitoring activities of phytoplankton require accurate identification of

microalgae coupled to fast toxicity assays for contingency plans to be deve-

loped allowing prevention or mitigation of human health and economy

impact. This study ascertained the identity of Pseudo-nitzschia populations,

the occurrence in critical numbers of potentially toxic species and their re-

current blooms along Latium region coast. Long-term data provided know-

ledge of seasonal patterns of the species distinguishable in LM, highlighting

as a consequence of the increased exploitation of marine resources. In this

scenario, fast and reliable tools, as the Screen Printed Electrodes, SPEs,

should be introduced in routine monitoring procedures for the detection of

algal toxins in diverse matrices in order to track toxins path and fate through

the food chains (Albertano et al., this volume).

References

Albertano, P., Congestri, R., Micheli, L., Moscone, D., and Palleschi, G., 2007, this volume.

Amato, A., Orsini, L., D’Alelio, D., and Montresor, M., 2005, Life cycle, size reduction patterns,

and ultrastructure of the pinnate planktonic diatom Pseudo-nitzschia delicatissima

(Bacillariophyceae). J. Phycol. 41:542–56.

Amzil, Z., Fresnel, J., Le Gal, D., and Billard, C., 2001, Domoic acid accumulation in French

shellfish in relation to toxic species of Pseudo-nitzschia multiseries and P. pseudo-

delicatissima, Toxicon 39:77–82.

Bates, S. S., and 17 co-authors, 1989, Pennate diatom Nitzschia pungens as the primary

source of domoic acid, a toxin in shellfish from eastern Prince Edwards island, Canada,

Can. J. Fish. Aquat. Sci. 46:1203–1215.

Bates, S. S., Garrison, D. L., and Horner, R. A., 1998, Bloom dynamics and physiology of

domoic-acid- producing Pseudo-nitzschia species, in: Physiological Ecology of Harmful

Algal Blooms, D. M. Anderson, A. D. Cembella, and G. M. Hallegraeff eds., Springer,

Berlin, pp. 267–292.

nitzschia calliantha Lundholm, Moestrup et Hasle and Pseudo-nitzschia delicatissima

(Cleve) Heiden in the Southern Adriatic Sea (Mediterranean Sea, Italy), J. Plank. Res.

27(8):763–774.

Cerino, F., Orsini,

L., Sarno, D., Dell’Aversano, C., Tartaglione, L., and Zingone, A., 2005,

The alternation of different morphotypes in the seasonal cycle of the toxic diatom

Pseudo-nitzschia galaxiae, Harmful Algae 4:33–48.

points at a very high risk that toxicity may suddenly arise in some areas, just

periods of maximum abundances when attention should be paid in order

to predict outbreaks and mitigate potential toxicity. To date, along Italian co-

ast potentially toxic species are more widespread than toxicity events, which

Caroppo, C., Congestri, R., Bracchini, L., and Albertano, P., 2005, On the presence of Pseudo-

208

Congestri, R., Polizzano, S., Micheli, L., Moscone, D., Palleschi, G., and Albertano, P., 2004,

On the presence of Pseudo-nitzschia spp. and domoic acid in natural samples from the

middle Tyrrhenian Sea (Mediterranean Sea). XI

International Conference on Harmful

Congestri, R., Sangiorgi, V., Bianco, I., Capucci, E., and Albertano, P., 2006, Il fitoplancton

delle coste laziali dal 1997 ad oggi: struttura della comunità, taxa dominanti e specie

tossiche, Biol. Mar. Medit. 13(1):54–60.

Hasle, G. R., and Syvertsen, E. E., 1997, Marine diatoms, in: C. R. Tomas, ed., Identifying

Marine Phytoplankton. Academic Press, San Diego, pp. 5–385.

Hasle, G. R., 1965, Nitzschia and Fragilariopsis species studied in the light and electron

microscopes. II. The group Pseudonitzschia, Skr. Nor. Vidensk-Akad. Oslo Part I. Mat-

Naturvidensk. Kl. 18:1–45.

Hernandez-Becerril, D. U., and Diaz-Almeyda, E. M., 2006, The Nitzschia bicapitata group,

new records of the genus Nitzschia, and further studies on species of Pseudo-nitzschia

(Bacillariophyta) from Mexican Pacific coast, Nova Hedw. Beih. 130:293–306.

Kaniou-Grigoriadou, I., Mouratidou, T., and Katikou, P., 2005, Investigation on the presence

of domoic acid in Greek shellfish, Harmful Algae 4:717–723.

Lundholm, N., and Moestrup, Ø., 2002, The marine diatom Pseudo-nitzschia galaxiae sp.

nov. (Bacillariophyceae), morphology and phylogenetic relationships Phycologia 41:

594–605.

Lundholm, N., and Moestrup, Ø., 2007, IOC Reference List of Toxic Pseudo-nitzschia species,

www.bi.kv.dk/IOC/group1.asp.

Lundholm, N., Moestrup, Ø., Hasle, G. R., and Hoef-Emden, K., 2003, A study of the

Pseudo-nitzschia pseudodelicatissima/cuspidata complex (Bacillariophyceae): what is

P. pseudodelicatissima? J. Phycol. 39:797–813.

Lundholm, N., Moestrup, Ø., Kotaki, Y., Hoef-Emden, K., Scholin, C., and Miller, P., 2006,

Inter- and intraspecific variation of the Pseudo-nitzschia delicatissima complex (Bacil-

lariophyceae) illustrated by rRNA probes, morphological data and phylogenetic analyses,

J. Phycol. 42:464–481.

Micheli, L., Radoi, A., Guarrina, R., Massaud, R., Bala, C., Moscone, D., and Palleschi, G.,

2004, Disposable immunosensors for the determination of domoic acid in shellfish,

Biosens. Bioelectron. 20:190–196.

Miller, P. E., and Scholin, C. A., 1996, Identification of cultured Pseudonitzschia (Bacil-

lariophyceae) using species-specific LSU rRNAtargeted fluorescent probes, J. Phycol.

32:646–55.

Miller, P. E., and Scholin, C. A., 1998, Identification and enumeration of cultured and wild

Pseudo-nitzschia (Bacillariophyceae) using species-specific LSU rRNA-targeted fluores-

cent probes and filter-based whole cell hybridization. J. Phycol. 34:371–82.

Orsini, L., Procaccini, G., Sarno, D., and Montresor, M., 2004, Multiple rDNA ITS-types

within the diatom Pseudo-nitzschia delicatissima (Bacillariophyceae) and their relative

abundances across a spring bloom in the Gulf of Naples, Mar. Ecol. Prog. Ser. 271:87–98.

PSEUDO-NITZSCHIA SPP. ALONG LATIUM COAST

Algal Blooms. Cape Town, South Africa, Abstract Book 93 pp.

209

Congestri, R., Micheli, L., Radoi, A., Polizzano, S., Albertano, P., and Palleschi, G., 2008,

Drugs submitted.

Sensing the risk: disposable immunosensors for domoic acid monitoring in the sea, Mar.

toxin analysis and phylogenetic relationships with other Pseudo-nitzschia species, Eur.

J. Phycol. 37:247–257.

Orsini, L., Sarno, D., Procaccini, G., Poletti, R., Dahlmann, J., and Montresor, M., 2002, Toxic

Pseudo-nitzschia multistriata (Bacillariophyceae) from the Gulf of Naples: morphology,

R. CONGESTRI, S. POLIZZANO AND P. ALBERTANO

Palleschi, G., Moscone, D., Micheli, L., and Botta, D., 2002, Rapid detection of seafood toxins,

in: Safety and quality issues in fish processing H. A. Bremner ed., Woodhead Publishing

Limited, Cambridge, UK, pp.142–160.

Pan, Y., Bates, S. S., and Cembella, A. D., 1998, Environmental stress and domoic acid pro-

duction by Pseudo-nitzschia: a physiological perspective, Nat. Toxins 6:127–135.

Parsons, M. L., Scholin, C. A., Miller, P. E., Doucette, G. J., Powell, C. L., Fryxell, G. A.,

Dortch, Q., and Soniat, T. M., 1999, Pseudonitzschia species (Bacillariophyceae) in

Louisiana coastal waters: molecular probe field trials, genetic variability and domoic

acid analyses, J. Phycol. 35: 1368–78.

Sanders, H. L., 1960, Benthic studies in Buzzard bay, Limnol. Oceanog. 5:138–153.

Sarno, D., and Dahlmann, J., 2000, Production of domoic acid in another species of Pseudo-

nitzschia: P. multistriata in the Gulf of Naples (Mediterranean Sea), Harmful Algae

News 21:5.

Scholin, C. A., and 25 co-authors, 2000, Mortality of sea lions along the central California

coast linked to a toxic diatom bloom, Nature 403:80–84.

Scholin, C. A., Buck, K. R., Britschgi, T., Cangelosi, G., and Chavez, F. P., 1996., Identifi-

cation of Pseudo-nitzschia australis (Bacillariophyceae) using rRNA-targeted probes in

whole cells and sandwich hybridization formats, Phycologia 35:190–197.

Shumway, S. E., Allen, S. M., and Dee Boersma, P., 2003, Marine birds and harmful algal

blooms: sporadic victims or under-reported events, Harmful Algae 2:1–17.

Socal, G., Boldrin, A., Bianchi, F., Civitarese, G., De Lazzari, A., Rabitti, S., Totti, C., and

Turchetto, M., 1999, Nutrient, particulate matter and phytoplankton variability in the

photic layer of the Otranto Strait, J. Marine Syst., 20:381–398.

Zingone, A., Siano, R., D’Alelio, D., and Sarno, D., 2006, Potentially toxic and harmful

microalgae from coastal waters of the Campania region (Tyrrhenian Sea, Mediterranean

Sea), H armful Algae 5:321–337.

210

V. Evangelista et al. (eds.), Algal Toxins: Nature, Occurrence, Effect and Detection.

ALGAL BLOOMS IN ESTONIAN SMALL LAKES

AIMAR RAKKO*, REET LAUGASTE AND INGMAR OTT

Institute of Agricultural and Environmental Sciences,

Estonian University of Life Science, Centre for Limnology,

61117 Rannu, Tartu County Estonia

Abstract. The database of the Centre for Limnology includes phytoplankton

material from 500 lakes: this represents approximately 21% the total num-

ber of the lakes in Estonia. A phytoplankton biomass value greater than

8 mg L

–1

was set as the limit criteria for further investigation. Blooms of cyano-

bacteria have been the most frequent and intensive: 20 different species of

cyanobacterial blooms in different lake types have been detected in approxi-

mately 15% of the Estonian lakes. Until 1970s, the most widely distributed

phytoplankton mass occurrences were caused by genera Microcystis and

Anabaena. After that period changes in plankton communities took place

and chroococcal cyanobacteria were replaced by filamentous forms, e.g.

Planktothrix, Aphanizomenon and Limnothrix. From that period onward

cyanobacterial biomasses have diminished, probably because of a decreased

nutritient load from agriculture. Raphidophyte Gonyostomum semen was

firstly recorded in the beginning of 1980s and up to now this species has

been found in more than 80 lakes, which belong to three different limnologi-

cal type: dystrophic, semidystrophic and oligotrophic. In addition, blooms of

chrysophytes, dinoflagellates, cryptophytes and chlorophytes were also

documented.

Keywords: Estonian lakes; algal blooms; cyanobacteria; Gonyostomum semen.

______

*To whom correspondence should be addressed. Aimar Rakko, Institute of Agricultural and

Environmental Sciences, Estonian University of Life Science, Centre for Limnology, 61117 Rannu,

Tartu County Estonia. Email: aimar.rakko@limnos.ee

211

A. RAKKO, R. LAUGASTE AND I. OTT

1. Introduction

There are about 2300 small lakes with an aquatory greater than 1 hectare in

Estonia which cover 4.8% of its territory (Tamre, 2006). The two largest

lakes Peipsi and Võrtsjärv (Figure 1) together make up for 87% of the area

of lakes. Roughly 50% of lakes are less than 3 hectares in size; only 45

lakes have a surface area of more than 100 hectares. Most of the lakes are

shallow: only 46 of them reach a depth of 15 or more metres (the deepest is

L. Rõuge Suurjärv with a depth of 38 m). According to the limnological

typology elaborated by Mäemets (1974; 1976) eight lake types can be found

acterized by a specific complex of fauna and flora and a certain matter and

energy circulation. This typology is based on the natural accumulation type,

very similar to the principles of Water Framework Directive of EU (2000)

and differs in principle from the typology that can be found in the literature

and which is based on the trophic state.

1.1. ALGAL-BLOOMS IN ESTONIAN LAKES

Algal blooms have been a regular phenomenon in Estonian small lakes.

Probably these blooms are as old as the formation period of lakes, which

started about 12000–13000 years ago when the continental ice retreated

from the present territory of Estonia. However, these blooms are reported to

have increased in frequency, biomass, and duration in recent decades, pre-

sumably in response to anthropogenic eutrophication (Ott and Kõiv, 1999).

The principal factors influencing the lakes have been (1) diffuse and point

source nutrient load from agriculture, (2) sewage water from rural areas, (3)

industrial waste water, (4) drainage and soil amelioration, (5) airborne

pollution from industrial areas (Laugaste, 1994, Mäemets et al., 1994). The

most intensive nutrient load originated from agriculture which culminated

in the years 1985–1988, contributed about 50–60% of the total nutrient

loading to Estonian lakes. From the late 1980s this loading decreased due to

a significant drop in the use of mineral fertilizers (Loigu, 1993). After that

period the ecological status of many lakes started to improve rapidly. The

improvement however is not relevant to all the lakes, mainly because of a

higher internal nutrient load.

1.1.1. Cyanobacteria

Cyanobacterial blooms (biomass >8 g L

–1

) have been detected in approxi-

mately 15% of the Estonian lakes. The blooms are caused by 20 different

212

in Estonia: oligotrophic (8% of the lakes), semidystrophic (6%), dystrophic

(6%), eutrophic+hypertrophic (36–37%), mixotrophic (36–37%), siderotrophic

(0,2%), halotrophic (1,4%) and alkalitrophic (2,6%). Each type can be char-

BLOOMS IN ESTONIAN LAKES

Figure 1. Location of Estonian lakes (Kask, 1979).

species in different lake types, even in oligotrophic lakes. Cyanobacterial

blooms were recorded for the first time in Estonian lakes at the beginning of

the 20

century (Olli, 1996). These blooms typically occurred in midsum-

mer and dominant species were Anabaena lemmermanni, A. flos-aquae ja

Microcystis aeruginosa. In the 1950s when more comprehensive studies of

Estonian small lakes began, the same genera were found widely distributed

in the plankton of mesotrophic and eutrophic lakes. Species from genera

Microcystis (M. aeruginosa, M. wesenbergi, M. flos-aquae, M. botrys) and

Anabaena (A. lemmermanni, A. flos-aquae, A. hassali, A. circinalis) were

widely distributed approximately up to the late 1960s. Since the 1970s with

the increase in nutrient load, the species composition changed – the abunance

of large colonies of Microcystis and some species of Anabaena (A. flosaquae,

A. hassali, A. lemmermanni, A. circinalis) decreased, while some filamentous

Limnothrix redekei have expanded in abundance and distribution con-

siderably (Ott and Kõiv, 1999). Moreov er, in opposition to the period prior

1970, the frequency of autumn blooms increased, especially in stratified

lakes. These blooms were induced mainly by nutrient enrichment (pre-

dominantly phosphorus) from the anoxic bottom layers in correspondence

to the autumn turnover (Milius and Pork, 1977). Due to the replacement of

the large colonies by remarkable smaller filaments, the biomass values

started to decrease after 1970s. Nevertheless, some species, like P. agardhii

and species belonging genera Anabaena, have quite large dimensions, for-

ming the greatest biomasses of phytoplankton (Table 1). In addition, it was

cyanobacteria such as Pseudanabaena limnetca, Planktothrix agardhii and

213

A. RAKKO, R. LAUGASTE AND I. OTT

also shown that P. agardhii formed the highest biomass in meta- and hypo-

limnion in strongly stratified lakes during the vegetation period (Laugaste,

1991; Kangro et al., 2005) and P. rubescens during winter under the ice

(Laugaste, 2006). Biomass concentration was still very high (>30 mg L

–1

) at

the beginning of 1990s in several lakes and dropped permanently from the

middle of the decade up to now. Concentrations higher than 10 mg L

–1

have

almost never been found. Dominant species are Limnothrix planctonica,

Aphanizomenon yezoense, A. gracile and Planktolyngbya limnetica. Biomass

and distribution of P. agardhii have diminished due to the decrease of ex-

ternal nutrient loading since the beginning of 1990s (Ott et al., 2002).

aeruginosa has decreased, while M. botrys increased. Probably this change

was not so obvious because in previous investigation periods the M. botrys

was confused with several other species from Microcystis genera, mainly

M. aeruginosa (Cronberg and Komarek, 1994). Microcystis species inhabits

mainly small unstratified or weakly stratified lakes.

Lake Type Surface

area, ha

Maximum

depth, m

Biomass,

mg*L

–1

Species Year

Rummu DEP 50 2,8 888 Anabaena

lemmermanni

1985

Verevi HY 12,6 11 499 Planktothrix agardhii 1985

Konsu HM 139,2 10,2 507 Planktothrix agardhii 1982

Peta HE 3,6 25 205 Planktothrix agardhii 1975

Ruusmäe HY 4,8 11,6 190 Anabaena spiroides 1990

There has been very little information available about the real toxicity of

cyanobacterial blooms in Estonia because of the scarce work in this field.

Basically, in small lakes, microcystins are produced by several bloom

forming cyanobacterial genera including Microcystis, Anabaena and

Planktothrix (Table 2). There is lack of evidence that toxins have caused the

death of cattle, wildlife, and present hazards to human health via drinking

water or accidental ingestion of cyanobacterial bloom material. However,

skin irritation and allergic reactions in swimmers exposed to cyanobacterial

blooms have been reprorted several times.

1.1.2. Raphidophytes

There are two species in Estonian lakes belonging to raphidophyte genera –

Gonyostomum semen and G. palludosum. Both species are uncommon and

no blooms have been documented.

The abundance of species from genera Microcystis has changed – M.

TABLE 1. 5 highest recorded cyanobacterial biomasses in Estonina natural lakes. DEP-

soft-water mixotrophic; HY– hypertrophic; HM – hard-water mixotrophic; HE – hard-water

eutrophic.

214

BLOOMS IN ESTONIAN LAKES

(Taner et al., 2005).

Sampling Sampling Dominant Concentrations of microcystins

Pg/l****)

point date species***)

Mcd

mRR

McRR McY

Mcd

mLR

McL

Pühajärv*) 3.07.01

M. botrys,

M. viridis,

M. wesenbergii,

M. flos-aquae

na na na na 1.1

Ähijärv*) 5.07.01

M. flos-aquae,

Radiocystis geminata

na na na na

0.1

Narva

reservoir.**) 6.09.02

A. circinalis,

M. viridis

na na na na 67

Pühajärv**) 25.06.04

M. botrys;

M. viridis;

M. flos-aquae;

M. wesenbergii,

A. lemmermannii

11.5 8.3 2.0 1.8 3.2

Pühajärv*) 25.06.04

M. botrys;

M. viridis;

M. flos-aquae;

A. lemmermannii

0.53 0.44 0.09 0.05 0.2

Notes:

*) mean water samples from the open area of the lake from the depth 30–50 cm

**) water sample from the region of inshore accumulation of cyanobacterial mass

***) A.- Anabaena; M. - Microcystis

****) na – not analysed

G. semen was found at first at the beginning of 1980s in some soft-water

forest bog and dystrophic lakes where the total alkalinity (HCO

–

) is below

60 mg L*

–1

(Ott and Kõiv, 1999). In the beginning of the 1990s G. semen

formed a great biomass in dystrophic lakes and was dominant also in some

semidystrophic, soft-water mixotrophic and in two formerly oligotrophic

lakes (Laugaste, 1992). This species was not found during the earlier in-

vestigation period (up to1980s). It is well known phenomenon that after

fixation of sample with Lugol solution G. semen cells break immediately

therefore making their recognition rather complicated (Hongve et al., 1988):

this might have been the main reason why the presence of G. semen has

been often overlooked. This, however, is not case of the samples collected

before the 1980s as re-examination of many of these old samples has pro-

ved lack of remnant cells.

TABLE 2. Concentrations of microcystins found in the water of some Estonian small lakes

215

A. RAKKO, R. LAUGASTE AND I. OTT

On the other hand widening may be connected with changes in water

chemistry. Cronberg et al., 1988 reported that the main reason for the ex-

pansion of G. semen in Swedish forest lakes was related to the acidification.

On the contrary no drastic decrease of pH in Estonian small lakes has been

observed. Estonia has carbonate-rich soils and therefore lakes are well-

buffered and, moreover, acidification is inhibited by alkaline air pollution

(Öpik, 1989), which neutralizes the effect of acid rains. It is more probable

that wider distribution and increased biomass of G. semen in lakes is related

to increasing nutrient content (mainly phosphorus) during the past decades

(Nõges and Laugaste, 2002). Positive correlation between higher phosphorus

levels and biomass has also been reported by Rosén (1981, cit. Nõges and

Laugaste, 2002).

Up to now G. semen has been found in more than 80 lakes, most of

which belonging to bog and forest dystrophic or mixotrophic lakes, but also

in two oligotrphic lakes in the 1990s (Nõges and Laugaste, 2002). The

highest biomasses were reported by the same authors in dystrophic lakes

with extremely dark water (Secchi depth <1 m; COD

60–100 mg O L

–1

The highest biomass concentration 100 mg L

–1

was recorded in 1991 in

brown-water lake (lake Orava Mustjärv ) near the town Põlva in the south-

eastern part of Estonia. The occurrences and higher biomasses correlated

positively with increasing phosphorus level in the lakes with moderate pH

(<7). It is also showed that G. semen can exploit nutrient resources from

deeper water layers (hypolimnion) as well. Studying Finnish dark-water

lakes, Salonen and Rosenberg (2000) found the highest biomass near the

surface during the daytime and in the hypolimnion during night. They

pointed out that diurnal vertical migration of G. semen was directly related

to taking up and storage of soluble reactive phosphorus (SRP). This gives an

important competitive advantage over the other algae and explains the do-

minance and high biomasses of G. semen in lakes. However, beside vertical

distribution, simultaneous horizontal distribution has also been observed in

one Estonian oligotrophic lake – Nohipalu Valgjärv (soft water, surface area

6,3 ha, maximum depth 11,7 m) – in August 2007.

(Figure 2). This hori-

zontal patchiness was probably due to concentration of cells in upwind

areas that has been already described for other downward-migrating algae,

e.g. dinoflagellates (Heany, 1976). As there may be differences in horizontal

and vertical distribution of cells, it may be sometimes overlooked already in

the sampling phase particularly in brown-water lakes.

However, G. semen has spread not into some semidystrophic lakes in

Estonia that exhibit nearly neutral pH, but in those lakes where the bicarbo-

nate content is over the 60 mg L

–1

. Its fast expansion in Estonian lakes

216

BLOOMS IN ESTONIAN LAKES

Figure 2. Bloom of Gonyostomum semen in lake Nohipalu Valgjärv in august 2007.

remains still unclear, but nutrient load seems to be one of the main factors

that may have enhanced it. According to the data of biomass from Estonian

lakes, G. semen usually reaches its biomass maximum on July or August

but it has also been observed in plankton from May to September. Blooms

of G. semen were considered to be non-toxic but, may result unpleasant for

swimmers by provoking mucilage and skin irritation thereby lowering

recreational value of lakes.

1.1.3. Other algae

Sometimes not regular phytoplankton mass occurrences have been noticed

by other algal groups. Higher biomasses have been observed among chryso-

phytes, dinoflagellates, cryptophytes and chlorophytes. The annual maximum

of chrysophytes is usually in spring, after the ice break. Dominating species

during that period belong to the genera Uroglena, but rarely the biomass

exceeds a value greater than 8 mg L

–1

. In midsummer higher biomass values

may originate from Mallomonas caudata and in 2007 at first recorded by

small-celled Chrysococcus sp. in oligotophic soft water lake Viitna Pikkjärv

(surface area 16,3 ha, maximum depth 7 m) (Rakko, 2007). The greatest

217

A. RAKKO, R. LAUGASTE AND I. OTT

recorded biomass values are 35 mg L

–1

in the Lake Kallete in 1975 (hard

water, surface area 8 ha, maximum depth 6,2 m, dominant Peridinium

willei) and 20 mg L

–1

in the lake Vagula in 1989 (hard water, surface area

518 ha, maximum depth 11,5 m). In the latter, higher biomass values of

C. hirundinella have been reported several times. Cryptophytes may have

higher biomasses usually under the thermocline in stratified lakes (Laugaste,

1991) or in nutrient rich shallow lakes. The greatest recorded values are

30 mg L

–1

in hypertrophic Lake Kooraste Linajärv in 1975 (soft water, sur-

face area 2,7 ha, maximum depth 12,7 m). Approximately 30–40 domina-

ting chlorococcal species were recorded in highly eutrophic lakes. The

highest biomass values, in the range of 40–78 mg L

–1

, were recorded several

times in the lake Harku in 1976–1990, suffered from sewage water, (hard

water, surface area 164 ha, maximum depth 2,5 m, dominant Scenedesmus

quadricauda,). Also, in other hypertrophic lake Partsi Kõrtsijärv (suffered

from flax retting), high biomass (35 mg L

–1

) was recorded in summer in

1975 (soft water, surface area 3,4 ha, maximum depth 5 m, dominant

Tetraëdron minimum).

2. Conclusions

The database of phytoplankton allows to follow long term dynamics and

phytoplankton mass occurrences in Estonian lakes. The highest values were

documented during Soviet time (1970–1980s), when extensive agriculture

prevailed. The main dominating species belong to cyanobacteria. During the

past deacades water blooms caused by chroococcal species (mainly Micro-

cystis) have been substituted by filamental species from Nostocales. Among

the other algae, Gonyostoum semen has become an important dominating

species in soft water lakes. In the lakes, suffered from easily decomposing

organic matter, chlorococcal species can prevail. Generally, the ecological

status of Estonian lakes has improved since 1990s. The status of the lakes

depend more from weather in different years and less from nutrient loading.

3. Acknowledgments

I thank Paolo Gualtieri for organizing the school “Sensor Systems for

Biological Threats: The Algal Toxins Case”. The article was supported by

NATO and the core grants of the Ministry of Education Nos. 0370208s98,

0362482s03 and by grants of the Estonian Science Foundation Nos. 3579

and 4835.

218

BLOOMS IN ESTONIAN LAKES

References

Cronberg, G. and Komárek, J., 1994, Planktic cyanoprokaryotes found in south Swedish

lakes during the XIIth international symposium on Cyanophyte research, 1992, Arch.

Hydrobiol., Algol. Stud. 75:323–352.

Cronberg, G., Lindmark, G. and Björk, S., 1988, Mass development of flagellate Gonyostomum

semen (Raphidophyta) in Swedish fortest lakes – an effect of acidification? Hydrobiologia

161:217–236.

Directive 2000/EC of the European Parliament and of the Council. 2000. Of establishing a

framework for Community action in the field of water policy. 151 pp.

Heaney, S.I., 1976, Temporal and spatial distribution of the dinoflagellate Ceratium hirundi-

nella O.F. Muller within a productive lake. Freshwater Biol, 6:531–542.

Hongve, D., Løvstad, Ø. and Bjørndalen, K., 1988, Gonyostomum semen – a new nuisance to

bathers in Norwegian lakes, Verh. Internat. Verein. Limnol, 23:430–434.

Kangro, K., Laugaste, R., Nõges, P. and Ott, I., 2005, Long-term changes and seasonal deve-

lopment of phytoplankton in a strongly stratified hypertrophic lake, Hydrobiologia 547:

91–103.

Kask, I., 1979, Eesti järvede arvust ja järvenõgude kla ssifikatsioonist, Eesti NSV saarkõrgustike

ja järvenõgude kujunemine, Tallinn, lk. 88–103. [About the number of Estonian lakes

and their classification. In estonian].

Laugaste, R., 1991, Fütoplankton, in: Verevi Järve Seisund, H. Timm, ed., Hüdrobioloogilised

uurimused XVII. Tartu, lk. 69–89. [Phytoplankton. In Estonian, summary in English].

Laugaste, R., 1992, Tativetikas? Eesti Loodus.12 :610–612. [Gonyostomum semen. In Estonian,

summary in English].

Laugaste, R., 1994, Verevi järve seisund, biogeensete ainete päritolu ja tervistamise abinõud,

in: Eesti Jõgede ja Järvede Kaitse, A. Järvekülg, ed., Eesti Teaduste Akadeemia Kirjastus,

Tallinn, lk. 47–64. [The state, the origin of nutrients and the measures necessary for re-

covering lake Verevi. In Estonian, summary in English].

Nõuni. In Estonian].

Environmental Report 7, M. Pyväläinen, ed., Environmen tal Data Centre, National Board

of Waters and the Environment, Helsinki, pp. 18–22.

Milius, A. and Pork, M., 1977, Seasonal variation of phytoplankton biomass, chlorophyll a

content and alkaline phosphatase activity in Lake Pangodi. Proc. Estonian Acad. Sci.

Biol. Ecol. 26

:128–137.

Mäemets, A., 1974, On Estonian Lake Types and Main Trends of Their Evolution Estonian

Wetlands and Their Life, in: Estonian Wetlands and Their Life, E. Kumari, ed., Valgus,

Tallinn, pp. 29–62.

Mäemets, A., 1976, Lake types as basis for the limnological division of the Estonian S.S.R.,

in: Estonia. Regional Studies. Tallin, Academy of Sciences of the Estonian S.S.R.

pp. 63 – 71.

Mäemets, Aare., Ott, I. and Mäemets, Aime., 1994, Eesti väikejärvede seisundi muutused ja

kaitse., in: Eesti Jõgede ja Järvede Kaitse, A. Järvekülg, ed., Eesti Teaduste Akadeemia

Kirjastus, Tallinn, lk. 32–47. [Changes in the status and protection of Estonian small

lakes. In Estonian, summary in English].

Nõges, P. and Laugaste, R., 2005, Nuisance alga Gonyostomum semen : implications for its

global expansion, in: Aquatic Ecosystems, Conservation, Restoration and Management

Ramachandra, T.V. Ahalya, et al., eds., Capital Publishing Company. New Dehli, Kolkata,

Bangalore 77–87.

Laugaste, R., 2006, Mis Nõuni järves toimub? Otepää Teataja 8. [What happened in lake

Loigu, E., 1993, Nutrient balance in surface water. In: Water Pollution and Quality in Estonia.

219

Olli, K., 1996, Mass occurrences of cyanobacteria in Estonian waters, Phycologia. 35

(6 Supplement):156–159.

Ott, I. and Kõiv, T., 1999, Eesti väikejärvede eripära ja muutused. Estonian small lakes:

Special features and changes. Tallinn, 128 pp.

Ott, I., Timm, H., Mäemets, H., Tammert, H., Rakko, A., and Laugaste, R., 2002,

Väikejärvede seisund. Eesti Keskkonnaseire 2001. lk. 76–82. [Status of small lakes. In

Estonian].

Rakko, A., 2007, Koldvetikad, vähetoiteliste järvede tunnusliigid. Eesti Loodus 11:590–596.

[Chrysophytes – characteristic species in oligotrophic lakes. In Estonian.].

Salonen, K. and Rosenberg, M., 2000, Advantages from diel vertical migration can explain

the dominance of Gonyostomum semen (Raphidophyceae) in a small, steeply-stratified

humic lake. J. Plankt. Res., 22:1841–1853.

Tamre, J., 2006, Eesti järvede nimestik. Keskkonnaministeeriumi Info- ja Tehnokeskus,

Tallinn, 168 lk. [The list of Estonian lakes. In Estonian].

Tanner, R., Kangur, K., Spoof, L. and Meriluoto, J., 2005, Hepatotoxic cyanobacterial pep-

tides in Estonian freshwater bodies and inshore marine water, Proc. Estonian Acad. Sci.

Biol. Ecol. 54:40–52.

Öpik, I., 1989, SEJ korstnaheitmed aluselised või happelised? Eesti Loodus 3:182–184.

[Emissions of thermal power plant’s stack – alkaline or acidic? In Estonian, summary in

English].

220

A. RAKKO, R. LAUGASTE AND I. OTT

V. Evangelista et al. (eds.), Algal Toxins: Nature, Occurrence, Effect and Detection.

COMPARATIVE ESTIMATION OF SENSOR ORGANISMS

SENSITIVITY FOR DETERMINATION OF WATER TOXICITY

PAOLO GUALTIERI

Istituto di Biofisica C.N.R., Area della Ricerca di Pisa, Via

Moruzzi 1, 56124, Pisa, Italy

TETIANA PARSHYKOVA*

Kiev National University named Taras Shevchenko,

Volodymyrska st., 60, 01017, Kiev, Ukraine

mation of toxicity in screening of water-bloom material and laboratory

cultures or cell extracts. It is discussed the advantages and difficulties at using

as bioassay the organisms from different systematic groups. It is determined

lethal doses for checking of natural algae toxins activity.

1. Introduction

Algae are the main primary producers of organic material and oxygen. They

are utilizers of CO

as well in continental reservoirs as in World Ocean. Due

to the high photosynthetic potential they synthesize up to 74% organic sub-

stances in water ecosystems or 25% of total production, which is formed on

the Earth (Considine, 1984).

Algae export into environment the significant part of organic substances

that are produced in process of vital activity. The portion of these substances

in the general cells balance is very valuable and makes about 30% of the

all daily oxygen balance or 40% pure daily production of photosynthesis

______

*To whom correspondence should be addressed. Tetiana Parshykova, Kiev National University

named Taras Shevchenko, Volodymyrska st., 60, 01017, Kiev, Ukraine. Email: ladik1@voliacable.com

221

Abstract: It was established that bioassay is convenient first test for esti-

Keywords: Water “blooming”, toxicity, bioassay, lethal dose

(Kirpenko, et al., 1977). Chemical composition of metabolites is varied

essentially. Among exometabolites are identified aminoacids and peptides,

compounds of polysaccharide nature, essential oils, aldehydes, organic acids,

terpenes, vitamins, compounds of polyphenolic and indolic nature, antimi-

crobial components and others compounds with high biological activity

(Sirenko and Kozitskaya, 1988). It was detected substances with allergenic,

mutagenic and cancerogenic effects, antihormonic, plant growth regulation,

bactericidic, insecticydic, fungicydic and algicidic activity.

Algae toxicity is bring to the attention at estimation of water quality,

functional activity of hydrobionts and products, which are received from it.

For example, it is carried out a great bulk of investigations on studying of

algae toxins effect on fishes and also organisms-filtrators in the context of

negative action of Microcystis aeruginosa on speed of zooplankton filtration

and lowering of speed the feed consumption in 10–15 times (Sirenko and

Parshykova, 1988). An important value has a search among algae toxins –

compounds with high biological activity, which may be used as medicines

(Carmichael, 1980). Fulfillment the complex of above mentioned resear-

ches promoted to essential widening the list of toxic algae flora represent-

tatives, deciphering the chemical nature of separate toxins, showing up the

factors, which are contribute to strengthening or weakening of water toxicity.

Thus, investigation of microscopic algae toxic exometabolites and prepara-

tive, purification of its compounds has as well theoretical as practical

significance.

Goal of our experiments was analyzed of perspectives for using of dif-

ferent organisms (warm-blooded, hydrobionts, microorganisms) for esti-

mation of biological activity of algae toxins.

2. Difficulties in Determination of Biological Activity of Algae Toxins

Taking into consideration that algae develop in close association with other

macro- and microorganisms in reservoirs, it is very important to study the

chemical nature of metabolites that produce such associations into environ-

ment. An additional point to emphasize is that biologically active compounds

which are produced by algae-microorganisms associations can create con-

ditions for formation of free-radical processes which will reinforce the

toxicity or to be of its reason. Localization of biologically active compounds

causes essential troubles in establishment of water microorganisms’ toxicity

too. There are 2 types of algae toxicity: endogenous and exogenous.

222

P. GUALTIERI AND T. PARSHYKOVA

result of cells ability to biosynthesis of special metabolites. Determination

connected as well with its lability, low concentration and small specificity,

as a result of demonstration of toxicity for various compounds. For example,

for cells of different living organisms (such as animals, plants and micro-

organisms) the intracellular oxygen may be toxic due to its superoxides, O

, hydrogen peroxide, OH-radical forms. The oxygen toxicity can show

up because of degradation of subcellular structures, inactivating of enzymes

and formation of intracellular lipid peroxides (Sirenko and Parshykova,

1988).

Exogenous toxicity links compounds which production by algae, post-

lethal degradation of organic matter and adaptive provision to influence of

foreign chemical ingredients. For example, Microcystis aeruginosa toxicity

sometimes is explained by necessity to accumulation of soluble organic

compounds in cultural medium. It is obligatory condition for growth of

young cells that feed on heterotrophic on earlier stage of ontogenesis. In this

case toxicity can be considered as biological appliance for supporting of

population (Sirenko and Parshykova, 1988).

3. Studying of Biological Activity of Algae Toxins

It is well known, that algae toxins are found out in representatives of

Cyanophyta (Cyanobacteria), Dinophyta, Chlorophyta and Chrysophyta.

Among of Cyanobacteria toxins the microcystins and nodularine are most

investigated in many countries of the world. There are 4 groups of algae

toxins by effect of human: hepatotoxins, dermatoxins, cytotoxins and neuro-

toxins (Carmichael, 1988). Comparative estimation of biological activity for

natural algae toxins testifies that metabolites of Cyanobacteria are on inter-

mediate position between toxins of microorganisms, amphibious animals

and toxins of higher plants or mushroom origin (Table 1).

It was registered, that lethal dose (LD

) for Cyanobacteria are: for ana-

toxin – Ⱥ/S (producer of Anabaena flos-aquae) –20 Pg/kg, nodularine

(Nodularia spumigena) and microcystine LR (Microcystis aeruginosa) –50,

anatoxin – Ⱥ (A. flos-aquae) –200 Pg/kg of animal body. It is significantly

Endogenous toxicity is caused, on one side, by organism genotype and

metabolic processes, on other side, by population, allelopatic and adaptive

mechanism of cells regulation. In all cases it is connected with accumu-

lation in cells the biologically active substances, which are formed as a

of chemical nature for compounds of this group is very difficult. It is con-

223

COMPARATIVE ESTIMATION OF SENSOR ORGANISMS

TABLE 1. Comparative toxicity of different biological toxins (Carmichael, 1992; Carmichael,

1994; Carmichael, 1997).

Toxins Producer, source Usual name

Lethal* dose

Botuline toxin Clostridium botulinum Bacteria 0.00003

Tetanus toxin Clostridium tetani Bacteria 0.0001

Ricin toxin Ricinus communis Plant 0.02

Diphtheria toxin Corynebacterium diphtherial Bacteria 0.3

Cocoy toxin Phyllobates bicolor Frog toxin 2.7

Tetrodotoxin Arothron meleagris Fish 8

Saxitoxin Aphanizomenon flos-aquae Cyanobacteria 9

Cobra toxin Naja naja Snake poison 20

Nodularine Nodularia spumigena Cyanobacteria 50

Microcystin-LR Microcystis aeruginosa Cyanobacteria 50

Anatoxin-A/S Anabaena flos-aquae Cyanobacteria 20

Anatoxin-A Anabaena flos-aquae Cyanobacteria 200

Curare Chrondodendron tomentosum Brazilian plant 500

Strychnine Strychnos nox-vomica Plant 500

Amatoxin Amanita sp. Mushroom 200–500

Muscarine Amanita muscaria Mushroom 1100

Fallotoxin Amanita sp. Mushroom 1500–2000

Potassium cyanide 10000

*Lethal dose in Pg on 1 kg of body weight: intraperitoneal injection for mice and rats.

less in comparison with alkaloid curare (Brazilian plant Chrondodendron

tomentosum) –500, muscarine (mushroom Amanita muscaria) –1100 Pg/kg

and even with potassium cyanide (LD

– 10000 Pg/kg).

As it may be seen from Figure 1, investigations, which were carried out

in many countries, allowed analyzing the experience of isolation, studying

and estimation of Cyanobacteria toxicity. Worlds search for new and more

sensitive separation and detection methods for phycotoxins seems partly a

genuine desire to limit the negative consequences of these poisons in our

food and water supplies plus scientists’ inherent drive to always develop

something “bigger and better” or, in keeping with the proper context, “more

rapid and more sensitive”. This is also true in the progression of techniques

for analysis of the cyanotoxins.

For estimation the biological activity of Cyanobacteria toxins in cells

biomass, water samples and animal tissues traditionally have been used

bioassay, chemical methods and immunological technologies. Bioassay is

224

P. GUALTIERI AND T. PARSHYKOVA

Figure 1. Flow chart for the isolation, detection and analysis of microcystins and nodularines

based upon screening method (Carmichael, 1994; Carmichael, 1997):GF – glass fiber; PP –

protein phosphotase inhibition; MS – mass spectroscopy; PBS – phosphate buffered saline;

TFA – threefluoroacetic acid; ODS – octadecylsilanized; HPLC – high-performance liquid

first test for estimation the toxicity in screening water-bloom material and

laboratory cultures or cell extracts and more fast than chemical and im-

munological methods. As a bioassay may be used organisms from different

systematic groups such as warm-blooded animals, invertebrates, micro-

organisms and others.

4. Toxicological Experimentes on Warmblood Animals

Received experimental data testifies (Kirpenko, et al., 1977) that white

mice, rats, chickens, guinea-pigs, cats and rabbits are sensitive to toxic

metabolites of Cyanobacteria. In many manuscripts (Sirenko and Kozitskaya,

1988; Carmichael, 1980; Carmichael, 1988; Carmichael, 1994; Carmichael,

1997) was discussed the level of sensitivity of different living organi-

sms because are known facts about absence of intoxication symptoms

after entering of Cyanobacteria toxins to test-organisms. It is possible that

contradiction of information about sensitivity to algae toxins for differ-

ent animals may be connected with character of substances entering and

differences in its biological activity. Some authors belief that toxicity of

chromatography; NMR – nuclear magnetic resonance; ELISA – enzyme-linked immuno-

sorbent assay.

COMPARATIVE ESTIMATION OF SENSOR ORGANISMS

225

Cyanobacteria toxins may appear only after parenteral entering. It was shown

by other scientists that manifestation of toxic effect of Cyanobacteria pos-

At Ukraine presence of toxic metabolites of Cyanobacteria in cells and

water filtrate was discovered on white mice and rats after peroral intro-

duction. By this way algae toxins may detect its unfavorable action in water

consumption for drinking aims.

It is well known that toxic metabolites are produced by specific strains

of Cyanobacteria and more intensive toxins emission in places of its accumu-

lation. In this connection toxicity were used main agents of water “blooming”

in different world reservoirs – Microcystis aeruginosa and Aphanizomenon

flos-aquae. It was estimated toxicity of Cyanobacteria cells depends on

different states of biomass such as tinned biomass or preserving by drying,

after boiling, freezing, ultrasound treatment (50 kHz) and during different

time of destruction process (Table 2).

Received experimental data testifies that in fresh and dried cells biomass

of Cyanobacteria toxic compounds were presented. Samples with domination

of M. aeruginosa (97%) had higher toxicity than with Aph. flos-aquae (96%).

Water filtrates of algae were toxic too but with low degree (1.76>1.21) than

cells biomass.

Table 2 indicates, that after freezing algae cells biomass with further

thaw or ultrasound treatment algae toxicity was increased (2.2 >1.68). Boiling

of algae cells decreases the toxic properties of Cyanobacteria (1.96 >1.72)

but don’t effect on water filtrates toxicity.

Toxicity of algae biomass and water filtrates is decreased during extrac-

tion process, especially after increasing of its terms (1.92 >1.12). These ex-

periments verify that white mice and rats are very sensitive to algae toxins.

So, toxicity of algae biomass may be increased after effect of thermal

and mechanical factors (such as freezing with further thaw, treatment of

ultrasound and other). It caused the formation of great quantity of degraded

algae cells. Boiling of algae biomass decreases the cells toxicity but don’t

effect on toxicity of water filtrates. This fact are interested from two points

of view. At first, it indicates on possibility of strengthening the toxicity of

natural algae populations under effect of extreme factors, which always

takes place under natural conditions (freezing, mechanical influence in

passing of hydrotechnical constructions, pumps during transfer and so on).

At second, it throws light on contradiction in toxicity estimation for the

same algae strains under different conditions.

sible after enteral introduction. However, toxicity of Cyanobacteria metabo-

lites is decreased in this case (Kirpenko, et al., 1977).

P. GUALTIERI AND T. PARSHYKOVA

226

TABLE 2. Semilethal doses (mg/kg) of water filtrates and Cyanobacteria biomass for

Probated patterns Using animals LD

TINNED BIOMASS

Microcystis aeruginosa biomass Mice r

M. aeruginosa biomass Rats r

M. aeruginosa water filtrate Mice r

M. aeruginosa water filtrate Rats r

Aphanizomenon flos-aquae Rats r

Aph. Flos-aquae water filtrate Rats r

FROZEN BIOMASS

M. aeruginosa water filtrate Mice r

M. aeruginosa biomass Mice r

M. aeruginosa biomass Rats r

M. aeruginosa water filtrate Rats r

Aphanizomenon flos-aquae Rats r

Aph. Flos-aquae water filtrate Rats r

BIOMASS AFTER BOILING

M. aeruginosa water filtrate Rats r

M. aeruginosa biomass Rats r

M. aeruginosa biomass Mice r

M. aeruginosa water filtrate Mice r

Aphanizomenon flos-aquae Rats r

Aph. Flos-aquae water filtrate Rats r

BIOMASS WORKED UP WITH ULTRASOUND (50 kHz, 20

M. aeruginosa water filtrate Mice r

M. aeruginosa biomass Mice r

M. aeruginosa water filtrate Rats r

M. aeruginosa biomass Rats r

BIOMASS DURING DESTRUCTION PROCESS

M. aeruginosa fresh biomass Mice r

M. aeruginosa fresh biomass Rats r

different animals (biomass content – 0,316 g/ml by dry matter) (Kirpenko, et al., 1977).

(Continued)

COMPARATIVE ESTIMATION OF SENSOR ORGANISMS

227

TWO DAYS LATER

M. aeruginosa biomass Rats r

M. aeruginosa water filtrate Rats r

M. aeruginosa biomass Mice r

M. aeruginosa water filtrate Mice r

FIVE DAYS LATER

M. aeruginosa biomass Rats r

M. aeruginosa water filtrate Rats r

M. aeruginosa biomass Mice r

M. aeruginosa water filtrate Mice r

5. Using of Invertebrates for Algae Toxins Indication

High biological activity of algae toxins, complexity and bulkiness of physical

and chemical methods of its detection, possibility of cumulating effect

display demand the elaboration of quick induction methods of presence of

algae toxins in water environment. It is possible to presence the plankton of

Crustacea (such as Daphnia, Cyclops) among the biological indicators that

are perspective for the usage (Fig. 2).

Figure 2. Daphnia magna.

TABLE 2. (Cont)

P. GUALTIERI AND T. PARSHYKOVA

228

was started in 16 hours (15%). Daphnia destructed completely in 48 hours.

Under the concentration of M. aeruginosa within the limits of 11075000

cells per liter the complete destruction in 4 hours has been observed.

The obtained results show that the Daphnia magna could be quite sen-

sitive biological test for the presence of Cyanobacteria toxic metabolites in

water. Considering that experimental results obtained on Daphnia showed

the good correlation under control with warm-blooded animals in sharp ex-

periment test with Daphnia could be used as the express-method for toxicity

determination. It is considered that under the usage of biological tests like

Daphnia to determine the toxicity of unknown samples one has to mention

that their destruction could be caused not only by toxic metabolites, but also

by the products of algae disintegration and also by own animals excrements

especially under prolonged experiments in closed volume of environment.

The check of biological activity of algae toxins preparations allocated

by Ukrainian scientists due to Daphnia rest showed the complete destruct-

tion of Daphnia was observed under concentration of algae toxin 0.0015

–0.0045 mg/l in 4 hours (Table 3).

TABLE 3. Daphnia magna st. survival (% to control) under different algae toxins concen-

trations (Kirpenko, et al., 1977).

Survival under different expositions, hours

Microcystin concentration,

mg/l

2 4 8 16 24 48

0.0045 36 0 0 0 0 0

0.0015 70 0 0 0 0 0

0.00015 100 100 100 100 90 80

0.00004 100 100 100 100 100 66

Another fractions of metabolites extracted from Cyanobacteria showed

less activity to Daphnia magna. So the algae toxin 7 (Kirpenko, et al.,

1977) caused the complete destruction of Daphnia under concentration 0.21

mg/l in 16 hours. The other preparations obtained on the base of natural

water samples gathering in spots of “blooming” water with the domination

of M. aeruginosa also shown less activity (Fig. 3). Algae toxins 6 and 8

were purified from different samples of natural Cyanobacteria population.

Algae toxin 6 contains 0.029 Pg/ml, algae toxin 8 – 0.008 Pg/ml of toxic

compounds.

Test with Daphnia magna st. is sensitive and quick methods for deter-

mination of the toxic metabolites of algae in natural conditions. It is shown

(Braginskiy et al., 1987), that under concentration in water the colony of

Microcystis aeruginosa in the limits of 875000 per liter destruction of Daphnia

COMPARATIVE ESTIMATION OF SENSOR ORGANISMS

229

Figure 3. Influence of algae toxins 6 and 8 on Daphnia survival:

The limitation for this method usage may be some statements namely

daphnia test could be non-specified if using of natural water samples. In this

case Daphnia may be destructed under another chemical substances expo-

sition. Moreover the test cannot be used always as the Daphnia are pre-

sented in biotopes only in a short period of time. Beside this in the moment

of high intensity of water “blooming” with the Cyanobacteria the Daphnia

usually leave the place with concentration of sestone and it is quite difficult

to determine them in water basin in this period.

6. Effect of Algae Toxins on Bacterial Flora

While searching of biological indicators for express-estimation of quantity

and activity of algae toxins in water surrounding the significant attention

attract the microorganisms. The collective of the Ukrainian scientists has

executed a complex of experimental works on studying of algae toxins

antimicrobial action as the metabolites of algae with the highest biological

activity that play an essential role in formation of algobacterial cenosis

(Kirpenko, et al., 1977). The spectrum of antimicrobial action was studied

on next pure cultures of microorganisms: Shigella flexneri, Escherichia coli,

Proteus vulgaris, Staphylococcus aureus and others. For investigations had

been used algae toxins with maximal biological activity that have been

collected in spots of water “blooming”. The sensitivity of microorganisms

to algae toxins and its bactericidal and bacteriostatic concentration of algae

toxin were established by method of serial cultivations in liquid cultural

medium. For bacteriostatic concentration we accepted that least concen-

tration of preparation at which the full growth inhibition of microorganisms

1 – concentration 7.25 mg/l; 2 – 1.75; 3 – 0.87;

4 – 0.44; 5 – 0.11 mg/l.

4 – 0.84; 5 – 0.42; 6 – 0.21 mg/l.

1 – concentration 6.7 mg/l; 2 – 3.35; 3 – 1.67;

P. GUALTIERI AND T. PARSHYKOVA

230

culture was marked. As bactericidal we considered that least quantity of

substance that caused absence of microorganisms growth under sowing on

the agar with one loop. The account was made in 48 hours after cultivation

in thermostat. Bactericidal and bacteriostatic concentrations of algae toxin

preparation are established by a method of serial cultivations on meat-

peptone broth (pH 7.2).

TABLE 4. Bactericide and bacteriostatic concentrations of algae toxin 1* during studying by

method of serial cultivations (Kirpenko, et al., 1977).

Concentration, %

Testing microorganism

Bactericide Bacteriostatic

Escherichia coli

–5

–7

Shigella flexneri

–6

–7

Salmonella Paratyphi B

–5

–7

Salmonella Typhimurium

–5

–7

Staphylococcus aureus

–4

–5

Staphylococcus weismani

–4

–5

Enterococcus

–4

–5

Mushrooms gen. Candida

–5

–6

*Algae toxin 1 was purified from natural samples of Cyanobacteria, contains 0.1 Pg/l of toxic com-

pound.

As it is shown on the Table 4, Escherichia coli, Shigella flexneri and

Salmonella are the most sensitive to algae toxins of Cyanobacteria. While

studying the mechanism of action of this algae toxin on microbial cell the

researches of dehydrogenase activity of microorganisms under effect of the

allocated preparation were carried out Table 5.

TABLE 5. Algae toxins effect on dehydrogenase* activity of Staphylococcus aureus cells

Time of methylene-blue discoloration, s

Algae toxin concentration, %

Dehydrogenase

Contro

–5

** 1

–6

–7

Glucose dehydrogenase 20.2 – 70.0 34.2

Glycerin dehydrogenase 24.5 – 65.7 26.0

Succinic acid dehydrogenase 312.5 – 562.5 320.0

*Dehydrogenase activity was measured with time (s) of methylene-blue discoloration.

**Under algae toxin concentration 1 10

–5

% methylene-blue didn’t become colorless during 3 days.

COMPARATIVE ESTIMATION OF SENSOR ORGANISMS

231

As dehydrogenase inactivation leads to infringement of exchange pro-

cesses, that in turn suppresses ability to live of the cell, the specified pa-

rameter can be used for biological testing of physiological activity of

substance, including algae toxins. As it is shown on Table 5 the introduction

of algae toxins into cultural environment caused the inhibition of micro-

organisms dehydrogenase that surely inhibit its duplication and caused dying

off. The maximal oppressing effect on studied dehydrogenase of Staphy-

lococcus aureus has algae toxin in concentrations 1

–5

and 1

–6

Therefore, one from ways of negative influence of algae metabolites on

bacterial cell is dehydrogenase inhibition, which has very important role in

energy processes of microbial cell. In one’s turn, dehydrogenase inhibition

and further test-culture extinction may be an index for indication of bio-

logical activity in water environment.

It is interesting to note that Cyanobacteria cells may be perspective

sensor for definition of biological activity of non-algae toxins. A hypothesis

on the appearance and persistence of natural foci of Cholera based on eco-

logical and bioenergetics features of the process was developed by I. Brown

verification. At the sacrifice of ability of various bacteria, including the

genus Vibrio and many Cyanobacteria species to perform energy coupling,

depending on external conditions by means of two cycles (the proton and

sodium cycles). Induction of the sodium cycle of energy coupling increases

the resistance of bacteria to various environmental factors, such as high

concentrations of sodium, alkaline pH, and high proton conductance of

coupling membranes and probably the virulence of these vibrios. In this

case development of Cyanobacteria in an aquatic environment enriched

with Na

accelerates alkalization of the medium and stimulates the deve-

lopment of the community of Cyanobacteria with Vibrio cholerae, an auto-

chthonous inhabitant of saline water bodies and marine shallow waters.

Salinization of water bodies accelerates their blooming and enriches them

with soluble organic matter, a substrate for vibrios inhabiting the biotope.

Thus, possibility of sharp growth of cholera epidemic in many districts

of Earth may be forecasted with high precision by intensity of water

“blooming”.

7. Conclusions

1. Algae cells egest into environment an essential quantity of organic com-

pounds of different chemical nature and biological activity in process of

and L. Sirenko (1997). In next years this hypothesis received experimental

Further propagation of Cholera infection is related to eating of heat-un-

treated hydrobionts from “blooming” of water bodies.

P. GUALTIERI AND T. PARSHYKOVA

232

compounds, which have toxic properties, inasmuch as they in a great deal

determine metabolites effect on forming of quantitative and qualitative

indices of hydrobiocenoses. In this connection using the biological pro-

duction of water ecosystems on further trophic levels, including human,

as higher link of biocenotic chain, needs a great attention to water quality

and estimation of its possible toxicity.

2. Range of toxic influence for metabolites, which were extracted from

algae samples essentially varies depending on algological composition,

vitality degree for cells of main producer of toxic compounds.

3. During preliminary stage of organic matter extinction its toxicity with

respect to warm-blooded organisms usually strengthens. However, in

this case determinative is don’t only increasing of algae toxins produc-

tion, but also presence of toxic products as a result of albuminous com-

pounds extinction.

4. Testing of different regimes for algae biomass detoxication – boiling,

strong acid hydrolysis, treatment by adsorbents (surfactants and ion-

changing pitchesɦɢ) testifies about possibility of carrying out the

detoxication with valuable decrease of toxicity. Choice of detoxication

regime is determined by character of further using of product and

demands to its security.

5. LD

of algae toxin during peroral introduction to warm-blooded animals

usually is about 10–20 mg/kg, during intraperitoneal introduction – less

than 1 mg/kg.

6. Among perspective sensors for determination of biological activity for

algae toxins may be used biological organisms of different systematic

groups: warm-blooded and invertebrate animals (for example, Daphnia

magna st.), bacterial microflora and so on.

7. Toxic-biological methods of detection Cyanobacteria toxins, which

were described above, may be used advisably under presence of toxin

within the bounds of 10

–3

–10

–4

mg/l. Researches will be began from

Protozoa (for example, determination of concentrations for Daphnia

death).

8. Advantage of using the bioassays for toxicity determination is moderate

cost of method and possibility of receiving the quick answer about

qualitative and quantitative toxin present. Weakness of bioassay method

is impossibility to determine low concentration of algae toxin, especially

in drinking water, and failure to disjoint it sharply between closely re-

lated algae toxins, which were produced by different algae strains.

its vital functioning. Most essentially on all links of ecosystem influence

COMPARATIVE ESTIMATION OF SENSOR ORGANISMS

233

9. Maximum permissible concentration of Cyanobacteria toxin in water is

about 0.0000006 mg/l. Higher concentrations are evidence of taking

special prohibitive measures necessity.

8. Acknowledgements

Kirpenko for help and useful suggestions.

References

Braginskiy, L.P. et al., 1987, Fresh Plankton in Toxic Environment. Kiev: Naukova Dumka.

Brown, I.I., Sirenko, L.A., 1997, The Role of Sodium Cycle of Energy Coupling in Occur-

rence and Persistence of Natural Nidi of Modern Chorela. Biochemistry, 62 (2): 263–269.

Carmichael, W.W. (Ed.), 1980, The water environment. Algae Toxins and Health. New York,

London: Plenium Press.

Carmichael, W.W. et al., 1988, Toxicity and Partial Structure of a Hepatotoxic Peptide

Carmichael, W.W. et al., 1992, Cyanobacteria Secondary Metabolites – the Cyanotoxins.

J. of Appl. Bacteriology, 72: 445–459.

Carmichael, W.W., 1994, The Toxins of Cyanobacteria. Scientific American, 270 (1): 78–86.

Carmichael, W.W., 1997, The Cyanotoxins. Adv. in Botan. Research, 27: 211–256.

Considine, M.L., 1984, Phytoplankton: Pastures of the Ocean. Ecos, 39: 11–18.

Kirpenko, Y.A. et al., 1977, Toxins of Blue-green Algae and Animal Organism. Kiev:

Naukova Dumka.

Sirenko, L.A., Kozitskaya, V.N., 1988, Biological Active Substances of Algae and Water

Quality. Kiev: Naukova Dumka.

Sirenko, L.A., Parshykova, T.V., 1988, Algae Toxicity and Difficulties of its Estimation in

Environment. Hydrobiological J., 24 (5): 48–58.

Authors are grateful to Prof. L. Sirenko, Prof. W. Carmichael, Dr. H.C. Yu.

Produced by the Cyanobacterium Nodularia spumigena Mertens emend. L575 from New

Zealand. Appl. and Envir. Microbiology, 54 (9): 2257–2263.

P. GUALTIERI AND T. PARSHYKOVA

234

V. Evangelista et al. (eds.), Algal Toxins: Nature, Occurrence, Effect and Detection.

BIOCHEMICAL METHOD FOR QUANTITATIVE ESTIMATION

OF CYANOBACTERIA TOXINS

LYDIA A. SIRENKO

Institute of Hydrobiology NAS of Ukraine, Geroev Stalingrada

pr. 12, 04210, Kiev, Ukraine

TETIANA V. PARSHYKOVA*

Kiev National University named Taras Shevchenko,

Vladimirskaya str. 60, 01017, Kiev, Ukraine

nesterase inhibition for qualitative and quantitative determination of Cyano-

bacteria toxic metabolites in natural waters and algae cells. It was established

that changes of cultural medium pH may be registered by spectrophotometric

method with using of bromine thymol blue indicator or by electrometric

method with indexes of pH-meter. Depending on degree of cholinesterase

inhibition the different quantity of organic acid is evolved

. It is determined

that method differs from other biochemical methods by rapidity and may be

used under field conditions.

1. Introduction

Water “blooming”, which is induced by mass reproduction of some algae

menon is registered as well in the majority of eutrophic freshwater reservoirs

______

*To whom correspondence should be addressed. Tetiana Parshykova, Kiev National University

named Taras Shevchenko, Volodymyrska st., 60, 01017, Kiev, Ukraine. Email: ladik1@voliacable.com

species, is most wide-spread case of biological contamination. This pheno-

(such as lakes, ponds, estuaries), as some seas (Azov, Black, Baltic) and sepa-

production of Cyanobacteria but well known also cases of water “blooming”

rate part of oceans. Water “blooming” in freshwater is caused by mass re-

235

Abstract: It is shown the possibility of using the model reaction with choli-

Keywords: Cyanobacteria, toxins, cholinesterase, nature water

which are caused by reproduction of Chlorophyta, Diatomea, Dinophyta

and Chrysophyta (Canter-Lund and Lund, 1995; Sirenko and Gavlilenko,

1978). Water “blooming” in sea-water (what is called as “red tides”) is caused

by different species of Diatomea algae. During recent years “red tides” were

registered in some freshwater reservoirs (for example, Biva lake in Japan).

aquae (L.) Ralfs., Anabaena flos-aquae (Lyngb.) Breb. are main agents of

water “blooming” among Cyanobacteria. These species are characterized by

essential toxicity. Taking into consideration the negative effect of Cyano-

bacteria toxins and its high biological activity, methods of identification,

preparative purification and its quantitative estimation were elaborated in

many countries of the world (Figure 1) (Harada, 1996).

By and large methods of detection and quantitative determination of

Cyanobacteria toxins may be divided by convention on the 3 groups (Kirpenko

et al., 1977; Carmichael, 1997):

Microcystis aeruginosa Kuetz. emend. Elenk., Aphanizomenon flos-

Figure 1. Summary of screening, identification, separation and quantification techniques

available for Cyanobacteria toxins (Harada, 1996). FL – fluorescence; FAB – fast atom

bombardment; ESI – electron spray ionization; CE – capillary electrophoresis.

236

L. A. SIRENKO AND T. V. PARSHYKOVA

Toxicity (mice)

•

Screening ELISA

•

• •

Phosphatase assay

•

• •

FID-GC, HPLC(FL)

•

NMR

•

MS, MS/MS

•

TLC/FAB

•

Identification LC/MS (FAB)

•

LC/MS (ESI)

•

micro LC/MS (FAB)

•

HPLC (photodiode array)

•

HPLC (CE)-linked phosphatase assay

•

Separation and HPLC (UV)

•

Quantification micro LC/MS (FAB, SIM)

•

HPLC (FL, CL)

• •

1mg

1µm

1ng 1pg

2. Chemical Nature of Cyanobacteria Toxins which were Used for

It is well known that Cyanobacteria toxins are complicated many-component

organic compounds by its chemical constitution. It is shown the empiric com-

position and structural formulae for many toxins in the literature (Carmichael,

1994; Carmichael, 1997; Sirenko and Kozitskaya, 1988). Some of Cyano-

bacteria toxins were synthesized. However, nature of the majority of Cyano-

bacteria toxins don’t elucidate because of difficulties of its purifycation and

identification. In connection with heterogeneity of Cyanobacteria toxins is

more rationally to use complex approaches for qualitative and quantitative

its studying in water and biological mediums.

For elaboration of biochemical method had been used Cyanobacteria

toxin which was isolated from natural populations (Sirenko, L. et al., 1995;

Kirpenko, 1996). It is white fine crystallized material, soluble in water up to

concentration of 1%. Solutions of toxins have no color, smell and optically

transparent. This compound withstand sterilization by boiling and autoclaving.

physics-chemical methods (relieving of UV, IR-spectrum, electron spin

resonance, chromatography, disk-electrophoresis in polyacrylamide gel,

high-voltage electrophoresis) which are used for identification of che-

mical nature for preparative purified compounds;

enzyme and immunological reactions for detection and quantitative

estimation of toxins in water and biological medium (determination of

Cyanobacteria toxins presence by cholinesterase activity, tripsin, ELISA

method);

toxicology-biological methods (estimation of acute toxicity on warm-

blooded animals and hydrobionts, using of insulated organs and mito-

chondria, tissue cultures and others experimental materils).

The aim of our work was acquaintance with experience of Ukrainian

scientists by studying of toxicity and elaboration the method of quantitative

estimation of presence and activity of Cyanobacteria toxins in water by

Toxins are soluble in organic solvents (such as butyl, ethyl, methyl alcohols),

but from these solvents toxins were very difficult to crystallized. Form of

crystals after crystallization from ethanol are presented at Figure 2.

for Elaboration of Reaction with Cholinesterase

METHOD FOR ESTIMATION OF CYANOBACTERIA TOXINS

237

reaction with cholinesterase.

–

Figure 2. Form of toxin crystals during crystallization from ethanol (Kirpenko et al., 1977).

Molecular weight of more active toxins fraction is about 19000. Toxin

has 5–7 characteristic spots with Rf 0.12; 0.24; 0.43; 0.56; 0.73; 0.93; 1.14

at thin layer chromatography with using of standard plates “Silufol” UV-

254 and next systems of solvents: isopropyl alcohols (CH

CH(OH)CH

acetic acid : water in proportion (60:1:40).

It were detected 5 fractions at electrophoretic separation of toxin in

boratic buffer (pH 8.4) with using of 600 V and 20mA during 4 hours. There

were up to 56% of protein, 4% peptides, more than 1% carbohydrates and

about 0.3% of reduction compounds in toxic substance of algae.

It were detected 16 aminoacids in toxin hydrolisate after hydrolysis

by proteolitic enzymes. It were leucyne (13.9±1.6), phenylalanine (4.6±0.27),

valine + methionine (4.1±0.41), tyrosine (6.3±0.36), proline, alanine (8.4±0.73),

threonine (14.9±1.27), glutamine acid (15.1±0.92), glycine + serine (7.9±5.6

and 13.3±0.8), asparaginic acid (5.4±0.27), arginine (5.1±0.32), hystidine

(2.4±0.73) and lysine (2.8±0.73). It was found the 1–2

free radicals in

the toxin composition with using of electron spin resonance method

(Malyarevskaya et al., 1986).

Solution of Cyanobacteria toxin in distilled water had the next maxi-

mum of absorption: 187, 189, 192, 193 nm for UV-areas and 2950, 2850,

1412, 730, 680 sm

–1

in IR-areas. Toxin was fractionated into 6 components

with relative electrophoretic mobility (REM)) in zones 0.09; 0.12; 0.17;

0.25; 0.44; 0.80 after using of disk-electrophoresis in polyacrylamide gel.

There are 4–5 acid components with close and identical mobility in its

structure. It is found the specific proteins in zones with REM near 0.80–

0.91 for most toxic preparations.

L. A. SIRENKO AND T. V. PARSHYKOVA

238

Cyanobacteria toxin (which is used for elaboration of this method) was

depolarized neuromuscular blocking agent and high cumulative by toxic-

pharmacological action. Anticholeneesterase acting were dominated after

sharp poisoning by toxin.

3. The General Principle of Model Reaction with Cholinesterase

Inhibition

All main elements of model reaction in vitro were based on experimental

data by Martin and Chatterjee (1969) (Sirenko et al., 1975) connected with

inhibition of acetylcholinesterase by algae toxins. This method was modi-

fied by group of scientists (Kirpenko et al., 1976; Sirenko et al., 1997) and

had been used for qualitative and quantitative estimation of toxic metabolites

in water and algae cells.

substrate (acetylcholine or butyrilcholine) and to decompose its into choline

and acetic or butyric acids by next scheme:

cholinesterase

HO(CH

)

OOCCH

 ⎯⎯⎯⎯⎯⎯⎯→ acetylcholine

HOCH

(CH

)

+ CH

COOH (acetic acid)

choline CH

COOH (butyric acid)

Changes of cultural medium pH are due to this reaction. This changing

may be registered by spectrophotometric method with using of bromine

thymol blue indicator or by electrometric method with indexes of pH-meter.

Depending on degree of cholinesterase inhibition the different quantity of

organic acid is evolved.

With aim of this reaction in mind to water sample with inferred present

of toxin added enzyme of cholinesterase with well-known activity and fixed

quantity of acetylcholine. Toxin quantity are determined by calibration curve.

Experiments were demonstrated that this method of Cyanobacteria toxic

metabolites estimation has high sensitivity. It makes possible to estimate

qualitative and quantitative content of biologically-active metabolites in

experimental samples. Method differs from other biochemical methods by

rapidity and may be used under field conditions (Kirpenko, 1996; Sirenko

et al., 1975). However, for its widespread use take into account that phenols,

heterocyclic amines which formation in large quantities in the breakdown of

organic compounds of algae may inhibition of cholinesterase too.

The principle of reaction lies in the fact that cholinesterase interact with

METHOD FOR ESTIMATION OF CYANOBACTERIA TOXINS

239

4. The Sampling of Water for Toxin Determination

Samples of water for estimation of algae toxin content were withdrawn from

reservoirs or at water-purifying stations on different phases of cleaning by

standard method. Volume of water samples was 0.5 l. Selected samples are

placed to glass capacities with neutral reaction. Plastic capacities for drink-

ing water or food products may be used too. Plastics and polyethylene of

other quality may leached different chemical compounds into water. It makes

difficult the receiving of analyze results.

All taking samples of water must be labeled with indication of day and

place of sampling, information about function of water. Water samples for

toxicology-hygienic analysis must be treated during 10–12 hours after

selection. Otherwise these samples necessary must be preserved in refri-

erator at temperature 4°С but no more than 2–3 days (Malyarevskaya et al.,

1986).

5. Preparing of Necessary Reagents

(Na

), 0.65 g of boric acid (H

) and 0.02 g of cholinesterase is

dissolved in 1 l volumetric retort. Activity of cholinesterase is measured

in International units (U) (at temperature 25

°С in 1 mg of dry preparation)

is 0.4–0.8 U.

Activity of cholinesterase in absolute units is characterized by

quantity (in mg) of butyrilcholineiodide cloven by 1 mg of dry enzyme

preparation for 1 hour at 20°С. Following a recommendations from

enzyme activity (U) is taken to be equal to its quantity which catalyzes

the transformation of 1 μΜ substrate during 1 min at 25°С under optimal

pH value and substrate concentration.

Method for determination of initial cholinesterase preparation

activity is based on titration with butyric acid which is evolved after

butyril-cholineiodide hydrolysis at 25°С and pH 8.0.

It is profitable to use solution with preparation concentration of 0.09

mg/l if level of cholinesterase cleaning the unknown. It is necessary to

prepare more concentrated solution if the reaction proceeds slowly.

Solution must be diluted if the reaction occurs rapidly.

Cholinesterase preparation weighing on analytical balance with an

accuracy of ±1% for determination of its activity. Then dissolved in 200

ml of saline solution. It is appropriate to prepare such concentrations of

preparations for analyze (mg/ml): 1.5; 0.5; 0.2; 0.09; 0.07; 0.05; 0.03;

0.01 (Malyarevskaya et al., 1986).

L. A. SIRENKO AND T. V. PARSHYKOVA

240

Enzyme Commission of International Biochemical Union the unit of

Standard solution of cholinesterase in borate buffer: 0.5 g of borax

24 ml of cholinesterase with fixed concentration adds to reaction capacity at

25°С. Then pH of cultural medium increases up to 8.5 with using of 0.1 n

NaOH. 1 ml of butyrilcholiniodide solution adds to this mixture. If pH

will decrease up to 8.0 it is necessary to add such quantity of 0.1 n NaOH

that pH is increased up to 8.1. It is noted the level of alkaline in micro-

burette after this manipulation. It is necessary to turn stop-watch at pH

8.0. Then the solution of NaOH adds during 3–5 minutes with such

speed that pH-meter pointer deflects from pH 8.0 no more than 0.5 point

to the left or to the right.

It is established the level of alkaline in microburette after necessary

time and ending of titration. Cholinesterase content is determined in

International units by formulae:

A = ,

where - P

– quantity of butyrilcholiniodide which was hydrolyzed

(μM);

- t – time (min);

- P

– quantity of cholinesterase which used for 1

determination (mg).

It is determined that 1 ml of 0.1 n NaOH represents the hydrolysis of

100 μM of butyrilcholineiodide.

Value of P

can be deduced from concentration (mg/ml) and volume of

cholinesterase (24 ml of saline solution), which used for 1 determination by

next formulae:

100

= ,

where - K – correction factor on titre of 0.1 n NaOH;

- С – concentration of cholinesterase, mg/ml.

Precision of method is ±1.5%. Solution of cholinesterase must be kept

in refrigerator at 4°С.

2. Solution of acetylcholine is prepared by dissolving of 0.2 g in 10 ml of

distilled water immediately before using.

3. Bromine thymol blue soluble indicator is prepared by dissolving of 0.1 g

in 100 ml of distilled water. Solution is kept in refrigerator.

4. Standard of coloring for spectrophotometry: 1 g of acetous copper

(Cu(CH

COO)

) is dissolved in 19 ml of distilled water under heating

up to 40–50°С. To chilled solution it is flushed 2.5 ml of 0.1 n KMnO

and 1 ml of ethyl alcohol. Mixture is stirred intensively under heating on

METHOD FOR ESTIMATION OF CYANOBACTERIA TOXINS

241

water bath up to 50°С during 15 minutes. Then it is endured 2 hours for

stabilization of coloring under room temperature. Work solution is

obtained by mixing of 1 ml standard solution with 3.5 ml of distilled

water. Main standard solution is kept under darkness in vessel with

sealing plug.

5. Butyrilcholineiodide (recrystallized) – C

6. Magnesium chloride (MgCl

), pure for analysis

7. Sodium hydroxide – NaOH, 0.1 n

8. Tetraboric potassium (borax) – Na

, pure for analysis

9. Boric acid – H

, pure for analysis

10. Distilled water

11. Saline solution: 6 g NaCl, 3 g MgCl

, 0.1 g borax potassium are dis-

solved in 1 l of distilled water.

12. Solution of butyrilcholineiodide in saline solution with concentration

of 200 mg/ml (20%) is prepared before using (Malyarevskaya et al.,

1986).

6. Construction of Calibration Curve for Estimation of Toxin

Quantity

For estimation of toxin quantity by inhibition of cholineesteraze activity

with using of pH-meter or spectrophotometer it is necessary to pursue its

preliminary calibration for transformation of equipment indices into units

of toxin concentration (Kirpenko et al., 1977; Kirpenko, 1996; Martin and

Chatterjee, 1969).

Calibration of instruments is carrying out with using of solution well

known concentration of compounds by standard method. For preparation of

calibration curve used series of toxin solutions from 0.1 to 10

–12

mg/l. These

solutions are prepared step by step after dilution of initial solution. 0.1–0.5 ml

of extracted toxin solution under different concentration is flushed into test-

flowed the distilled water instead of toxin solution. After first incubation in

test-tube it is necessary to add 0.1 ml of bromine thymol blue and 0.2 ml of

acetylcholine solution. The optical density of solution is determined by

using of cuvette in 0.5 cm thick at 680 nm by spectrophotometry after second

incubation (20 min). As the control had been used standard of coloring.

tube. Then 1–2 ml of cholinesterase solution in borate buffer with pH

8.3–8.4 is added into experimental test-tube. Mixture is incubated during 10

min under temperature 37°С during 20 minutes. In the control test-tube is

L. A. SIRENKO AND T. V. PARSHYKOVA

242

Computation of cholinesterase change is produced by subtraction of

optical density or pH of experimental solution from control value, which are

always greater, than with algae toxin.

Construction of calibration diagram is executed by put aside abscissa

axis concentration of spectrophotometrized solutions in μg (mg) on ml (l).

Aside ordinate axis are put values of optical density for spectrophotometrized

solutions (control – experiment). Obtained calibration diagram is used for

estimation of toxin concentration in investigated solutions on the base of

values of its optical density or indices of pH change.

0.1–0.5 ml of experimental water samples added into test-tubes (3 parallel).

Then it is necessary to add 1–2 ml of cholinesterase solution in borate

buffer. Mixture is incubated during 20 minutes under temperature 37°С. In

control test-tube add of distilled water instead of experimental solution.

After incubation 0.1 ml of bromine thymol blue indicator add into investi-

gational test-tube. After second incubation with acetylcholine (during 20

minutes) is determined optical density of solution with using of Spectro-

photometer SF-46 and cuvette in 0.5 cm thick. Investigational length of

wave is 680 nm.

Computation of cholinesterase change is produced by subtraction of

optical density or pH of experimental solutions from control value, which

are always greater, than with algae toxin.

On the base of calibration curve is calculated the quantity of toxin in

water by the formulae:

a V

where - Т – toxin quantity in investigational water samples, mg/ml;

- a – quantity of toxin on calibration curve, mg;

- V – volume of investigated water sample, ml;

- V

– volume of water for determination of toxin, ml;

- V

– total volume of mixture for carrying out the reaction, ml.

Thus, reaction with cholinesterase may be used as express-reaction of

qualitative and quantitative estimation of toxin in water. Obtained information

allows to judge about water quality on different stages of its purification

or biological medium, which is used for cultivation of other hydrobionts.

in Natural Water

Т =

Qualitative Estimation of Cyanobacteria Toxic Compounds

METHOD FOR ESTIMATION OF CYANOBACTERIA TOXINS

243

However, above mentioned method isn’t suitable for quantitative estimation

of algae toxin for Cyanobacteria, which is accumulated in tissues of hydro-

bionts and animals. For these purposes using of immunological methods is

more perspective. With the help of specific antiserum, which is obtained by

toxin immunization (as example, for guinea-pigs), allows to receive reliable

and precise data about toxins concentration in water and other biological

objects, which may accumulate toxins in own organisms.

8. Conclusions

Algae toxin oppresses oxidative-restoration enzymes and cholinesterase,

increasing of aldolase activity under chronic poisoning. Destruction of car-

bonic and protein exchanges is consequence of enzyme activity changing. It

causes accumulation of unoxidated products of carbonic exchange, strength-

ening of ATP consumption and inhibition of its restoration. It has a negative

effect on energy balance of cells and causes pathologic changes in its func-

tional activity.

By this means action of Cyanobacteria toxic metabolites may be deter-

mined by inhibition of enzyme activity which catalyzes the different stages

of metabolism in organism. It was proved that Cyanobacteria toxins may be

regarded to enzyme poisons. Such method in algae toxins pharmacodynamics

is highly efficient because it combines a great group of toxic compounds

with different properties. It is evident that inactivation of enzyme systems

plays decisive role in pathogenesis of intoxication (Kirpenko, 1996).

–12

mg/l.

This biochemical method can be carried out in field conditions. The re-

striction of this biochemical method using can be promoted by strengthening

of destruction processes in cells. At these processes decomposition of algae

biomass are intensified considering that Phenols and heterocyclic amines

which are formed after destruction processes can oppress cholinesterase too.

In this case it is advantageous to use the complex estimation of the quali-

tative and quantitative content of Cyanobacteria toxins, supplemented bio-

chemical investigations by the performance of immunological tests.

Proportional biochemical methods for quantitative determination of

Cyanobacteria toxins by inhibition of cholinesterase reaction can be used for

mono- and mixed algae cultures. Toxicity is decreased under algae cultiva-

tion in algologically pure cultures. Conversely, toxicity is increased under

algae cultivation in mixed cultures. It was registered that toxicity may be

greatly increased after joint development of species-antagonists (for example

Microcystis and Aphanizomenon, Microcystis and Anabaena, Aphanizo-

menon and Anabaena). It was shown that sensitivity of this method achi-

eved to

L. A. SIRENKO AND T. V. PARSHYKOVA

244

References

Canter-Lund, H., Lund, J., 1995, Freshwater algae, their microscopic world explored.

Bristol: Biopress Ltd.

Carmichael, W.W., 1994, The Toxins of Cyanobacteria. Scientific American 270 (1): 78–86.

Carmichael, W.W., 1997, The Cyanotoxins. Adv. In Botan. Research 27: 211–256.

Harada, K., 1996, Chemistry and detection of microcystins. In Toxic Microcystis (Eds.

Watanabe, M., Harada, W., Carmichael, W., Fujiki, H). Boka Raton: CRC Press.

Kirpenko, Y. et al., 1976, Method of determination of Cyanobacteria toxin. Patent of USSR,

Kiev.

Kirpenko, Y.A. et al., 1977, Toxins of blue-green algae and animal organism. Kiev: Naukova

Dumka.

Kirpenko, Y., 1996, Biological-active algae compounds with antiblastomic and antimicrobial

action. Thesis of dissertation for obtaining the scientific degree (Dr. h. c.). Speciality –

Pharmacology. Kiev.

Malyarevskaya, A. et al., 1986, Determination of Cyanobacteria toxins in water and fish, dia-

gnostics of fishes poisoning during water “blooming”. Kiev: Institute of Hydrobiology

NAS of Ukraine.

Martin, D., Chatterjee, A., 1969, Isolation and characterization of a toxin from the Florida

Sirenko, L., Gavlilenko, M., 1978, Water “blooming” and eutrophycation. Kiev: Naukova

Dumka.

Sirenko, L., Kozitskaya, V., 1988, Biologically active substances of algae and water quality.

Kiev: Naukova Dumka.

Sirenko, L. et al., 1975, Methods of physiology-biochemical investigations of algae in

hydrobiological practice. Kiev: Naukova Dumka.

Sirenko, L. et al., 1995, Effect of metabolites of some species of algae on cell cultures of

human and animals. Algologia 5 (1): 102–105.

Sirenko, L. et al., 1997, Method of receiving of biological-active compounds with anti-

blastomic

antimicrobial and neurotropic action. Patent of Ukraine, Kiev.

red tide organisms. Nature 221 (5175): p.59.

METHOD FOR ESTIMATION OF CYANOBACTERIA TOXINS

245

USING OF LASER-DOPPLER SPECTROMETRY FOR

DETERMINATION OF TOXICITY DEGREE OF CHEMICAL

AND NATURAL COMPOUNDS

VITALIY VLASENKO

Institute of Bioorganic and Oil Chemistry NAS of Ukraine,

Murmanskaya st., 1, 02660, Kiev-94, Ukraine

TETYANA PARSHYKOVA* AND VADYM TRETYAKOV

Kiev National University named Taras Shevchenko,

Vladimirskaya st., 60, 01017, Kiev, Ukraine

Abstract: It is presented the results of using of laser-doppler spectrometry

method for estimation of toxicity level as well synthesized (on example,

) as natural biologically active substances (Emystime C). As the

test-objects had been used 3 species of Chlamydomonas: Chl. reinhardtii

Dang., Chl. aculeata Korschikoff in Parscher and Chl. pitchmannii Ettl. It is

shown the high sensitivity of laser-doppler spectrometry method and pers-

pectives of its using for determination of toxicity for different exometaboli-

tes caused by plants, mushrooms and microorganisms into environment.

Keywords: Laser-doppler spectrometry, microalgae, speed of movement, energy

1. Introduction

Changes of physiological reactions of plant and animal organisms are widely

used for studying of toxicity degrees in reservoirs and soils. The answering

reaction of living organisms (as well single-cells as multi-cells) conducts on

______

*To whom correspondence should be addressed. Tetiana Parshykova Kiev National University

named Taras Shevchenko, Volodymyrska st., 60, 01017, Kiev, Ukraine. Email: ladik1@voliacable.com

V. Evangelista et al. (eds.), Algal Toxins: Nature, Occurrence, Effect and Detection. 247

consumption, potassium dichromate, growth regulator

cell level under influence of extreme factors of environment. In all pro-

bability mechanism of one-typical nonspecific answering reaction on the

impaired influence during evolution process in cells was elaborated.

Invertebrates (such as Daphnia magna Straus, infusoria Tetrahymena

pyriformis W.) and high water plants (such as Elodea canadensis

L., Vallisneria spiralis L.) very often used as the primary, non-expensive

and sensitivity test-objects. In the first case the mortality of infusoria or

dead of more than 50% of Daphnia from starting quantity (during 96 hours

exposition) comparison with control are estimated for water toxicity degree

(Braginskiy, L.P. et al., 1987). The speed of cytoplasm movement in cells

of high water plants is main physiological reaction for vital activity of

object (Smirnova and Sirenko 1993). It associated with that mobility of

intracellular structure is as well function of intensity of energy process that

caused in cell as characteristic of aggregative state of cytoplasm (its vis-

cosity). Considerable and short-term stimulation of oxidative-restoration

process with the generation of energy (for example, increasing of respi-

ration intensity) may be happen under the effect of individual toxic mix-

tures. This process results in increasing of cytoplasm movement, which

with time have drained the cell supply of energy and caused of its death. All

organisms may perish after blocking of photosynthetic processes.

The movement of green algae (such as Dunaliella salina Teod., D. viridis

L., Euglena gracilis Klebs, Pedinomonas tennuissima M., Chlamydomonas

reinhardtii Dang. and other) is of frequent use in biotesting of sea and

freshwater reservoirs among microscopic organisms (Barsanti and Gualtieri,

2006; Massjuk et al., 2007, Novikova et al., 2007). The reason is that

movement of living, nondestructive algae cells are connected with main

fundamental processes of vital activity of organisms such as photosynthesis,

energy transformation, transfer the compounds into membranous structure

of cell. Studying of movement cells has a direct relation to revealing of

general principles for regulation as well intracellular metabolism processes

as ontogenesis, embriogenesis and morphogenesis. Studies of peculiarities

of algae movement are definitely of interest for ecology and geography of

algae. In particular, outecology allow specifying characteristics of some

species concerning their reactions to considerable amount of parameters (for

example, reaction to light, temperature, content of cultural medium) and

determine optimum, maximum and minimum values of acting factors of

environment. It may help to estimate the toxicity of biology-active com-

pounds as well of experimental plants as other organisms which entering

V. VLASENKO T. PARSHYKOVA AND V. TRETYAKOV

248

into environment. In this connection the origination of demand in ela-

boration and using quick, sensitivity and reliable methods for estimation of

LASER-DOPPLER SPECTROMETRY

parameters and speed of movement of different algae species as the

test-objects.

The aim of our investigations was elucidation of possibility to using of

laser-doppler spectrometry (LDS) method for express-estimation of toxicity

degree of chemical and natural compounds.

2. Material and Methods

As the test-objects have been used algological and bacterial pure cultures

of mobile algae from Chlorophyta genus Chlamydomonas that were selec-

ted from freshwater biotopes: Chlamydomonas reinhardtii Dang. (from

collection of Oak Ridge National Laboratory, USA); Chl. Aculeate Kors-

chikoff in Parscher, Chl. pitchmannii Ettl. (from SAG collection from

University of Gettingen, Germany). The algae were grown in Erlenmeyer

retort with using of the similar cultural medium for different species of

Chlamydomonas (Sirenko et al., 2005) at temperature 20 r2°ɋ and lighting

4500–5000 lux. Duration of light and dark periods were 12/12 hours. For

experiments have been used the cultures on the logarithmic and stationary

growth phase. There were two series of experiments for determination of

sensitivity of LDS method. Chemical and natural compounds that used in

industrial and biotechnological processes had been used in these experi-

ments.

Series 1. – K

was used as toxic compound. Using concentration

were 0.05; 15.0; 45.0 and 75.0 mg/l. Determination of experimental indices

of algae development were provided during 1, 7 and 14 days of cells contact

with potassium dichromate.

Series 2. – Growth regulator with wide spectrum of action (Emystime

C) had been used in this series. Emystime C is exometabolites of mushrooms-

epiphytes that were cultivated in root system of medical plant. Emystime C

added in concentration 0.005; 0.013; 0.025; 0.05; 0.1; 0.15 and 0.25 mg/ml

to cultural medium. Estimation of cell development indexes was provided

after 1, 2, 7, 14, 21 and 28 days.

Laser-Doppler Spectrometer (Vlasenko et al., 1992) produced by Molfar

Instruments was used for control of vital activity of test-object. Figure 1

shows a block diagram of information-measuring systems on the basis of

Laser-Doppler spectrometer. LDS makes it possible to estimate the speed of

cells motion (Pm/s), energy consumption for cells movement (relative

units), part of living and dead algae cells (%) as well as the reactions under

the effect of different groups of possible toxicants. 300–500 Pl of algae

suspension with cell concentration from 0.5 to 200 billion cells per 1 ml

249

V. VLASENKO T. PARSHYKOVA AND V. TRETYAKOV

were placed in a cuvette. Measurements for 1 sample lasted up to 3 minutes.

Measurement error does not exceed 3% for all parameters.

Changes of speed Chlamydomonas cells movement and its consump-

tion of energy had been proved in 10 times repetition. For this aim it was

Figure 1. Laser-doppler spectrometer.

registered averaged experimental data. Methodical aspects for procedure of

energy consumption by algae cells are presented in our last paper (Novikova

et al., 2007).

250

1. Electronic module of a network or autonomous power supply.

2. Laser-optical measuring module.

3. Multi-channel analog-digital signal converter.

4. Universal interface with auxiliary and other specialized measuring systems

of monitoring.

5. Computer.

6. Specialized software.

7. Channels of exchange and connection of a complex with standard networks.

2.1. Laser (He-Ne, 632.8nm). 2.2. Laser power supply unit. 2.3. Temperature-

2.5. Photodetector. 2.6. Electronic amplifier.

controlled zone of measurement. 2.4. Electronic control of thermal stability.

LASER-DOPPLER SPECTROMETRY

(Pm

) were calculated by suitable formulae (Parshykova et al., 2006) with

using of ocular-micrometer indices. Concentration of algae cells may be

estimated by LDS method (in relative units) too. It is necessary to pursued

calibration of laser-doppler spectrometer for receiving this parameter in

absolute units. With this aim used parameters must be received by hard

calculation of cell number with Goryaev chamber.

Control of algae pigment complex is carried out by chlorophyll a

content with using of extraction or non-extraction methods. For measure-

ment of pigment concentration by extraction (spectrophotometry) method

have been used Spectrophotometer SF-46 with regard to UNESCO work

group recommendation (Musienko et al., 2001). Method of differential

fluorimetry of native algae cells was used for non-extraction estimation of

pigment concentration. In these experiments have been used the Plancto-

fluorometer FL 300 3M, which was elaborated by specialists from Kras-

noyarsk State University (Gold et al., 1984, Gold et al., 1996). At parallel it

is determined the 'F indices which characterized by intensity of fluorescence

before and after addition of symazine as inhibitor of electron transport of

photosynthesized cells. 'F index characterizes the level of vital activity of

algae by magnitude of its potential photosynthetic activity (Parshykova

et al., 2001).

Methods of statistic analysis have been used for mathematical treatment

of receiving experimental data (Lapach et al., 2000). Conclusions were

formulated on the base of Student criterion with confidence probability

Ɋ = 0.95.

3. Results and Discussion

3.1. SERIES 1. CHEMICAL SYNTHESIZED REAGENT – K

Receiving experimental data testifies that cells of different species of

Chlamydomonas differ by speed of cell movement and energy consumption

up to beginning of experiments. Cells of Chl. aculeata (52.60 r 3.87 Pm/s)

had the highest speed of movement in comparison with Chl. pitchmannii

(43.51 r 2.74 Pm/s) and Chl. reinhardtii (34.93 r ). Energy consum-

ptions for movement realization was higher in cells of Chl. aculeata (17.67

r 2.15 rel. units) in comparison with other objects (Chl. pitchmannii (6.51 r

0.68) and Chl. reinhardtii (3.61 r.2) (Figure 2).

251

Number of algae cells was defined with using of Goryaev chamber on

MBI-1 microscope. Size of cell surface (Pm

) and volume of microalgae

V. VLASENKO T. PARSHYKOVA AND V. TRETYAKOV

Figure 2. Initial (without addition of reagents) speed of cells motion and energy consum-

ption for different species of Chlamydomonas.

Different species of Chlamydomonas are specific by answer reaction

after 1 contact day with K

. Chl. aculeata cells had more resistance to

presence of K

in cultural medium (Figure 3). These cells don’t feel

toxicity of Cr (VI) that was in content of potassium dichromate. Speed of

Chl. aculeata cells motion was decreased only at maximal experimental

concentrations of K

(45 and 75 mg/l).

Figure 3. Effect of potassium dichromate on speed of motion and energy consumption for

Chlamydomonas aculeata cells.

The speed of cells motion is kept on the level of control for limit-

permissible concentration of K

(0.05 mg/l) after 14 day of contact.

The speed of cells movement to begin to decline at maximal experimental

concentrations 45 and 75 mg/l (on 28–34%). It testifies about increasing of

toxicity level of K

at rising of the contact time for Chlamydomonas

cells with toxicant. It is significantly that energy consumption for cells

motion was gradually reduced beginning with concentration of 15 mg/l after

1 day of contact with K

. It was noted that stimulation of energy

consumption of Chl. aculeata cells at more low concentration (0.05 mg/l)

252

LASER-DOPPLER SPECTROMETRY

after 14 days of contact in comparison with control. It testifies that algae

cells were sensitive to K

toxicity and increased the consumption of

energy on its movement. In this connection is good reason to believe that

mobility of algae cells can helps to survived under effect of unfavorable

chemical factors of water environment. It must be emphasized that such

protective mechanism can help in survive of microalgae cells only up to

fixed concentration of toxic compounds. In experimental cells had been regis-

tered sharp decreasing the consumption of energy on further increasing of

toxicant concentration. It may be connected with damaged of photoreceptor

apparatus under higher concentrations. We observed the similar reaction in Chl.

aculeata cells at concentration of K

15 mg/l after 14 days of contact. It

was registered the sharp decreasing the consumption of energy (at 88–91%

for concentrations 15 and 75 mg/l) under increasing of acting concentration

above 15 mg/l. It testifies about dying away of microscopic algae cells.

Chl. reinhardtii cells had medium degree by resistance of potassium

dichromate toxicity from experimental species of Chlamydomonas (Figure 4).

Cells of this species increased speed of movement beginning from con-

centration of 15 mg/l after 1-day contact with K

. The limit-permissible

concentration of K

don’t influence on speed of cells motion but

maximal experimental concentration (75 mg/l) makes Chl. reinhardtii cells

immovable after 1 days of contact. The speed of cells movement was per-

ceptibly decreased at concentrations 45 and 75 mg/l (in medium on 79–

85%) after 14 days of contact in comparison with control.

Figure 4. Changes in speed of motion and energy consumption for Chlamydomonas

reinhardtii cells under influence of K

The consumption of cell energy increased at rise of toxicant concentration

after 1 contact day with K

. It was registered the maximal increasing of

the consumption of cell energy for concentration of 45 mg/l (on 235%) in

comparison with control. Maximum experimental concentration (75 mg/l) is

appears lethal for Chl. reinhardtii cells under 1 contact day after addition of

into cultural medium. It was registered the successive decreasing

253

V. VLASENKO T. PARSHYKOVA AND V. TRETYAKOV

the consumption of energy on 20–91% at concentrations 0.05 and 75 mg/l

in comparison with control (Figure 4).

Chl. pitschmannii cells are the least resistance to presence of K

cultural medium (Figure 5).

Figure 5. Changes in speed of motion and energy consumption for Chlamy-domonas pitchmannii

cells under presence of different concentrations of potassium dichromate in cultural medium.

Algae cells of this species lost of mobility at concentrations of reagent

45 and 75 mg/l after 1 day of contact with potassium dichromate. It was

registered the increasing of speed of movement and the consumption of

energy under decreasing of K

concentration to 0.05 mg/l. It testifies

about its capacities to survive. It is interesting to note that at K

concentration 15 mg/l was registered the sharp increasing of speed of

movement (on 100%) after 1 contact day in comparison with control. Lethal

concentration of K

for Chl. pitchmannii cells was 45 mg/l after 1 day

of contact with it. It is noted that the consumption of energy for Chl.

pitchmannii cells at maximum experimental concentrations of K

were registered at level of 2.65–2.81 relative units. It testifies about possible

damage surface membrane – plasmalemme by K

. Such membrane is

found as well under hydroxyproline cell walls that are surrounded of Chlamy-

domonas cells as cover of filaments.

As illustrated of experimental data the least resistance to K

species of Chlamydomonas (Chl. reinhardtii and Chl. pitchmannii) had as

well less cells number in suspension as lower temps of quantity growth

(Table 1).

It is evident that biomass factor or total number of cells in liquid volume

is of considerable importance in determination of toxicity level of K

and changes of physiological state of algae. The greater is the biomass of

algae the feeble is inhibition influence of K

on the physiological state

of algae.

Obtaining experimental data connection with toxicant effect of photo-

synthesis productivity (Figure 6) and dynamic of photosynthetic pigments

content confirmed main conclusions that had been used with LDS method.

254

LASER-DOPPLER SPECTROMETRY

Levels of Chlamydomonas cells resistance to addition of K

into

cultural medium are arranged in the next order: Chl. aculeata > Chl.

reinhardtii > Chl. pitchmannii.

TABLE 1. Changes of cell number (mln. cells/ml) species of Chlamydomonas under

influence of different concentration of K

Chl. aculeata

Variant of

experiment

initial 1 day later 14 days later

Control 3.87r0.26 6.60r0.45

0.05 mg/l 3.46r0.23 6.19r0.47

15 mg/l 5.43r0.39 2.31r0.16

15 mg/l 5.09r0.34 4.35r0.31

75 mg/l

3.61 r 0.28

3.98r0.29 3.62r0.28

Chl. reinhardtii

Variant of

experiment

initial 1 day later 14 days later

Control 1.02r0.09 1.19r0.11

0.05 mg/l 0.67r0.06 0.46r0.04

15 mg/l 0.84r0.08 0.80r0.07

15 mg/l 0.62r0.05 0.49r0.05

75 mg/l

1.01 r 0.08

0.60r0.06 0.46r0.04

Chl. pitchmannii

Variant of

experiment

initial 1 day later 14 days later

Control 0.82r0.06 0.85r0.09

0.05 mg/l 0.76r0.07 0.29r0.03

15 mg/l 0.52r0.05 0.41r0.04

15 mg/l 0.51r0.05 0.44r0.05

75 mg/l

0.82 r 0.07

0.45r0.04 0.31r0.03

By this means the complex using traditional (microscopic analyses and

spectrophotometry) methods of analyze for physiological state of micro-

algae and LDS method are supported the sensitivity of this method and

assurance of receiving information. It is significant that LDS is efficient

method for determination of species specificity of answer reaction for

different species of one microalgae genus.

255

V. VLASENKO T. PARSHYKOVA AND V. TRETYAKOV

3.2. SERIES 2. NATURAL GROWTH REGULATOR – EMYSTIME C.

Much attention is given to search and elaboration of effective growth

regulator of cells in connection with intensive development of algae bio-

technologies. In current time the practical choosing of growth regulator of

Figure 6. Influence of potassium dichromate on dynamics of chlorophyll a content for

different Chlamydomonas species: A – Chl. aculeata; B – Chl. reinhardtii; C – Chl.

pitchmannii.

microalgae in intensive cultivation isn’t large and limited by derivates of

E-indolylacetic acid, hyberillines, cytocynines and other very expensive

compounds. In this connection scientists carried out experiments in recei-

ving of natural phytohormone on the base of plants, mushrooms and micro-

organisms. LDS method had been used for express estimation of toxicity

and efficiency natural biologically active compounds.

256

LASER-DOPPLER SPECTROMETRY

It was shown that addition of Emystime C into cultural medium essen-

tially stimulated activity in cells motion (Figure 7). Stimulation effect was

of greater intensity than higher using concentration of Emystime C. It was

noted increasing of speed of cell movement and it’s the consumption of

energy during all time of observations.

Figure 7. Changes in speed and energy consumption for Chlamydomonas reinhardtii cells

under addition of Emystime C.

Changes the speed of test-object movement and increasing of its energy

consumption at first hours of contact the algae cell with growth regulator

which have been estimated by LDS method are supported by strengthening

of cultures growth by dynamic of chlorophyll a concentration. As illustrated

Figure 8 temps of chlorophyll a growth in experimental variants are

changed after addition of growth regulator into cultural medium. Then

chlorophyll a content rised at increases of duration of cells contact with

Emystime C and depends from its concentration.

Figure 8. Influence of Emystime C on chlorophyll a content and its photosynthetic activity.

Emystime C concentration of 0.005 mg/ml had maximal stimulation

effect on the dynamic of chlorophyll biosynthesis. The higher concentration

257

V. VLASENKO T. PARSHYKOVA AND V. TRETYAKOV

didn’t demonstrate stimulation effect at first time. When duration of contact

time is increased higher concentrations had positive effect on chlorophyll

biosynthesis. Potential photosynthetic activity of algae ('F) changed too

under effect of Emystime C. The decline of 'F is registered at Emystime C

concentration of 0.25 mg/ml. This is due to the fact of increasing of optical

density for culture in experimental variants. The reason has to do the self-

shading cells in cultures and impairment of light regime.

Cells numbers of Emystime C for terms of optimal work of photoreactor

are tabulated in Table 2. Referring to it, cells number increasing and at 7

days was more than control on 47% for Emystime C at concentration of

0.005 mg/ml. Self-shading of cells have clearly defined on 28 day of contact of

test-object with growth regulator in laboratory experiments.

TABLE 2. Changes is cells number under influence of growth regulators.

Number of cells, mln/m l Variant of

experiment

initial 1 day later 2 days later 7 days later

Control 5.58 r 0.28 6.20 r 0.32 6.65 r 0.34

Emystime C

0.005 mg/ml 4.56 r 0.19 8.82 r 0.42 9.80 r 0.46

0.25 mg/ml

6.72 r0.35

4.50 r 0.18 4.78 r 0.21 5.02 r 0.22

Factor of self-shading is removed at mass (industrial) cultivation of

algae. The way to do this is through photobioreactor construction, intensity

of its lighting and regime of light delivery to algae suspension (for example,

by special optical fibers). Regular removal of algae biomass is of considerable

importance in elimination of self-shading. Considering that the main goal of

our investigations was possibilities of LDS method using we didn’t con-

ducted of regulation of self-shading of algae cultures.

Results of investigations are confirmed that natural growth regulator

Emystime C are influence positively on speed of cells movement for algae

test-cultures, its consumption of energy, the pace of chlorophyll a accumu-

lation and photosynthetic activity of organism. This suggests the possibility

of Emystime C at mass cultivation of algae.

4. Conclusions

By this means LDS method may be recommended for express estimation of

toxicity as well chemical synthesized as natural biological-active substances,

which are produced by microorganisms, plants and mushrooms into environ-

ment. LDS method may be used for biotesting investigations because makes it

258

LASER-DOPPLER SPECTROMETRY

possible receiving of spatiotemporal characteristic of unfavourable state of

water quality (for example, with the availability of water “blooming” spots,

caused by mass reproduction of toxic algae species) on the different parts of

water objects or in recervoirs as a whole. LDS method may be used for

operative revealing of local contamination sourses, for mapping zones of its

distribution and determination of more ecologically unfavourable part of

water area. It is evident that LDS method have the benefits in comparison

with other methods which using in for natural water monitoring.

LDS method with standard set of toxicants may be successfully used

control of sewage quality before it’s entering to water reservoirs by industrial

plants.

High sensitivity of LDS method makes possible to extend the range of

search for most perspective and selective acting of growth regulator for

microalgae and accelerates its choosing for practical using at mass

(industrial) algae cultivation. It is shown that addition of growth regulator in

special choosing concentration for every algae species into cultural medium

will increase temps of growth biomass and efficiency work of photobioreactors.

5. Acknowledgements

Authors are grateful to Prof. I. Yu. Kostikov for possibility to using

for experiments Chl. aculeata and Chl. pitchmannii cultures and PhD

S. P. Ponomarenko for help and useful suggestions with natural growth

regulators.

References

Barsanti, L., Gualtieri, P., 2006, Algae: anatomy, biochemistry and biotechnology. Boca

Raton: CRC.

Braginskiy, L.P., et al., 1987, Freshwater plankton in the toxic environment. Kiev: Naukova

Dumka.

Gold, V.M., et al., 1984, Theoretical basis and methods of fluorescence chlorophyll

studying. Krasnoyarsk: Krasnoyarsk univ.

Gold, V.M., et al., 1996; Assimilation activity of chlorophyll (theoretical and methodical

aspects). Biology of Internal Water 1: 24–32.

Lapach, S.N., et al., 2000, Statistical methods in medicobiological investigations with using

of EXCEL. Kiev: MORION.

Massjuk, N., et al., 2007, Photomovement of Dunaliella Teod. cells (Dunaliellales, Chloro-

phyceae, Viridiplantae). Kiev.

Musienko, N.N., et al., 2001, Spectrophotometric methods in practice of physiology,

biochemistry and ecology of plants. Kiev: Phytosociocentre.

Novikova, I.P., et al., 2007, Effect of K

on the photosynthetic activity and mobility of

Euglena gracilis Klebs cells. Algologia, 17 (3): 305–316.

259

V. VLASENKO T. PARSHYKOVA AND V. TRETYAKOV

Parshykova, T.V., et al., 2001, Express-control of growth and physiological state of

microalgae. Algologia, 11 (3): 403–413.

Parshykova, T.V., et al., 2006, Determination of microalgae growth characteristics for

biominotoring realization. Kiev: Logos.

Smirnova, N.N., Sirenko, L.A., 1993, Cytophysiological method of express-estimation of

toxicity for natural water. Hydrobiological J. 29 (4): 95–101.

Sirenko, L.A., et al., 2005, Collection of living cultures of microalgae (acronym of collection

– HPDP). Kiev: Phytosociocentre.

Vlasenko, V.V., et al., 1992, Method of determination for toxic influence of chemical

compounds which entering in water environment on the culture of plankton hydrobionts.

Patent of Ukraine, Kiev.

260

PCR TECHNIQUES AS DIAGNOSTIC TOOLS FOR

THE IDENTIFICATION AND ENUMERATION OF TOXIC

MARINE PHYTOPLANKTON SPECIES

ANTONELLA PENNA*

Centro Biologia Ambientale, University of Urbino

“Carlo Bo”, Viale Trieste 296, 61100 Pesaro, Italy

LUCA GALLUZZI

Centro Biotecnologie, Fano Ateneo, University of Urbino

“Carlo Bo”, Via T. Campanella 1, 61039 Fano, Italy

for the rapid, specific and sensitive detection of target toxic microalgae

ther, a need to quantify species specific target HAB (Harmful Algal Bloom)

cells in natural assemblages avoiding the time consuming traditional methods

of the microscopy is basically required. Here, a brief review of the quail-

tative and quantitative PCR-based methods applied for the monitoring of

HAB species in field samples from the Mediterranean Sea is presented.

Keywords: HAB species, Mediterranean Sea, molecular techniques, PCR, primers,

1. Introduction

During these last decades numerous phylogenetic studies on marine phyto-

plankton at genus, species and population levels permitted to achieve rele-

vant information on the existing relationships among them. Most of these

______

*To whom correspondence should be addressed. Antonella Penna, Centro Biologia Ambientale,

University of Urbino, 61100 Pesaro, Italy. Email: antonella.penna@uniurb.it

have been developed and performed in many laboratories worldwide. Fur-

V. Evangelista et al. (eds.), Algal Toxins: Nature, Occurrence, Effect and Detection. 261

Abstract: Molecular based techniques applied to the marine environment

rRNA genes

phylogenetic studies used the ribosomal genes (rRNA) that included a huge

sequence dataset useful to assess the genetic variability within the genes or

non coding regions to design oligonucleotide primers and/or probes taxon

specific for the HAB micro-organisms to be examined (Scholin et al., 1996;

Simon et al., 2000; John et al., 2005). The molecular assays for the identi-

fication of the toxic marine phytoplankton taxa are strictly related to the

level of genetic variability within a species or genus and/or a fine grouping

as among populations within a species. Molecular species is defined based

on the molecular divergence or accumulated mutations among single in-

dividuals or individual groups in selected coding or non coding regions of

nuclear and/or organelle genomes (Palumbi, 1992; 1994). This concept is

well visualized by a phylogenetic analysis where each clade is evolutionary

distinct also by its ancestor and descendent even if it may be not repro-

ductively isolated (Gosling, 1994; Avise, 1998). Another important consi-

deration has to be taken care on the molecular species concept applied to

the marine phytoplankton, as the potential conflict with the morphological spe-

ciation concept; based on several studies it well established that different

morphotypes of the Alexandrium tamarense species complex belong to the

same geographic ribotypes (Scholin et al., 1994; John et al., 2003); within

some diatom species of the genus Pseudo-nitzschia high genetic variation

was found among spatial and temporal series collected isolates (Orsini

et al., 2004; Evans et al., 2004; Lundholm et al., 2006).

Within the coding or non coding regions of the nuclear genome once

assessed the level of genetic variation at which the potential discrimination

of taxa (genus, species, toxic or no toxic isolates) have to be done, appro-

priate molecular markers can be selected and used in the molecular assay.

The choice of the molecular marker in these assays is of great importance

since it reflects species specific differences in polymorphism between popu-

lations of a species within its geographic range. In fact, the genetic probes

for Pseudo-nitzschia species designed from ribosomal gene sequences of

isolates collected over a limited geographical area did not match with iso-

lates of the same species elsewhere (Parson et al., 1999; Orsini et al., 2002).

The biodiversity in marine systems is higher respect to that of terrestrial and

freshwater ecosystems due to the high dispersal and great population sizes;

in fact, a large portion of species exists as a planktonic phase, and the

marine microorganisms are subjected to environmental factors responsible

of the species adaptive strategies (Avise, 1998; Feral, 200

2).

The harmful phytoplankton constitute a group that holds sanitary, eco-

logical and economic implications towards the coastal environments, the

262

A. PENNA AND L. GALLUZZI

human health and mariculture facilities due to the consequences of recurrent

harmful microalgal occurrences or blooms. The adverse effects of HABs

include toxin production, fish gill clogging, oxygen depletion with ipoxia or

anoxia events and unpleasant water quality.

2. Detection and Monitoring of HABs

The Harmful Algal Blooms are increasing worldwide (Graneli and Turner,

2007). This may be attributed to many reasons, including the increased utili-

zation of coastal waters for aquaculture, eutrophication and/or unusual clima-

tological conditions, the movement of resting cysts caused either by ships’

ballast waters or the translocation of shellfish stocks, overfishing and also

an increased scientific interest regarding harmful species. The design of har-

monized global detection and monitoring approaches is relevant and an

early warning system for detection of HAB species is needed. This effort

will be facilitated by the implementation of official monitoring procedures

using novel innovative technologies, including also molecular and toxin

detection. Molecular-based methods for detecting HAB species are used

routinely in many laboratories around the world. No single type of mole-

cular probe or assay strategy appears as the “best”. Indeed, some HAB

species can be detected using a variety of probes. The choice of probes/

techniques for a given species seems to follow personal references, tech-

nical background and available laboratory equipment. These innovative mole-

cular methods for detection and monitoring of HABs may be applied

together with traditional methods or constitute alternative methodologies to

traditional ones (Round Table Detection and Monitoring of HABs, XI Int.

Conf. Harmful Algal Blooms, Cape Town, 2004). Current methods depend

on microscopy, toxin and pigment analyses, which are time consuming and

require considerable expertise and skill. The molecular techniques present

many advantages including being more rapid, more specific at the species

and population level, may require a minor level of expertise in the routine

laboratory procedures respect to expertise needed to discriminate key mor-

phological features indicative of HAB species, and they can be applied in

the screening of numerous field samples (Anderson, 1995; Scholin et al.,

1999; Bowers et al., 2000; Penna and Magnani 2000; Litaker and Tester,

2002; Medlin et al., 2006).

PCR TECHNIQUES AS DIAGNOSTIC TOOLS

263

DNA DirectTM Kit (Dynal, A.S., Oslo, Norway), DNeasy Plant Kit (Qiagen,

Valencia, CA, USA), Dinoflagellate Isolation Kit (Diatheva, Fano, Italy).

The efficiency of extraction and purification of genomic DNA from field

samples is relevant for the PCR-based assay when the target cells are at very

low concentration. The efficiency is related to the lysis process of cellular

compounds can be applied. Effects of inhibitors on PCR can be reduced by

adding bovine serum albumin (BSA) or dimetylsulphide (DMSO) to PCR

and sometime it is also useful to dilute the DNA template,.

4. PCR Techniques

To analyze the genetic variability it is necessary to select the appropriate

at the required hierarchical level (Hershkovitz and Lewis, 1996).

PCR amplification technique is fundamental for the genetic identify-

cation and characterization of microorganisms (Monis et al., 2005) and

widely used in many areas of research for cost and ease of use. In these last

decades, PCR based techniques were successfully employed for the gene-

tic characterization of many taxa of harmful phytoplankton species in the

marine environments (Bolch, 2001; Connell, 2002; Godhe et al., 2002; Vila

et al., 2005; Penna et al., 2007).

Primers are short synthetic oligonucleotides ranging between 10–30 (bp)

and containing 40–60% G/C content. They have to be complementary to

target sites on the template DNA. A list of essential requisites has to be

taken into consideration for the optimal primer design:

– a) primers should have G or C, or CG or GC at the 3’ termini to increase

the efficiency of priming;

3. Nucleic Acid Extraction

Genomic DNA of microalgal clonal cultures and field samples is extracted

and purified using a variety of commercial extraction kits as the Dynabeads

during the genomic DNA extractions otherwise the subsequent PCR reac-

humic acids, clays, heavy metals can act as inhibitory agents on the PCR

material and purification is based on the removing potential inhibitors and re-

reaction. These substances have to be eliminated from the sea-water samples

covering target DNA. The substances such as poly-phenols, poly-saccharides,

tions may be compromised. Several attempts to eliminate the effects of those

molecular technique and the DNA or RNA target regions that can discriminate

264

A. PENNA AND L. GALLUZZI

4.1. QUALITATIVE PCR AND OLIGONUCLEOTIDE PRIMER DESIGN

– d) cross dimers between sense and antisense primers should be avoided.

A 3’end cross dimer with a ¨G of –5 kcal/mol and an internal cross

dimer with a ¨G of –6 kcal/mol is tolerated (Fig. 2);

– e) melting temperatures (Tms) are preferred to be in the range of

52–58°C;

– f) primer annealing temperature (Ta) is the primer melting temperature

of the DNA-DNA hybrid stability. Too high Ta will give insufficient

primer-template hybridization resulting in low PCR product amounts.

Too low Ta can give aspecific products caused by a high number of

mismatches;

– g) optimal lengths of primers should be recommended in the range of

18–22 bp to avoid the missing of base or mistakes during the dNTP

incorporation;

– h) it should be avoided an imbalanced distribution of G/C and A/T rich

domains in the primers;

– i) the amplified product length for standard PCR can be in the range of

100–500 bp;

– l) primer can be located at the 5’ and 3’ ends, and generally the

sequence close to the 3’ end is known to show higher confidence and

preferred most frequently, because this is the end of the primer that is

extended by the DNA polymerase;

– m) primers have to be designed with high specificity in the target gene

to avoid cross homology with other DNA sequences in the PCR mix.

Commonly, primers are designed and sequences are analyzed in silico

using BLAST tool or others, to check for the specificity.

Primer design is achieved using software platforms such as Oligo

(www.oligo.com), CLCbio (www.clcbio.com), Primer Premier

(www.premierbiosoft.com/primerdesign/).

– b) self complementary as the formation of hairpins (secondary struc-

tures) inside the primer should be avoided. A 3’en d hairpin with a ¨G of

–2kcal/mol and an internal hairpin with ¨G of –3 kcal/mol is tolerated

(Fig. 1);

– c) the 3’-ends of primers should not be complementary to avoid primer

dimer formation;

The identification of harmful algal species is done using different genetic

markers coupled with molecular assays. Ribosomal RNA (rRNA) genes,

PCR TECHNIQUES AS DIAGNOSTIC TOOLS

265

4.2. DESIGN OF PHYTOPLANKTON TAXON SPECIFIC PRIMERS

Figure 1. Hairpin formation.

Figure 2. Cross dimer formation.

Subunit), 5.8S, and the non-coding Internal Transcribed Spacer (ITS) and

External Transcribed Spacer (ETS) regions, are traditionally employed and

a huge sequence database for many phytoplankton taxa is currently available

in Genbank (http://www.ncbi.nlm.nih.gov/), EMBL (http://www.ebi.ac.uk/)

and DDBJ (http://www.ddbj.nig.ac.jp/). Ribosomal genes can cover a number

of addressed questions for the phytoplankton genetic diversity characteri-

zation (Guillou et al., 2002; John et al., 2005). In fact, conserved and vari-

able regions are present within ribosomal genes: highly conserved regions

such as SSU are preferentially used for the discrimination above species

level for taxonomy and phylogeny purposes (Edvardsen et al., 2003; Lange

et al., 2002); whereas, moderately conserved or variable regions such as

LSU and ITS, respectively, are used for the discrimination between species

including the SSU (Small Subunit), D1/D2/D3 regions of LSU (Large

for taxonomy, phylogeny and detection purposes (Adachi et al., 1996; Saito

et al., 2002; Sako et al., 2004; Penna et al., 2005a). A series of molecular

266

A. PENNA AND L. GALLUZZI

PCR TECHNIQUES AS DIAGNOSTIC TOOLS

techniques are employed to investigate the genetic diversity at different

taxonomic levels (Table 1).

TABLE 1. Molecular techniques, marker and their application for the genetic characteri-

zation in marine phytoplankton.

Technique Marker Application Discrimination

level

Reference

RFLP (Restriction

Fragment Length

Polymorphism)

Variable

regions

Polymorphism study

of cleaved DNA

fragments

Among strains,

populations

Scholin et al.,

1994

AFLP (Amplified

Fragment Length

Polymorphism)

Variable

regions

Polymorphism study

of amplified and

cleaved DNA

fragments

Among strains,

populations

John et al., 2004

RAPD (Random

Amplified

Polymorphic DNA)

Variable

regions

Polymorphism study

of amplified DNA

fragments

Among strains,

populations

Bolch et al.,

1999

PCR and real time

PCR (Polymerase

Chain Reaction)

Target DNA

regions

Taxonomy,

Phylogeny,

diagnostic detection

Genus, species Godhe et al.,

2002; Galluzzi

et al. 2004;

Bowers et al.,

2000; Penna

et al., 2007

DGGE

(Denaturing

Gradient Gel

Electrophoresis)

Ribosomal

genes

Polymorphism study

of amplified DNA

fragments

Among strains,

populations

Van Hannen

et al., 1998;

Larsen et al.,

2001

TSA-FISH

(Tyramide Signal

Amplification-

Fluorescence

Hybridization)

Ribosomal

genes

Diagnostic detection Genus, species Miller and

Scholin, 2000;

Not et al., 2004

SHA (Sandwich

Hybridization

Assay)

Ribosomal

genes

Diagnostic detection Genus, species Scholin et al.,

1999; Tyrrell

et al., 2001

DNA ARRAY

with fluorescence

Ribosomal

genes

Diagnostic detection Taxon specific,

Genus, species

Metfies and

Medlin, 2004

Electrochemical

detection

Ribosomal

genes

Diagnostic detection Taxon specific,

Genus, species

Metfies and

Medlin, 2005

267

A. PENNA AND L. GALLUZZI

In particular, the target 5.8S rDNA and ITS regions are useful in

developing genus and species specific primers (Fig. 3); the high variable ITS1

and ITS2 regions together with the more conserved 5.8S rDNA sequences

proved robust among target genera and species, allowing discrimination of

the inter-specific variability in environmental samples containing mixed

phyto-plankton populations (Penna et al., 2007).

Figure 3. Harmful phytoplankton taxa oligonucleotide primer locations.

We report the design of genera and species-specific primers in the 5.8S

rDNA-ITS regions (Table 2). To design the couple of primers for each

specific taxon is essential carrying out the multiple alignments of the seve-

ral sequences within each species or genus. Sequence alignment can be done on

CLUSTAL W program (http://www.ebi.ac.uk/Tools/clustalw/).

A PCR based assay of natural samples always has to include a positive

control containing the plasmid cloned target fragment-taxon specific to test

that all reagents are working properly; a negative control with no DNA

added to test for the potential contamination of the PCR reagents with extra-

neous template DNA; and a spiked control containing known amount of

plasmid DNA added together with DNA of field samples to assess inhibit-

tion of the DNA polymerase caused by contaminants.

The PCR products are resolved on 1.8% (w/v) agarose gel, 0.5X TBE

(Tris/Borate/EDTA) buffer gel and are visualized by standard ethidium

bromide staining under UV light, along with a molecular weight standard.

The presence or absence of a appropriate size base pair band indicates if

specific harmful taxa are present in the sample.

268

PCR TECHNIQUES AS DIAGNOSTIC TOOLS

TABLE 2. Oligonucleotide primers targeting the ITS-5.8S rDNA regions of different

Harmful Algal Bloom genera and species of the Mediterranean Sea*.

Target taxa Forward primer (5’– 3’) Size bp Primer location

Reverse primer (5’ – 3’)

Alexandrium spp. F’- GCAADGAATGTCTTAGCTCAA

R’- GCAMACCTTCAAGMATATCCC

135 5.8S (5’o3’)

5.8S (3’m5’)

Dinophysis spp. F’- GCACGCATCCAAYTATCCATAAC

R’-CATACAGACACCAACGCAGG

360 ITS1 (5’o3’)

5.8S (3’m5’)

Pseudo-nitzschia

spp.

F’-CGATACGTAATGCGAATTGCAA

R’-GTGGGATCCRCAGACACTCAGA

111 5.8S (5’o3’)

5.8S (3’m5’)

Ostreopsis spp.

F’-AAAACGATATGAAGAGTGCAGC

R’-CCAGGAGTATGCCTACATTCAA

92 5.8S (5’o3’)

5.8S (3’m5’)

A. catenella F’-AGCATGATTTGTTTTTCAAGC

R’-GCAMACCTTCAAGMATATCCC

226 ITS1 (5’o3’)

5.8S (3’m5’)

A. minutum F’-CATGCTGCTGTGTTGATGACC

R’-GCAMACCTTCAAGMATATCCC

212 ITS1 (5’o3’)

5.8S (3’m5’)

A. tamarense

F’- TGTTACTTGTACCTTTGGGA

R’- ACAACACCCAGGTTCAAT

134 5.8S (5’o3’)

ITS2 (3’m5’)

A. taylori F’-TGGTGTTTGAATGCGGTTGT

R’-GCAMACCTTCAAGMATATCCC

297 ITS1 (5’o3’)

5.8S (3’m5’)

Fibrocapsa

japonica

F’-GCAGAGTCCAGCGAGTCATCA

R’-TAATATCCCAGACCACGCCAGA

180 5.8S (5’o3’)

ITS2 (3’m5’)

Coolia monotis

F’-ATAAGTTCAACATGTGATGA

R’-CATATCTTCAAGCATATCC

121 5.8S (5’o3’)

5.8S (3’m5’)

Lingulodinium

polyedrum

F’-ATGTGTTCTCATCGGATGTTG

R’-CACAGTACCGCTGCCACTTAAA

383 ITS1 (5’o3’)

ITS2 (3’m5’)

Protoceratium

reticulatum

F’-TGCTGATTGCCATCTATCTT

R’-CAGAAGCGCGTTAAACAG

382 ITS1 (5’o3’)

ITS2 (3’m5’)

O. ovata

F’-CAATGCTCATGTCAATGATG

R’-CCAGGAGTATGCCTACATTCAA

210 ITS1 (5’o3’)

5.8S (3’m5’)

O. cf. siamensis F’-TGTTACCATTGCTGAGTTTG

R’-CCAGGAGTATGCCTACATTCAA

223 ITS1 (5’o3’)

5.8S (3’m5’)

Degenerate code D = A/G/T; M = A/C; Y = C/T; R = A/G

*modified from Penna et al. (2007)

5. PCR Detection Assay

Generally, once an assay is developed, it should be assessed using as many

related microorganisms as possible to test the specificity. Potential cross

269

A. PENNA AND L. GALLUZZI

when the assay is applied to natural populations in the seawaters. The other

important requisite is the range of sensitivity of a molecular assay; it is

relevant to assess the limit of detection for the assay especially when the

molecular method is compared with the traditional ones for the detection of

HAB phytoplankton species. In fact, the PCR based technique gave higher

positive detection of target species than microscopy methods; target phyto-

plankton cells can be detected in environmental samples containing mixed

phytoplankton population even at low cell concentration or below the detec-

tion limit of the microscopy and when the target taxon is not a dominant

component of the phytoplankton community (Galluzzi et al., 2004; Penna

et al., 2007).

As previously mentioned, the specificity of the primers is first evaluated in

silico using the BLAST tool. Then, the specificity can be assessed in vitro

by the PCR amplification of genomic DNAs purified from non target micro-

algal clonal strains together with target species of clonal cultures (Penna

et al., 2007). Afterwards, the primers specificity has to be tested in natural

seawater samples. The validation of taxon specific primers consists in the

absence of non-target genomic DNA fragment amplifications in all these

assays (Fig. 4).

Figure 4. Genus and species specific PCR based amplification assay. Genomic DNAs (1 ng)

of target HAB phytoplankton in the presence of non target background DNAs were ampli-

fied with specific primers for Lingulodinium polyedrum (1A), Protoceratium reticulatum

(2A), Fibrocapsa japonica (3A), O. ovata (4A), O. cf. siamensis (5A), Coolia monotis (6A).

L, size standards; lane A, genus or species specific PCR product; lane B, positive control

(103 copies of plasmid containing cloned amplified fragments of genus or species ITS-5.8S

rDNA); lane C, negative control containing mixed background DNAs of different clonal

culture samples (modified from Penna et al., 2007).

reactivity with other organisms in the sample should be also investigated

270

5.1. SPECIFICITY OF THE PCR BASED ASSAY

PCR TECHNIQUES AS DIAGNOSTIC TOOLS

The sensitivity of the PCR assay can be tested spiking serial dilutions of

genomic DNA of target phytoplankton taxa, as 100, 10 and 1 pg of genomic

DNA, in the presence of background net seawater DNA and unrelated DNA

in the mixture. Further, the PCR sensitivity can be assessed using serial

dilutions of a plasmid containing the target sequence of the taxa to be exa-

mined, as 10

, 10

and 10 copies of plasmid DNA.

The PCR assay is usually sensitive enough to detect 10 copies of plas-

midic DNA and 1 pg of genomic DNA. The presence of background DNA

doesn’t affect the sensitivity of the PCR assay. A PCR sensitivity test using

genus and species-specific primers is illustrated in Fig. 5.

diluted from 104 to 10 copies per reaction tube. Genomic DNA of O. ovata CNR-D1 (A) and

A. tamarense CNR-ATA1 (B) are serially diluted from 100 pg to 1 pg with 25 ng of

background DNA of a net concentrated seawater sample and with 500 ng of background

DNA of human placenta. (e), genomic DNA of net seawater. (h), genomic DNA of human

placenta. (-) negative control with sterile water (modified from Penna et al., 2007).

Figure 5. Sensitivity of the PCR based amplification assay to target HAB genera and

species. Sensitivity of the PCR was tested both with plasmidic DNA containing the ITS-5.8S

rDNA and genomic DNA of the target genus and species. Plasmidic DNAs were serially

271

5.2. SENSITIVITY OF THE PCR BASED ASSAY

A. PENNA AND L. GALLUZZI

PCR amplifications were carried out on many lugol fixed natural seawater

samples collected along the coastal areas of the Mediterranean Sea, includ-

ing Italy, Spain and Greece, to detect the presence of the four potentially

HAB genera and ten species, as listed in Table 2. The bucked or net sea-

water samples contained mixed phytoplankton populations with target, pot-

entially HAB taxa ranging from amounts of 5.0 · 10

–1.0 · 10

of total

concentrated cells to bloom densities, such as 1.0 · 10

–1.0 · 10

of total

concentrated cells to be processed in the PCR assay. In other seawater sam-

ples, potentially HAB target cells were below the detection limit of light

microscopy (<10 cells L

–1

). Genomic DNAs purified from seawater samples

were promptly amplified by PCR using the genus and species – specific

primers. The PCR amplified fragments of expected size for each genus and

species were detectable in all samples examined containing the target taxa,

confirming the amplificability of the genomic DNA and the applicability of

the PCR based assay to environmental samples.

Furthermore, the PCR detection analyses were compared with micro-

scopy counts. The PCR analysis of potentially harmful phytoplankton taxa

gave positive results even when target cells were not observed in the field

samples using microscopic determinations. Further, the PCR based assay

allowed the identification of HAB species in seawater samples when un-

certain species-specific identification of cells was obtained by light micro-

scopy and calcofluor epifluorescence examinations.

PCR analyses were also applied to environmental samples containing benthic

and epiphytic assemblages of microalgae communities to detect the presence

of the two potentially toxic Ostreopsis species, O. ovata and O. cf. siamensis,

and C. monotis in different coastal areas of N Tyrrhenian, Ionian and

Catalan Seas. PCR analyses detected the presence of the genus Ostreopsis

in all examined samples, while O. cf. siamensis was present in in Tossa de

Mar (Catalan Sea, Spain) and Siracusa (Ionian Sea, Italy), and O. ovata was

detected in Genova (N Tyrrhenian Sea, Italy). These PCR detections were

in agreement with microscopy identification of the genus Ostreopsis, while

the identification at the species level was determined only by PCR analysis.

C. monotis was detected in Porto Torres (Italy) and Genova (Italy) field

samples in agreement with microscopy detections.

272

5.3. DETECTION OF POTENTIALLY HARMFUL PHYTOPLANKTON

GENERA AND SPECIES IN NATURAL SEAWATER SAMPLES

IN THE MEDITERRANEAN SEA

5.4. DETECTION OF POTENTIALLY HARMFUL MICRO-PHYTOBENTHOS

IN BENTHIC ASSEMBLAGES IN THE MEDITERRANEAN SEA

PCR TECHNIQUES AS DIAGNOSTIC TOOLS

Molecular determinations by PCR based assay are always carried out to-

gether with microscopy analyses of the phytoplankton and microphyto-

benthos target taxa present in the natural samples. Harmful target genera

and species are indentified and counted under an inverted light microscope

at a magnification of x 200–400. Then, PCR detections of the target species

are compared with the microscopy analyses of the same natural samples.

Based on numerous environmental samples analyzed by PCR assay and

optical microscopy for different harmful taxa, the PCR based technique pro-

vide higher positive detection of target species than microscopic methods;

target cells can be detected in environmental samples containing mixed phy-

toplankton populations even at low cell concentration or below the detection

limit of the microscopy and when the target species is not a dominant com-

ponent of the natural plankton or phytobenthos community. These higher

frequencies of positive detection events are registered for all harmful taxa

examined until now (Fig. 6). The higher percentage of the qualitative detec-

tion of harmful taxa by PCR technique when compared to light microscopy

Figure 6 . Comparison of positive samples by PCR and microscopy methods for some HAB

taxa detection. Net seawater samples were collected along coastal sites of the Mediterranean

Sea during the period of 2002–2005.

273

5.5. COMPARISON OF THE PCR ANALYSES AND MICROSCOPIC

DETERMINATIONS

A. PENNA AND L. GALLUZZI

could depend on the different sample volume processed in both methods;

in the microscopic method only 5–10 ml of net sample was settled in the

counting chamber to avoid the overlapping of the target phytoplankton

cells; this limits the microscopic method to the processed volume of sample,

potentially loosing the effective target cell number to be counted when the

target harmful species are a minor component of the phytoplankton com-

munity. In the genomic DNA extraction, the entire net sample can be pro-

cessed, but only a small fraction is used as DNA template in the PCR

reaction. This can be balanced by the fact that the target sequence is usually

rDNA, which is expressed in multiple copies in the genome (Galluzzi et al.,

2004).

In the case of the microphytobenthos toxic species of Ostreopsis spp.,

the species-specific identification of O. ovata and O. cf. siamensis can be

confirmed only by the PCR analysis, due to the extreme variability of the

morphological and morphometric features within this genus (Penna et al.,

2005b).

6. Quantitative Real-time PCR

6.1. BASIC PRINCIPLE OF THE REAL-TIME PCR ASSAY

Quantitative real-time PCR is a very sensitive method, which has been used

in the last years to detect and quantify various phytoplankton species in

environmental samples (Bowers et al., 2000; Popels et al., 2003; Galluzzi

et al., 2004; Coyne et al., 2005). In the real-time PCR assay, a target gene is

amplified with specific primers and product formation is monitored after

each cycle (in real-time) by measuring a fluorescence signal. If the effici-

ency of the reaction remains constant, the increase in fluorescence observed

during the reaction will be proportional to the starting quantity of the target

molecule. The fluorescence can be generated by using an intercalating fluo-

rescent dye (e.g. SYBR Green) or a number of alternative probe systems

(e.g. TaqMan®, molecular beacons, etc.). The use of intercalating dyes is

the cheaper and simplest approach and consists in adding the fluorescent

dye directly to the PCR mixture. These dyes bind to double stranded DNA

and, following a conformational change, emit fluorescence (Fig. 7A). SYBR

Green-based assays are very sensitive, but it is noteworthy that any double

stranded DNA can be detected using this dye, including primer dimers or

non-specific amplified sequence, leading to false positive results. For this

reason, the primer’s specificity is crucial. Moreover, multiplexing is usually

not feasible.

274

The TaqMan® approach is based on the use of oligonucleotide probes

PCR amplification. The TaqMan® probe possess a fluorescent reporter dye

mity of these two dyes, the fluorescence of one (the reporter) is quenched by

loop structure by the annealing of complementary sequences at its 5’ and 3’

ends. The sequence in the loop is the sequence complementary to the target

region. Similar to the TaqMan® probe, a fluorophore and a quencher are

covalently linked at each end of the molecule. In the “closed” conformation,

fluorophore and quencher are into proximity and the fluorescent signal is

absent. When the probe loop anneals to its target sequence forming a probe-

target hybrid (with greater stability than the stem structure) the fluorophore

and the quencher are separated from each other and a fluorescent signal can

be observed (Fig. 7C). This signal is proportional to the amount of DNA

amplified.

The fluorescence signal, generated either by intercalating dyes or fluo-

rescent probes, is measured by the real-time PCR instrument at the end of

every cycle. The instrument also normalizes the fluorescence signal of the

Figure 7. Chemistries used in real-time PCR assays. A) SYBR Green molecules; B)

Taqman£ probe; C) Molecular beacons (see text for details). (from Galluzzi et al., 2007).

complementary to a sequence located between the two primers used for

Molecular beacons are oligonucleotide probes that can adopt a stem-

PCR TECHNIQUES AS DIAGNOSTIC TOOLS

sion step of the PCR, the DNA polymerase (which possesses a 5’–3’ exonu-

degradation results in the separation of reporter from quencher and an increase

and a quencher dye conjugated at the 5’ and 3’ ends. Due to the close proxi-

in fluorescence emission can be observed (Fig. 7B). This approach is less sub-

ject to false positives than the intercalating dye method, but it is more expen-

the other through fluorescence resonance energy transfer. During the exten-

sive. Furthermore, it is possible to carry out multiplex PCR by choosing

cleolytic activity) encounters the bound TaqMan® probe and degrades it. This

appropriate fluorophores.

275

A. PENNA AND L. GALLUZZI

reporter dye by the fluorescence signal of the passive reference dye (ROX)

to obtain a ratio defined as the normalized reporter signal (Rn). The fact that

DNA amplification is measured in real-time inside the reaction tube makes

the method a “closed-system” and limits problems associated with carry-

over contaminations (Raoult et al., 2004).

The C

value (threshold cycle) is defined as the number of cycles

required for the fluorescence to cross a fixed threshold above the baseline.

Due to the fact that the increase in fluorescence and the starting amount of

the target molecule are strictly related, the amount of target sequence in an

unknown sample can be calculated by plotting its C

value on a standard

curve generated using the target sequence cloned into a plasmid, or using

the DNA extracted from a known number of cultured cells. When a plasmid

is used as a standard, it is essential to know the amount of target gene per

cell in order to allow the determination of the cell number in the field

sample. This implies certain work on laboratory cultures to optimize the

method for each target species or strain. An example of standard curve

generated with plasmid containing the target sequence is shown in Fig. 8.

Figure 8. A) Example of amplification plots for a standard curve generated with different

amounts of plasmid molecules (from 106 to 10 copies) containing the target sequence. The

cycle number is plotted vs the Delta Rn, which represents the normalized reporter signal

(Rn) minus the baseline signal established in the early PCR cycles. B) Calibration curve

plotting log starting copy number vs Ct. NTC, no template control; T, threshold (from

Galluzzi et al., 2004).

276

PCR TECHNIQUES AS DIAGNOSTIC TOOLS

6.2. APPLICATIONS OF THE REAL-TIME PCR BASED ASSAY

Real-time PCR based assays have been developed for the monitoring of a

number of toxic phytoplankton species. Also, several real-time PCR proto-

cols have been optimized for the quantitative approach using different standard

curves (generated using plasmid dilutions or axenic cultures), different DNA

template preparation (purified DNA or cell lysates), different real-time PCR

chemistries (intercalating dyes or fluorescent probes), and different target

DNA sequences.

Recently, a real-time PCR assay based on the use of a TaqMan probe

has been developed for the specific detection and quantification of Crypto-

peridiniopsis brodyi (a Pfiesteria-like dinoflagellate) in environmental sam-

ples (Park et al., 2007). The assay has been developed against the ITS2

ribosomal DNA region. The choice of this variable rDNA region ensured

the species-specificity of the assay. This assay was used in conjunction with

the real-time PCR assays specific for Pfiesteria piscicida (Bowers et al.,

2000) and Pfiesteria shumwayae (Zhang et al., 2005) to investigate the

temporal variations of C. brodyi, P. piscicida, and P. shumwayae abundance

in a coastal region of Tasmania.

Several species of Alexandrium have been detected and quantified using

real-time PCR using either SYBR green or TaqMan chemistries. Assays

were developed for A. minutum (Galluzzi et al., 2004), A. fundyense

(Dhyrman et al., 2006), A. catenella (Hosoi-Tanabe and Sako, 2005) and

A. tamarense, both for vegetative cells (Hosoi-Tanabe and Sako, 2005) and

cysts (Kamikawa et al., 2005).

Other toxic species have been the objective of the real-time PCR-based

assay development: these include Aureococcus anophagefferens (Popels et al.,

2003), Karenia brevis (Casper et al., 2004), Cochlodinium polykrikoides,

Karenia mikimotoi, Heterocapsa circularisquama, Chattonella antiqua, C.

marina, C. ovata (Kamikawa et al., 2006), Heterosigma akashiwo (Coyne

et al., 2005; Kamikawa et al., 2006), Chattonella subsalsa (Coyne et al.,

2005) and Prymnesium parvum (Galluzzi et al., in press).

Real-time PCR multiplexing and multiprobing have also been investi-

gated. Handy et al. (2006) designed and evaluated a TaqMan®-based real-

time PCR assay for single tube detection of three raphidophyte species

(Chattonella cf. verruculosa, C. subsalsa and Heterosigma akashiwo). Envi-

ronmental samples containing these raphidophytes have shown to be success-

fully multiplexed or multiprobed with only minimal losses in sensitivity.

In principle, the real-time PCR technique can be applied to any

phytoplankton species having DNA sequence data available and informa-

tive at the species or strain level, so that primers and/or probes can be

277

A. PENNA AND L. GALLUZZI

designed. However, due to the possibility of variations of target gene

(mostly rRNA genes) copy number among different strains, and in order to

verify the primers specificity, the method needs to be tested and optimized

with the local phytoplankton population in a geographical area to be invest-

tigated.

The main advantages of the real-time PCR application in phytoplankton

monitoring concern specificity, sensitivity and applicability to preserved envi-

ronmental samples. Sample preservation is often necessary, but the use of

fixatives may cause the morphology distortion of some phytoplankton spe-

cies, making more difficult to distinguish them from closely related species

using a microscope. The development of a quantitative real-time PCR-

based assay may help to overcome this kind of problems. Moreover, the

general high sample throughput of this method may reduce working time

compared to the microscope-based methods.

Concerning the costs, the real-time PCR instruments are becoming to be

affordable also for small research groups and are now quite common in mole-

cular biology-equipped laboratories. Moreover, the consumable cost per

sample has been estimated in about $4.0 to $6.0 (Handy et al., 2006; Galluzzi

et al., in press) depending on the method/master mix/chemistry, which makes

Generally, only one species or strain at the time can be analyzed in a

quantitative approach, unless a multiplex reaction is performed. However,

although multiplexing and/or multiprobing are powerful tools for molecular

investigations of specific groups of toxic algae, their development and

validation can be difficult and expensive (Handy et al., 2006).

7. Conclusion

Based on different studies, the specificity, sensitivity and feasibility of the

PCR detection of several potential harmful phytoplankton taxa in environ-

mental samples have been demonstrated (Guillou et al., 2002; Godhe et al.,

2002; Connell, 2002; Galluzzi et al., 2005). In most of these studies the

molecular markers are the ribosomal genes as target regions for the primer

design. Further, the PCR method revealed higher detection efficiency than

microscopic analysis, giving the higher positive percentage values of noxious

target species presence in seawater samples and benthic assemblages.

PCR based technique coupled with quantitative real-time PCRs could

represent well set up methods for the detection of the phytoplankton

cells at the pre-bloom levels necessary to predict species-specific potential

bloom sites, to determine potential environmental factors that influence a

bloom, and to evaluate potential sources of species-specific low-level cell

the real-time PCR a potential affordable method for monitoring applications.

278

PCR TECHNIQUES AS DIAGNOSTIC TOOLS

inoculations through natural or anthropogenic transport mechanisms in

coastal seawaters.

Quantitative real-time PCR method is still at the developmental stage

and its application for monitoring of harmful algae requires validation in

the area to be investigated due to the possible variability in terms of target

gene copy number in different phytoplankton populations within the same

species.

References

Adachi, M., Sako, Y., and Ishida, Y., 1996, Analysis of Alexandrium (Dinophyceae) species

using sequences of the 5.8S ribosomal DNA and internal transcribed spacer regions.

J. Phycol. 32: 424–432.

Anderson, D. M., 1995, Identification of harmful algal species using molecular probes: an

emerging perspective, in: Harmful marine algal blooms. Lassus, P., Arzul, G., Erard, E.,

Gentien, P., Marcaillou, C., eds., Lavoisier Sci. Publ., Paris, pp. 3–13.

Avise, J. C., 1998, Conservation genetics in the marine realm. J. Hered. 89: 377–382.

Bolch, C. J. S., Blackburn, S. I., Hallegraeff, G. M., and Vaillancourt, R. E., 1999, Genetic

variation among strains of the toxic dinoflagellate Gymnodinium catenatum (Dino-

phyceae). J. Phycol. 35: 356–367.

Bolch, C. J. S., 2001, PCR protocols for genetic identification of dinoflagellates directly

from single cyst and plankton cells. Phycologia 40: 162–167.

Bowers, H. A., Tengs, T., Glasgow, H. B., Burkhoelder, J. M. j., Rublee, P. A., and Oldach,

D. W., 2000, Development of real-time PCR assay for rapid detection of Pfiesteria

piscicida and related dinoflagellates. Appl. Environ. Microbiol. 66: 4641–4648.

Casper, E. T., Paul, J. H., Smith, M. C., and Gray, M., 2004, Detection and Quantification of

the Red Tide Dinoflagellate Karenia brevis by Real-Time Nucleic Acid Sequence-Based

Amplification. Appl. Environ. Microbiol. 70: 4727–4732.

Connell, L., 2002, Rapid identification of marine algae (Raphidophyceae) using three-primer

PCR amplification of nuclear internal transcribed spacer (ITS) regions from fresh and

archived material. Phycologia 41: 15–21.

Coyne, K. J., Handy, S. M., Demir, E., Whereat, E. B., Hutchins, D. A., Portune, K. J., Doblin,

M. A., and Cary, S. C., 2005, Improved quantitative real-time PCR assays for enumeration

of harmful algal species in field samples using an exogenous DNA reference standard.

Limnol. Oceanogr. Methods 3: 381–391.

Dyhrman, S. T., Erdner, D., La Du, J., Galac, M., and Anderson, D. M., 2006, Molecular

quantification of toxic Alexandrium fundyense in the Gulf of Maine using real-time PCR.

Harmful Algae 5: 242–250.

Edvardsen, B., Shalchian-Tabrizi, K., Jakobsen, K. S., Medlin, L. K., Dahl, E., Brubak, S.,

and Paasche, E., 2003, Genetic variability and molecular phylogeny of Dinophysis

species (Dinophyceae) from Norwegian waters inferred from single cell analysis of

rDNA. J. Phycol. 39: 395–408.

Evans, K. M., Bates, S. S., Medlin, L. K., and Hayes, P. K., 2004, Microsatellite marker

development and genetic variation in the toxic marine diatom Pseudo-nitzschia multi-

series (Bacillariophyceae). J. Phycol. 40: 911–920.

279

A. PENNA AND L. GALLUZZI

Feral, J. P., 2002, How useful are the genetic markers in attempts to understand and manage

marine biodiversity? J. Exp. Mar. Biol. Ecol. 268: 121–145.

Galluzzi, L., Penna, A., Bertozzini, E., Vila, M., Garcés, E., and Magnani, M., 2004,

Development of Real-Time PCR assay for rapid detection and quantification of A.

minutum species (Dinoflagellate). Appl. Environ. Microbiol. 70: 1199–1206.

Galluzzi, L., Penna, A., Bertozzini, E., Vila, M., Garcés, E., Giacobbe, M.G., Prioli, S., and

Magnani, M., 2005, Development of a qualitative PCR method for the Alexandrium

(Dinophyceae) detection in contaminated mussels (Mytilus galloprovincialis). Harmful

Algae 4: 973–983.

Galluzzi, L., Magnani, M., Saunders, N., Harms, C., and Bruce, I. J., 2007, Current mole-

cular techniques for the detection of microbial pathogens. Science Progress 90: 29–50.

Detection and quantification of Prymnesium parvum (Haptophyceae) by real-time PCR.

Lett. Appl. Microbiol. (in press)

Godhe, A., Anderson, D. M., and Rehnstam-Holm, A. S., 2002, PCR amplification of micro-

algal DNA for sequencing and species identification: studies on fixatives and algal

growth stages. Harmful Algae 1: 375–382.

Gosling, E. M., 1994, Speciation and species concepts in the marine environment, in: Gene-

London, pp. 1–15.

Granéli, E., and Turner, J. T., 2007, An Introduction to Harmful Algae, in: Ecology of

Harmful Algae. E. Granéli, J. T. Turner, eds., Springer, Berlin, pp. 3–7.

Guillou, L., Nézan, E., Cueff, V., Erard-Le Denn, E., Cambon-Bonavita, M. A., Gentien, P.,

and Barbier, G., 2002, Genetic diversity and molecular detection of three toxic dino-

flagellate genera (Alexandrium, Dinophysis and Karenia) from French coasts. Protist

153: 223–238.

Handy, S. M., Hutchins, D. A., Cary, S. C., and Coyne, K. J., 2006, Simultaneous enume-

ration of multiple raphidophyte species by quantitative real-time PCR: capabilities and

Hershkovitz, M. A., and Lewis, L. A., 1996, Deep-level diagnostic value of the rDNA-ITS

coding region. Mol. Biol. Evol. 13: 1276–1295.

Hosoi-Tanabe S., and Sako, Y., 2005, Species-specific detection and quantification of toxic

marine dinoflagellates Alexandrium tamarense and A. catenella by Real-Time PCR

assay. Mar. Biotechnol. 7: 506–514.

John, U., Fensome, R. A., and Medlin, L. K., 2003, The application of a molecular clock

based on molecular sequences and the fossil record to explain biogeographic distribu-

tions within the

Alexandrium tamarense ‘species complex’ (Dinophyceae). J. Mol. Evol.

20: 1015–1027.

John, U., Groben, R., Beszten, B., and Medlin, L., 2004, Utility of amplified fragment length

polynrorphisms (AFLP) to analyse genetic structures within the Alexandrium tamarense

species complex. Protist 155: 169–179.

John, U., Medlin, L. K., and Groben, R., 2005, Development of specific rRNA probes to

distinguish between geographic clades of the Alexandrium tamarense species complex.

J. Plank. Res. 27: 199–204

Kamikawa, R., Hosoi-Tanabe, S., Nagai, S., Itakura S., and Sako, Y., 2005, Development of

a quantification assay for the cysts of the toxic dinoflagellate Alexandrium tamarense

using real-time polymerase chain reaction.

Fish. Sci. 71: 987–991.

limitations. Limnol. Oceanogr. Methods 4: 193–204.

Genetics and evolution of aquatic organisms. A. R. Beaumont, ed., Chapman and Hall,

Galluzzi L., Bertozzini E., Penna A., Perini F., Pigalarga A., Graneli, E., and Magnani, M.,

280

PCR TECHNIQUES AS DIAGNOSTIC TOOLS

Lange, M., Chen, Y. Q., and Medlin, L. K., 2002, Molecular genetic delineation of

Phaeocystis species (Prymnesiophyceae) using coding and non-coding regions of nuclear

and plastid genomes. Eur. J. Phycol. 37: 77–92.

Litaker, R. W., and Tester, P. A., 2002, Molecular methods for detecting and characterizing

harmful phytoplankton, in: Environmental Microbiology. C. J. Hurst, R. L. Crawford,

G. R. Knudsen, M. McInerney, L. D. Stetzenbach, eds., 2nd edition, ASM Press, New

York, USA, pp. 342–353.

Medlin, L. K., Metfies, K., Mehl, H., Wiltshire, K., and Valentin, K., 2006, Picoeukaryotic

methods. Microb. Ecol. 52: 53–71.

Metfies, K., and Medlin, L. K., 2004, DNA microchips for phytoplankton: the fluorescent

wave of the future. Nova Hedwigia 79: 321–327.

Metfies, K., Huljic, S., Lange, M., and Medlin, L. K., 2005, Electrochemical detection of the

toxic dinoflagellate Alexandrium ostenfeldii with a DNA-biosensor. Biosens. Bioelec-

tron. 20: 1349–1357.

Miller, P. E., and Scholin, C. A., 2000, On detection of Pseudo-nitzschia (Bacillariophyceae)

species using whole cell hybridization: sample fixation and stability. J. Phycol. 36:238–250.

Monis, P. T., Giglio, S., Keegan, A. R., and Andrew Thompson, R. C., 2005, Emerging

technologies for the detection and genetic characterization of protozoan parasites. Trends

Parasitol. 21: 340–346.

Not, F., Latasa, M., Marie, D., Cariou, T., Vaulot, D., and Simon, N., 2004, A single species,

Micromonas pusilla (Prasinophyceae), dominates the eukaryotic picoplankton in the

Western English Channel. Appl. Environ. Microb. 70: 4064–4072.

Orsini, L., Sarno, D., Procaccini, G., Poletti, R., Dahlmann, J., and Montresor, M., 2002,

Toxic Pseudo-nitzschia multistriata (Bacillariophyceae) from the Gulf of Naples: morpho-

logy, toxin analysis and phylogenetic relationships with other Pseudo-nitzschia species.

Eur. J. Phycol. 37: 247–257.

Orsini, L., Procaccini, G., Sarno, D., and Montresor, M., 2004, Multiple rDNA ITS-types

within the diatom Pseudo-nitzschia delicatissima (Bacillariophyceae) and their relative

abundances across a spring bloom in the Gulf of Naples. Mar. Ecol. Progr. Ser. 271:

87–98.

Palumbi, S. R., 1992, Marine speciation on a small placet. Tree 7: 114–118.

Palumbi, S. R., 1994, Genetic divergence, reproductive isolation, and marine speciation.

Ann. Rev. Ecol. Syst. 25: 547–572.

Park T. G., de Salas, M. F., Bolch, C. J., and Hallegraeff, G. M., 2007, Development of a

real-time PCR probe for quantification of the heterotrophic dinoflagellate Crypto-

peridiniopsis brodyi (Dinophyceae) in environmental samples. Appl. Environ. Microbiol.

73: 2552–2560.

Kamikawa, R., Asai, J., Miyahara, T., Murata, K., Oyama, K., Yoshimatsu, S., Yoshida T.,

and Sako, Y., 2006, Application of a Real-time PCR Assay to a Comprehensive Method

of Monitoring Harmful Algae. Microb. Environ. 21: 163–173.

Progr. Ser. 221: 47–57.

A., Thyrhaug, R., van Hannen, E. J., and Bratbak, G., 2001, Population dynamics and

and intraspecific variation of the Pseudo-nitzschia delicatissima complex (Bacillario-

diversity of phytoplankton, bacteria and viruses in a seawater enclosure. Mar. Ecol.

Larsen, A., Castberg, T., Sandaa, R. A., Brussaard, C. P. D., Egge, J. K., Heldal, M., Paulino,

J. Phycol. 42: 464–481.

plankton diversity at the Helgoland time series site as assessed by three molecular

phyceae) illustrated by rRNA probes, morphological data and phylogenetic analyses.

Lundholm, N. M. Ø., Kotaki, Y., Hoef-Emden, K., Scholin, C., and Miller, P., 2006, Inter-

281

A. PENNA AND L. GALLUZZI

Parsons, M. L., Scholin, C. A., Miller, P. E., Doucette, G. J., Powell,C. L., Fryxell, G. A.,

Dortch, Q., and Soniat, T. M., 1999, Pseudo-nitzschia species (Bacillariophyceae) in

Louisiana coastal waters: molecular probe field trials, genetic variability and domoic

acid analyses. J. Phycol. 35: 1368–1378.

Penna, A., and Magnani, M., 2000, A PCR immunoassay method for the detection of

Alexandrium (Dinophyceae) species. J. Phycol. 36: 1183–1186.

Penna, A., Garcés, E., Vila, M., Giacobbe, M. G., Fraga, S., Luglié, A., Bravo, I., Bertozzini,

E., and Vernesi, C., 2005a, Alexandrium catenella (Dinophyceae), a toxic ribotype

expanding in the NW Mediterranean Sea. Mar. Biol. 148: 13–23.

Penna, A., Vila, M., Fraga, S., Giacobbe, M. G., Andreoni, F., Riobó, P., and Vernesi, C.,

2005b, Characterization of Ostreopsis and Coolia (Dinophyceae) isolates in the Western

Mediterranean Sea based on morphology, toxicity and internal transcribed spacer 5.8S

rDNA sequences. J. Phycol. 41: 212–225.

Penna, A., Bertozzini, E., Batocchi, C., Giacobbe, M. G., Galluzzi, L., Garcés, E., Vila, M.,

Lugliè, A., and Magnani, M., 2007, Monitoring of HAB species in the Mediterranean

Sea through molecular techniques. J. Plank. Res. 29: 19–38.

Popels, L. C., Cary, S. C., Hutchins, D. A., Forbes, R., Pustizzi, F., Gobler, C. J., and Coyne,

enumeration of the harmful alga Aureococcus anophagefferens in environmental samples

along the United States East Coast. Limnol. Oceanogr. Methods 1: 92–102.

Raoult, D., Fournier, P. E., and Drancourt, M., 2004, What does the future hold for clinical

microbiology? Nat. Rev. Microbiol. 2: 151–159.

terization of the rRNA locus of Pfiesteria piscicida and development of standard and

quantitative PCR based detection assays targeted to the nontranscribed spacer. Appl.

Environ. Microb. 68: 5394–5407.

rRNA-targeted probes for simple and rapid identification of the toxic dinoflagellates

Alexandrium tamarense and Alexandrium catenella. J. Phycol. 40: 598–605.

Scholin, C. A., Herzog, M., Sogin, M., and Anderson, D. M., 1994, Identification of group-

and strain-specific genetic markers from globally distributed Alexandrium (Dino-

phyceae). II. Sequence analysis of fragments of the LSU rRNA gene. J. Phycol.

30:

999–1011.

Scholin, C. A., Buck, K. R., Britschgi, T., Cangelosi, G., and Chavez, F. P., 1996, Identi-

fication of Pseudo-nitzschia australis (Bacillariophyceae) using rRNA-targeted probes in

whole cells and sandwich hybridization formats. Phycologia 35: 190–197.

Scholin, C. A., Marin, R., Doucette, G. J., Powell, C. L., Haydock, P., Howard, J., and Ray, J.,

1999, DNA probes and a receptor-binding assay for detection of Pseudo-nitzschia

(Bacillariophyceae) species and domoic acid activity in cultured and natural samples.

J. Phycol. 35: 1356–1367.

Simon, N., Campbell, L., Ornolfsdottir, E., Groben, R., Guillou, L., Lange, M., and Medlin,

L. K., 2000, Oligonucleotide probes for the identification of three algal groups by dot

blot and fluorescent whole-cell hybridisation. J. Euk. Microbiol. 47: 76–84.

Tyrrell, J. V., Bergquist, P. R., Bergquist, P. L., and Scholin, C. A., 2001, Detection and enu-

meration of

Heterosigma akashiwo and Fibrocapsa japonica (Raphydophyceae) using

rRNA-targeted oligonucleotide probes. Phycologia 40: 457–467.

XI International Conference Harmful Algal Blooms, 14–19 November 2004, Cape Town.

Sako, Y., Hosoi-Tanabe, S., and Uchida, A., 2004, Fluorescence in situ hybridization using

Round Table Detection and Monitoring of HABs, by Penna, A., Silke, J., and Diogene, J.,

Saito, K., Drgon. T., Robledo, J. A. F., Krupatkina, D. N., and Vasta, G. R., 2002, Charac-

K. J., 2003, The use of quantitative polymerase chain reaction for the detection and

282

PCR TECHNIQUES AS DIAGNOSTIC TOOLS

Van Hannen, E. J., van Agterveld, M. P., Gons, H. J., and Laanbroek, H. J., 1998, Revealing

genetic diversity of eukaryotic microorganisms in aquatic environments by denaturing

gradient gel electrophoresis. J. Phycol. 34: 206–213.

Vila, M., Giacobbe, M. G., Masó, M., Gangemi, E., Penna, A., Sampedro, N., Azzaro, F.,

Camp, J., and Galluzzi, L., 2005, A comparative study on recurrent blooms of Alexan-

drium minutum in two Mediterranean coastal areas. Harmful Algae 4: 673–695.

Zhang, H., and Lin, S., 2005, Development of a cob-18S rRNA gene real-time PCR assay for

quantifying Pfiesteria shumwayae in the natural environment. Appl. Environ. Microbiol.

71: 7053–7063.

Readings on PCR Techniques:

Altshuler, M., 2006, PCR troubleshooting: the essential guide. Caister Academic Press,

Norfolk, U.K.

Dieffenbach, C. W., and Dveksler, G. S., 2006, PCR Primer: a laboratory manual. 2nd ed.,

Cold Spring Harbor Laboratory Press, New Jork, USA.

Edwards, K., Logan, J., and Saunders, N., 2004, Real-Time PCR An essential guide. Horizon

Bioscience, Norfolk, U.K.

Mullis, K. B., 1990, The unusual origins of the polymerase chain reaction. Sci. Am. 262: 56–65.

Tevfik Dorak, M., 2006, Real Time PCR, Taylor and Francis, Cornwall, U.K.

White, T. J., 1996, The future of PCR technology: diversification of technologies and

applications. Trends Biotechnol. 14: 478–483.

McPherson, M. J., and Møller, S. G., 2006, PCR, 2nd ed., Taylor and Francis, Cornwall, UK.

283

DETECTION OF PHYTOPLANKTON WITH NUCLEIC ACID

SENSORS

SONJA DIERCKS

*, KATJA METFIES

, FRIEDHELM

SCHRÖDER

, LINDA K. MEDLIN

AND FRANCISCUS

COLIJN

GKSS Research Centre Geesthacht GmbH,

Max`Planck-Street 1, 21502 Geesthacht, Germany

Alfred Wegener Institute for Polar and Marine Research,

Am Handelshafen 12, 27570 Bremerhaven, Germany

toxic algae was developed during the EU-project ALGADEC. Identification

of toxic algae is based on molecular probes that specifically target its rRNA.

17 taxon specific probe sets were developed for harmful algae that occur in

three different coastal areas in Europe. A sandwich-hybridization and two

labelled probes are used to detect the rRNA. A capture probe, immobilised

on the biosensor, binds to RNA-strands isolated from the target organism.

A second digoxigen-labelled probe binds also to the RNA-strands. After

incubation with an antibody-enzyme complex directed against digoxigenin,

a substrate is added and a redox-reaction takes place. The resulting elec-

trical current is measured and the amount of bound rRNA is proportional to

the electrical current. The adaptation to the sensor and the probe specificity

tests were done using laboratory strains with closely related species to avoid

false positives and to guarantee that only desired strains are detected. The

signals from the different probes are recorded by a microcontroller unit. If a

PC is connected to the system, an easy to operate software visualizes pro-

cess data, graphic results, and the measured values will be stored on the

hard disc. The main steps of the analysis process are executed automatically

in the measurement device. Only a manual filtering, including a lysis pro-

cedure has to be done before the automatic measurement. The portable

ALGADEC device is also capable to operate as a stand-alone system with

______

*To whom correspondence should be addressed. Sonja Diercks, GKSS Research Centre GmbH,

Max-Planck Street , 21502 Geesthacht, Germany. Email: sonja.diercks@awi.de

V. Evangelista et al. (eds.), Algal Toxins: Nature, Occurrence, Effect and Detection. 285

Abstract: A potential hand-held biosensor system for the in-situ analysis of

S. DIERCKS ET AL.

build in keypad, display, power supply and memory card. In a new project,

the ALGADEC device shall be further automated, optimized and imple-

mented into a FerryBox system.

1. Introduction

Microalgae are the major producers of biomass and organic compounds in

the oceans because of their photosynthetic activity and they represent the

base of the aquatic food chain. About 5000 species of marine microalgae

are known to date (Sournia et al., 1991) and some 300 species can pro-

liferate in such high numbers that they discolour the surface of the sea

(Daranas et al., 2001; Hallegraeff, 2003) as a so-called bloom (Figure 1).

Figure 1. Bloom of Noctiluca scintillans in October 2002, Leigh, New Zealand (photo:

Miriam Godfrey)

A bloom is regarded as a sudden increase in the microalgal population

activated by suitable growth conditions so that concentrations of 10

–10

286

Keywords: Biosensor, microalgae, ALGADEC, sandwich hybridisation, FerryBox

NUCLEIC ACID SENSORS

cells per liter can be reached for a certain period of time (Masó and Garces,

2006). A particular species or a group of species can dominate the bloom

(Masó and Garces, 2006). The proliferation of microalgae is a normal event

and can be beneficial for aquaculture and fisheries operations. However, it

can also have a negative effect if the bloom consists of harmful algae and

thus cause severe economic losses to aquaculture, fisheries and tourism

(Hallegraeff, 2003). About 200 noxious microalgal species and 97 toxic

species (mainly dinoflagellates) are known to have the potential to form

Harmful Algal Blooms (HABs) (Zingone and Enevoldsen, 2000; Moestrup,

2004). The impact of HABs is defined by the concentration of harmful

species, even the most toxic species must occur with a minimum cell con-

centration to exert a harmful effect (Zingone and Enevoldsen, 2000). HABs

have occurred throughout recorded history and are natural phenomena.

However, in the past decades, the public health and economic impacts

appear to have increased in frequency, intensity and geographic distribution

(Daranas et al., 2001; Hallegraeff, 2003). This can possibly be explained by

an increase of scientific awareness and by increased aquaculture. The

increase of fish and shellfish farming has been observed worldwide and

consequently, the reports of harmful algae and human illnesses rise. Addi-

tionally some algal blooms appear to be stimulated by eutrophication acti-

vated by domestic, industrial and agricultural wastes. Also, climatological

conditions can have an effect on the spatial distribution of a species.

1.1. AQUACULTURE AND HARMFUL ALGAL BLOOMS

Shellfish production and mariculture experience a worldwide expansion,

especially in the Asia-Pacific region where seafood products are consu-

med in large amounts. In Europe, Spain, France, Italy, Denmark and the

Netherlands are the main shellfish producers, with a total production of

about one million tonnes in 1997. In 1998, worldwide production of mari-

culture fish was about 0.7 million tonnes (Rensel and Whyte, 2003).

Shellfish, such as bivalve molluscs, gastropods, crabs and lobsters,

accumulate phycotoxins by direct filtration of the algal cells or by feeding

on contaminated organisms. Toxin accumulation rates as well as the rates of

toxin loss by filter-feeding shellfish from toxic algae are toxin- and species-

specific (Fernández et al., 2003). Consequently, the duration of market

closure depends on these rates. For example, in 1984, the Swedish mussel

industry was shutdown for almost a year because of DSP toxins (Hallegraeff,

2003) that resided in the mussels depurated at slow rate (Svensson and Förlin,

2004). High economic losses to aquaculture were caused by fish killing

287

S. DIERCKS ET AL.

microalgae in the last decades. A massive bloom of Chrysochromulina

polylepsis occurred in 1988 in the Skagerrak, the Kattegat, the Belt and the

Sound between Denmark, Norway and Sweden and caused the deaths of

900 tonnes of fish, including cod, salmon and trout (Hallegraeff, 2003).

2. Monitoring of Phytoplankton

Monitoring programmes along the coastlines all around the world include,

in the majority of cases, a surveillance for potentially toxic algal species

(identification and quantification) and the monitoring of toxin content in

shellfish. HAB monitoring programmes, e.g., GEOHAB, aim to prevent

intoxication of humans and animals through the consumption of contamin-

ated seafood as well as the protection of humans from algal toxins delivered

via sea spray or direct contact. The damage of living resources, such as shell-

fish and fish, as well as the economic losses to fisherman, aquaculturists

and the tourist industry should be minimized (Andersen et al., 2003). In

addition, water temperature, salinity, nutrients, chlorophyll, water stratifica-

tion, current circulation and other parameters are also observed for bloom

prediction.

Microscope-based methods can identify and quantify microalgae at the

species or genus level. However, the identification of unicelluar algae re-

quires a broad taxonomic knowledge, because toxic and non-toxic strains

can belong to the same species and thus are morphologically identical (e.g.,

Alexandrium tamarense species complex, (John et al., 2005). Consequently,

an improved monitoring, rapid detection and enumeration of toxic algae is

crucial because monitoring methods based on light microscopy are time-

consuming and costly if many samples need to be processed. In the past

decade, a variety of molecular methods have been adapted for the detection

of harmful algae.

2.1. PROBE DEVELOPMENT

Molecular probes are widely applied for the identification of micro-organisms.

The small and the large subunit ribosomal RNA genes are the usual targets

for probes, because of their high target number in the cell. More or less

conserved regions in these genes make it possible to develop probes that are

specific at different taxonomic levels (Groben et al., 2004). Oligonucleotide

DNA probes have usually a length of 18-25 base pairs and can be designed

using the probe design option in ARB software package (Ludwig et al.,

2004). It is necessary that probe specificity is extensively tested to eliminate

false positives. The probes must be tested so that close phylogenetic

neighbours (clade tests) and probe neighbours (probe tests), who are species

288

NUCLEIC ACID SENSORS

with close target sequence but who are phylogenetically unrelated do not

bind to the probe. Additionally, a BLAST search (Altschul et al., 1990)

should be conducted to test the overall specificity of the probes against all

publically available sequences not included in the ARB database.

Probes for several toxic algae (e.g., Alexandrium minutum and Gym-

nodinium catenatum) have been developed for the detection with sandwich

hybridization formats (Diercks et al., 2008c). Developed probes need a

regular review for their specificity, because new sequences are added to the

available online genetic databases daily. This cross check will help to

determine if there is any cross reactivity with other marine organisms.

2.2. SANDWICH HYBRIDIZATION

The principle of the sandwich hybridization (SHA) was described by Dunn

and Hassel, 1977; Zammatteo et al. (1995) and Rautio et al. (2003) (Dunn and

Hassel, 1977; Zammatteo et al., 1995; Rautio et al., 2003) and represents a

DNA probe-based method for rapid target identification that uses two

oligonucleotide probes targeting ribosomal RNA (rRNA). A capture probe

bound to a solid surface immobilizes the target ribosomal RNA and forms a

hybrid complex with a second signal probe (Figure 2). An antibody-enzyme

complex binds to the signal moiety of the signal probe and reacts with a

substrate forming an electrochemical current (Metfies et al., 2005) in case

of the biosensor.

Figure 2. Principle of sandwich hybridization.

3. Biosensor

Biochemical recognition with signal transduction for the detection of specific

molecules is combined on electrochemical biosensors. The detection com-

ponent (e.g., probe sequence, antibodies, enzymes) catalyzes a reaction with

289

S. DIERCKS ET AL.

or specifically binds to the target of interest. A transducer component

transforms this detection event into a measurable signal such as an electrical

current.

Biosensor types comprise optical, bioluminescent, thermal, mass and

electrochemical recognition (Gau et al., 2005). A specific detection of tar-

gets in a complex sample is possible, as a result of this various sectors, such

as clinical diagnostic, environmental monitoring, biothreat detection and

forensics, apply single electrode sensors as well as arrays (Berganza et al.,

2006; Lermo et al., 2006; Taylor et al., 2006). Arrays of electrodes enable a

simultaneous detection of multiple species with different molecular probes

(Dock et al., 2005; Farabullini et al., 2007). The in-situ use of biosensors

circumvents the need to return samples into the laboratory and thus rapid

identification of aquatic microorganisms is possible. The identification of

microorganisms, as well as physical and chemical measurements of the

environment, are important for the understanding of coastal dynamics and

processes that can impact marine ecosystems, such as the introduction and

spreading of microbial pollutants and the initiation of HABs (Lagier et al.,

2005).

3.1. SINGLE ELECTRODE MEASURING DEVICE

A biosensor in combination with a hand held device was introduced by

Metfies et al. (2005). This first prototype was used in combination with sand-

wich hybridization for the detection and identification of the toxic dino-

flagellate Alexandrium ostenfeldii (Metfies et al., 2005). Metfies et al. (2005)

showed that the signal intensity is proportional to the rRNA concentration

applied to the sensor with a detection limit of ~100 ng/µL RNA for the first

prototype. A second prototype (Figure 3), the PalmSens (Palm Instruments,

Houten, Netherlands), has been extensively used to improve the biosensor

system (Diercks et al., 2008b). The protocols and electrochemical readings of

the measuring device are simple and easy to use, even for laypersons. Single

electrode sensors can be produced very cheaply and coated in advance of use

with capture probes. The long term storage of 12 months enables mass pro-

duction and introduction to the market (Diercks et al., 2008a).

The electrochemical detection method with the hand held device and

biosensors is a rapid method to detect toxic algae in a water sample. How-

ever, the method for the use of the prototypes for single electrode sensors

contains a lot of manual steps, such as the isolation of RNA from the algal

cells.

290

NUCLEIC ACID SENSORS

Figure 3. Handheld PalmSens device from Palm Instruments.

The manual isolation of RNA is currently the limiting factor of the

system, because the concentration and quality of the RNA required is high.

Single electrode sensors can only detect one species per working electrode

and additionally a positive and a negative control has to be carried out. The

ribosomal RNA concentration per cell has to be determined for each target

species. Additionally, a calibration curve must be developed for each new

probe set in order to determine the signal intensity at different RNA concen-

trations. Using the obtained information on the curve, the electrical measure-

ment of the hand held device can be related to cell numbers, e.g., in field

samples.

3.2. MULTIPROBE CHIPS

As mentioned above, arrays of electrodes facilitate a simultaneous detection

of multiple species with different molecular probes. This system is bene-

ficial for the observation of phytoplankton communities, which consist of

different species. The temporal and spatial variability in species compo-

sition in the sea is substantial and therefore a simultaneous detection of multi-

ple species is important.

A system with two major parts was developed during the EU-project

ALGADEC: a multiprobe biosensor and semi-automated device (see chapter

3.3). The present multiprobe chip consists of a disposable ceramic sensor

chip with 16 gold electrodes (Figure 4) (Diercks et al., 2008a).

291

S. DIERCKS ET AL.

Figure 4. Multiprobe chip with 16 gold working electrodes and gold stems.

This multiprobe chip can be used for the simultaneous detection of 14

different targets plus two controls and thus for the detection of species

compositions in harmful algal blooms. Signal transmission between the

electrodes was assessed and no tranmission was determined. This is an im-

portant attribute for the coating of the 16 working electrodes with different

species probes and false positive signals must be avoided (Diercks et al.,

2008a). Automated spotting of the multiprobe chips with DNA probes is

possible using a piezo spotter with image recognition. The automated spot-

ting will achieve a regular signal formation and increase the sensitivity of

the system.

The goal of ALGADEC was the detection of the different toxic algae

species in three different areas in Europe: Skagerrak in Norway, the Galician

coast in Spain and the area of the Orkney Islands in Scotland. Thus, probe

sets for different toxic algae (e.g., Alexandrium minutum, Pseudo-nitzschia

sp., Dinophysis sp.) have been developed and tested (Diercks et al., 2008c).

3.3. ALGADEC DEVICE

A portable semi-automated device was developed in the ALGADEC project

(Figure 5) (Diercks et al.). This device enables the electrochemical detec-

tion of toxic algae in less than two hours. The main steps of the probe to tar-

get hybridisation and analysis process are executed automatically in the

measurement device. A manual filtering and a lysis procedure has to be

done before the automatic measurement. And prior to measurement, the

one-way multiprobe chip has to be inserted into the flow cell unit.

The ALGADEC device contains reservoirs for antibody, substrate

and washing buffers. The signals from the different working electrodes

are recorded by a microcontroller unit whilst the electrochemical reaction

takes place on the chip. If a PC is connected to the system, an easy to operate

software (Figure 6) visualizes process data, graphic results, and the measured

values will be stored on the hard disc.

292

NUCLEIC ACID SENSORS

Figure 5. Portable ALGADEC device in waterproof case.

Figure 6. Software of the ALGADEC device.

A flowchart visualizes the status of the valves and temperature of the

inlet and the hybridization chamber (Figure 7).

The device can be used by laypersons because of the development of a lysis

protocol that eliminates the need for manual RNA isolation. The multiprobe

293

S. DIERCKS ET AL.

Figure 7. Flowchart for status visualization.

chip and the ALGADEC device can be used as a stand-alone system in the

field or aboard ships with build in keypad, display, power supply and

memory card. A waterproof case protects the system and allows the use

under heavy conditions.

4. Future Research

4.1. SYSTEM IMPROVEMENTS

The sensitivity of the system has to be optimised and the detection limit

must be reduced, because when a cell count of the toxic algal cells is reached,

then fisheries are closed. An inrease of sensitivity and regular signal formation

can be achieved by an automation of spotting of the multiprobe chips with

DNA probes. Thus, different DNA probes i.e., species can be spotted onto a

chip and area specific chips can be developed. 17 specific DNA probe sets

for toxic algae have already been developed (Diercks et al., 2008c) and new

probe sets for other toxic can be developed and need to be adapted to the

chips. Furthermore, the sensors must be calibrated for each DNA probe set

to allow a conversion of the electronic signal with the help of custom-made

software into the concentration of toxic cells.

The biosensor system can be simplified by an an automated water

sample filtration, because a manual filtering and a lysis procedure is still

required. However, with this adaptation it would be possible to integrate

this system into a buoy. Additionally the biosensor can be adapted to other

fields, e.g., medical diagnostics.

294

NUCLEIC ACID SENSORS

4.2. IMPLEMENTATION OF THE BIOSENSORS INTO THE FERRYBOX

SYSTEM

The biosensor will be implemented into a FerryBox system at Helgoland in

the North Sea. The current “German FerryBox” consists of a fully auto-

mated flow-through system (Figure 8) with different sensors and automatic

analysers, e.g., water temperature, salinity, turbidity, dissolved oxygen, pH,

nutrients (ammonium, nitrate/nitrite, phosphate, silicate) and the algal on-

line analyser (Petersen et al.).

Figure 8. Flow chart of the FerryBox System.

The Algal online analyser (AOA, bbe-moldaenke, Germany) measures

the chlorophyll fluorescence of the main algal groups. Five different algal

groups are detected with the algal online analyser:

Chlorophyceae

Cyanophyceae

Bacillariophyceae

Dinophyceae

Cryptophyceae

However, it is not possible to differentiate Bacillariophyceae and

Dinophyceae (Figure 9) and to identify species.

295

–

S. DIERCKS ET AL.

Figure 9. Relative chlorophyll fluorescence intensity of the different algal groups.

The biosensor system will be used to identify species or clades with the

help of clade level or species level probes. For this system reusable multi-

probe chips will be developed, so that the chip must not be changed and a

continuous flow through is possible. Thus, an automated screening of biodi-

versity and species composition during the course of the year will be possible.

5. Conclusions

A portable semi-automated device was developed in the EU project

ALGADEC that automatically processes the main steps of the probe to

target hybridisation and facilitates the electrochemical detection of toxic

algae in less than two hours. A multiprobe chip for the simultaneous detec-

tion of 16 different target molecules was developed. The multiprobe chip in

combination with the ALGADEC device is an autonomous and portable

system and thus can be used as a stand-alone system in the field and aboard

ships. Furthermore, the device can be used by layperson because a manual

RNA isolation is now no longer required. 17 probe sets for toxic algal

species were designed and can be used for the detection using the semi-

automated device and the multiprobe chips. The ALGADEC device will

contribute to monitoring programs to provide an early warning system for

296

NUCLEIC ACID SENSORS

the aquaculture and tourist sectors who are most affected by toxic algal

blooms.

6. Acknowledgement

The authors would like to thank all partners from the EU-Project ALGADEC

for excellent cooperation and valuable discussions in the development of

the multiprobe chips and the ALGADEC device. Sonja Diercks was suppor-

ted by the EU-project ALGADEC (COOP-CT-2004-508435-ALGADEC)

of the 6th Framework Programme of the European Union and the Alfred

Wegener Institute for Polar and Marine Research.

References

Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. 1990, Basic local

alignment search tool. J. Mol. Bio. 215: 403–410.

Andersen, P., Enevoldsen, H., and Anderson, D. M. 2003, Harmful algal monitoring

programme and action plan design, pp. 627–647. In G. M. Hallegraeff, D. M. Anderson

and A. D. Cembella [eds.], Manual on Harmful Marine Microalgae. United Nations

Educational, Scientific and Cultural Organization.

Berganza, J., Olabarria, G., García, R., Verdoy, D., Rebollo, A., and Arana, S. 2006, DNA

microdevice for electrochemical detection of Escherichia coli O157:H7 molecular

markers. Biosens. Bioelectron 22: 2132–2137.

Daranas, A. H., Norte, M., and Fernandez, J. J. 2001, Toxic marine microalgae. Toxicon 39:

1101–1132.

Diercks, S., Metfies, K., and Medlin, L. K. 2008b, Electrochemical detection of toxic algae

with a biosensor. In B. Karlson, C. Cusack and E. Bresnan [eds.], Microscopic and

molecular methods for quantitative phytoplankton analysis. Manuals and Guides.

Intergovernmental Oceanographic Comission.

Diercks, S., Metfies, K., and Medlin, L. K. 2008c, Molecular probes for the detection of

Dock, E., Christenson, A., Sapelnikova, S., Krejci, J., Emneus, J., and Ruzgas, T. 2005,

A steady-state and flow-through cell for screen-printed eight-electrode arrays. Anal.

Chim. Acta 531: 165–172.

Dunn, A. R., and Hassel, J. A. 1977, A novel method to map transcripts: Evidence for

homology between an adenovirus mRNA and discrete multiple regions of the viral

genome. Cell 12: 23–36.

Diercks, S., Metfies, K., and Medlin, L. K. 2008a, Development and adaptation of a

multiprobe biosensor for the use in a semi-automated device for the detection of toxic

297

Diercks, S., Metfies, K., Jäckel, S., and Medlin, L. K. 2008, Development and Optimization

toxic algae for use in sandwich hybridization formats. Plankton J. Res. 30: 439–448.

of a semi automated rRNA biosensor for the detection of toxic algae (part B).

algae. Biosens. Bioelectron 23: 1527–1533.

S. DIERCKS ET AL.

Farabullini, F., Lucarelli, F., Palchetti, I., Marrazza, G., and Mascini, M. 2007, Disposable

electrochemical genosensor for the simultaneous analysis of different bacterial food

contaminants. Biosensors and Bioelectronics 22: 1544–1549.

Harmful Marine Phytoplankton. United Nations Educational, Scientific and Cultural

Organization.

molecular analysis without nucleic acid amplification. Methods 37: 78–83.

review. Nova Hedwigia 79: 313–320.

Hallegraeff, G. M. 2003, Harmful algal blooms: a global overview, pp. 25–49. In G.M.

Harmful Anderson, D. M. and Cembella A. D. [eds.], Manual on Harmful Marine

John, U., Medlin, L. K., and Groben, R. 2005, Development of specific rRNA probes to

distinguish between geographic clades of the Alexandrium tamarense species complex.

J. Plankton Res. 27: 199–204.

Escherichia coli. Marine Pollution Bulletin 50: 1251–1261.

Acids. Res. 32: 1363–1371.

Masó, M., and Garces, E. 2006, Harmful microalgae blooms (HAB); problematic and

conditions that induce them. Mar. Pollut. Bull 53: 620–630.

Metfies, K., Huljic, S., Lange, M., and Medlin, L. K. 2005, Electrochemical detection of the

toxic dinoflagellate Alexandrium ostenfeldii with a DNA-biosensor. Biosens. Bioelectron

20: 1349–1357.

Moestrup, O. 2004, IOC Taxonomic Reference list of Toxic Algae. In O. Moestrup [ed.],

IOC taxonomic reference list of toxic algae. Intergovernmental Oceanographic Commis-

sion of UNESCO.

– Assessment of coastal and shelf sea ecosystems by combining in situ and remotely

Rautio, J., Barken, K. B., Lahdenpera, J., Breitenstein, A., Molin, S., and Neubauer, P. 2003,

lysates. Microb. Cell Fact 2: 4.

Harmful Marine Microalgae. United Nations Educational, Scientific and Cultural Orga-

nization.

Sournia, A., Chrdtiennot-Dinet, M. -J., and Ricard, M. 1991, Marine phytoplankton: how

many species in the world ocean? J. Plankton Res. 13: 1093–1099.

Svensson, S., and Förlin, L. 2004, Analysis of the importance of lipid breakdown for

elimination of okadaic acid (diarrhetic shellfish toxin) in mussels, Mytilus edulis: results

from a field study and a laboratory experiment. Aquatic Toxicology 66: 405–418.

Gau, V., Ma, S., Wang, H., Tsukuda, J., Kibler, J., and Haake, D. A. 2005, Electrochemical

labelled rRNA probes for hierarchical estimation of phytoplankton diversity – a mini-

pp. 657–692. In G. M. Hallegraeff, D. M. Anderson and A. D. Cembella [eds.], Manual on

Fernández, M. L., Shumway, S., and Blanco, J. 2003, Management of shellfish resources,

Groben, R., John, U., Eller, G., Lange, M., and Medlin, L. K. 2004, Using fluorescently-

Microalgae. United Nations Educational, Scientific and Cultural Organization.

food pathogens. Biosens. Bioelectron 22: 2010–2017.

Lagier, M. J., Scholin, C. A., Fell, J. W., Wang, J., and Goodwin, K. D. 2005, An

Lermo, A., Campoy, S., Barbé, J., Hernández, S., Alegret, S., and Pividori, M. I. 2006,

electrochemical RNA hybridization assay for detection of the fecal indicator bacterium

In situ DNA amplification with magnetic primers for the electrochemical detection of

Ludwig, W., and others 2004, ARB: a software environment for sequence data. Nucleic

Petersen, W., Wehde, H., Krasemann, H., Colijn, F., and Schroeder, F. FerryBox and MERIS

sensed data. Estuarine, Coastal and Shelf Science doi:10.1016/j.ecss.2007.09.023.

Rensel, J. E., and Whyte, J. N. C. 2003, Finfish mariculture and harmful algal blooms,

pp. 693–722. In G. M. Hallegraeff, D. M. Anderson and A. D. Cembella [eds.], Manual on

Sandwich hybridisation assay for quantitative detection of yeast RNAs in crude cell

298

NUCLEIC ACID SENSORS

Taylor, A. D., Ladd, J., Yu, Q., Chen, S., Homoloa, J., and Jiang, S. 2006, Quantitative and

simultaneous detection of four foodborne bacterial pathogens with a multi-channel SPR

sensor. Biosens. Bioelectron 22: 752–758.

Zammatteo, N., Moris, P., Alexandre, I., Vaira, D., Piette, J., and Remacle, J. 1995, DNA

probe hybridisation in microwells using a new bioluminescent system for the detection

of PCR-amplified HIV-1 proviral DNA. Virol. Methods 55: 185–197.

Zingone, A., and Enevoldsen, H. O. 2000, The diversity of harmful algal blooms: a challenge

for science and management. Ocean Coast Manage 43: 725–748.

299

DEVELOPMENT OF SENSORS TO TRACE TOXINS FROM

DINOFLAGELLATES AND OTHER ALGAE TO SEAFOOD

PATRIZIA ALBERTANO*, ROBERTA CONGESTRI

Department of Biology University of Rome “Tor Vergata”

LAURA MICHELI, DANILA MOSCONE, GIUSEPPE

PALLESCHI

Department of Chemical Sciences and Technologies,

University of Rome “Tor Vergata” – Via della Ricerca

Scientifica, 00173 Rome, Italy

bined with various electrochemical detection systems is being developed to

quantify phycotoxins in algae and seafood. The use of disposable screen-

printed electrodes for the immunosensor development is illustrated. Labo-

ratory responses on contaminated mussels were obtained by domoic acid

and saxitoxin sensors with detection limit of 5 and 0.1 ng/ml respectively.

Application to algal extracts was also performed to detect domoic acid con-

centration in phytoplankton populations along Latium (Middle Tyrrhenian

Sea, Mediterranean Sea) coast.

1. Introduction

In recent years, marine food and environment resources have been

threatened worldwide by the massive development of several harmful

phytoplankton species which contaminate shellfish and other marine

______

*To whom correspondence should be addressed. Patrizia Albertano, Department of Biology,

University of Rome “Tor Vergata” – Via della Ricerca Scientifica, 00173 Rome, Italy. Email:

albertano@uniroma2.it

V. Evangelista et al. (eds.), Algal Toxins: Nature, Occurrence, Effect and Detection. 301

– Via della Ricerca Scientifica, 00173 Rome, Italy

Abstract: Sensor technology based on immunological ELISA analyses com-

Keywords: Phycotoxin traceability, domoic acid, saxitoxins, immunosensors

P. ALBERTANO ET AL.

products causing animal mortality and severe human illness, and endangering

ecosystem quality (Zingone and Enevoldsen,

2000; Scholin et al., 2000;

Shumway et al., 2003;

Van Dolah et al., 2003

Increasing number of reports pointed to health risks connected to sea-

food consumption along Mediterranean coasts and lagoons (Taleb et al., 2001;

Vila et al., 2001; Turki, 2004; Blanco et al., 2005; Turki and Balti, 2005;

Illoul et al., 2007; Mikhail et al., 2007; Turki et al., 2007).

Blooms of Diarrhoeic Shellfish Poison (DSP) species are a common

phenomenon in the Adriatic and the Central-Southern Tyrrhenian Sea. Ex-

tended stretches of coast are frequently interested by the massive presence

of DSP algae (Dinophysis spp. and Phalachroma spp.) and most rarely by

Paralytic Shellfish Poison (PSP) producers (Ciminiello et al., 2000; Zingone

et al., 2006). On the contrary, PSP-producing Alexandrium spp. cause severe

problems in coastal areas of the Ionian (Giacobbe et al., 2004) and North

Adriatic Sea (Honsell et al., 1996). In addition, Gonyaulax spinifera, Lingu-

lodinium polyedrum and Protoceratium reticulatum have been recently

shown to be responsible of yessotoxin production and accumulation in

shellfish along North Adriatic coast (Ciminiello et al., 2003; Riccardi et al.,

2007), while pectenotoxins have been detected both in algae and mussels

(Draisci et al., 1999).

To understand the risk connected to the development of these harmful

algal blooms (HABs), the structure and dynamics of marine phytoplank-

ton has been recently assessed along Latium coast since 1997 to 2006

(Congestri et al., 2006). In this study 33 potentially toxic species, out of 374

microalgae present in the natural populations, have been identified with

light and electron microscopy (Fig. 1).

Sixteen thecate (Congestri et al., 2004a) and at least six naked dino-

flagellates were recorded together with six Pseudo-nitzschia species, the

latter being responsible for massive annual blooms (up to 10

cells l

–1

)

(Congestri et al., this volume). There were also sporadic brown tides due to

Fibrocapsa japonica intense growth during summer. Bloom periodicity and

cell abundances highlighted that spring and summer were the most critical

for toxicity events (Bianco et al., 2006).

Furthermore, recurrent summer blooms of the dinoflagellates Ostreopsis

ovata and Coolia monotis (Fig. 2) along with Prorocentrum lima started

to affect rocky, sheltered environments along Italian coast and promp-

ted monitoring of toxic microphytobenthos (HBABs) from 2003 (see www.

bentoxnet.it, Congestri et al., 2006; Ingarao et al., 2007). However, the produc-

tion of phycotoxins has being seldom recorded in phytoplankton communities

from the Central Mediterranean, and data on accumulation in mussels, fish

and other animals are still scarce (Azmil et al., 2003; Kaniou-Grigoriadou

et al., 2005).

302

IMMUNOSENSORS TO TRACE PHYCOTOXINS

Figure 1. SEM micrographs of Alexandrium minutum a, Lingulodinium polyedrum b,

Dinophysis caudata c, D. sacculus d, Prorocentrum minimum g and P. lima h, LM

micrographs of Dinophysis rotundata e, D. fortii f, Akashiwo sanguinea i, Karenia cf.

bicuneiformis l, K. cf. mikimotoi m, K. cf. papilionacea n. Late spring-summer occurrence of

these species was observed along Latium coasts, distribution was patchy and densities never

exceeded 10

cell l

–1

. Highest abundances were recorded for Alexandrium minutum (9.3 ×

cell l

–1

) at one station in May 2005, while at the same site Lingulodinium polyedrum

peaked in June (5.8 × 10

cell l

–1

), Dinophysis spp. had low densities, D. caudata showed

maximum values (2.3 × 10

cell l

–1

) in July 2003, and other species were present with

densities around 10

cell l

–1

. Among unarmoured taxa Karenia cf. mikimotoi had the highest

abundances (4.6 × 10

cell l

–1

) in May 2004 at a southern site. Bars = 4 Pm (g); 5 Pm (a); 10

Pm (b, h, i, l, m, n); 20 Pm (d, e, f); 50 Pm (c).

Figure 2. Mucilaginous benthic aggregates mostly comprising of Ostreopsis ovata (up to

7.5 × 105 cell g-1 fresh weight, 5 × 105 cell l-1) (a, c) and Coolia monotis (b, d), present

with lower densities, developed on living organisms (c) and rocky substrates (c) regularly

from 1999 to 2006 in the southern Latium coast. The first bloom event also coincided with

mass mortality of zoobenthos. Using LC-MS/MS methods a palytoxin analogue was detected

in mucous aggregates dominated by Ostreopsis ovata. Bars = 10Pm (b, d, e, f, g); 30 Pm (c).

303

P. ALBERTANO ET AL.

To face the very high risk of seafood toxicity, fast analytical procedures

based on the use of electrochemical disposable immunosensors for the

detection of phycotoxins were recently developed and applied directly in

shellfish samples following easy extraction procedures (Palleschi et al.,

2003, Micheli et al., 2004). Analogous approach was developed to quantify

toxins in algae (Micheli et al., 2003). These studies mostly focused on

domoic acid (DA) and saxitoxin (STX). DA is a potent water-soluble acidic

amino acid neurotoxin that causes the human Amnesic Shellfish Poisoning

(ASP) syndrome, while the water-soluble and thermostable tetrahydropurine

compound STX is responsible of the Paralytic Shellfish Poisoning (PSPs).

These toxins accumulate in the digestive glands of shellfish without causing

any apparent toxic effect on the molluscs. Conversely, human consumption

of a sufficient amount of seafood contaminated by DA and STX (both

odourless and tasteless) can result in mild to severe neurological symptoms

and in rare cases, death.

2. Methodological Approach and Results

The construction of electrochemical immunosensors coupled to elec-

trochemical techniques as differential pulse voltammetry (DPV) and chro-

noamperometry for the detection of DA and STX in algal and seafood

extracts is illustrated.

The analysis involves the use of disposable screen-printed electrodes

(SPEs) for the immunosensor development based on a “competitive test”

(Friguet et al., 1985). The support of the immunochemical chain was the

screen-printed electrode (SPE) (Fig. 3), produced by a thick-film technology

that combines the easiness of use and portability with simple and inexpen-

sive fabrication techniques. Application of the immunoelectro-chemical

ELISA (immunosensor), allows the selectivity of immunological analysis to

be combined with the sensitivity of the electrochemical detection (Del Carlo

et al., 1997; Santandreu et al., 1998; Warsinke et al., 2000).

In the case of domoic acid, the toxin was conjugated to bovine serum

albumin (BSA-DA) and coated onto the SPE. Incubation with the sample

(or standard toxin) and the anti-DA antibody followed (Fig. 4A). An anti-

goat IgG-alkaline phosphatase conjugate was used for signal generation,

measured with DPV. For the detection of STX, the “direct format” (Fig. 4B)

was used with the immobilisation of the primary antibody (against the toxin)

onto the electrode and the competition between the free (STX) and labeled

toxin with enzyme (STX-HRP) was then carried out. The enzymatic product

was detected by Chronoamperometry.

304

IMMUNOSENSORS TO TRACE PHYCOTOXINS

Figure 3. Screen-printed electrode with PalmSens, portable electrochemical instrumentation.

Figure 4. Schemes of indirect A and direct B competitive ELISA formats used for SPE-

immununosensors.

DA results showed a detection limit of 5 ng/mL with a working range

between 5–70 ng/mL of DA (Fig. 5A), while a detection limit of 0.1 ng/mL

and a working range of 0.1–10

ng/mL was obtained for STX (Fig. 5B).

The suitability of the assays for the quantification of these toxins in

mussels was also evaluated. Samples were spiked with toxin standard

before and after the sample treatment to study the extraction efficiency and

the matrix effect, respectively. After treatment, samples were analysed at

1:1000 v/v dilution in PBS for STX and 1:250 v/v in PBS-M (phosphate

saline buffer pH 7.4 + CH

OH 10%) for DA to minimize the matrix effect

and to detect the regulatory limit for both toxins in mussels as given by the

Food and Drug Administration (www.fda.org, Compliance Programme

7303.842, Guidance Levels, Table 3, p. 248).

The reliability of the immunoassays for the determination of the DA and

STX in spiked samples was demonstrated by comparison of the data with

305

the fully validated confirmatory HPLC results (Micheli et al., 2004). Very

P. ALBERTANO ET AL.

70 ng/ml) B.

suitability of the proposed assays for accurate determination of the both

toxin concentrations in mussel samples.

2.1. APPLICATION TO ALGAE

The method for DA was adjusted to test natural algal matrices. Extracts

were obtained from net samples collected fortnightly during one year at

six stations along Latium (Italy) coast, and analysed by using SPEs immu-

nosensors and HPLC. About 22% of samples were positive for DA and

results of the two assays showed a RE = ± 20% (Micheli et al., 2003).

Countings at the species level in surface water samples allowed to put in

relation high abundance of Pseudo-nitzschia spp. to the summer peaks of

DA observed at some stations (Congestri et al., 2004b).

3. Conclusions

Bloom events of toxic algal species may result in extensive and unpre-

cedented closures of shellfish harvesting areas to prevent poisoning syndromes

in human consumers. Karenia and Ostreopsis blooms may affect residents

in coastal areas by inducing respiratory irritation in beach-goers. Bacterial

decomposition of dead animals and algal cells may cause anoxia of bottom

water, which may spiral into multiple species unusual mortality events in

thousand square-miles of sea-bottom. Preliminary estimates of the eco-

nomic impact due to HABs along US coasts accounted for more than 80

good recoveries (90–110%) were obtained for both toxin, demonstrating the

Figure 5. Calibration curves of SPE-immunosensors for DA (5 ng/ml) A and STX (5–

306

IMMUNOSENSORS TO TRACE PHYCOTOXINS

million dollars per year in 1987–2000. These estimates included public

health costs of illness (45%), lost revenues of commercial fisheries (46%),

local recreation and tourism impacts (5%), and coastal monitoring and

management expenditure (4%) (Jewett et al., 2007).

Furthermore, the worldwide increase in coastal algal blooms is currently

regarded as one of the first biological signs of global warming of ocean waters,

thus continuous monitoring activities will be crucial for the understanding of

aquatic processes and climate change.

In this scenario, environmentally sound techniques to reduce HABs

impacts should be based on effective methodologies for rapid field detec-

tion of phycotoxins to develop early warning systems, response plans, and

methods to reduce public health, ecological, social, and economic impacts

of HABs.

There is, therefore, a critical need for cost-effective and user-friendly

monitoring tools that can be used by tribes, local environmental groups, and

state agencies to monitor toxins concentrations.

Competitive immunoassays for DA and STX are indeed a functional

strategy useful to support surveillance activities of both phytoplankton and

seafood. The rapid and accurate identification of phycotoxins in a working

range that is comparable to that of conventional methods and the detection

limit suitable for “on-site” monitoring allow successful application on algae

and mussel matrices. Electrochemical SPE-immunosensors may presently

contribute to the development of early warning protocols for routine app-

lication. Further studies on different animal matrices might reveal the fate

of phycotoxins and their amplification along the whole food chain and thus

contribute to assess the extent of the impact of toxic bloom events on

environmental and human health.

References

Amzil, Z., Fresnel, J., Le Gal, D., and Billard, C., 2001, Domoic acid accumulation in

French shellfish in relation to toxic species of Pseudo-nitzschia multiseries and

P. pseudodelicatissima, Toxicon 39: 77–82.

Bianco, I., Congestri, R., Sangiorgi, V., Zaottini, E., and Albertano P., 2006, Blooms

(Fioriture) di microalghe potenzialmente tossiche lungo le coste laziali. Biol. Mar. Medit.

13: 947–950.

Blanco, J., Moroño, Á., and Fernández, M.L., 2005, Toxic episodes in shellfish, produced by

lipophilic phycotoxins: an overview, Galician J. Mar. Res. 1: 1–70.

Ciminiello, P., Dell’Aversano, C., Fattorusso, E., Forino, M., Magno, S., Guerrini, F.,

Pistocchi, R., and Boni, L., 2003, Complex yessotoxins profile in Protoceratium reti-

culatum from north-western Adriatic sea revealed by LC–MS analysis. Toxicon 42:

7–14.

307

P. ALBERTANO ET AL.

Ciminiello, P., Fattorusso, E., Fiorino, M., and Montresor, M., 2000. Saxitoxin and neosaxi-

toxin as toxic principles of Alexandrium andersoni (Dinophyceae) from the Gulf of

Naples, Italy. Toxicon 38: 1871–1877.

Congestri, R., Micheli, L., Radoi, A., Polizzano, S., Albertano, P., and Palleschi, G., Sensing

the risk: disposable immunosensors for domoic acid monitoring in the sea, Mar. Drugs

submitted.

Congestri, R., Bianco, I., and Albertano, P., 2004a, Potentially toxic thecate dinoflagellates

of Middle Tyrrhenian coastal waters (Mediterranean Sea), in Harmful Algae 2002. Proc.

Intern. Conf. On harmful Algae K.A. Steidinger, J.H. Landsberg, C.R. Tomas, and

G.A. Vargo eds., Florida Fish and Wildlife Conservation Commission and Inter-

governmental Oceanographic Commission of UNESCO, USA, pp. 332–334.

Congestri, R., Polizzano, S., Micheli, L., Moscone, D., Palleschi, G., and Albertano, P.,

2004 b, On the presence of Pseudo-nitzschia spp. and domoic acid in natural samples

from the middle Tyrrhenian Sea (Mediterranean Sea). XI

International Conference on

Harmful Algal Blooms. Cape Town, South Africa, Abstract Book 93 PP.

Congestri, R., Sangiorgi, V., Bianco, I., Capucci, E., and Albertano, P., 2006, Il fitoplancton

delle coste laziali dal 1997 ad oggi: struttura della comunità, taxa dominanti e specie

tossiche, Biol. Mar. Medit. 13(1): 54–60.

Congestri, R., Penna, A., and Zingone, A., 2006, BENTOX-NET, a research and manage-

ment iniziative on Ostreopsis spp. and other benthic microalgal blooms on the Italian

coast, Harmful Algae News 32: 11–12.

Del Carlo, M., Lionta, I., Taccini, M., Cagnini, A., and Mascini, M., 1997, Disposable

screen-printed electrodes for the immunochemical detection of polychlorinated bip-

henyls, Analytical Chimica Acta 342: 189–197.

Draisci, R., Palleschi, L., Giannetti, L., Lucentinia, L., James K.J., Bishop, A.G., Satake, M., and

Yasumoto, T., 1999, New approach to the direct detection of known and new diarrhoeic

shellfish toxins in mussels and phytoplankton by liquid chromatography–mass spect-

rometry, J. Chromatogr. A 847: 213–221.

Friguet, B., Chaffotte, A.F., Djavadi-Ohaniance, L., and Goldberg, M.E., 1985, Measure-

ments of the true affinity constant in solution of antigen-antibody complexes by Enzyme-

Linked Immunosorbent Assay, J. Immunol. Methods 77: 305–319.

Giacobbe, M.G., Azzaro, F., Decembrini, F., Galletta, M., Gangemi, E., Raffa, F., Ceredi, A.,

Milandri, A., Poletti, R., and Maso´, M., 2004. Fioritura tossica del dinoflagellato

Alexandrium minutum in un’area costiera del Mar Ionio. Biol. Mar. Med. 11: 703–707.

Honsell, G., Poletti, R., Pompei, M., Sidari, L., Milandri, A., Casadei, C., and Viviani, R.,

1996, Alexandrium minutum Halim and PSP contamination in the northern Adriatic Sea

(Mediterranean Sea). In Harmful and Toxic Algal Blooms T. Yasumoto, Y. Oshima and

Y. Fukuyo eds., Intergovernmental Oceanographic Commission of UNESCO, Paris,

pp. 77–80.

Illoul, H. et al., 2007, Detection of toxic Gymnodimium catenatum (Graham 1943) in

Algerian waters (SW Mediterranean), Harmful Algae News 29: 10–12.

Ingarao, C., Lanciani, G., Verri, C, and Pagliani T., 2007, First record of Prorocentrum lima

on Abruzzo Region coast, W Adriatic, Harmful Algae News 35: 10–12.

Jewett, E.B., Lopez, C.B., Dortch, Q., and Etheridge, S.M., 2007, National assessment of

efforts to predict and respond to Harmful Algal Blooms in U.S. Waters. Interim Report.

Interagency Working Group on Harmful Algal Blooms, Hypoxia, and Human Health of

the Joint Subcommittee on Ocean Science and Technology. Washington, DC, pp. 1–70.

Kaniou-Grigoriadou, I., Mouratidou, T., and Katikou, P., 2005, Investigation on the presence

of domoic acid in Greek shellfish, Harmful Algae 4: 717–723.

308

IMMUNOSENSORS TO TRACE PHYCOTOXINS

Landsberg, J.H., 2002, The effects of harmful algal blooms on aquatic organisms, Rev. Fish.

Sci. 10: 113–390.

Micheli, L., Polizzano, S., Albertano, P., Moscone, D., and Palleschi G., 2003, SPE

immunosensors for the detection of domoic acid in cell extracts of the diatoms Pseudo-

nitzschia spp. from Italian coasts. International Workshop on Biosensors for Food Safety

and Environmental Monitoring, Marrakech (Morocco), Abstract Book pp.47

Micheli, L., Radoi, A., Guarrina, R., Massaud, R., Bala, C., Moscone, D., and Palleschi, G.,

2004, Disposable immunosensors for the determination of domoic acid in shellfish,

Biosens. Bioelectron. 20: 190–196.

Mikhail, S.K., Oakbah, M.A., and Labib, W., 2007, Toxic phytoplankton species linked to

massive fisn and invertebrate mortality in the Eastern Harbour of Alexandria, Harmful

Algae News 29: 3–4.

Palleschi, G., Moscone, D., and Micheli, L., 2003, The rapid detection of toxins in food: a

case study, in Rapid and on-line instrumentation for food quality assurance Ibtisam

Tothill E. ed., Woodhead publishing limited, Cambridge, UK, pp. 116–135

Palleschi, G., Moscone, D., Micheli, L., and Botta, D., 2002, Rapid detection of seafood

toxins, in: Safety and quality issues in fish processing H.A. Bremner ed., Woodhead

Publishing Limited, Cambridge, UK, pp. 142–160.

Riccardi, M., Guerrini, F., Milandri, A., Pigozzi, S., Riccardi, E., Dell’Aversano, C.,

Ciminiello, P., Fattorusso, E., Pistocchi, R., 2007, Tossicità ed analisi filogenetica di

alcuni ceppi di Gonyaulax spinifera dal Mare Adriatico, Riunione Scientifica Annuale

del Gruppo di Lavoro per l’Algologia - Societa` Botanica Italiana, S. Maria di Galeria

(Rome), Italy, 9–10 November, Abstract Book 22 pp.

Santandreu, M., Solè, S., Fàbreg as, E., and Alegret, S., 1998, Development of electrochemical

immunosensing system with renewable superficies, Biosens. Bioelectron. 13: 7–17.

Scholin, C.A., and 25 co-authors, 2000, Mortality of sea lions along the central California

coast linked to a toxic diatom bloom, Nature 403: 80–84.

Shumway, S.E., Allen, S.M., and Dee Boersma, P., 2003, Marine birds and harmful algal

blooms: sporadic victims or under-reported events, Harmful Algae 2: 1–17.

Taleb, H., Vale, P., Jaime, E., and Blaghen, M., 2001, Study of paralytic shellfish poisoning

toxin profile in shellfish from the Mediterranean shore of Morocco, Toxicon 39: 1855–

1861.

Turki, S., 2004, Suivi des microalgues planctoniques toxiques dans les zones de production,

d’elevage des mollusques bivalves et d’exploitation des oursins du nord de la Tunisie.

Bull. Inst. Natn. Scien. Tech. Mer de Salammbô 331: 83----96.

Turki, S., and Balti, N., 2005, Detection of toxic Alexandrium catenella (Whedon and

Kofoid) Balech in clam production zone of North Lake and Channel, Tunisia, Harmful

Algae News 28: 1–2.

Turki, S., Balti, N., and Ben Jannet, H., 2007, First bloom of dinoflagellate Alexandrium

catenella in Bizerte Lagoon (northern Tunisia), Harmful Algae News 35: 7–9.

Van Dolah F.M., Doucette, G.J., Gulland, F.M.D., Rowles, T.L., and Bossart, J.D., 2003, Im-

pact of algal toxins on marine mammals, in Toxicology of marine mammals

J.G. Vos,

J.D. Bossart, M.E. Fournier and T.J. O’Shea, eds., Taylor & Francis, London, pp. 247–269.

Vila, M., Garces, E., Maso´, M., and Camp, J., 2001, Is the distribution of the toxic

dinoflagellate Alexandrium catenella expanding along the NW Mediterranean coast?,

Mar. Ecol. Prog. Ser. 222: 73–83.

Warsinke, A., Benkert, F.W., and Scheller, 2000, Electrochemical immunoassays, Fresnius

Analyt. J. Chem. 366 (6–7).

309

P. ALBERTANO ET AL.

Zingone, A., and Enevoldsen, H.O., 2000, The diversity of harmful algal blooms: a challenge

for science and management, Ocean Coast. Manage. 43: 725–748.

Zingone, A., Siano, R., D’Alelio, D., and Sarno, D., 2006, Potentially toxic and harmful

microalgae from coastal waters of the Campania region (Tyrrhenian Sea, Mediterranean

310

Sea), H armful Algae 5: 321–337.

RECOMBINANT FORMALDEHYDE DEHYDROGENASE

AND GENE-ENGINEERED METHYLOTROPHIC YEASTS

AS BIOANALITYCAL INSTRUMENTS FOR ASSAY OF TOXIC

FORMALDEHYDE

GALYNA GAYDA, OLHA DEMKIV, ɆYKHAILO

GONCHAR*

Institute of Cell Biology, NAS of Ukraine, Drahomanov Str.

14/16, 79005 Lviv, Ukraine;

SOLOMIYA PARYZHAK

Ivan Franko National University of Lviv, Hrushevs’kyi Str. 4,

79005 Lviv, Ukraine;

WOLFGANG SCHUHMANN

Ruhr-Universität, Universitätsstr. 150, D-44780, Bochum,

Germany

polymorpha strains NCYC 495 and CȼS 4732, resistent to elevated con-

centrations of formaldehyde in a medium (up to 15–20 mM) and over-

producing a homologous NAD- and glutathione-dependent form-aldehyde

dehydrogenase, were constructed. Optimal cultivation conditions for the

highest yield of the enzyme were established. A simple scheme for the iso-

lation of formaldehyde dehydrogenase from the re-combinant strains was

proposed, and some characteristics of the purified enzyme were studied.

Enzymatic and biosensoric methods for formaldehyde assay based on the

formaldehyde dehydrogenase and the constructed recombinant cells were

developed. The reliability of the developed analytical approaches was tested

on real samples of waste waters, pharmaceuticals, formaldehyde-containing

industrial products, and vaccines. The comparison of formaldehyde content

values obtained by the use of biosensors (enzyme and cells-based), enzymatic

______

*To whom correspondence should be addressed. Ɇykhailo Gonchar, Analytical Biotechnology Dept.,

Institute of Cell Biology, Drahomanov Str. 14/16, 79005 Lviv, Ukraine. Email: gonchar@cellbiol.lviv.ua,

myg52@yahoo.com

V. Evangelista et al. (eds.), Algal Toxins: Nature, Occurrence, Effect and Detection. 311

Abstract: Recombinant yeast clones, originated from the recipient Hansenula

G. GAYDA ET AL.

methods and two routinely used chemical ones (chromotropic acid and

3-methyl-2-benzothiazolinone hydrazone) showed a good correlation bet-

ween these approaches.

Keywords: Yeast Hansenula polymorpha (Pichia angusta), gene engineering,

1. Introduction

Formaldehyde (FA), extremely toxic agent, is found in more than 2000

commercial products. This compound is widely used as building block for

the synthesis of many organic chemicals and materials, for example, phenol-,

urea- and melamines-derived polymeric resins. Humans are exposed to FA

from a variety of sources. The major source of atmospheric FA is related to

combustion processes – forest fires, automobile exhaust, photooxidation of

hydrocarbons. In water, FA is also formed by the irradiation of humus

substances by sunlight (Liteplo et al., 2002; National Research Council,

1982). Additional exposure to FA emissions comes from its use as an

embalming fluid in anatomy labs, morgues, and its use as a fumigant and

sterilant (Liteplo et al., 2002). FA is used as a preservative in the pro-

duction of vaccines instead of harmful merthiolate that can cause neuro-

developmental disorders including autism and autism spectrum disorders

(Offit and Jew, 2007; Geier and Geier, 2004), in the production of different

consumer goods: detergents, soaps, and shampoos (Gerberich and Seaman,

1994). Resin treated fabric, rugs, paper, etc. and materials such as particle

board and plywood which contain resin adhesives and foam insulation

release FA which may build up in homes and occupational atmospheres

(Liteplo et al., 2002; National Research Council, 1982). Recently, a new

health risk factor associated with FA has been revealed. Some advanced

technologies of potable water pre-treatment include the ozonation process

during which FA is generated as a result of reaction of ozone with humus

traces (Schechter and Singer, 1995). At the same time, FA is a natural

metabolite of all living organisms. It has been found in fruits, vegetables,

flesh, and biological fluids of human origin (Gerberich and Seaman, 1994).

In extreme cases, some frozen fish, especially of Gadoid species, can

accumulate up to 200 mg of FA per 1 kg of wet weight due to the enzymatic

degradation of a natural fish component – trimethylamine oxide (Rehbein,

1995; Pavlishko et al., 2003).

FA is emitted by bacteria, algae, plankton (Liteplo et al., 2002). Data on

the aquatic toxicity of FA are numerous. The most sensitive aquatic effects

identified were observed for marine algae. FA concentration of 0.1 and 1

312

formaldehyde dehydrogenase, enzymatic assay, biosensor, formaldehyde

FORMALDEHYDE ASSAY

mg/L in water caused 40–50% mortality after 96 h in day-old zygotes of

Phyllospora comosa, a brown marine macroalgae endemic to south-eastern

Australia. Total (100%) mortality resulted from exposures to 100 mg/L for

24 h and 10 mg/L for 96 h. The 96h no-observed-effect concentration and

lowest-observed-effect concentration of 7-day-old embryos of the same

species were reported as 1 and 10 mg/L, respectively, indicating that older

organisms are more tolerant to FA. Concentrations of 0.1, 1, and 10 mg/L

also reduced germination and growth rates of the zygotes and embryos.

Freshwater algae may be slightly more tolerant of FA, based on a cell

multiplication inhibition test. The toxicity threshold was 0.9 mg FA/L. The

toxicity of FA for fish is also variable: the most sensitive freshwater fish

were fingerlings of striped bass Roccus saxatilis (Liteplo et al., 2002).

FA has a negative influence on human’s health, especially on the central

nervous, blood and immune systems. It is a potent nasal irritant, causes

stunted growth, blindness and respiratory diseases. Release of FA vapors

in mobile homes has been associated with headache and pulmonary and

dermal irritation (Ellenhorn and Barceloux, 1988). The relation of chronic

respiratory symptoms and pulmonary function to FA in homes was studied

in a sample of 298 children (6–15 years of age) and 613 adults. The permissible

level of FA in industrial areas is set to 0.5–2.0 ppm. Significantly greater

prevalence rates of asthma and chronic bronchitis were found in children

from houses with FA levels 60–120 ppb than in those less exposed, especially

in children also exposed to environmental tobacco smoke. In children, levels

of peak expiratory flow rates decreased linearly with FA exposure, with the

estimated decrease due to 60 ppb of FA equivalent to 22% of peak expi-

ratory flow rates level in nonexposed children. The effects in asthmatic

children exposed to FA below 50 ppb were greater than in healthy ones. The

effects in adults were less evident: decrements in peak expiratory flow rates due

to FA over 40 ppb were seen only in the morning, and mainly in smokers.

FA is classified as a mutagen and possible human carcinogen (Feron

et al., 1991), one of the chemical mediators of apoptosis. These consi-

derations are sufficient to demonstrate the necessity for FA control in con-

sumer goods, environment, as well as in biological samples. Control of

pollutants and toxic compounds is of great importance for all countries, and

such control requires the development of simple, cheap, sensitive, and selec-

tive methods for FA analysis. Among them, enzymatic and biosensor-based

approaches are the most promising due to high selectivity and sensitivity.

The existing enzymatic methods for FA assay are laborious, not enough

selective and specific, and the corresponding kits are still unavailable at the

world market place (Ho and Richards, 1990; Patent, 2002). Recently, we

have described the fabrication and properties of a reagentless bienzyme

amperometric biosensor based on alcohol oxidase/peroxidase in combination

313

G. GAYDA ET AL.

with an Os-complex modified electro-deposition paint (Smutok et al., 2005).

Although the developed biosensor showed good sensitivity for the detection

of FA, the poor selectivity of the used biological recognition element,

alcohol oxidase, application of these sensors is limited.

To solve this problem, we have developed new analytical approaches for

FA assay based on NAD

- and glutathione-dependent formaldehyde dehydro-

genase (FdDH) isolated from recombinant yeast cells-overproducing FdDH.

FdDH, a key enzyme of FA metabolism in microorganisms, is proposed

to be used for bioanalytical purposes (Ben Ali et al., 2006). The broad use

of FdDH in analytical practice is hampered by insufficient activity of the

commercial preparations of the enzyme from Pseudomonas putida and

Candida boidinii, as well as by relatively high costs of the enzymes’

preparations isolated from the wild type strains (Sigma-Aldrich Catalogue,

2007).

In this paper, we describe:

– construction of the recombinant yeast strains, originated from the reci-

pient thermotolerant methylotrophic yeast Hansenula polymorpha, over-

producing a homologous thermostable FdDH;

– optimization of the cultivation conditions for the gene-engineered strains,

the procedure of enzyme isolation from the recombinant cells, some

characteristics of the purified FdDH;

– development of enzymatic FdDH-based approach for FA assay;

– development of biosensoric methods for FA assay, based on the use of

the recombinant FdDH and gene-engineered yeast cells over-producing

this enzyme;

– comparison of the developed bioanalytic approaches, namely bio-sensoric

(FdDH- and cells-based) and enzymatic ones, with standard chemical

methods for FA assay in real samples: wastewater, some industrial goods,

pharmaceuticals, and vaccines.

2. Materials and Methods

2.1.

MICROBIAL STRAINS, MEDIA, CULTIVATION CONDITIONS,

AND PREPARATION OF CELL-FREE EXTRACTS

The following strains were used in the present study: Hansenula polymorpha

356 (leu2) line DL1, H. ɪolymorpha NCYC 495 (leu1-1) and H. ɪolymorpha

CȼS 4732 (leu2-2). For vector construction, gene FLD1 H. ɪolymorpha and

plasmid pYT1 were used (Baerends et al., 2002; Demkiv et al., 2005).

314

FORMALDEHYDE ASSAY

Yeast cells were cultivated in flasks on a shaker (200 rpm) at 28

C until

the middle of the exponential growth phase (~24 h) in a medium containing

(g/L): (NH

)

– 3.5; KH

–1.0; MgSO

× 7H

O – 0.5; CaCl

– 0.1;

yeast extract – 0.5 with the supplement of standard microelements (Demkiv

et al., 2005). As carbon sources, 1% methanol, 1% glucose, or 1% ethanol

were used. For cultivation of the strains leu 1-1 and leu 2-2, leucine was

added up to 40 mg/L.

After washing, the cells were suspended in 0.05 M K, Na-phosphate

buffer, pH 8.0 (PB), containing 0.4 mM PMSF and 1.0 mM EDTA, frozen,

and kept at –20°C. To obtain the cell-free extract (CE), cells were disrupted

with glass beads (d = 0.45 – 0.5 mm) in a planetary disintegrator at 1000

rpm (r = 10 cm) at 4°C for 6 min. The cell debris was removed by cen-

trifugation at 15000 rpm (r = 8 cm) for 40 min and the supernatant (CE) was

used for testing and isolation of the enzyme.

2.2.

CONSTRUCTION AND SELECTION OF FDDH OVER-PRODUCING

RECOMBINANT STRAINS

To construct strains, over-producing thermostable NAD

- and glutathione-

dependent FdDH, the H. ɪolymorpha FLD1 gene with its own promotɟr

(Baerends et al., 2002) was inserted into the integrative plasmid pYT1

(Demkiv et al., 2005) containing the LEU2 gene of Saccharomyces cerevisiae

(as a selective marker). The constructed vector was used for multi-copy

integration of the target gene into the genome by transformation of leu 1-1

(Demkiv et al., 2005) and leu 2-2 recipient cells (both leu allels are comple-

mented by S. cerevisiae gene LEU2). The transformation was performed using

three different methods: electroporation (Delorme, 1989), lithium chloride

method (Ito et al., 1983), and protoplasting procedure (Hinnen et al., 1978).

Selection of FdDH-overproducing strains was carried out by leucine

prototrophy and simultaneously by the resistance to elevated concentrations

of FA in the medium (up to 20 mM). Finally, FdDH specific activities were

tested in cell-free extracts (CE) of the selected FA-resistant Leu-prototrophic

transformants. Activity of FdDH was determined by the rate of NADH

formation monitored spectrophotometrically at 340 nm (Schutte et al.,

1976). One unit (1 U) of the enzyme activity was defined as the amount of

the enzyme which forms 1 Pmole NADH per 1 min under standard con-

ditions of the assay: 25°C, 1 mM FA, 1 mM NAD

, and 2 mM glutathione

in PB (50 mM PB, pH 8.0). Instant activity of FdDH (A) was calculated

as a difference between A

+FA

(in the presence of FA) and A

–FA

(without

addition of FA). Protein concentration was estimated by Lowry method.

315

G. GAYDA ET AL.

2.3. ISOLATION AND PURIFICATION OF FDDH

The stable recombinant strain Tf 11-6 was chosen as FdDH over-producer

shown to have the highest activity of FdDH (up to 4.0 Pmoles·min

–1

·mg

–1

protein) in cell-free extract (Demkiv et al., 2005).

FdDH was isolated from the cell-free extract (CE) by two-step column

chromatography on anion-exchange sorbent DEAE-Toyopearl 650 M (Demkiv

et al., 2007a). On the first step, CE was applied to column, equilibrated by PB,

pH 8.0. The fraction of unabsorbed proteins, which contained FdDH, was

diluted by water (1:3), Tris-base was added for adjusting pH to 8.8, and the

final solution was applied to the same column (the second step), previously

washed by 1 M NaCl and equilibrated by 40 mM Tris-buffer, pH 8.8 (TB).

Enzyme was eluted by 0.1 M NaCl in the initial buffer (TB), and the

specific activity of FdDH was assayed in each fraction. The concentration

of protein was determined by the Lowry method. The fractions of eluate

with the activity of the enzyme higher than 10 U·mg

–1

were combined, then

dithiothreitol (DTT) – up to 2 mM, and ammonium sulfate (up to 80%

saturation; pH 8.0; at 0°C) were added. After incubation at 0°C for 1 h, the

enzyme was collected by the centrifugation (15000 g, r

= 8 cm, 30 min,

4°C), and pellet was resuspended in a minimal volume of ammonium

sulfate solution (80% saturation) in 40 mM PB with 1.0 mM EDTA, 2 mM

DTT and kept at –10°C.

2.4.

ELECTROPHORESIS

The molecular weight of the FdDH subunits was calculated from the

electrophoretic mobility values of FdDH and a set of standard proteins after

SDS-gel electrophoresis in 5–20% polyacrylamide gel (PAAG). SDS-PAAG

was stained with Coommassie Blue R-250. To visualize enzyme bands in

native PAAG (Maidan et al., 1997), we used a modified mixture for FdDH

assay: 1.0 mM FA, 1.0 mM NAD, 2.0 mM glutathione, 0.05 mM nitrotetra-

zolium blue (NTB), and 0.003 mM phenazine methosulfate (PMS) in 50

mM PB, pH 8.0. The PAAG was washed with water after the appearance of

blue-violet FdDH bands.

2.5.

METHODS OF FA ASSAY

2.5.1. Chemical methods

The assay was performed by two methods using chromotropic acid (Polska

Norma PN-71 C-04568, 1988) and 3-methyl-2-benzothiazolinone hydrazone

hydrochloride (MBTH) (Sawicki et al., 1961).

316

FORMALDEHYDE ASSAY

2.5.2. Enzymatic methods

2.5.2.a. FdDH-based method “Formatest”

0.5 ml of model and real samples (water for the blank sample) were treated

at room temperature by 0.5 ml FdDH-containing reagent of the following

composition: 23 mU/ml FdDH, 0.63 mM glutathione, 0.31 mM NAD

, 0,2

mM NTB, 0.024 mM PMS, and 0.01% Triton X-100 in 50 mM PB, pH 8.0.

Reaction mixture was incubated for 30 min at room temperature. To

terminate the reaction, 3 ml 0.3 M HCl was added, and optical density of

the sample at 570 nm was measured. FA content was calculated from the

calibration curve.

2.5.2.b Oxidase/peroxidase-based method “Alkotest”

Assay was performed as described by us (Gonchar et al., 2005), using yeast

alcohol oxidase capable to oxidize FA by O

to formic acid and H

2.6.

CONSTRUCTION OF FDDH- AND CELLS-BASED AMPEROMETRIC

BIOSENSORS

2.6.1. Electrodes

Graphite rods (type RW001, 3.05 mm diameter) from Ringsdorff Werke

(Bonn, Germany), sealed in glass tubes by means of epoxy glue and used as

working electrodes, were polished with emery paper of decreasing size. Plati-

nisation of the graphite electrodes (for enzyme-based biosensors) was carried

out in a 6 mg·ml

–1

solution of hexachloroplatinum(IV)-acid-hexahydrate in

HPLC-grade water by cyclic voltammetry (0.4 to –0.6 V at a scan rate of 10

mV s

–1

, 3–4 potential cycles). After platinisation, the electrodes were rinsed

with 0.2 M phosphate buffer, pH 8.2. The properties of amperometric bio-

sensors were evaluated by means of constant-potential amperometry in a

three-electrode configuration with a Ag/AgCl/KCl (3 M) reference elec-

trode and a Pt-wire counter electrode.

2.6.2. Immobilization of FdDH by entrapment within the polymer layer

of a cathodic electrodeposition paint

2 ȝl of FdDH suspension (15 U·ml

–1

) and 2 µl of cathodic paint (CPOs)

were mixed and dropped onto the surface of a platinised graphite electrode.

In a miniaturized electrochemical cell the cathodic paint was precipitated

using a potentiostatic pulse sequence with pulses to a potential of –1200

mV for 0.2 s and a resting phase at a potential of 0 mV for 5 s (Ngounou

et al., 2004). At the applied cathodic potential, water is reduced at the

electrode surface leading to an increase of the pH-value in a diffusion zone in

317

G. GAYDA ET AL.

front of the working electrode surface. Subsequently, the cathodic paint is

deprotonated imposing a significant change in its solubility which leads to the

precipitation of the polymer on the electrode surface simultaneously entrapping

the enzyme.

2.6.3. Entrapment of FdDH and NAD

within an Os-complex modified

cathodic electrodeposition paint

2 µl of 25 mM NAD

, 2 ȝl of FdDH suspension (15 U·ml

–1

) and 2 µl of Os-

complex modified cathodic paints were dropped on the surface of a platinized

graphite electrode, CPOs was electro-precipitated and enzyme with NAD

were co-entrapped within the polymer film. After the immobilization proce-

dure, the electrodes were rinsed with 0.02 M PB, pH 8.2.

2.6.4. Co-entrapment of glutathione and covering of the sensing layer

by a Nafion membrane

On the top of a 1CPOs-NAD

-FdDH-modified electrode, 3 ȝl of a 50 mM

neutralized to pH 8.0 solution of reduced glutathione were dropped. After

drying (2–4 min), 5 ȝl of 1% Nafion solution in ethanol (neutralized) were

dropped on the sensor surface. The Nafion membrane was allowed to dry

for 20 to 25 min at a temperature of +4

2.6.5. Immobilization of recombinant FdDH-producing yeast cells

2 ȝl of FdDH suspension (15 U·ml

–1

) was put on the surface of graphite

electrode. On the top of a Cells-modified electrode, 3 ȝl of a 50 mM ne-

utralized solution of reduced glutathione and 2 µl of 25 mM NAD

were

dropped. After the immobilization procedure, the electrodes were rinsed

with 0.02 M PB, pH 8.0. After drying (2–4 min), 5 ȝl of a 1%neutral Nafion

solution were dropped on the sensor surface. The Nafion membrane was

allowed to dry for 20–25 min at +4°C. Phenazine methosulfate was used as

a free-diffusing redox mediator for cells-based biosensors. 10 ml of a 1 mM

solution of the mediator in 20 mM PB, pH 8.2 was added to the electrolyte

solution. In these experiments, the glass cell was wrapped with aluminium

foil as phenazine methosulfate is light sensitive.

2.6.6. Amperometric measurements

Amperometric measurements were carried out using an Autolab PGstat12

potentiostat (Eco Chemie, Utrecht, Holland) controlled by the GPES4.9

software. Amperometric experiments were performed in steady-state mode

using a standard cell with 10 ml volume at 25°C under continuous stirring.

After 20 min of the background current stabilizing, the experiments were

started by addition of the sample aliquots. In the course of the experiments,

318

FORMALDEHYDE ASSAY

the modified electrodes were stored in 20 mM PB, pH 8.0 at 4°C. All

measurements were repeated at least 3 times.

2.7.

CONSTRUCTION OF FDDH-BASED POTENTIOMETRIC BIOSENSORS

2.7.1. Insulating/semiconductor (IS) structures preparation

A pH-sensitive insulator–semiconductor (IS) transducer (Si/SiO

/Si

)

made in the Institute of Microtechnology of University of Neuchatel

(Switzerland) was used. The studied Si/SiO

/Si

structures were based on

a p-type silicon substrate, 400 Pm thickness, with 10 Ohm/cm resistance,

covered with a 50 nm layer of thermally grown silicon dioxide and a 100

nm layer of silicon nitride prepared using a low pressure chemical vapour

deposition (LPCVD) technique at 750°C. The Ohmic contact was obtained

using deposition of indium/gallium alloy on the silicon unpolished face. In

our work, we have used the Si/SiO

/Si

structures as physical transducers

due to their good stability and low hysteresis properties.

Substrates were treated in a sulfochromic mixture and rinsing with ultra-

pure water to increase the number of free active sites on the surface of Si

(silanol and silylamine sites). After the cleaning process, the substrate was

placed at room atmosphere at 70°C during 10 min to remove water.

2.7.2. Transducer functionalization

20 ȝl of the mixture containing 5 mM PB, pH 7.25; 50 mg/ml serum

bovine albumin, 0.1 M NAD

(neutralized), 20 mM reduced glutathione

(neutralized), and 36 U/ml of recombinant FdDH was dropped on the

surface of the structure Si/SiO

/Si

(1cm

) and spinned (v = 2300 rpm )

for 5 min. The sample was treated in glutaraldehyde vapours during 20

min, dried in air during 20 min and, finally, covered with 1% Nafion

(neutralized). After 20 min of drying, the bio-functionalised structure was

washed several times with 5 mM PB, pH 7.25 and stored in this buffer at

4°C before using.

2.7.3. Capacitance measurements

To examine the response of the FdDH-based biosensor, capacitance

measurements were performed in a three-electrode electrochemical cell

(Pt-counter, Ag/AgCl electrode as reference and the bio-functionalized

Si/SiO

/Si

structure as a working electrode). The cell was connected

to impedance analyzer Voltalab 40 (Radiometer Analytical SA Villeurbane,

France). The capacitance–voltage measurements were carried out at DC

voltage was swept from í0.5 to 2 V and an AC voltage was superposed

319

G. GAYDA ET AL.

with a frequency of 10 KHz and a signal amplitude of 10 mV. All of these

experiments were performed in darkness at room temperature.

2.8.

STATISTICS

Statistic treatment of the data and the level of correlation between experi-

mental values have been calculated using computer program Origin 6.0 and

Microsoft Excel.

3. Results and Discussion

3.1.

YEAST ENGINEERING FOR OVERPRODUCING FORMALDEHYDE

DEHYDROGENASE (FDDH)

As already reported (Demkiv et al., 2005), the FLD1 gene from H. polymorpha

with its own promoter has been re-cloned into LEU2-containing plasmid

pYT1 devoid of the ARS to be used for multi-copy integration of the gene

into chromosomes of the recipient strain leu1-1 (Fig. 1). The transformation

by electroporation have been done by linear and cyclic forms of the

plasmid, and 50 clones among Leu

-transformants with a higher resistance

to formaldehyde have been selected and tested by their FdDH activity in

CE. The stable recombinant strain Tf 11-6 with the highest FdDH activity

up to 5.0 U/mg was chosen and characterized (Demkiv et al., 2005).

Figure 1. The structure of plasmids as the vectors in construction of H. polymorpha FdDH

over-producers.

320

FORMALDEHYDE ASSAY

Similar experiments were carried out using strain leu 2-2 as a recipient

for the transformation by FLD1-containing plasmid pYT1. Different met-

hods for the transformation were used (see 2.1) to select new integrative

clones by the phenotypes of enhanced resistance to FA and increased FdDH

synthesis. All selected strains (approximately 80), isolated by LiCl-method,

had the highest resistance to FA (up to 15 mM on a methanol medium) and

two clones, Tf 22-142 and Tf 22-126, were resistant up to 20 mM FA (on

plates). The tested integrants grew better and were more resistant to eleva-

ted FA content in the growth medium in comparison with the recipient

strains both on the plates (in solid) and in the liquid medium. The selected

strains were considered to be not only a good source for FdDH production,

but also the perspective organisms for the environmental bioremediation

technologies.

3.2.

OPTIMIZATION OF CULTIVATION CONDITIONS

FOR FDDH-OVERPRODUCING STRAINS

To optimize the cultivation conditions for the highest enzyme yield, the

influence of a growth medium composition on FdDH level for two the best

strains, Tf 11-6 and Tf 22-142, was investigated (Fig. 2). As shown in Fig.

2A, FdDH activity in CE was dependent on a carbon source. The only

cultivation on 1% methanol provided a considerable level of the enzyme

synthesis for the tested strains, both recipient cells and their transformants.

Addition of FA to methanol medium additionally stimulated synthesis of

FdDH. As shown in Fig. 2B, FdDH specific activities in CE of Ɍf 11-6 and

Ɍf 22-142, cultivated on the methanol medium supplemented by 10 ɦɆ FA,

were found to be 7.0 and 8.5 U/mg, respectively, that is more than twice

higher compared to the activity of FdDH of the cells cultivated without

addition of FA.

3.3.

FDDH PURIFICATION AND CHARACTERIZATION

For enzyme isolation (Demkiv, 2007a), cells of the recombinant over-

producer strain Tf 11-6, cultivated in 1% methanol medium in the presence

of 5 mM FA, were used. Some physico-chemical characteristics of the

purified FdDH are shown in Figure 3. The molecular mass of FdDH

subunit, estimated by SDS-electrophoresis, was shown to be about 40 kDa

(Fig. 3A), that is the same found for C. boidinii – 41 kDa (Melissis et al.,

2001). In Fig. 3B the evalution of pH-optimum and pH-stability of the

enzyme (incubation in the appropriate buffer at room temperature during 60

min) is presented. pH-optimum was found to be in the range of 7.5–8.5, and

the highest stability of FdDH was observed at pH 7.0–8.5.

321

G. GAYDA ET AL.

Figure 2. FdDH activity in CE of the recipient and recombinant strains cultivated in different

media. A. Vizualization of FdDH activity in 8% PAAG after native electrophoresis of CE.

Carbon sources in a growth medium: 1% ethanol (EtOH), 1% methanol (MeOH) or 1%

glucose (Glc). Each CE sample contained 0.1 mg protein: a) 1 – leu1-1 (0.01 U for EtOH

and Glc, 0.15 U for MeOH); 2 – Tf 11-6 (0.12 U for EtOH, 0.35 U for MeOH, and 0.10 U

for Glc); b) 1 – leu2-2 (0.01 U for Glc, 0,07 for EtOH and 0.15 U for MeOH); 2 – Tf 22-142

(0.12 U for EtOH, 0.40 U for MeOH, and 0.11 U for Glc); K – 0.01 mg of purified FdDH

preparation (0.17 U). B. FdDH activity in CE of cells cultivated in a medium containing 1%

methanol and different concentrations of FA, mM.

322

Optimal temperature for the enzyme activity is 50°C, at 65°C enzyme

retained about 60% of its highest activit y, that is equal to the level of FdDH

activity at 30°C (Fig. 3C). The thermostability of the enzyme (Fig. 3C) is

FORMALDEHYDE ASSAY

A B

Figure 3. Some characteristics of the purified FdDH preparation (17 U/mg). A. Estimation of

M.m. of the enzyme subunit (kDa) in 5–20% SDS-PAAG: 1 – protein standards; 2–5 Pg

FdDH. B. pH-optimum (1) and pH-stability (2) of enzyme preparation. (2) FdDH was incu

bated at different buffers (for pH 5.25–8.0 – in 50 mM PB, pH 9.2–10.0 – in 50 mM borate

buffer) during 60 min and then tested for a residual activity at standard assay conditions. C.

Temperature optimum (1) and thermostability (2) of FdDH. (1) – Before FdDH adding,

reaction mixture was pre-incubated for 10 min at a fixed temperature (23°C, 30°C, 35°C,

40°C, …70°C); then FdDH was added and its activity was determined in thermostated

cuvette at the same temperature for at least 5 min; (2) – FdDH solution in PB, pH 8.0 was

heated during 10 min at fixed temperature (23°C, 30°C, 35°C, 40°C, …70°C), cooled and

tested for a residual activity at standard assay conditions (25°C).

apparently high allowing the usage of FdDH for bioanalitical purposes,

323

namely, for FA assay in food products, waste-water, and pharmaceuticals,

as well as for biotransformation of FA to formic acid.

G. GAYDA ET AL.

It was reported that the predicted FLD1 gene product (Fld1p) is a

protein of 380 amino acids, 41 kDa (Baerends et al., 2002). Taking into

account that the molecular weights of native FdDH from various methanol-

utilizing yeasts were estimated to be from 80 to 85 kDa (Table 1), the

isolated by us thermostable NAD

- and glutathione-dependent FdDH from

the gene-engenered thermotolerant methylotrophic yeast H. polymorpha is

supposed to be dimeric. As shown in Table 1, values of the Michaelis-

Menten constant (K

) for FA and NAD

calculated for this enzyme are

close to K

for the wild-type enzyme.

TABLE 1. Some characteristics of the purified FdDH from the different yeasts.

Ɇ.m, kDa K

, mɆ

Strains

enzyme

subunit

GSH

NAD

Reference

Candida boidinii 80 40 0.25-0.29 0.13 0.025–0.09

Schutte,

1976;

Pichia pastɨris 84 39 0.43 0.48 0.24

Allais,

1983

H. polymorpha,

wild type strain

82 40.6 0.21 0.18 0.15

Dijken,

1976;

. polymorpha,

ecombinant strain

40 0.18 0.21

This

paper

3.4. APPLICATION OF FDDH FOR ENZYMATIC ASSAY OF FA

FdDH preparation isolated from the recombinant strain of the yeast H.

polymorpha with the specific activity 17.0 units per mg

of protein at 25°C

(about 27 U·mg

–1

at 37°C, see Fig. 3C) was proposed to be used for the

enzymatic assay of FA. In methylotrophic yeasts, NAD

- and glutathione-

dependent FdDH catalyzes the oxidation of FA to formic acid under simul-

taneous reduction of NAD

to NADH. The proposed enzymatic method is

based on the photometric detection of colored product, formazan, formed

from nitrotetrazolium blue in reaction coupled with FdDH-catalyzed oxi-

dation of FA in the presence of an artificial mediator, PMS (Demkiv

et al., 2007a).

The assay was performed in a mode of incomplete conversion of the

analyte (approximately, 10%), using a limited concentration of the enzyme

(23 mU/ml) in the reagent. These conditions are economic and reasonable,

324

FORMALDEHYDE ASSAY

because of a high content of FA in the tested samples. At conditions of

complete oxidation of FA (excess of the enzyme), sensitivity of assay was

determined to be 2.5 ȝM (in final reaction mixture) or 20 ȝM – in the tested

samples. The reliability of the developed method “Formatest” was tested on

the real waste-water samples containing FA. As shown in Table 2, the

comparison of FA content values obtained by FdDH-based method and by

two routinely used chemical ones (chromotropic acid and MBTH), showed

a good correlation between both approaches. Only in some cases (samples

DK5 and DK7) with a lower FA content, the difference between the com-

pared methods is higher than 15%–41% and 26%, respectively. A rela-

tively high difference is also observed between two chemical methods for

the mentioned above samples –37% and 21%. This can be explained by a

higher error in measurement of low optical density values obtained for

samples with a low FA content. On the other hand, it is worth to emphasize

that the used chemical approaches are not free from possible mistakes due

to interfering effects of the co-impurities, usually present in the real sam-

ples, for example, phenol which is an attendant pollutant of FA-containing

wastes (Polska Norma PN-71 C-04568, 1988).

Thus, we can conclude that analytical data obtained by FdDH-based

method are more reliable than chemical ones. Due to this very important

analytical feature of the enzymatic method, it can be recommended for

practical application instead of chemical ones which are labour- and time

TABLE 2. Comparison of different methods for FA assay (mg/L) in real samples of waste-

water (DK), pharmaceutical (Formidron), disinfectant (Descoton forte) and industrial pro-

duct (formalin)

Chemical methods Enzymatic methods

Samples

Chromotropic acid ɆȼɌɇ «Formatest» «Alcotest»

DK 1 9.3 ± 0.61 9.56 ± 0.51 7.89 ± 0.59 9.6 ± 0.45

DK2 8.7 ± 0.50 8.06 ± 0.32 6.66 ± 0.26 8.12 ± 0.2

DK3 7.2 ± 0.33 7.84 ± 0.36 6.88 ± 0.41 8.00 ± 0.44

DK4 7.1 ± 0.36 6.3 ± 0.46 7.58 ± 0.32 6.86 ± 0.3

DK5 1.65 ± 0.35 1.2 ± 0.15 2.32 ± 0.08 1.97 ± 0.12

DK6 4.64 ± 0.24 4.99 ± 0.059 5.73 ± 0.32 5.60 ± 0.28

DK7 1.62 ± 0.17 1.96 ± 0.20 2.47 ± 0.15 2.19 ± 0.20

Formidron 107.70 ± 12.2 107.1 ± 8.3 96.60 ± 7.31 97.5 ± 9.3

Descoton forte 44.4 ± 7.82 49.22 ± 1.83 42.05 ± 4.02 45.93 ± 3.36

Formalin 420 ± 24 378 ± 21 405 ± 21 –

325

G. GAYDA ET AL.

consuming: need distillation of the samples or performing standard addition

test (in the case of phenol contamination).

3.5.

CONSTRUCTION OF FA-SELECTIVE BIOSENSORS

3.5.1. FdDH-based capacitance biosensor

FdDH was tested as a FA-recognising element coupled with semiconductor-

based structure Si/SiO

/Si

as a transducer (Ben Ali et al., 2007). The

bio-recognition element had a bi-layer architecture and consisted of FdDH,

cross-linked with albumin, and two cofactors (NAD and glutathione) in the

high concentrations (first layer); the second layer was a negatively charged

Nafion membrane which prevented a leakage of negatively charged co-

factors from the bio-membrane. Changes in capacitance properties of the bio-

recognition membrane were used for monitoring FA concentration in a bulk

solution. It has been shown that FA can be detected within a concentration

range from 10 PM to 25 mM with a detection limit of 10 PM (Fig. 4).

Figure 4. Response of bio-functionalized Si/SiO2/Si3N4 structure for formaldehyde (in

logarithms of the molar concentration) in the tested solution.

3.5.2. FdDH- and cells-based amperometric biosensors

In the physiological electron-transfer pathway, the electrons are transferred

from FA via intermediate hydroxymethylglutathione to the active centre of

FdDH under simultaneous reduction of NAD

to NADH. For the design of

an electron-transfer pathway for the immobilised FdDH as a bioselective

element of the sensor, the enzymatically generated NADH has to be reoxidised

additionally at the electrode surface using a suitable redox mediator (Fig. 5).

326

FORMALDEHYDE ASSAY

The recombinant yeast cells H. polymorpha and FdDH isolated from these

cells were used as biorecognition elements of amperometric biosensors. Elec-

tron transfer between the immobilized bioelement and graphite electrode was

established using different mediators. The best mediators for enzyme biosensor

were shown to be positively charged cathodic electrodeposition paints modified

with Os-bis-N,N-(2,2’-bipyridil)-dichloride ([Os(bpy)

]) complexes. Among

five tested Os-containing redox polymers of different chemical structure

and properties, complex 1CPOs of osmium-modified poly(4-vinylpyridine)

with molecular mass 60 kDa containing diaminopropyl groups was selected

as optimal. Polymer layer simultaneously served as a matrix for keeping

the negative charged low-molecular cofactors, glutathione and NAD

, in the

bioactive layer. For cells-based biosensors phenazine methosulfate (free-

diffusing redox mediator) exhibited the best electron transfer characteristics.

Figure 5. Schematic representation of the electron pathway for the FdDH-based ampero-

metric biosensor for FA detection (A) and the scheme of intracellular red-ox reactions coupled

with electrochemical oxidation of the mediator PMS for cells-based sensor (B).

For construction of the envisaged FA biosensor we proposed a sop-

histicated sensor architecture aiming on the secure fixation of all sensor

components in a bioactive layer on the transducer surface. Especially, the

sensor architecture was designed to prevent any leakage of the low-molecular

and free-diffusing cofactors of the enzyme thus enabling FA determination

without addition of the cofactors to the analyte solution (Fig. 6). In the opti-

mized biosensor’s construction, platinised graphite electrode was used as a

transducer and [Os(Me

bpy)

]-modified positively charged cathodic

paint 1CPOs was found to be the best redox mediator, as well as a good

matrix for enzyme or cells electrodeposition and for holding enzyme’s co-

factors, glutathione and NAD, in a bioactive layer. Covering of the biolayer

327

G. GAYDA ET AL.

Figure 6. Architecture of FdDH- (Ⱥ) and cells-based (ȼ) amperometric biosensors.

by a negatively charged Nafion membrane additionally prevents the co-

factors from a leakage, as well as contributes to the enhanced stability of the

sensor.

Bioanalytical characteristics of the constructed biosensors (Table 3) were

studied in detail: kinetics, dynamic and linear range, selectivity, dependence

of sensors output on temperature. For enzyme-based biosensor the maxi-

mum current value was 250 ± 5.25 µA and the apparent Michaelis-Menten

constant (K

app

) derived from the FA calibration curves was 120 ± 5.3 mM

with a linear detection range for FA up to 20 mM. For cells-based bio-

sensor, the maximum current value was 1.07 ± 0.04 µA and the apparent

Michaelis-Menten constant (K

app

) derived from the FA calibration curves

was 20.1 ± 1 mM with a linear detection range for FA up to 8 mM. The

328

FORMALDEHYDE ASSAY

thermostability of the used enzyme and thermotolerance of recombinant yeast

cells. The bioanalytical properties of the developed biosensors were evalu-

ated specifically aiming at an improved long-term operational stability of

the sensor. A novel biosensor demonstrated a good sensitivity, high selec-

tivity to FA, and a good stability. A typical response of the developed

1CPOs-NAD

-FdDH-modified electrode towards FA and the linear range are

shown in Fig. 7.

Another amperometric biosensor developed by us in a cooperation with

scientific group headed by Prof. E. Czöregi (University of Lund, Sweden)

was a bi-layer bi-enzyme sensor based on diaphorase and FdDH together

with [Os(4,4’-dimethylbipyridine)

Cl]

+/2+

(PVP-Os). The sensorarchitecture

comprised a first layer containing diaphorase from Bacillus stearothermophilu

cross-linked with the PVP-Os redox polymer. On the top, a second layer

was formed by additional cross-linking of FdDH with poly(ethylene glycol)

(400)diglycidyl ether. The sensor architecture was optimised with respect

to efficient electron transfer and stability of the enzyme(s). Bioanalytical

basic characteristics of the biosensor, polarized at +180 mV vs. NHE, are

presented in Table 3.

TABLE 3. Bioanalytical characteristics of developed biosensors (FdDH-based and recom-

binant cells-based)

FdDH-based biosensor

Characteristics

Mono-

enzyme

Bi-enzyme

(+diaphorase)

Mono-

enzyme

Cells-based

biosensor

Type of signal

detection

Amperometric Capacitance Amperometr

Detection limit, mM 0.003 0.032 0.01 0.11

Linear range, mM up to 20.0 0.05–0.5 0.01–25 up to 8.0

max,

ȝA 250±5.25 0.18 – 1.07 ± 0.03

Sensitivity

358

A· m

–2

·M

–1

A· m

–2

·M

–1

31 mV/de-

cade

5.1

A· m

–2

·M

–1

Reference

Demkiv et al.,

2007b

Nikitina et al.,

2007

Ben Ali

et al., 2007

Paryzhak

et al., 2007

329

optimal pH-value for the developed biosensors was in the range of 7.6

to 8.3 with an optimal temperature between 45–50°C, due to a higher

G. GAYDA ET AL.

Figure 7. Chronoamperometric determination of FA, using a 1CPOs-NAD+-FdDH-GSH-

Nafion -based biosensor (A) and Cells-Tf11-6-NAD+-GSH-Nafion-modified graphite

electrode (B) and linear concentration range for biosensors.

330

FORMALDEHYDE ASSAY

3.6. APPLICATION OF AMPERMETRIC BIOSENSORS

FOR FA-MONITORING IN REAL SAMPLES

The constructed amperometric biosensors revealed a high selectivity to FA

(100%) and a very low cross-sensitivity to other structurally similar sub-

stances: butyraldehyde (0,93%), propionaldehyde (1,89%), acetaldehyde

(5,1%), methylglyoxal (9,12%) (Paryzhak et al., 2007). These sensors were

applied for FA testing in some industrial goods: Formidron, Descoton forte,

formalin and rabbit vaccine against viral hemorrhage. A good correlation

was observed between the data of FA testing (Table 4) by the biosenor’s

approaches (FdDH and cells-based), proposed enzymatic method Formatest

and standard chemical methods.

TABLE 4. FA content in real samples determined by different methods: chemical (MBTH,

Chromotropic acid), enzymatic (FdDH-based) “Formatest”, and biosensor approaches (FdDH-

based and recombinant cells-based sensors)

FA molar (mole/L) concentration, Ɇ±m

Chemical methods FdDH-based methods

Sample/

Method

acid biosensor

Formidron 1.64 ± 0.61 1.48 ± 0.26 1.53 ± 0.31 1.57 ± 0.13

1.48 ±

0.06

Descoton

forte

3.57 ± 0.30 3.59 ± 0.44 3.25 ± 0.8 3.61 ± 0.13

3.29 ±

0.12

Formalin 12.6 ± 0.73 14.0 ± 0.81 13.5 ± 0.7 13.6 ± 0.6

13.82 ±

0.54

Rabbit

vaccine

against viral

hemorrhage

0.038 ± 0.003 0.029 ± 0.005 0.042 ± 0.004

0.041 ±

0.005

0.042 ±

0.002

4. Acknowledgements

This work was financially supported by the projects: INTAS OPEN CALL

03-51-6278, NATO LINKAGE GRANTS LST.NUKR.CLG 980621 and

PDD(CP)-(CPP.NUKR.CLC, 982955), NAS of Ukraine in the framework

of the Program “Sensors’ Systems for Medico-Ecological, Industrial and

Technological Purposes” and WUBMRC.

331

ɆȼɌɇ Chromotropic Formatest FdDH- Cells-

biosensor

G. GAYDA ET AL.

References

Allais, J.J., Louktibi, A., and Baratti, J., 1983, Oxidation of methanol by the yeast, Pichia

pastoris, purification and properties of the formaldehyde dehydrohenase, Agric. Biol.

Chem. 47 (7): 1509–1516.

Baerends, R.J.S., Sulter, G.J., Jeffries, T.W., Cregg, J.M., and Veenhuis, M., 2002,

Molecular characterization of the Hansenula polymorpha FLD1 gene encoding formal-

dehyde dehydrogenase, Yeast 19: 37–42.

Ben Ali, M., Korpan, Y., Gonchar, M., El’skaya, A., Maaref, M.A., Jaffrezic-Renault, N.,

and Martelet, C., 2006, Formaldehyde assay by capacitance versus voltage and impe-

dance measurements using be-layer bio-recognition membrane. Biosens. Bioelectron. 22:

575–581.

Ben Ali, M., Gonchar, M., Gayda, G., Paryzhak, S., Maaref, M.A., Jaffrezic-Renault, N,. and

Korpan, Y., 2007, Formaldehyde-sensitive sensor based on recombinant formaldehyde

dehydrogenase using capacitance versus voltage measurements, Biosens. Bioelectron. 22

(12): 2790–2795.

Delorme, E., 1989, Transformation of Saccharomyces cerevisiae by electroporation, Appl.

Environ. Microbiol. 55 (9): 2242–2246.

Demkiv, O.M., Paryzhak, S.Ya., Krasovs’ka, ȿ.S., Stasyk, Ɉ.V., Gayda, G.Z., Sibirny, A.A.,

and Gonchar, Ɇ.V., 2005, Construction of methylotrophic yeast Hansenula polymorpha

strains overproducing formaldehyde dehydrogenase, Biopolymers and cell. 21(6): 525–

530 (in Ukrainian).

Demkiv, O., Paryzhak, S., Gayda, G., Sibirny V., and Gonchar M.V., 2007a, Formaldehyde

dehydrogenase from the recombinant yeast Hansenula polymorpha: ɿsolation and

bioanalytic application, FEMS Yeast Research. 7: 1153–1159.

Demkiv, O., Vus, B., and Gonchar, M., 2007b, Amperometric biosensors for formaldehyde

assay, Proceedings of Scientific Society Named after Shevchenko. 19: 216–224

Dijken, van, J.P., Oostra-Demkes, G.J., Otto,

R., and Harder, W., 1976, S-Formylglutathione:

the substrate for formate dehydrogenase in methanol-utilizing yeasts, Arch Microbiol.

111(1–2):77–83.

Ellenhorn, M.J., and Barceloux, D.G., 1988, Medical Toxicology - Diagnosis and Treatment

of Human Poisoning. New York, NY: Elsevier Science Publishing Co., Inc., pp. 1002.

Feron, V.J., Til, H.P., De Vrijer, F., Woutersen, R.A., Cassee, F.R., and Van Bladeren, P.J.,

1991, Aldehydes: occurrence, carcinogenic potential, mechanism of action and risk assess-

ment, Mutat. Res. 259: 363–385.

Geier, D.A., and Geier, M.R., 2004, Neurodevelopmental disorders following thimerosal-

containing childhood immunizations: a follow-up analysis, Int. J. Toxicol. 23: 369–376.

Gerberich, H.R., and Seaman G.C., 1994, Encyclopedia of Chemical Technology. 4

edit.

New York: John Wiley & Sons.11, pp. 929– 951.

Gonchar,

Ɇ.V., Grabek, D., Ɉklejewich, B., Pavlishko, H.Ɇ., Shamlian, Ɉ.V., Sybirny, V.Ⱥ.,

Kotylak, Z., Rudke, K., Rudke K., Csoregi, E., and Sibirny, A.A., 2005, A new enzymo-

chemical method for simultaneous assay of methanol and formaldehyde, Ukr. Biochem.

J. 77 (3):146–154.

Hinnen, A., Hicks, J.B. and Fink, G.R., 1978, Transformation of yeast, PNAS. 75: 1929–

1933.

Ho, M.H., and Richards, R.A., 1990, Enzymatic method for the determination of formalde-

hyde, Environ. Sci. Technol. 24: 201–204.

Ito, H., Fukuda, Y., Murata, K., and Kimura, A., 1983, Transformation of intact yeast cells

treated with alkali cations, J. Bacteriol. 153(1): 163–168.

332

FORMALDEHYDE ASSAY

Lee, B., Yurimoto, H., Sakai, Y., and Kato, N., 2002, Physiological role of the glutathione-

dependent formaldehyde dehydrogenase in the methylotrophic yeast Candida boidinii,

Microbiology.

148( 9): 2697–2704.

Liteplo, R.G., Beauchamp, R., Meek, M.E., and Chenier, R., 2002, Formaldehyde, Geneva.

www. Formaldehyde. org/who.pdf .

Maidan, M.M., Gonchar, Ɇ.V., and Sibirny, A.A., 1997, Oxidation of exogenious formaldehyde

in cells of methylotrophic and nonmethylotrophic yeast, Biochemistry. 62 (6): 744–749

(in Russian).

Melissis, S.C., Rigden, D.J., Clonisa, Y.D., 2001, New family of glutathionyl-biomimetic

ligands for affinity chromatography of glutathione-recognising enzymes, J. of Chroma-

National Research Council, Formaldehyde and Other Aldehydes pp. 2–1 to 5–96 USEPA

600/6–82–002 (1982).

Ngounou, B., Neugebauer, S., Frodl, A.., Reiter, S., and Schuhmann, W., 2004, Combi-

natorial synthesis of a library of acrylic acid-based polymers and their evaluation as

immobilisation matrix for amperometric biosensors, Electrochim. Acta. 49: 3855–3863.

Nikitina, O., Shleev, S., Gayda, G., Demkiv, O., Gonchar, M., Gorton, L., Csöregi, E.,

Nistor, M., 2007, Bi-enzyme biosensor based on NAD

- and glutathione-dependent re-

combinant formaldehyde dehydrogenase and diaphorase for formaldehyde assay, Sensors

and Actuators B. 125:1–9.

Offit, P., and Jew, R., 2007, Addressing parents’ concerns: do vaccines contain harmful

preservatives, adjuvants, additives, or residuals, Pediatrics. 112(6): 1394–1401.

Paryzhak, S., Demkiv, O., Gayda, G., Sibirny, V., Schuhmann, W., and Gonchar, M., 2007,

Enzyme- and cells-based biosensors for assay of formaldehyde in vaccines, Proc. 2nd

Polish-Ukrainian Weigl Conference “Microbiology in the XXI century” (Warsow, 24–26

September, 2007). pp. 170–173.

Patent ʋ 1213358 EP, Publ. 12.06.2002. K. Takahide, S. Atsushi, H. Shizuo et al. (JP).

Method and kit for the determination of a biological component.

Pavlishko, H.M, Honchar, T.M., and Gonchar, M.V., 2003, Chemical and enzymatic assay

of formaldehyde content in fish food, Experiment. ɋlin. Physiol Biochem. 4:56–63 (in

Ukrainian).

Polska Norma PN-71 C-04568., 1988 Water and Waste Water. Determination of methyl

alcohol content. Ed. 5 (Polish Com. Standard. eds.).

Rehbein, H., 1995, Formaldehyd und Dimethylamin in tiefgekühlten Fischerzeugnissen aus

dem Handel - eine Bestandsaufnahme, Archiv Lebensmittelhyg. 46: 122–124.

Sawicki, E., Hauser, T.R., Stanley, T.W., and Elbert, W., 1961, The 3-methyl-2-benzothiazolinone

hydrazone test. Sensitive new methods for the detection, rapid estimation, and

determination of aliphatic aldehydes, Anal. Chem. 33: 93–96.

Schechter, D.S., and Singer, P.C., 1995, Formation of aldehydes during ozonation, Ozone

Sci. Eng. 17: 53–55.

Schutte, H., Flossorf, J., Sahm, H., and Kula, M.R., 1976, Purification and properties of

formaldehyde dehydrogenase and formate dehydrogenase from Candida boidinii, Eur. J.

Biochem. 62(1): 151–160.

Sigma-Aldrich Catalogue, 2007, www.sigma-aldrich.com.

Smutok, O., Ngounou, B., Pavlishko, H., Gayda, G., Gonchar, M., and Schuhmann W., 2006,

A reagentless bienzyme amperometric biosensor based on alcohol oxidase/peroxidase

and an Os-complex modified electrodeposition paint. Sensors and Actuators B: Chemical.

113: 590–598.

333

tography A. 917: 29–42.

V. Evangelista et al. (eds.), Algal Toxins: Nature, Occurrence, Effect and Detection.

ELECTROCHEMICAL SENSING METHODS: A BRIEF REVIEW

ANDREA SCOZZARI*

CNR Institute of Geoscience and Earth Resources, Via

Moruzzi 1, 56124, Pisa, Italy

study chemical and biological systems. This chapter gives an overview of

the most common electrochemical sensing techniques, their basic working

principles and their typical configurations, paying a brief look to some more

recent developments. Due to the huge extension of the subject and to the very

large amount of the possible applications, what is given here is a synthesized

review of the most general families of methods regarding aqueous solutions,

together with a few particular application examples. In the most recent deve-

lopments, the combination of electroanalytical techniques with different

sensing methods, and the usage of signal processing techniques for pattern

recognition applied to the electroanalytical data series, emerged in the scien-

tific literature, as pointed out in the text.

1. General Concepts About Electrochemical Techniques

Electrochemical methods are probably among the oldest measurement tech-

niques, and are also comprising a very wide range of analytical possibilities,

enhanced by the recent technological developments in signal processing and

front-end electronic systems.

Electrochemistry implies the transfer of charge between an electrode

and a liquid or solid phase. Both the electrode reactions at the interface and

the electrical conduction in the bulk solution participate to this process.

______

*To whom correspondence should be addressed. Andrea Scozzari, CNR Institute of Geoscience and

Earth Resources, Via Moruzzi 1, 56124, Pisa, Italy. Email: a.scozzari@igg.cnr.it.

335

Abstract: Electroanalytical methods are often seen as an effective tool to

Keywords: Electrochemistry, liquid, characterization, water monitoring

A. SCOZZARI

In the absence of convection, the transfer of charge carriers may be due

to a concentration gradient of electroactive species (diffusion current) or to

the presence of an electric field (migration current). Mass transport by mig-

ration is what mostly happens in the bulk solution and is generally responsible

for its electrical conductivity.

The diverse kinds of electrochemical sensors can be split into the fol-

lowing main classes:

x potentiometric, implying a pure voltage measurement;

x amperometric, where current in a closed loop involving two electrodes

is the measured variable;

x conductimetric, where the conductance of an electrochemical cell is de-

termined.

1.1. ELECTROCHEMICAL CELLS

Most of the applications can be reduced to a two-electrodes or a three-ele-

ctrodes cell scheme, as shown in Figure 1. A signal source (generator) is

connected between a pair of electrodes and, in the most generic approach,

both a current and a voltage measurement are performed.

In a two-electrodes arrangement (Figure 1a) a Working Electrode (WE)

is coupled with a non-polarizable Reference (REF); a difference of elec-

trical potential is measured between the WE and the well-defined potential

of the REF electrode.

Amperometric measurements are performed by using an excitation

signal coming from a generator, and by measuring the resulting current in

the loop closed by the cell.

Potentiometric measurements are performed in zero-current conditions,

thus removing the generator and the current measurement device from the

scheme, and by measuring the voltage across WE and REF with a device

having a high input impedance, to minimize the contribution of the ohmic

potential drop to the total difference of potential.

In a three-electrodes arrangement (Figure 1b) the current loop comprises

a large auxiliary electrode (AUX), having a small charge-transfer resistance,

in order to overcome the said ohmic potential drop, due to the current flowing

through the cell. This configuration is very general, works also with solu-

tions having poor electrical conductivity, and is the one typically used in

laboratory instruments based on voltammetry.

Voltammetry is a group of electroanalytical methods in which infor-

mation about the analyte is derived from the measurement of a current

flowing through a polarized WE, with an imposed voltage between WE and

REF. That is, the WE potential (calculated with respect to REF) is forced

336

ELECTROCHEMICAL SENSING METHODS

to adhere to a predetermined program or waveshape, and the current i is

measured as a function of the applied potential, or as a function of time. The

electronic device that implements such concept is called potentiostat.

Figure 1. a) Two-electrodes cell configuration; b) Three-electrodes cell configuration.

1.1.1. Electrical equivalent cell models

The equivalent circuit of a cell is a schematic diagram, made with con-

centrated parameters elements, having an electrical behavior equivalent to

the one exhibited by the cell. The intrinsic non-linearity of such systems and

their complex behavior make the even most reliable model of the electro-

chemical mechanisms only partially applicable. In particular, the model

discussed here can be complicated by additional components, in order to

better fit a real behavior, leading to a larger network where also non-linear

components and frequency-dependent impedances may be present.

A passive equivalent circuit, made of resistors and capacitors, can be a

suitable electrical model for small amplitude sinusoidal excitation signals,

at a given frequency. According to the simplest approach almost universally

presented in the literature, the components that contribute to the total im-

pedance of the cell are:

x the solution resistance, R

x the double-layer capacitance, C

x the faradaic impedance, Z

The double-layer capacitance is due to the ionic charge accumulated on

the solution side of a polarized interface (electrode); an ideally non-polari-

zed interface would have a perfectly resistive behavior, instead.

The faradaic impedance Z

involves interfacial effects, and it is seen as

an electrical bypass to the double-layer capacitor; it is due to the electrolytic

Generator

REF

Generator

REF

AUX

337

A. SCOZZARI

reactions and it has a remarkably non-ideal behavior, characterized by a

strong dependency upon frequency.

The behavior of Z

as a function of frequency carries out meaningful

chemical information, that can be extracted with more or less direct methods.

Typical techniques for the measurement of the faradaic impedance vs. fre-

quency rely on ac voltammetry or polarography methods, where a relatively

small amplitude ac signal (generally a few mV peak) is superimposed to a

voltage ramp in a three-cell embodiment. An explanation of how the poten-

tiostat works in this configuration is given in paragraph 1.3.2.

In Figure 2 the equivalent circuit of an electrochemical cell, in the form

discussed here, is shown. The faradaic impedance is often reduced to a pure

resistance, the charge transfer resistance R

, which shorts the double layer

capacitor C

, as it is shown in Figure 3a. A capacitive element is often

added to the network, either in a series (R

, C

) or in a parallel (R

, C

)

configuration, as it is shown in figure 3b.

Figure 2. Equivalent circuit of an electrochemical cell.

Figure 3. a) Purely resistive faradaic impedance. b) Complex faradaic impedance (series and

parallel topology).

Again, while R

and C

have a basically linear and almost pure electrical

behavior,

is strongly dependent upon frequency. According to a wide

literature available, the faradaic impedance is related to the kinetic para-

meters of the electrode reactions. Z

can thus be seen as the combination of

a mass-transfer impedance and a contact resistance; its amplitude and phase

angle take information about the concentration of the electroactive species

338

ELECTROCHEMICAL SENSING METHODS

and the charge transfer resistance (Delahay and Reilley, 1954; Bard and

Faulkner, 1980, 2000).

1.2. POTENTIOMETRIC SENSORS

1.2.1. Working principle

Electrodes for potentiometry are based on the interface between two elec-

trolyte phases, which are put into contact. A non-polarized interface (selective

or not) exhibits an half-cell potential, that is related to the activities of the

species involved into the equilibrium of the electrochemical potentials. The

half-cell potential (or formal potential) is defined as the electrical potential

measured with respect to a standard hydrogen reference electrode (Bard and

Faulkner, 1980, 2000; Ives and Janz, 1961; Janata, 1989).

The electrochemical potential in a location P, can be defined as (Butler,

1926; Guggenheim, 1929; Guggenheim, 1930):

ii ii

RT a z F

DD D D

 

(1)

where:

is the charge of species i.

F is the Faraday’s constant,

is the electrical potential at the location P for phase Į,

is the standard chemical potential of the species i in phase Į,

a is the activity of the species i in phase Į.

Non-polarized interfaces reach equilibrium conditions that are governed

by activities of the ions; the difference in electrical potential, that makes the

electrochemical potential constant across the interface, depends on the said

activities as explained by the Nernst equation, put into the following form:



(2)

where:

is the interfacial potential difference,

is the standard interfacial potential difference, measurable with equal

activities in phase Į, ȕ,

a is the activity of the species i in phase ȕ.

339

A. SCOZZARI

The two phases Į, ȕ may represent the sample phase and the electrode

phase, according to the described approach. Thus,

is the voltage measur-

able across a semipermeable membrane between the sample and an unpolar-

ized reference. It is now clear how selective membranes, that respond in a

Nernstian fashion to specific electroactive species, can be the fundamental

building block of Ion-Selective Electrodes (ISE). In this context, ion acti-

vity can be measured with a two-electrodes configuration, where the WE

(often called indicator) is actually a reference electrode interfaced to the

sample via a specialized membrane and a reference solution in between,

having the analyte at a fixed activity.

1.2.2. Ion-selective electrodes

Ion-selective electrodes are based on an ion selective membrane that

interfaces an internal reference to the external environment (that is, the

sample). Glass membranes are probably the most commonly used; in fact,

they have been developed and used since the beginning of the 20

century,

especially for the measurement of pH. Other ion-selective membranes, both

solid-state and liquid, have been developed and are commercially available;

the usage of some particular kinds of membranes, such as lipid/polymer

ones and chalcogenide glasses, is still matter of research, especially for the

development of arrays of sensors.

When the ion selective membrane uses a glass/electrolyte interface, the

whole cell is configured in the following way:

Ag/AgCl/HCl (c)/Glass membrane/SAMPLE//Reference (3)

where:

/ denotes the interfaces,

// denotes the junctions,

c is the concentration of the reference solution.

The internal reference in this example is of the Ag/AgCl kind; the ex-

ternal reference electrode can be of the same kind, but not necessarily.

In the case of pH electrodes, the membrane essentially responds to H

ions, and is formed by a dry bulk and two thinner dry layers that come into

contact with the liquid phase. In the bulk structure only mobile cations pre-

sent in the glass, such as Na

or Li

, are substantially responsible for electrical

conduction. Deep explanations about the principles and construction of pH

electrodes can be found in the literature cited in the references (Bates, 1973;

Garrels , 1967).

In addition, there’s a wide availability of sources of information about

theory and construction of the ISEs, such as the book edited by H. Freiser

(1978).

340

ELECTROCHEMICAL SENSING METHODS

1.2.3. Semiconductor field-effect sensors

A typical issue in the usage of glass electrodes lies in their high output

impedance, that is, the need for the voltmeter device, placed between the ISE

and the REF electrode, to drain the smallest possible current from the mea-

surement loop. In fact, typical impedance values for commercial combined

pH electrodes (embedding their REF) are in the order of the hundreds of

MOhms.

The front-end electronic component typically used in the electrometers

for potentiometry is a kind of FET (Field-Effect Transistor) that may be

realized in different ways, according to the particular technology employed.

In general, the active building-blocks of the amplifier and buffer stage will

be one or more FETs, with insulated gates in bipolar or MOS technology;

such stage has to process the weak signal coming from the electrodes and

adapt its impedance level to the input of data acquisition and display devi-

ces, connected to the output of this buffer/amplifier stage.

The idea to embed an ion-sensitive capability into a FET device comes

from the early 70s, and has generated the first integrated chemical sensor.

CHEMFETs (CHEMically sensitive FETs) can be mainly split in two

categories:

x ISFETs, based on an ion-sensitive membrane on behalf of the metallized

gate of standard FETs,

x ENFETs, based on a chemically selective enzyme layer.

To avoid confusion, it must be clarified that some authors consider

ENFETs a mere kind of ISFETs, and do not use the term CHEMFET.

Figure 4. Structure of a CHEMFET/ISFET device. Electrical connections are shown.

The structure and a simplified schematic diagram for potentiometric

measurements performed by using an ISFET device are shown in Figure 4.

The V

REF

generator provides the right Gate voltage to polarize the FET for a

correct modulation of the channel in the desired working region. Channel

conductance is a function of the ion activity because of the electric field

generated by the charges accumulated on the membrane; thus the observable

P substrate

Encapsulation

Ion-sensitive membrane

REF

Solution under

measurement

REF

341

A. SCOZZARI

is the current i, which is also a function of the Drain-to-Source voltage (V

Among the various sources of information which are available, good expla-

nations abut the working principles of CHEMFETs can be found in the

book by Jiri Janata (1989).

1.3. VOLTAMMETRY

1.3.1. Working principle

The electrochemical behavior of a system can be determined by imposing

known varying potentials between WE and REF, and recording either the

current-voltage or the current-time curve, that is obtained in each experiment.

The saturation level of the current in the i-v curve, due to the mass-

transport limitation, carries information about the concentration and nature

of the electroactive depolarizing species involved in the process, that is,

those involved in the interfacial charge transfer across the double layer.

The different decomposition potentials, diffusion coefficients and mass-

transfer limits, that are exhibited by electroactive species in a solution, gene-

rate different contributions to the complex curve (voltammogram) obtained;

different kinds of voltammetry are classified according to the waveform of

the excitation signal.

In this framework, a known technique to get a complete electrochemical

signature of a system consists into applying a series of potential steps (actu-

ally rectangular pulses) having different amplitude, always recording the

current vs. time curve. But this represents just one of the possibilities.

There’s a wide range of possible implementations of measurement meth-

ods based on voltammetry, according to the type and material of the working

electrodes (i.e. solid metal microelectrodes, dropping mercury, planar rotating

disks, carbon electrodes, etc.), and according to the particular electrochemi-

cal experiment, which depends on the program imposed by the generator.

There’s a huge quantity of useful readings to get a deep knowledge about

polarographic methods and more recent applications of voltammetry; among

the many available, we can mention the excellent textbook by Bard and

Faulkner (Bard and Faulkner, 1980, 2000) and others cited in the references

(Janata, 1989; Bond, 1980; Macdonald, 1977).

Under the theoretical point of view, the difference of electrochemical

potential between two points (A,B) of a solution can arise because of:

x a difference in the concentration of electroactive species over the

distance A to B,

x an electric field with a non-zero component along the direction A-B.

342

ELECTROCHEMICAL SENSING METHODS

These two phenomena contribute to the mass transport by diffusion and

migration, respectively; the flux of charged species transported can be ex-

pressed in terms of current density.

For non convective mass transfer, in the proximity of an electrode, the

electroactive substance is transported by both the processes previously des-

cribed (migration and diffusion).

In this case, the general flux equation is given by:

()

jjj jj

Jx DC DC



     



(4)

where:

D is the diffusion coefficient of species j,

C is the local concentration of species j.

Stirred solutions, which are mostly used in practice, involve forced

convection. In this case, a model has been proposed (Bard and Faulkner,

1980, 2000), where it is assumed that convection maintains the concen-

trations of all the species uniform and equal to the bulk values, till a certain

distance G from the electrode. Within this layer having thickness G, it is

assumed that there’s no solution movement, thus mass transfer is thought to

be due by diffusion only.

1.3.2. The potentiostat

The basic component of the measurement system is called potentiostat. A

potentiostat is a device which injects current into the AUX electrode, closing

the current loop via the working electrode WE, in order to impose a known

difference of potential between WE and a reference electrode REF. Such

voltage has to be measured with a high impedance differential amplifier, to

make negligible the current going through REF.

The functional diagram of a potentiostat to make voltammetric measure-

ments with a three-electrodes cell is shown in Figure 5. The voltage imposed

across WE and REF is supposed to be determined by a function generator

placed at the input of the potentiostat; the excitation function corresponds to

the v

(t) signal indicated in the diagram. The experimental observable, that

is obtained by each measurement session, is the response of the system

potentiostat-cell to the excitation signal (voltage) imposed, that is, the loop

current i

(t). Under the hypothesis that all the current losses in the system

can be neglected, i

(t) is equal to the output current of the control amplifier (1).

The potential on the WE is tied to the analog ground by the I/V con-

verter (3); the differential electrometer (2) is connected to the negative input

343

A. SCOZZARI

of the control amplifier (1) and closes the feedback loop, which ensures that

the voltage difference between the reference electrode REF and the WE is

equal to the voltage set by the input signal v

(t). All this is true until both

the voltage assumed by the auxiliary electrode AUX and the current which

flows through it, lie in the output swing capability of (1).

Figure 5. Simplified block diagram of a potentiostat in a three-electrodes configuration.

Automatic measurements are often performed by controlling the poten-

tiostat with a Personal Computer and an adequate piece of software. Different

kinds of working electrodes have been presented in the literature and are

also commercially used, depending on the different measurement requirements,

and can also be automatically switched.

Fundamental parameters, such as the number and type of electrodes, the

shape of the excitation waveforms, and the duration and amplitude of such

waveforms can usually be changed, by configuring the measurement device

accordingly.

Many different measurement schemes can be obtained by combining

different excitation functions and data recording criteria; we can mention

here linear sweep chronoamperometry, where current is recorded as a func-

tion of time with a linear (ramp) excitation, and pulse polarography, where

a current-potential response is obtained, according to the varying amplitude

344

ELECTROCHEMICAL SENSING METHODS

of the potential steps applied. Even if the terms seem quite exchangeable in

the literature, according to a IUPAC recommendation, the term ‘polaro-

graphy’ should be used only with liquid renewed working electrodes, such

as the dropping mercury ones (DME).

Ramp signals and rectangular pulses may also have small amplitude

alternating signals superimposed; such small amplitude potential changes

give the possibility to work in a region where the current is dominated by

electrode kinetics, while large amplitude steps go directly to the mass-

transfer controlled region. Deep explanations of this family of methods can

be found in a rich literature available (Bard and Faulkner, 1980, 2000;

Janata, 1989; Bond, 1980; Macdonald, 1977), going outside the aim of this

chapter.

1.4. CONDUCTIMETRY

Conductance and impedance measurement techniques play a significant role

in the arena of electrochemical methods. The current flowing in a solution

under the influence of an electric field is due to the migration of ions;

individual ionic currents are proportional to the strength of such field, and

are determined by the balance between the frictional drag and the said

electric field, which bounds the terminal velocity of each ionic species, thus

its associated current density.

Conductance, which is the reciprocal of resistance, is generally defined

for a given volume, delimited by parallel current flow lines, as:

(5)

where:

ı is the electrical conductivity of the medium,

S is the cross-sectional area of two finite surfaces normal to the flow

lines,

L is the path length between the two said surfaces.

G is expressed in ȍ

–1

(or Siemens), while ı, which is an intrinsic property

of the solution, is expressed in ȍ

–1

The contribution of each ionic species in the solution to the total con-

ductivity is called transference number, and is defined in the following way:

jjj

iii

zCu

(6)

345

A. SCOZZARI

where:

i, j are the subscripts denoting the generic i, j ion species,

is the mobility of the generic i-th ion species,

is the concentration of the generic i-th ion species,

| is the normalized charge for the generic i-th ion species.

In most of the applications, the conductivity of a solution is measured in

a two-electrodes cell configuration, with two identical metal electrodes;

conductance is usually measured between the two terminals, either by mea-

suring the current flowing at a known imposed voltage, or by measuring the

potential drop at a known injected current, finally, various versions of

bridge configurations have been seen in the literature.

In order to avoid the effects of polarization and of faradaic processes on

the measurement (represented in the model by the double-layer capacitor

and the faradaic impedance), periodic and alternating excitation signals are

generally chosen. Both pure sinusoidal signals and rectangular pulses have

been proposed in the literature, with different approaches as to sampling,

rectification and filtering of such signals; even other waveshapes have been

experimented, such as triangular ones (Luce, 1986).

Typical probes for measuring the conductivity of a solution are made by

two facing Pt plates, coated with a colloidal deposit of “platinum black”,

confined into an electrically isolated environment in order to bound the cell

volume precisely. The advantage of platinum black lies in its large effective

wet surface with respect to its actual geometry, thus limiting the effects of

adsorption due to fast electrode reactions that may happen during each half-

cycle of the excitation signal.

Other materials, such as titanium cladded with platinum, have been pro-

posed (Iwamoto, 1993); also, graphite electrodes are available on the market

and carbon-filled polymers are proposed for conductivity measurements in

microdevices(Baldock et al., 2003).

There are alternatives to the two-electrodes approach used in practice,

such as a four-electrodes configuration, where current is injected through a

pair of electrodes and voltage is measured across the other two electrodes

with an high input impedance device, being substantially prevented from

interfacial effects due to the transit of current. In addition, non-contact

inductive sensors are sometimes used in the industry, but their description

goes beyond the scope of this chapter.

346

ELECTROCHEMICAL SENSING METHODS

2. Recent Developments and Applications

2.1. IMPEDANCE MEASUREMENTS

The measurement of a purely dissipative (real) impedance parameter of a

fluid, such as the conductivity, represents a limited source of information

with respect to its complete behavior as a function of frequency. In fact,

depending on the frequency content of the excitation signal used, the elec-

trical behavior of the circuit under measurement (the cell) changes in a way

that makes a purely resistive model unsatisfactory.

When dealing with conductivity measurements, the excitation wave-

forms and frequencies are selected in order to extract information about the

real part of the impedance under measurement, trying to work in a region

where undesirable effects (i.e. polarization and faradaic processes) are

negligible.

Characterization and quality control of organic matter and materials,

instead, get the information from the whole impedance, often denoted by

the frequency behavior of a sample; amplitude and phase information are

often put in terms of concentrated parameters of an equivalent electrical

circuit.

Examples of recent applications of impedance measurement techniques

regard the usage of faradaic impedance spectroscopy for the development of

enzyme sensors, immunosensors and DNA sensors; in this case, the faradaic

impedance spectroscopy has been proposed in association with chrono-

potentiometry as a mean to follow biocatalytic precipitation processes in

biosensing applications (Alfonta et al., 2001).

Other examples of biosensing transduction by using impedance spectro-

scopy techniques may regard the detection of bacterial cells by directly

measuring the impedance of the bacterial cell suspensions (Yang, 2008),

and some studies for the detection of enzyme activity by the degradation of

the gelatine coating of interdigitaded electrodes, indirectly affecting the

measurable impedance (Saum et al., 1998).

There are also recent theoretical works, which look for a deeper know-

ledge about the impedance measurement of an electrochemical cell and its

fundamental mechanisms. The study of non-linear impedance spectroscopy,

due to second-order effects (Mishuk et al., 2002), gives a good example of

such basic research, which is still fully alive.

347

A. SCOZZARI

sensor arrays for the characterization of liquids.

In this context, data fusion between different sensor modalities and

feature extraction techniques applied to multisensor data, have been fre-

quently proposed and studied in the recent literature. There are a number of

applications where an automatic (and fast) quality assessment of a resource

attracts scientific and industrial interests; among the many which have been

proposed we can mention: food and beverage quality tests, pollution moni-

toring of surficial and ground water, drinking water quality tests and classi-

fication, including water distribution networks.

The fundamental idea that lies behind such devices is their capability to

provide an aggregate of chemical information, useful for characterizing the

liquid being measured, or, to provide alarms upon the detection of changes.

Sometimes, especially in the most recent literature, this class of devices is

referred to as “electronic tongue” or “e-tongue” devices. This is the wet-

counterpart of the e-nose concept, which has been very much explored in

the scientific literature, especially in the early 90s.

Several chemometric methods, based on the multicomponent analysis of

signals generated by an array of cross-sensitive potentiometric sensors, have

been proposed. Sometimes, these are also combined with completely different

sensor modalities, such as spectrophotometry and/or gas chromatography of

the gases separated in the head space of an equilibrium cell.

An example of an array of screen-printed electrodes made of carbon

paste on a polymeric substrate is given by Lvova et al. (2002); other examples

about the usage of non-specific arrays of sensors can be found in the last ten

years (Ciosek et al., 2004; Legin et al., 1999). Both the latter two examples

propose arrays of Ion-Selective Electrodes as a sensory interface to the

liquid under measurement, making use of custom-made selective membranes,

commercial electrodes and also solid-metal electrodes. Good results in terms

of discrimination capability have been shown in the classification of fruit

juice, wine and water, in the experiments which have been published.

Data fusion between potentiometry, gas chromatography and spec-

trophotometry is presented by Rodriguez-Mendez et al. (2004) for the char-

acterization of wines, while a general approach for the combination of

liquid-phase information (electronic tongue) and vapor-phase information

(electronic nose) is proposed by Winquist et al., (1999), where the liquid-

phase device is based on voltammetry, as it will be explained in the next

paragraph.

348

2.2. POTENTIOMETRIC MEASUREMENTS

A good part of the development of new transducers still relies on poten-

tiometric techniques; one of the major application frameworks, that populated

some literature in the last fifteen years, consists into the development of

ELECTROCHEMICAL SENSING METHODS

2.3. VOLTAMMETRY

Voltammetry has been recently proposed as a possible tool for the

characterization of liquids with a non-conventional chemometric approach.

This mature sensor technique, with the aid of a suitable signal processing

methodology, has proven to be an interesting option for the continuous

monitoring of a process, thanks to its very low analytical limits and to the

large amount of data that it is possible to obtain, particularly with “pulse

polarography” experiments. Both the ability to classify samples and the abi-

lity to detect changes in a solution under measurement have been investi-

gated in recent works.

The usage of pulse voltammetry, with a series of rectangular pulses

modulated by a ramp, has been presented in different contexts (Winquist

et al., 1999; Scozzari et al., 2005) as an efficient sensor technique for auto-

matic classification/characterization purposes. In fact, some recent deve-

lopments (Robertsson and Wide, 2005; Scozzari et al., 2007) are concerning

signal processing aspects, in the framework of pattern recognition techni-

ques for automatic monitoring systems. In the works cited, focus has been

given to the drinkable water distribution surveillance and to food processing

applications.

This kind of measurement approach is often catalogued in the literature

as belonging to the family of e-tongue devices, this time relying on voltam-

metry as a sensor technique.

The large multivariate space (Scozzari et al., 2007), generated by the

time series of the current signals acquired, requires a suitable processing

in order to extract the useful information; such processing steps may be

resumed in:

x reduce the dataset with the minimum loss of information,

x extract the salient features from the reduced data-set to make a correct

characterization of the sample.

The performance of such systems is generally expressed in terms of:

x capability to discriminate between different classes of liquids (i.e. dif-

ferent brands of bottled mineral water),

x capability to detect changes in the electrochemical behavior of a solution

(change detection, i.e. due to pollution).

The latter being particularly interesting for what regards the detection of

pollutants, poisons, or simply any alteration in a process under monitoring.

Promising results have been published, essentially in the area of water

quality assessment and beverage industry, by using pulse voltammetry with

a set of solid metal switched working electrodes, made by different metals

(Krantz-Rulcker et al., 2001; Scozzari, 2007). Also, an application example

349

A. SCOZZARI

regarding the quality control in the production of food for children has

recently been proposed (Robertsson and Wide, 2005).

In the framework of possible applications to drinkable water monitoring,

the capability to detect changes in water due to slight levels of pollution by

organics and pesticides have been investigated (Scozzari, 2007), showing

detectible limits compatible with drinkable water regulations.

Finally, methods based on polarography and chronoamperometry are

still matter of research; as an example, the development of biosensors cited

in paragraph 2.1 combines impedance spectroscopy with chronoampero-

metry (Alfonta et al., 2001), in order to determine the charge-transfer re-

sistance in the measurement of the faradaic impedance.

References

Alfonta L., Bardea A., Khersonsky O., Katz E. and Willner I., 2001, Chronopotentiometry

and Faradaic impedance spectroscopy as signal transduction methods for the bio-

catalytic precipitation of an insoluble product on electrode supports: routes for enzyme

sensors, immunosensors and DNA sensors, Biosensors & Bioelectronics, 16: 675–687.

Baldock S. J., Fielden P. R., Goddard N.J., Prest J. E. and Treves Brown B. J., 2003,

I ntegrated moulded polymer electrodes for performing conductivity detection on

isotachophoresis microdevices, Journal of Chromatography A, 990:11–22.

Bard A. J. and Faulkner L. R., 1980 (1

ed.), 2000 (2

ed.), Electrochemical methods, fun-

damentals and applications, John Wiley & Sons.

Bates R.G., 1973, Determination of pH, Wiley-Interscience.

Bond A.M., 1980, Modern polarography methods in analytical chemistry, CRC Press.

Butler A.V., 1926, Proc. Royal Society, London, 112A, 129 pp.

Ciosek P., Brzózka Z. and Wróblewski W., 2004, Classification of beverages using a re-

duced sensor array, Sensors and Actuators B, 103:76–83.

Delahay P. and Reilley C.N., 1954, New instrumental methods in electrochemistry, Wiley-

Interscience.

Freiser H. (Ed.), 1978, Ion-Selective Electrodes in Analytical Chemistry, Plenum.

Garrels R.M., 1967, Glass Electrodes for Hydrogen and Other Cations, George Eiseman

(Ed.), Marcel Decker.

Guggenheim E.A., 1929, J. Phys. Chem., 33, 842 pp.

Guggenheim E.A., 1930, J. Phys. Chem., 34, 1540 pp.

Ives D.J.G. and Janz G.J. 1961, Reference Electrodes, Theory and Practice. Academic Press.

Iwamoto Y., 1993, Conductivity meter and method of producing an electrode for use in

same, US patent US5212018.

Janata J., 1989, Principles of chemical sensors, Plenum.

Krantz-Rulcker C., Stenberg M., Winquist F. and Lundstrom I., 2001, Electronic tongues for

environmental monitoring based on sensor arrays and pattern recognition: a review,

Analytica chimica acta, 426: 217–226.

Legin A., Rudnitskaya A., Vlasov Y., Di Natale C., Mazzone E. and D’Amico A., 1999,

Application of Electronic Tongue for Quantitative Analysis of Mineral Water and Wine,

Electroanalysis, No. 10–11.

350

ELECTROCHEMICAL SENSING METHODS

Luce R. S., 1986, Instrument for measuring electrical conductivity of a liquid, US patent

US4585996.

Lvova L., Kima S.S., Legin A., Vlasov Y., Yang J.S., Chaa G.S. and Nama H., 2002, All-

solid-state electronic tongue and its application for beverage analysis, Analytica Chimica

Acta, 303–314.

Macdonald D.D., 1977, Transient Techniques in. Electrochemistry, Plenum Press.

Mishuk V. Ya., Elkin V.V., Abaturov M.A., Alekseev V.N. and Grafov B.M., 2002, Second-

order Impedance in Electrode Kinetics, Russian Journal of Electrochemistry, 38(9):

959–964. Translated from Elektrokhimiya, 38(9): 1069–1074.

Robertsson L. and Wide P., 2005, Improving food quality analysis using a wavelet method

for feature extraction, IEEE IMTC, Ottawa (CA), 1: 93–97.

Rodríguez-Méndez M.L., Arrieta A.A., Parra V., Bernal A., Vegas A., Villanueva S.,

Gutiérrez-Osuna R. and De Saja J. A., 2004, Fusion of Three Sensory Modalities for

the Multimodal Characterization of Red Wines, IEEE Sensors Journal, 4(3).

Saum A.G.E., Cumming R.H. and Rowell F.J., 1998, Use of substrate coated electrodes and

AC impedance spectroscopy for the detection of enzyme activity, Biosensors & Bio-

electronics, 13: 511–518.

Scozzari A., Acito N. and Corsini G., 2005, Signal analysis of voltammetric data series for

water quality tests and classification, IEEE IMTC, Ottawa (CA), 1: 89–92.

Scozzari A., Acito N. and Corsini G., 2007, A novel method based on voltammetry for the

qualitative analysis of water, IEEE Transactions on Instrumentation and Measurement,

56(6).

Scozzari A., 2007. Application of an e-tongue to groundwater monitoring: a measurement

perspective, 12

Symposium on Water-Rock Interaction, Bullen & Wang (eds), Taylor

& Francis group, Kunming (Cina), 2: 1115–1118.

Yang L., 2008, Electrical impedance spectroscopy for detection of bacterial cells in sus-

pensions using interdigitated microelectrodes, Talanta, 74: 1621–1629.

Winquist F., Wide P. and Lundstrom I., 1997, An electronic tongue based on voltammetry,

Analytica chimica acta, 357: 21–31.

Winquist F., Lundstrom I. and Wide P., 1999, The combination of an electronic tongue and

an electronic nose, Sensors and Actuators B 58, 512–517.

351

V. Evangelista et al. (eds.), Algal Toxins: Nature, Occurrence, Effect and Detection.

ODDITIES AND CURIOSITIES IN THE ALGAL WORLD

LAURA BARSANTI

, PRIMO COLTELLI

, VALTERE

EVANGELISTA

, ANNA MARIA FRASSANITO

VINCENZO PASSARELLI

NICOLETTA VESENTINI

AND PAOLO GUALTIERI

Istituto di Biofisica C.N.R.,

Istituto Scienza e Tecnologia

dell’ Informazione C.N.R.,

Istituto di Fisiologia Clinica

C.N.R. Area della Ricerca di Pisa, Via Moruzzi 1, 56124,

Pisa, Italy

assemblage, of O

–evolving, photosynthetic organisms. The profound diver-

sity of size, shape, habitat, metabolic traits and growth strategies makes this

heterogeneous assemblage of both prokaryotic and eukaryotic species an

almost unlimited source of curious and unusual features. Algae display an

incredible adaptability to most environments, and provide an excellent sys-

tem for testing hypotheses concerning the evolution of ecological tolerance.

In fact, they are not limited to temperate waters, but can survive at very low

depth and very low irradiance, and thrive beneath polar ice sheets. Upon

adaptation to life on land, algae have colonized such surprising places, as

catacombs, tree trunks, hot springs, and can also resist desiccation in the

desert regions of the world. Moreover, relations between them and other

organisms, which include competition within and between species for space,

light, nutrient or any limiting source, are based on a variety of associations,

which includes epiphytism, parasitism, and symbiosis. Algae can share their

life with animals, growing on sloth hair, inside the jelly capsule of amphi-

bian eggs, upon the carapaces of turtles or shells of mollusks, camouflaging

the dorsal scute of harvestmen. They can also light up the sea at night, and

cause infections in animals and humans.

______

*To whom correspondence should be addressed. Paolo Gualtieri, Istituto di Biofisica C.N.R., Area

della Ricerca di Pisa, Via Moruzzi 1, 56124, Pisa, Italy. Email: paolo.gualtieri@pi.ibf.cnr.it

353

Abstract: The term algae refers to a polyphyletic, non-cohesive and artificial

L. BARSANTI ET AL.

Keywords: Algae, extreme environments, mutualisms, blooms, bioluminescence,

1. Introduction

The term algae has no formal taxonomic standing, nevertheless it is routinely

used to indicate a polyphyletic, non-cohesive and artificial assemblage, of

–evolving, photosynthetic organisms (with several exceptions of color-

less members, which are undoubtedly related to pigmented forms). No

easily definable classification system acceptable to all exists for algae, since

taxonomy is under constant and rapid revision at all levels following every

day new genetic and ultrastructural evidence. Keeping in mind that the

polyphyletic nature of the algal group is somewhat inconsistent with tradi-

tional taxonomic groupings, though they are still useful to define the general

character and level of organization, and aware of the fact that taxonomic

opinion may change as information accumulates, the tentative scheme re-

ported in Table 1 of chapter one of this book is adopted (Barsanti and

Gualtieri, 2006).

This review is meant to discuss these diverse organisms from a different

perspective by focusing on some of their more unusual characteristics or

oddities. The oddities we will deal with are quite diverse, since we came across

them studying the algal world in its different aspects. The world of any

organism results from the interaction of both abiotic (physiochemical) and

biotic factors. Among the major physiochemical factors affecting algae are

light, temperature, salinity, nutrient availability. Among biotic factors are

relations between algae and other organisms, which include competition

within and between species for space, light, nutrient or any limiting source,

and a variety of associations, which includes epiphytism, parasitism, and

symbiosis. The interactions between these different variables can both hide

and reveal odd traits of algae.

2. Occurrence and Distribution

Algae can be aquatic or subaerial, when they are exposed to the atmosphere

rather than being submerged in water. Aquatic algae are found almost any-

where from freshwater springs to salt lakes, with tolerance for a broad range

of pH, temperature, turbidity, O

and CO

concentration. They can be

planktonic, as are most unicellular species, living suspended throughout the

lighted regions of all water bodies including under ice in polar areas. They

can be also benthonic, attached to the bottom or living within sediments,

limited to shallow areas because of the rapid attenuation of light with depth.

354

protothecosis

HOW ODD ALGAE CAN BE

Benthic algae can grow attached on stones (epilithic), on mud or sand

(epipelic), on other algae or plants (epiphytic) or on animals (epizoic). In

the case of marine algae, other terms can be used to describe their growth

habits, such as supralittoral, when they grow above the high tide-level, within

reach of waves and spray; intertidal, when they grow on shores exposed to

tidal cycles, or sublittoral, when they grow in the benthic environment from

the extreme low-water level to around 200 m deep, in the case of very clear

water.

Dealing with subaerial algae, oddities do not lack; upon adaptation to

life on land, algae have colonized such surprising places, as hot springs,

catacombs, and they can also be found embedded within desert crust or

sharing their life with animals.

2.1. LOW DEPTH

The depth record is held by dark-purple crustose coralline algae collected at

268 meters, where the faint light is blue-green and its amount is approxi-

mately 0.0005% of the surface value (Markager and Sand-Jensen, 1992;

Gattuso et al., 2006). Considering that “full sun” (i.e. irradiance in the middle

of the day) shines approximately 10

mol photons m

–2

year

–1

on the earth

surface (Littler et al., 1985; Spalding et al., 2003), 0.0005% is equivalent to

a photon flux of only 5 mol photons m

–2

year

–1

during full sunlight at its

maximum zenith. At these depths the red part of the sunlight spectrum is

filtered out from the water and not enough energy is available for photo-

synthesis. These red algae are able to survive in the dark blue sea because

they possess accessory pigments, including carotenoids, xantophylls and

phycobiliproteins, that absorb light in spectral regions different from those

of the green chlorophylls a and b. This absorbed light energy is channeled

to chlorophyll a, which is the only molecule able to convert sunlight energy

into chemical energy (Barsanti et al., 2007). Due to the presence of these

pigments, the green of their chlorophylls is masked and these algae look

dark purple.

Also green algae occur to depths comparable with those of red algae. In

the temperate western North Atlantic, green algae such as Derbesia marina

(Chorophyta) may occur with red algae in the deep clear waters of the con-

tinental shelf to at least 30 m, (Sears and Cooper, 1978; Lewbel et al., 1981).

In southern California, an encrusting Codium sp. (Chorophyta) was found

at 91 m (Lissner and Dorsey, 1986). The occurrence of these green algae in

deep water is not surprising, because many deep-water green algae, including

the Derbesiales and Codiales, have been found to contain siphonaxanthin, a

carotenoid capable of absorbing the green light prevalent in deep waters

(Yokohama et al., 1977; Yokohama, 1981). Palmophyllum umbracola, one

355

L. BARSANTI ET AL.

of the deepest occurring Chlorophyta (70 m), (Hanisak and Blair, 1988),

also possesses an unidentified orange pigment (Nelson and Ryan, 1986) that

may be siphonaxanthin.

2.2. COLD ENVIRONMENTS

Other unusual and extreme habitats for algae are represented by very cold

environments, such as platelet ice layer, the snowfield and the glaciers,

(Leya et al., 2000). Algal cells adapting to cold temperatures have to take

care of the following three processes: (1) changing the ratio of saturated and

unsaturated fatty acids in the lipids of the cell membranes to maintain

membrane fluidity (Morris et al., 1981; Roessler 1990), (2) adjusting the

permeability of the cell membrane for water to react to osmotic changes of

the outer medium (Kawecka, 1986), and, (3) when exposed to freezing

temperatures, reducing the water content of the cell interior to prevent ice

crystal formation (Bunt, 1968; Giese, 1973).

The platelet ice layer consists of a lattice of flat, disk-shaped ice crystals

that accumulate to a thickness of up to several meters under sea ice located

adjacent to floating ice shelves (Dayton et al., 1969, Smetacek et al., 1992).

Because it is submerged beneath 1–2 m of consolidated ice, irradiance rea-

ching the platelet ice is first attenuated by the overlying snow cover, sea

ice crystals and brine inclusions, particles, and soluble material (Robinson

et al., 1995), resulting in a light field that is reduced in magnitude and

restricted in spectral distribution (Palmisano et al., 1987a; SooHoo et al.,

1987; Arrigo et al., 1991; Robinson et al., 1995). Nevertheless, reports of

high algal production and biomass accumulation in the platelet ice of the

Weddell and Ross Seas (Antartica) (Bunt and Lee, 1970; Grossi et al., 1987,

Smetacek et al., 1992, Arrigo et al., 1995) attest to the success of the pla-

telet ice microalgal community at growth in these low light conditions.

Phyllophora antartica (Rhodophyta) is a representative alga in this environ-

ment. The structure of the platelet ice layer provides a large surface area for

the attachment and growth of microalgae (Arrigo et al., 1993). In addition,

the fixed position of the platelets provides a stable substrate that isolates the

algae from vertical mixing and holds them in a higher and less variable light

field than that available within the underlying water column. Vertical

compression of the biomass also reduces the fraction of PAR absorbed by

the ice/water milieu of the platelet layer and increases the fraction absorbed

by the algae for use in photosynthesis (Arrigo et al., 1993). The algae in-

habiting the platelet ice layer are extremely shade adapted, typically attain-

ing maximum photosynthetic rates at an irradiance lower than 500 mol

photons m

–2

year

–1

(Palmisano and Sullivan 1985; Palmisano et al., 1987b;

Arrigo et al., 1993; Robinson et al., 1995).

356

HOW ODD ALGAE CAN BE

The successful exploitation of the Antarctic platelet ice layer by sea ice

microalgae for growth results from a unique combination of physical pro-

perties and biological adaptations, (Cota, 1985; Dieckmann et al., 1992;

Lizotte and Sullivan 1992; Lizotte et al., 1998; Thomas and Dieckmann,

2002). Adaptive features include pigments, polyols (sugar alcohols, e.g.

glycerin), sugars and lipids (oils), mucilage sheaths, motile stages and spore

formation. Moreover, since the algae living in regions that receive full solar

exposure are adapted to high UV light environment, they can augment their

UV protection capacity especially during summer months by producing

secondary metabolites including phenylpropanoids, carotenoids, xantophylls,

and mycosporine amino acids (Bidigare et al., 1993; Ryan et al., 2002).

True snow algae are defined as those that grow and reproduce wholly

within the water retained by snow during snowmelt. During summer months

large blooms occur, which can reach cell concentration of 10

cells mL

–1

and

color whole snow banks red, orange, green or gray depending on the species

and habitat conditions. Most snow algae belong to Chlorophyta, such as

Chloromonas rubroleosa and Chlamydomonas nivalis. These algae color

the snow red, due to the excess of carotenoids and xantophylls (Müller et al.,

1998; Hoham and Blinn, 1979; Kol and Eurola, 1974; Thomas, 1972; Kol,

1969). Species from other algal groups are also important and the dominant

alga in many of the glaciers around the world is the saccoderm desmid

Mesotaenium berggrenii (Chlorophyta), an alga that colors the snow grey,

due to its iron tannin compounds, (Ling and Seppelt, 1990; Yoshimura

et al., 1997).

Snow algae go through a complex life history, involving motile vegetative

stages that undergo syngamy and thick-walled resting spores and zygotes.

The latter allow them to survive the time when the snow has completely

melted, and probably to be spread by wind (Muller et al., 2001). Many of

these algae possess vegetative and or motile cells that are usually green in

color and immotile spores or cysts that may be red, orange or yellow green

in color. The green vegetative cells color the snow green, whereas the red

and orange snow are generally caused by the spore stages though some

snow algae may be red-pigmented in their vegetative state. The spores

usually have thick walls and large amounts of lipid reserves, polyols and

sugars. They are able to withstand sub-zero temperatures in winter and also

high soil temperatures and desiccation in summer, which would kill normal

vegetative cells. The motile stages enable them to re-colonize the snow from

germinating spores left behind on the soil as well as to position themselves

at the optimum depth for photosynthesis in the snow/ice column. The cells

of some species also secrete copious amounts of mucilage which enable them

to adhere to one another and to snow crystals and prevent the cells from

being washed away by melt water. The mucilage also forms a protective

357

L. BARSANTI ET AL.

coat and delays desiccation, and it may have an additional function as an

UV shield. A few species are common worldwide, but others are restricted

to either the Northern or Southern Hemispheres.

Snow algae sustain a highly diverse microbial community on snow fields

and glaciers, which is composed of bacteria, heterotrophic flagellates and

ciliates. These organisms in turn, sustain a community of cold-adapted animal

species, such as midges, copepods and snow fleas on Himalayan glaciers,

and ice worms and collembolas on North American glaciers (Aitchison,

2001; Kikuchi, 1994; Kohshima, 1984; Goodman, 1971). Blooms of snow

algae can reduce the surface albedo, (i.e. the ratio of reflected to incident

light, see later) of snow and ice, and largely affect their melting, (Takeuchi

et al., 2001; Kohshima et al., 1993).

The ecology of snow algae is important for understanding the glacial

ecosystem since they can be used as indicators to date ice cores drilled from

glaciers. Their biomass and community structure inside ice cores may also

provide information on the paleo-environment (Yoshimura et al., 2006).

2.3. HOT SPRINGS

Another example of ecological diversification of algae is the colonization of

alkaline hot spring habitats across western North America, Asia, Africa, and

possibly Europe by members of the genus Synechococcus (Cyanophyta),

(Castenholz, 1996). Hot spring outflows typically exhibit marked tempera-

ture gradients, and microbial communities containing Synechococcus gene-

rally develop in these systems at temperatures between about 45°C and

73°C, which is the thermal maximum for photosynthetic life (Brock 1967,

Castenholz, 1999; Brock, 1978). Studies on the behavior of C-phycocyanin

from Synechoccocus lividus showed that purified C-phycocyanin is stable

up to least 70°C and it is highly aggregated with identical spectroscopic

behaviors at 20°C and 70°C (Edwards et al., 1996; Edwards et al., 1997). For

these characteristics, it is termed temperature resistant protein (Samsonoff

and MacColl, 2001).

The biology of acid hot springs is quite different from that of the

neutral/alkaline springs. Though most thermo-acidophiles are prokaryotes

(Archea and Bacteria), photosynthetic prokaryotes, such as cyanobacteria,

are completely absent from acid water even when the temperature has

dropped to quite low values. The photosynthetic microorganisms of such

acid water are rare kinds of eukaryotes found no where else on earth, the

Cyanidiales, a group of asexual unicellular red algae (Cinilia et al., 2004).

The main representative in hot acid springs is Cyanidium caldarium

(Rhodophyta), an organism of unusually evolutionary ancestry, which can

grow even when the acidity is close to zero and maintain its intracellular

358

HOW ODD ALGAE CAN BE

pH at close to neutral. How this important physiological resistance is achi-

eved is still not understood, though a strong proton pump or a low proton

membrane permeability are possibilities. The upper temperature limit for

Cyanidium is about 56°C, lower than that of the cyanobacteria as would be

expected since Cyanidium is a eukaryote. As in the case of Synechococcus,

C-phycocyanin from Cyanidium fits the characteristics of a temperature-

resistant protein. Its hallmark for stability is to remain inflexible toward

structural change over a wide range of temperatures from 10°C to 50°C. The

protein denatures irreversibly at the temperature at which the alga is no

longer viable between 60°C to 65°C, (Eisele et al., 2000).

2.4. CATACOMBS

Different species of terrestrial epilithic cyanobacteria, such as Leptolyngbya

sp. and Scytonema sp., occurring in Roman hypogea, inside St. Callistus and

Priscilla Catacombs, live under extremely low photon fluxes, 3–30 mol pho-

tons m

–2

year

–1

(Albertano et al., 2000), similarly to deep-water algae. At

this extremely low photon fluxes, these algae can grow because of the pre-

sence of phycobyliproteins organized in phycobilisomes in the thylakoid

membranes inside the cell that transfer their absorbed extra energy to

chlorophylls. They sense the light direction by means of a photoreceptive

apparatus that is located in the apical portion of the tip cell, which is com-

posed by a carotenoid-containing screening device and a light detector based

on rhodopsin-like proteins, (Albertano et al., 2001).

2.5. DESERT CRUSTS

Crusts can be defined as microbiotic assemblages formed by living org-

anisms and their by-products, creating a complex surface structure of soil

particles bound together by organic material. Some crusts, are characterized

by their marked increase in surface topography, often referred to as pinn-

acles or pedicles (Anderson and Rushefort, 1977). Other crusts are merely

rough or smooth and flat (Johansen, 1993). The process of creating surface

topography, or pinnacling, is due largely to the presence of filamentous

cyanobacteria and green algae. These organisms swell when wet, migrating

out of their sheaths. After each migration new sheath material is exuded,

thus extending sheath length. Repeated swelling leaves a complex network

of empty sheath material that maintains soil structure after the organisms

have dehydrated and decreased in size (Belnap and Gardner, 1993; Barger

et al., 2006).

Algal crusts of desert regions have been suggested to retard soil erosion

(Booth, 1941; Fletcher and Martin, 1948; Shields and Durrell, 1964; Metting

359

L. BARSANTI ET AL.

1981; Mucher et al., 1988; Liu and Ley, 1993; Johansen, 1993; St. Clair

et al., 1986), which generally includes rain and wind erosion. Although the

erodibility of soil with and without crusts has been quantified (Booth 1941;

Loope and Gifford, 1972; Brotherson, and Rushforth, 1983; Gillette and

Dobrowolski, 1993; Maxwell and McKenna Neuman, 1994; Liu et al., 2001),

only few studies have been focused on the specific effects of different algae

in stabilization of sand dunes. The recovery rate of cryptogamic crusts (i.e.

a thin crust made up of mosses, lichens, algae, and bacteria) in natural and

artificial conditions has been examined (Belnap, 1993; St. Clair et al., 1986),

as well as the effect of the wind regime (including wind force and types),

moisture, crust development, soil texture, vegetation coverage, season and

human activity on algal crust integrity, (Belnap and Gillette, 1997,1998;

Brotherson and Rushforth, 1983, Dong et al., 1987, Hu et al., 1991, Liu et al.,

1994, Williams et al., 1995). Most algal crust formation in arid area is

initiated by the growth of cyanobacteria during episodic events of available

moisture with subsequent entrapment of mineral particles by the mechanical

net of cyanobacterial filaments and glue of extra-cellular slime, (Johansen

1993; Belnap and Gardner, 1993). Algal crusts are critical to the ecosystem

in which they occur. Evidence has shown that they may play important roles

in the stabilization of soil surfaces and the improvement of soil structure,

contributing significantly to soil fertility of these regions through such

processes as nitrogen fixation, excretion of extracellular substances, and reten-

tion of soil particles, organic matter and moisture (Hu et al., 2002; Li et al.,

2002; Barger et al., 2006). Nitrogen fixation by cyanobacteria and lichens

(due to their symbiotic cyanobacteria) comprising the crusts is the primary

source of nitrogen input in many of the arid ecosystems on a worldwide

basis. The fascinating points herein are why and how the algal crusts, only a

few millimeters thick, play such important roles, and how the relevant orga-

nisms survive and even flourish in such a harsh environment with extreme

desiccation, strong radiation, and large fluctuation of temperature (Evans

and Johansen, 1999; Wynn-Williams, 2000).

Systematic investigations of algal crusts conducted in the Tengger Desert

(China) have provided data on the vertical microdistribution of cyanobacterial

and algal species within samples aged 42, 34, 17, 8, 4 years (Hu et al.,

2003). This vertical distribution was distinctly laminated into an inorganic-

layer with few algae (0.00– 0.02 mm,), an algae-dense-layer relatively compact

and densely inhabited with algae (0.02–1.0 mm) and an algae-sparse layer

(1.0–5.0 mm). Due to extremely high irradiation, the surface of the inorganic

layer was the harshest microenvironment of the desert crusts, and therefore

was colonized only with Scytonema javanicum, and Nostoc flagelliforme

(Cyanophyta), desiccation-tolerant species possessing high UV screening

pigments. These two heterocystous, diazotrophic species were the only algae

360

HOW ODD ALGAE CAN BE

found at the depth of approximately 0.02–0.05 mm, while around 0.05–0.10

mm, the coccoid green alga Desmococcus olivaceus (Chlorophyta), charac-

terized by strong resistance to stressful environments, was the dominant

species. The biggest algal biovolume was present at 0.10–0.15 mm, with the

dominance of Microcoleus vaginatus (Cyanophyta), a sheath-forming and

polysaccharide-excreting cyanobacterium capable to stabilize sand grains.

The diversity of algal species was the largest in all the crust samples at

the depth of approximately 0.15–0.50 mm. Filamentous (Anabaena azotica,

Phormidium tenue, Lyngbya cryptovaginatus) and unicellular cyanobacteria

(Gloeocapsa sp., Synechocystis pevalekii) unicellular coccoid green algae

(Chlamydomonas sp., Chlorococcumhumicola, Chlorella vulgaris and Pal-

mellococcusminiatus), diatoms (Naviculacryptocephala, D. vulgare var. ovalis

and Hantzschia amphioxys) and euglenoids (Euglena spp.) were present.

Within the range of approximately 0.50–1.00 mm there were much more

green algae and euglenoids than in the other strata. Because the upper 1 mm

of the crust was the euphotic zone (i.e. the zone where enough light pene-

trates for photosynthesis to occur), more than 96% algal bio-volume was

distributed in this algae-dense-layer (0.02–1.0 mm). By the algae-sparse-layer,

dramatically reduced irradiance was inadequate for efficient photosynthesis

and therefore this layer had only about 4% of the total algal bio-volume. At

1.0–2.0 mm, species usually found were L. cryptovaginatus, M. vaginatus,

P. tenue, S. pevalekii, N. cryptocephala and H. amphioxys. At the depth of

approximately 2.0–3.0 mm, P. tenue was the dominant species together with

diatoms, mainly N. cryptocephala and H. amphioxys. At the depth of ap-

proximately 3.0–4.0 mm only diatoms were present. Existence of a diatom

layer at the crust base might be the result of downward seepage of water

and the high motility of these algae.

The older the crusts, the nearer to the surface were Nostoc sp., Chlorella

vulgaris, Microcoleus vaginatus, Navicula cryptocephala and fungi, which

might be less resistant to the surface stresses. This might reflect the slow

but effective process of algal crust development at early stages, and this

process might be beneficial to the transformation from algal crusts to lichen

crusts at later stages in consideration of the integration of cyanobacteria and

green algae, such as Nostoc, with fungi to form lichen, (Hu et al., 2003).

3. Animal-Algae Interactions

Algae are involved into complex relationship with very different animals.

They have been reported to grow epizoic on sloths, polar bears, seals, frogs

and salamanders, artropods and turtles. In the case of the tree sloths, Bradypus

sp. and Choloepus sp., the algae effectively turn these animals green, giving

them excellent camouflage among the leaves. The camouflage is crucial to

361

L. BARSANTI ET AL.

the sloth’s survival, because its inability to move quickly makes it an easy

target for predators such as the harpy eagle (Harpia harpyja). Among the

many odd features of these interesting animals, perhaps the oddest of all is

their hair which, with its peculiar structure and its algal presence, is unlike

the hair of any other mammal (Gilmore et al., 2001). During the dry season,

the hair of sloths usually has a dirty brown coloration, but during long

period of rain it may show a very appreciable greenish tinge brought about

by the increased presence of symbiotic algae. The algae may already be

present in the hair of juveniles only a few weeks old and they could pro-

vide camouflage for the sloths while obtaining shelter for themselves. The

algae have a distinct distribution patterns in Choloepus and Bradypus, lying

longitudinally along the grooves in the former and in short lateral tongue or

lines in the latter. Algae representing four phyla have been cultured from

Bradypus, these being Chlorophyta, Chrysophyta, Cyanophyta, Rhodophyta,

(Thompson, 1972). The algae found on the coat of Bradypus tridactylus lie

between the cuticle scales (Aiello, 1985) and the hair changes with age in

apparently all species of Bradypus. Young hairs are white, gray, brownish

or black and do not possess the deep cracks seen in older hairs. The first

traces of algae appear on these young hairs as tiny dots or extremely narrow

transverse lines. Older hairs have larger, wider algal colonies and obvious

deep transverse cracks. When wet, these cracks close considerably, but when

dry give the effects of beads on a string. The oldest hairs are badly deterior-

ated with the spongy cuticle worn off on one side exposing the full length of

the cortex. In the older hairs living algae are absent. It was suggested (Aiello,

1985) that either the algae colonize the very narrow cracks in young hairs or

the algae themselves initiate the cracks. The hair of all the three Bradypus

species (B. tridactylus, B. variegatus and B. torquatus) readily absorbs water,

but those of Choloepus do not. Lack of healthy algal colonies has been ob-

served in Bradypus kept in captivity; since they do not survive long under

these conditions, algae have been suggested to provide nutrition or a parti-

cular trace element essential for the health of the animals (Aiello, 1985).

Polar bears (Thalarctos maritimus) normally have creamy-white fur,

presumably an adaptation for camouflage in a snowy environment. However,

cases are been reported of polar bears kept in captivity in different American

zoos, which turned green as result of algae growing on their fur (Lewin and

Robinson, 1979). The coloration was particularly evident on the flanks, on

the outer fur of the legs and in a band across the rump. This coloration was

clearly attributable to the presence of algae inside the hairs, specifically in

the hollow medullae of many of the wider (50–200 µm), stiffer guard hairs

of the outer coat. The thinner (less than 20 µm) hairs of the undercoat,

which were not hollow, were colorless. The fact that some of these lumina

were in connection with the external air or water could explain how the

362

HOW ODD ALGAE CAN BE

algal cells could have entered the hairs in the first place, and how exchange

of O

and CO

and uptake of water and mineral salts would be facilitated

and could permit growth of the algae if suitable illuminated. Such a habitat

has certain advantages, being warm and protected from most kind of poten-

tial predators. The algae isolated from the polar bear hairs and cultured

under controlled conditions were identified as cyanobacteria, (Lewin and

Robinson, 1979). Unidentified green algae are also known to color green

the fur of the monk seal (Monachus sp.), refer to http://www.pifsc.noaa.gov/

psd/mmrp/brochure.pdf).

Another mutualistic association with algae occurs in some amphibians.

All amphibians lay eggs with a jelly capsule, although the form and thick-

ness of the capsule vary widely (Duellman and Trueb, 1986; Salthe, 1963).

Some amphibians, including the spotted salamander Ambystoma maculatum

and the pickerel frog Rana palustris, embed their eggs in large masses of

relatively firm jelly, which are attached to vegetation in ponds. Other

amphibians, including the wood frog Rana sylvatica and the spotted marsh

frog Lymnodynastes tasmaniensis, lay their eggs in masses that float at the

surface of the pond or are loosely attached to vegetation. The jelly capsule,

at least in aquatically developing amphibians, protects the eggs from pre-

dators (Ward and Sexton, 1981). It also resists exchange of respiratory gases.

A further factor in gas exchange in amphibian egg masses is that many

are colonized by symbiotic algae. For example, virtually all Ambystoma

maculatum egg masses in the wild are inhabited by algae (Gatz, 1973). The

algae were first noted by Orr (1888), who speculated that they must have

considerable influence on the respiration of the embryos. It is well esta-

blished that this relationship is symbiotic. The alga Oophila ambystomatis

(Chlorophyta) is found exclusively in amphibian egg masses, mostly in

those of Ambystoma maculatum, but also in those of R. sylvatica and some

other species (Gilbert, 1942), and derives its name from the association. The

benefit to the algae may be higher CO

or ammonia concentrations found

inside egg capsules; algal growth is much greater in the presence of embryos

than after the embryos had been removed from the jelly (Gilbert, 1944). The

amphibian embryos also benefit, having higher hatching success and shorter

developmental times when reared with algae than without (Gilbert, 1944)

and, in egg masses with algae, higher hatching success in light than in

darkness (Breder, 1927; Gilbert, 1942). The basis for the beneficial effect of

the algae on the embryos was uncertain until the work of Pinder and Friet

(1994). These authors concluded that symbiotic algae in A. maculatum egg

masses produce more O

than they consume, making the egg mass hyper-

oxic in light. Because O

diffusing in from the water is consumed before

reaching the centre of the egg mass, O

produced by local algae may be the

only source of O

for innermost late-stage embryos.

363

L. BARSANTI ET AL.

Algae are also important for tadpoles of other amphibians, establishing

an ecologically important mutualism that is conditional and provide partner

species with novel options for adjusting to changing environment (Hay

et al., 2004). It is well know that organisms reaching their critical thermal

maximum (CTM, the minimal high deep-body temperature that is lethal to

an animal) are incapable of escaping the lethal conditions (Freidenburg and

Skelly, 2004). This holds especially true for aquatic organisms in thermally

uniform systems, which have no refuge from heat stress; further, temp-

erature increases within such systems decreases the concentration of the

necessary gases oxygen and carbon dioxide, (Wu and Kam, 2005). Aquatic

organisms that are stressed for these gases for respiration and photo-

synthesis would benefit from fortuitous mutualistic interactions in which

the “by-product” gases evolved by metabolism can be absorbed recipro-

cally. Observations were conducted on numerous tadpoles of the dwarf

American toad, Bufo americanus charlesmithi in a shallow temporary pool

subjected to extended exposure to solar radiation, located in Ashley County

(Arkansas, USA), (Tumlison and Trauth, 2006). The water became very

warm by mid-afternoon, and some of the tadpoles possessed an atypical

greenish coloration. The tadpoles were late stage, and some of them exhi-

bited well-developed legs. Microscopic examination of live tadpoles from

the pool revealed cluster of biflagellated green algae identified as Chloro-

gonium (Chlorophyta) scattered as greenish blotches over the skin, (Nozaki

et al., 1998). Individuals of this alga were observed actively flagellating to

maintain a position oriented to the skin of the tadpole. The distribution of

the alga generally followed the pattern of cutaneous blood vessels on the

dorsal surfaces of the legs, tail, and lateral body wall.

The high CTM of toads help them survive in warmer conditions and

shortens the time required for development, thereby promoting meta-

morphosis prior to desiccation of the habitat, (Noland and Ultsch, 1981).

Rates of oxygen consumption in tadpoles increase with higher temperatures,

but water at higher temperature holds a lower concentration of gases (Ultsch

et al., 1999). Although tadpoles are tolerant to warmer temperatures, the O

deficits can lead to respiratory distress and death. Under conditions of low

tadpoles of some species can supplement oxygen intake by gulping air,

but the late development of the lungs precludes this in Bufo, (Duellman and

Trueb, 1994). Consumption of O

increases sharply prior to metamorphosis.

Thus, the warmer water contains less O

at a time when more may be needed.

Even after acclimatization to warmer temperatures, the CTM of tadpoles of

most anuran species is 38–40°C, with a few exceptions above 41°C in

species that develop in xeric (with very little moisture) or tropical habitats.

On the other hand, the rate of photosynthesis tends to increase with

increases in temperature up to an optimum, after which it decreases rapidly,

364

HOW ODD ALGAE CAN BE

partly limited by the availability of inorganic carbon. Growth rate of algae

slows in stagnant cultures because the rate of diffusion of CO

from the air

become limiting, partly because CO

diffuses 10

times faster in air than in

water. Green algae (Chlorophyta, including Chlorogonium) tend to dominate

in temperatures of 15–30°C, but are replaced by cyanobacteria above 30°C,

(DeNicola, 1996). Thermophilic algae thrive best in waters rich in CO

where conditions necessary to maintain high rates of photosynthesis are

met, (Fogg, 1969). The pattern of association and distribution of Chloro-

gonium over the skin of tadpoles allow maximum potential for uptake of

otherwise limiting CO

released via cutaneous respiration by tadpoles. The

relatively small size of Chlorogonium specimens also could indicate stress.

The mean length of the cells taken from the tadpoles was 13.4 ȝm (range

7–22 ȝm), and width ranged only between 1.5–3 ȝm. The normal mea-

surements from species known to occur in the United States ranges from

19–59 ȝm in length and 5–18 ȝm in width. Smaller cells result in a higher

surface/volume ratio, which could help maximize absorption in CO

-limited

environment.

The CTM at which tadpoles of Bufo americanus could survive in-

dependently is 39.5°C. In a heat-stress-inducing environment, however, the

CTM could be expanded by over 4°C (to about 43°C) in the presence of a

photosynthetic, mutualistic alga such as Chlorogonium. Considering these

phenomena, it is hypothesized that the Chlorogonium and tadpoles are

exhibiting a facultative symbiosis in which tadpoles gain O

produced via

photosynthesis adjacent to the skin, and concomitantly Chlorogonium receive

the metabolic CO

evolved from the tadpoles, (Tumlison and Trauth, 2006).

Similar algal accumulations have been found on tadpoles of gray tree frogs

(Hyla versicolor) and cricket frog (Acris crepitans) at other locations within

Arkansas (USA), (Tumlison and Trauth, 2006).

Arthropods are also good host for algae. Cyanobacteria were reported to

grow epizoically on the dorsal scute of the harvestman Neosadocus sp.

(Arachnida, Opiliones), in the Cardoso Island, southeast Brazil. The epizoic

algae almost fully covered the harvestmen’s back, giving the animals a

greenish coloration contrasting markedly with the brownish body and

appendages. The growth of the algae did not affect behavior and locomotion

of the animals, which would benefit from the presence of the photosynthetic

organism by being camouflaged and thus protected from visual diurnal

predators, (Machado and Moreira Vital, 2001).

The occurrence of carapacian algae on turtle is a common phenomenon

often reported in literature. Among them the green algal genus Basicladia

Hoffman and Tilden (Chlorophyta) contains species which are specifically

epizoic on carapaces of turtles or shells of mollusks, (Normandin and Taft,

1959; Neil and Ross Allen, 1954; Ernst and Norris, 1978). Closely related

365

L. BARSANTI ET AL.

to Cladophora, Basicladia is mainly distinguished by its epizoic nature.

Five species are recognized, and all are known only from freshwater turtles

or snails. Basicladia crassa and B. chelonum have been reported from

freshwater turtles in several states of the Rocky Mountains. Outside of the

United States, B. sinensis was described from the back of a turtle brought

from China to an aquarium in California, and B. ramulosa, an exceptionally

large species, is known from Australian turtles. The fifth taxon, B. vivipara

is known only from the freshwater snail, Viviparus malleatus Reeve. In

1975, B. crassa was reported for the first time from Virginia on the carapace

of a red-bellied turtle Chrysemis rubriventris. The algae were restricted to

the turtle carapace, where they formed a wide band thickly covering the

marginals and ventral half of the pleural scutes, but thinning as it extended

dorsally. The rugose carapacial surface of this turtle is well suited for the

attachment of algal rhizoids, but the basking habit of the turtle may account

desiccation and solar radiation above the water level. Also C. rubiventris

sheds the epidermal scutes of its carapace periodically, thus freeing itself of

any algae attached. However, it is not uncommon to find “moss-back” red-

bellies in the spring, especially just after emergence from hibernation when

air temperature are still too cool for much basking. B. crassa and B.

heat than the turtles themselves. It is possible that repeated exposure to the

sun’s ultraviolet rays and the drying effect through frequent basking

associated with the grazing action of herbivorous fish or amphipods would

at least limit the growth of these algae, (Ernst and Norris, 1978).

Algae can also establish pathogenic association with both animals and

humans. Among the genera most intensely investigated is Prototheca,(Di

Persio, 2001). These algae are unicellular, spherical to oval in shape,

ranging from 3 to 30 Pm in diameter. Prototheca species are closely related

to the green alga Chlorella (Chlorophyta), but lack chloroplasts and possess

a two-layered, instead of three-layered cell wall (Joshi et al., 1975); they are

heterotrophic and require external source of organic carbon and nitrogen

(Koenig and Ward, 1983). The life cycle is similar to that of algae of the

genus Chlorella; reproduction is asexual by internal septation and irregular

cleavage, with subsequent rupture and release of 2–16 autospores through

a characteristic split in the cell wall of the parent cell. Released autospores

then go on to develop into mature cells (Pore, 1998a). The taxonomic status

of the genus Prototheca has changed during the last decades and curren-

tly the following four species are assigned to this genus: P. zopfii, P.

wickerhamii, P. stagnora, P. ulmea and P. blashkeae (Roesler et al., 2006).

A fifth species, P. moriformis is not generally accepted (Kruger, 1894; Pore,

1985; Ueno et al., 2003). Only two of these species have been documented

366

chelonum are able to survive periods of basking desiccation and even more

for absence of most carapacial algae since they are subject to increased

HOW ODD ALGAE CAN BE

to cause infections in humans and animals (Pore, 1998b), i.e. P. zopfii and

P. wickerhamii.

These algae are globally ubiquitous (Pore et al., 1983) and can be isolated

from various reservoirs, such as environment, animals and food. Typical

sources of Prototheca species are the slime flux of trees, fresh and marine

waters, soil and sewage, stables and animal buildings, excrement, various

animals (cattle, deer, dogs), and food items such as butter, potato peels,

bananas, cow’s milk (Pore et al., 1983; Pore, 1985; Pore, 1986).

In 1952, P. zopfii was first identified as a pathogen of bovine mastitis

associated with reduced milk production characterized by thin watery secre-

tion with white flakes (Lerche, 1952). While in the past only sporadic cases

of protothecal mastitis have been observed, this form of mastitis now occurs

endemic in the most countries of the world (Hodges et al., 1985; Costa et

al., 1996; Aalbaek et al., 1998; Janosi et al., 2001; Moller et al., 2007). This

infection represent a serious problem since the affected animals must be

culled from their herds to halt transmission of the disease (Cunha et al.,

2006).

Prototheca produce disease also in humans, and the clinical conditions

caused by this alga are generally referred to as protothecosis (Thiele and

Bergmann, 2002). The first case of human infection was diagnosed in 1961

in Sierra Leone on a rice farmer; it took the form of a verrucose foot lesion

from which P. zopfii was isolated as etiological agent. Over the following

years, the number of documented cases of protothecosis rose continuously,

with about four new cases being diagnosed every year over the past decade

(Lass-Florl et Mayr, 2007). Three clinical forms of human protothecosis

have been described: cutaneous/subcutaneous infections, olecranon bursitis,

and disseminated or systemic protothecosis. Over one-half the documented

cases of protothecosis concern cutaneous or subcutaneous manifestation,

which are often preceded by skin or wound infections (Thiele and Bergmann,

2002). The incubation time for protothecosis is not generally known, but in

situations where documented trauma is believed to be the cause (the algae

penetrate the skin following posttraumatic damage) the incubation period

has been approximately 2 weeks. The lesions are slow to develop and do

not usually resolve spontaneously. They can be eczematoid or ulcerative

(Krcmery, 2000), are present mainly in exposed areas, such as the extre-

mities and the face; they generally remain localized, though patients with

cellular immunodeficiency show a trend toward dissemination (Iacoviello

et al., 1992). Infection of the bursa subcutanea olecrani are generally pre-

ceded by injuries or grazing of the elbow; signs and symptoms appear

gradually several weeks following the trauma and include mild induration

of the bursa accompanied by swelling, tenderness, erythema and production

of serosanguineous fluid (Lass-Fllorl and Mayr, 2007).

367

L. BARSANTI ET AL.

Only a few cases of systemic disease have been reported. Most infec-

tions are likely due to traumatic implantation of organisms, but a few cases

of opportunistic infection have also been reported. Arthropod bites were

thought to facilitate transmission of this organism in at least one case (Wirth

et al., 1999). Disseminated protothecosis occurs in immuno-compromised

individuals whose resistance has been weakened by long period of treat-

ment with glucocorticoid steroids (e.g. after transplant or chemotherapy), or

suffering from diseases such as diabetes, systemic lupus erythematosus,

malignancy, or renal failure. A few cases of protothecosis in patients with

AIDS have been described, but HIV disease is not a primary predisposing

form of immunosuppression (Laeng et al., 1994). The organs most com-

monly affected in dissemination are the skin, subcutaneous tissue, gut,

peritoneum, blood.

Protothecosis as also been diagnoses among other very different spe-

cies such as dogs, cats, sheep, deer, Atlantic salmon, carp, and flying foxes,

(Thiele and Bergman, 2002).

Despite its non-photosynthetic, obligate heterotrophic nature, Prototheca

is known to have retained a plastid with starch granules; recent data indicate

that several metabolic pathways (e.g. carbohydrate, amino acid, lipid, and

isoprenoid) are located in this non-photosynthetic plastid. The reconstruct-

tion of this complex metabolic network could represent a new approach in

the treatment of protothecosis (Borza et al., 2005).

4. Dimensions

Growth of algae is possible over quite wide ranges of forms, sizes and

relative proportion of the parts. Among giant algae, giant kelp Macrocystis

pyrifera (Pheophyta) is a marine alga found along the Pacific coast of North

America from central California to Baja California, (North, 1971). It has

one of the highest growth rates of all macroscopic photoautotrophs (30–60

cm d

í1

; Gerard, 1982) and can grow up to 60 m long. This alga forms ag-

gregations known as kelp forests and the fronds form a dense canopy at the

surface. Therefore, light attenuation is high inside the kelp forest. The

irradiance at 20 m depth could be <1% of the incident light at the surface

(Dean, 1985). Therefore, photosynthetic tissue of a single organism is ex-

posed to a large gradient of light quantity and quality, (Colombo-Pallotta

et al., 2006).

The genus name Macrocystis means “large bladder” and it contains at

least two recognized species: Macrocystis pyrifera, or giant bladder kelp,

sometimes referred to as the sequoia of the sea; and Macrocystis integrifolia

the small perennial kelp. In the Northern hemisphere it occurs only along the

Pacific coasts of Canada, the United States and Baja California. Populations

368

HOW ODD ALGAE CAN BE

of Macrocystis in the North Pacific extend from Alaska to localities of cool,

up welled water in Baja California. The kelp beds along the Pacific coast

are the most extensive and elaborate submarine forests in the world. The

genus is best developed as the species Macrocystis pyrifera from the

southern California Channel Islands to northwestern Baja California.

Macrocystis plays an important role in the marine environment by pro-

viding food and habitat for a wide range of marine invertebrates and fishes

in southern California. Forests of giant kelp may support millions of indi-

vidual organisms and more than 1,000 species of marine plants and animals,

(Hepburn and Hurd, 2005). Kelp begins life as a microscopic spore that

grows into a tiny male or female plant called a gametophyte. These plants

produce eggs and sperm, which fertilize and grow to form the large plants

(sporophytes), which in turn release many new spores to start the process

over again. The minimum amount of time needed to complete the Macrocy-

stis life cycle is believed to be 12 to 14 months although in the environ-

ment, grazing by animals and shading by other plants would affect this rate

of development (Dayton, 1985).

The average kelp plant is capable of releasing trillions of spores a year.

Few, if any, of the billions of spores produced by a single mature Macrocystis

kelp plant ever make it to adult gametophytes due to burial by sand or mud

(sedimentation), competition for limited space with other plant or animal

species, the lack of light at the ocean floor due to absorption by the water or

shading by kelp and other plant species, nutrient limitation, and the effects

of animals which graze on the tiny plants. Only 1 in 100,000 young kelp

plants need to mature to reestablish the kelp beds. As the fertilized eggs

develop into microscopic sporophytes, they must avoid shading and over-

growth by other organisms; grazing by small echinoids, gastropods, micro-

crustaceans and the bat star (Patiria) as well as being buried and abraded by

sediments, (Harrold and Reed, 1985).

Although giant kelp plants are perennial, the individual fronds only sur-

and deteriorate about 6 months after they are produced. Mature fronds con-

tinually develop, then die and break away in a process known as sloughing,

giving way to the new fronds shooting up from the holdfast. Although the

individual fronds only survive for about 6 months, individual blades last

only about 4 months, (Lobban and Harrison, 1994).

At the other extreme dimensions, there are eukaryotic algae with a

diameter of <2–3 µm, the so-called “picoeukaryotes”. Up to now the smallest

of the small eukaryotic phytoplankton is considered Ostreococcus tauri

(Chlorophyta) (Derelle et al., 2006). The size of this organism is about that

of a typical bacterium. Its genome is equally remarkable for its small size

and extreme compactness; it is also unexpectedly complex and provides a

369

vive for about 6–9 months. Fronds of mature kelp plants become senescent

L. BARSANTI ET AL.

fascinating glimpse into the genetic makeup and metabolic potential of the

smallest known eukaryote at the base of the marine food chain (Archibald,

2006).

Ostreococcus tauri, together with its close relatives, has become the

focus of concerted efforts to understand the global distribution and eco-

logical significance of eukaryotic picoplankton. Ostreococcus tauri was

first discovered in 1994 in France’s Thau lagoon, a shallow offshoot of the

Mediterranean Sea known for its oyster farming. Barely 1 µm in diameter

and practically invisible under the light microscope, O. tauri was detected

by flow cytometry and hailed as the “smallest eukaryotic organism” (Courties

et al., 1994). Its ultrastructure proved to be shockingly simple: O. tauri cells

lack flagella and a cell wall and contain one mitochondrion, one chloroplast,

a single Golgi apparatus, and a nucleus containing a single nuclear pore.

Molecular data (Guillou et al., 2004) indicate that O. tauri belongs to a

class of green algae called Prasinophyceae, a lineage thought to be of key

importance in elucidating the earliest events in the evolution of chlorophyll

b-containing organisms. Ostreococcus tauri appears to be ubiquitous in coa-

stal waters and in the open ocean, and its minimal cell structure and high

growth rate have made it a promising model picoeukaryote.

The complete genome sequence weighs 12.56 Mbp and is composed of

20 linear chromosomes, making it among the smallest, although not the

smallest, nuclear genome of a free-living eukaryote characterized thus far

(that honor belongs to the 9.2-Mbp genome of the fungus Ashbya gossypii

(Dietrich et al., 2004). Derelle et al. (2006) raise the possibility that chro-

mosome 2 is a sex chromosome, however meiosis has never been observed

in O. tauri, although the presence of a near-complete set of meiotic genes

encoded in its genome suggests that sex is at least a possibility (Ramesh

et al., 2005).

What does such a small genome reveal about the cell biology and

metabolism of this tiny alga? The genome possesses complete or nearly

complete gene sets for proteins involved in cell division, starch metabolism,

and nitrogen assimilation, as well as a diverse set of transcription factors and

proteins with putative kinase- and calcium-binding domains. As expected, a

complete suite of enzymes essential for carbon fixation and the Calvin cycle

are present, as is a complex gene family encoding prasinophyte-specific

light-harvesting antenna proteins. Most unexpected is the presence of genes

implicated in C4 photosynthesis. C4 carbon fixation is an improvement

over the simpler and more ancient C3 carbon fixation strategy used by most

algae and plants. C4 photosynthesis is thought to have evolved multiple times

from C3 ancestors. Although timing is uncertain, it is currently thought to

have first evolved 24–35 million years ago in relation to environmental

pressures (e.g. declining atmospheric CO

) (Giordano et al., 2005; Sage,

370

HOW ODD ALGAE CAN BE

2004). Both C3 and C4 methods overcome the tendency of ribulose-1,5-

biphosphate carboxylase-oxygenase (rubisco, the first enzyme in the Calvin

cycle) to waste energy by using oxygen to break down carbon compounds

to CO

. C4 plants separate rubisco from atmospheric oxygen, fixing carbon

in the mesophyll cells and using oxaloacetate and malate to ferry the fixed

carbon to rubisco and the rest of the Calvin cycle enzymes isolated in the

bundle-sheath cells. The intermediate compounds both contain four carbon

atoms, hence the name C4. This process has evolved repeatedly in higher

plants as an adaptation to environmental stress (e.g. drought and low CO

concentrations) and involves modifications to leaf structure and altered

biochemistry (Sage, 2004). The existence of C4 photosynthesis in phyto-

plankton is controversial, but O. tauri appears to possess the right combi-

nation of enzymes in the right cellular locations to drive such a process, and

genes putatively encoding all enzymes required for C4 photosynthesis were

identified in its genome. Much experimentation will be required to de-

termine whether C4 photosynthesis actually occurs in the tiny cells of

O. tauri, but it is significant that its genome does not encode any obvious

“carbon-concentrating mechanism” (CCM) genes comparable with those in

Chlamydomonas or common to organisms that actively or passively enhance

inorganic carbon influx.

Despite its energetic cost, if O. tauri is capable of C4 photosynthesis, it

could constitute a critical ecological advantage in conditions of high cell

density and low CO

levels typical of phytoplankton blooms, especially

when competitors have lower CCM efficiencies or no CCM at all.

A very interesting algal feature as to relative proportions of the parts can

be found in the algae belonging to the family Characeae and expecially in

Chara corallina, (Yamamoto et al., 2006). The main axis of this alga con-

sists of regularly alternating discoidal nodal and long cylindrical internodal

cells that elongate up to 20 cm with a diameter of 1 mm. These cells are so

large that microelectrodes can be easily inserted for electrophysiological

studies. These cells contain well over a thousand nuclei, which are produced

by the replication of a single original nucleus by a process that does not

involve the typical mitotic apparatus. This high number of nuclei is

presumably required to balance the large increase in cell volume, which is

mediated by development of a large internal vacuole. The cytoplasm nearest

the central vacuole of these cells is an ideal site for visualizing cytoplasmic

streaming resulting from microfibrillar activity (Northnagel and Webb,

1982). Such streaming is necessary to achieve mixing and long distance

transport of cell constituent in long cells having large cytoplasmic volume,

which cannot rely on simple diffusion for the transportation and distribution

of essential molecules throughout the cell. Probably owing to this large size,

cytoplasmic streaming in characean algal cells is very fast (about 70 µm s

–1

371

L. BARSANTI ET AL.

at 20°C). The cytoplasm flows in a direction nearly parallel to the long axis

of the cylindrical internodal cell. It goes up along the inner surface of one

hemicylinder to the upper node, turns and comes down along the other he-

micylinder to the lower node, and then turns and goes up again. There exist

areas between the two hemicylinders where the direction of flow reverses

(neutral zones).

It is known that this cytoplasmic streaming is generated by the sliding

movement of a myosin along the actin cables fixed on the surface of chloro-

plasts lining the cytosolic face of the cell membrane (Kamitsubo, 1966;

Kachar and Reese, 1988; Yamamoto et al. 1994; Kashiyama et al., 2000).

Myosin from Chara corallina is very fast, moving actin filaments at 40–50

µm/s in the in vitro motility assay. This sliding velocity is about 10 times

faster than that of the fast skeletal muscle myosin (6 µm/s in the rabbit).

Chara myosin has shown to possess unique kinetic features suited for this

fast movement, namely, a dramatic acceleration of ADP release by actin

and extremely fast ATP binding rate (Ito et al., 2003; Ito et al., 2007).

5. Bloom-linked Phenomena

In general, the growth rate of a population of algae would be proportional to

the uptake rate of one limiting factor (i.e. factor available in the smallest

quantity with respect to the requirement of the alga). When the limiting

factor is a nutrient, nutrient-limited growth is usually modeled with a Monod

(or Michaelis-Menten) equation:

µ = µ

max

[LN]/([LN]+ K

)

where µ is the specific growth rate of the population as a function of [LN];

[LN] is concentration of limiting nutrient; µ

max

is maximum population

growth rate (at “optimal” conditions) and K

is the Monod coefficient, also

called the half-saturation coefficient because it corresponds to the concen-

tration at which µ is one-half of its maximum. When the concentration of

limiting nutrient [LN] equals K

, the population growth rate is µ

max

/2.

As [LN] increases, µ ҏҏincreases and so the number of cells (algal

population) increases. Beyond a certain [LN], µ ҏtends asymptotically to its

maximum (µ

max

), and the population tends to its maximum yield. If this

concentration is not maintained, rapidly primary productivity returns to a

level comparable to that prior to the nutrient enrichment. This productivity

variation produces seasonal blooming (Barsanti and Gualtieri, 2006).

Normal becomes abnormal when there is a continuous over-stimulation

of the system by excess supply of one or more limiting nutrients, which leads

372

HOW ODD ALGAE CAN BE

to intense and prolonged algal blooms throughout the year. The continuous

nutrient supply sustains a constant maximum algal growth rate, (Lapointe,

1997; Riegman et al., 1992). Therefore, instead of peaks of normal blooms,

followed by periods when phytoplankton is less noticeable, continuous

primary production occurs (See images of abnormal algal blooms that were

recently reported in the news off Canada’s west coast at http://www-

sci.pac.dfo-mpo.gc.ca/osap/data/SearchTools/SearchSatellites_e.asp), (Kutser

et al., 2006). In this process, the enhanced primary productivity triggers

various physical, chemical and biological changes in autotroph and hetero-

troph communities, as well as changes in processes in and on the bottom

sediments and changes in the level of oxygen supply to surface water and

oxygen consumption in deep waters. Blooms can result in a series of

undesirable effects. Excessive growth of planktonic algae increases the

amount of organic matter settling to the bottom. This may be enhanced by

changes in the species composition and functioning of the pelagic food web

by stimulating the growth of small flagellates rather than larger diatoms,

which leads to lower grazing by copepods and increased sedimentation. In

areas with stratified water masses, the increase in oxygen consumption can

lead to oxygen depletion and changes in community structure or death of

the benthic fauna. Bottom dwelling fish may either die or escape. Harmful

algal blooms may cause discoloration of the water, foam formation, death of

benthic fauna and wild or caged fish, or shellfish poisoning of humans,

(Sellmer et al., 2003; Smayda, 1990; Van Dolah, 2000; Carmichael, 2001;

Heil et al., 2005).

Under bloom conditions, single cell level features such as the carbonate

covering structures of Haptophyta (coccoliths) and the luminescent organel-

les of Dinophyta (scintillons) give rise to impressive phenomena that will be

described in the following.

5.1. MILKY WATERS

Some marine organisms combine calcium with carbonate ions in the pro-

cess of calcification to manufacture calcareous skeletal material. Calcium

carbonate (CaCO

) may either be in the form of calcite or aragonite, the

latter being a more soluble form. After death, this skeletal material sinks

and is either dissolved, in which case CO

is again released into the water,

or it becomes buried in sediments. This bound CO

is thus removed from

the carbon cycle.

The calcification process can be summarized by the following reaction:

+ 2HCO

–

ļ CaCO

+ CO

+ H

373

L. BARSANTI ET AL.

The amount of CO

taken up in the carbonate skeletons of marine orga-

nisms has been, over geological time, the largest mechanism for absorbing

. At present, it is estimated that about 50*10

tonnes of CO

occurs as

limestone, 12*10

tonnes in organic sediments, and 38*10

tonnes as

dissolved inorganic carbonate.

Among the marine organisms responsible for calcification, coccolitophores

play a major role, especially Emiliania huxleyi, (Jordan and Chamberlain,

1997). When the blooms of this haptophyte appear over large expanses of

the ocean (white water phenomenon), myriad effects on the water and on

the atmosphere above can be observed. Although each cell is invisibly small,

there can be as many as a thousand billion billion (10

) of them in a large

bloom, and the population as a whole has an enormous impact. E. huxley

blooms are processed through the food web, with viruses, bacteria and zo-

oplankton all contributing to their demise and decomposition. Some debris

from the bloom survives to sink to the ocean floor, taking chemicals out of

the water column. While they live and when they die, the phytoplankton cells

leak chemicals into the water. A bloom can be thought of as a massive

chemical factory, extracting dissolved carbon dioxide, nitrate, phosphate,

etc. from the water, and at the same time injecting other chemicals such as

oxygen, ammonia, DMS (dimethyl sulfide) and other dissolved organic

compounds into the water, (Gabric et al., 2001; Lomans et al., 2002). At the

same time, this chemical factory pumps large volumes of organic matter

and calcium carbonate into the deep ocean and to the ocean floor, (Fasham,

2003; Sarmiento and Gruber, 2004). Some of this calcium carbonate even-

tually ends up as chalk or limestone marine sedimentary rocks, perhaps to

cycle through the Earth’s crust and to reappear millions of years later as

mountains, hills and cliffs, (Anbar and Knoll, 2002). Coccolithophorids are

primarily found at low abundance in tropical and subtropical seas, and at

higher concentrations at high latitudes in midsummer, following diatom

blooms, (Iida et al., 2002). Hence, export of inorganic carbon by diatoms in

spring at high latitudes can be offset by an efflux of carbon to the atmos-

phere with the formation of coccolithophore blooms later in the year.

Coccolithophores influence regional and global temperature, since they

can affect ocean albedo (i.e. a ratio of scattered to incident electromagnetic

radiation power) and ocean heat retention, and causing a sort of greenhouse

warming effect. Coccoliths do not absorb photons, but they are still optically

important since they act like tiny reflecting surfaces, diffusely reflecting the

photons (Fukushima et al., 2000).

A typical coccolith bloom (containing 100 mg m

–3

of calcite carbon) can

increase the ocean albedo from 7.5% to 9.7% . A global satellite study by

Brown and Yoder (1994) detected an annual area of blooms of 1.4*10

;

374

HOW ODD ALGAE CAN BE

if each bloom is assumed to persist for about a month, then this annual

coverage will increase the global annual average planetary albedo by

(9.7–7.5)

(1/12)

(1.4/510) = 0.001%

where 510*10

is the surface area of the Earth.

This is a lower bound on the total impact, because sub-bloom concen-

tration coccolith light scattering will have an impact, over much larger areas

(estimated maximum albedo impact = 0.21%). A 0.001% albedo change

corresponds to a 0.002 W m

–2

reduction in incoming solar energy, whereas

an albedo change of 0.21% causes a reduction of 0.35 W m

–2

. These two

numbers can be compared to the climate forcing due to anthro-pogenic

addition of CO

since the 1700’s, estimated to be about 2.5 W m

–2

Coccolith light scattering is therefore a factor of only secondary importance

in the radiative budget of the Earth. However, this scattering causes more

heat and light than usual to be pushed back into the atmosphere; it causes

more of the remaining heat to be trapped near to the ocean surface, and only

allows a much smaller fraction of the total heat to penetrate to deeper in

the water. Because it is the near-surface water which exchanges heat with

the atmosphere, all three of the effects just described conspire to mean that

coccolithophore blooms may tend to make the overall water column dra-

matically cooler over an extended period, even though this may initially be

masked by a warming of the surface skin of the ocean (the top few meters),

(Tyrrell, 2002).

As above said, coccolithophores are unique in that they take up bicar-

bonate (HCO

–

), with which to form the calcium carbonate of their coccoliths.

There are three forms of dissolved carbon in seawater: CO

, HCO

–

and CO

–

;

and carbon can shift very easily from being in one of these dissolved forms

to being in another. How much of the total carbon is in each form is de-

termined mainly by the alkalinity and by the water temperature. When the

seawater carbon system is perturbed by coccolithophore cells removing

HCO

–

to form coccoliths, this causes a re-arrangement of how much carbon

is in each dissolved form, and this rearrangement takes place more or less

instantaneously. The removal of 2 HCO

–

molecules and the addition of one

molecule changes the alkalinity and this indirectly causes more of the

dissolved carbon to be pushed into the CO

form. Although the total dis-

solved carbon is obviously reduced by removal of dissolved carbon (bicar-

bonate ions) into solid calcium carbonate, yet the total effect, paradoxically,

is to produce more dissolved CO

in the water. In this way, coccolithophore

blooms tend to exacerbate global warming (by causing increased atmospheric

), rather than to ameliorate it, as is the case when dissolved CO

goes into

new organic biomass (Chuck et al., 2005). However, additional properties

375

L. BARSANTI ET AL.

of coccoliths may make the situation yet more complicated. Coccolith calcite

is rather dense (2.7 kg per liter compared to seawater density of 1.024 kg

per liter), and the presence of coccoliths in zooplankton faecal pellets and

‘marine snow’ (the two main forms in which biogenic matter sinks to the

deep ocean) causes them to sink more rapidly. Slow-sinking organic matter

may also adhere to the surfaces of coccoliths, hitching a fast ride out of the

surface waters. If organic matter sinks faster then there is less time for it to

be attacked by bacteria and so more of the locked-in carbon will be able to

escape from the surface waters, depleting the surface CO

. This co-transport

of organic matter with coccoliths has been suggested to offset the atmospheric

increase that would otherwise be caused, and make coccolithophore blo-

oms act to oppose global warming, rather than to intensify it (Neil, 2001).

5.2. BIOLUMINESCENCE

The phenomenon of dinoflagellate bioluminescence has been observed by

sailors from the days of the earliest voyages. That each fleck of the spark-

ling luminescence present in the sea was the flash from a single creature of

minute size rather than the phosphorescence of a chemical substance was

known before the end of the eighteenth century (Harvey, 1952, 1957). The

light emitting properties of some of the dinoflagellates became apparent

because these organisms were on occasion so very plentiful. One of the ear-

liest to be recognized was Noctiluca (Baker, 1753; de Quatrefages, 1850)

because of its large size and the great brightness of its luminescence, as well

as its common occurrence along the shores of Europe. The “red tides” of

Gonyaulax polyedra on the west coast of the United States and the extreme-

ely bright luminescence which accompanied them led to the identification

of this dinoflagellate as luminescent (Kofoid, 1911). Moreover, these micro-

algae are considered responsible for luminous trails observed around moving

ships, dolphins and breaking waves (Rohr et al., 1998, 2002).

Among the relative few species, the luminescence of which has already

been well established, there are: Fragilidium heterolobum, Gonyaulax cate-

nella, Gonyaulax hyaline, Gonyaulax polyedra, Gonyaulax sphaeroidea,

Lingulodinium polyedrum, Noctiluca miliaris, Peridinium brochi, Peridinium

conicum, Peridinium depressum, Peridinium pentagonum, Pyrodinium baha-

mense, Pyrocystis lunula, Pyrocystis noctiluca (Sweeney, 1963).

Three stimuli have been observed to trigger the phenomenon of bio-

luminescence:

x mechanical stimuli – when shear forces, such as those caused by the

stirring of water from the wake of a boat, a swimming fish or a breaking

wave, deform the cell membrane, the dinoflagellates responds in less

than 20 ms with a short flash lasting approximately 100 msec. Deformation

376

HOW ODD ALGAE CAN BE

of the cell surface by forces as small as 10

–6

dyne can trigger dino-

flagellate luminescence (Hickman et al., 1980; Widder and Case, 1981;

Cussatlegras and Le Gal, 2004). The total mechanically stimulated bio-

luminescence has been measured in different species and varies from

photons cell

–1

in Gonyaulax sp. (Seliger et al., 1969) to 6*10

photons cell

–1

in Pyrocystis sp. (Swift et al., 1985; Batchelder et al.,

1992). The light emission is in the blue wavelengths, with the maximum

centered around 473–478 nm (Swift et al., 1973; Hastings and Morin,

1991).

x chemical stimuli – reducing the pH of their external medium by adding

acid can cause some dinoflagellates to glow continuously.

x temperature stimuli – some species of dinoflagellate, such as G. polyhedra,

will be induced to glow if the temperature is lowered.

Whatever the stimulus, the mechanism by which dinoflagellates emit

light, though not completely understood, is always the same, with both a

electrical and a chemical component to the initiation of a flash. The elec-

trical process consists in an action potential during which the inside of the

vacuolar membrane becomes hyperpolarized (it has more negative voltage

with respect to resting potential). This sets up the conditions for the che-

mical reaction. The actual chemical reaction by which light is produced

involves a substrate called luciferin and an enzyme called luciferase, which

are sequestered into out-pocketings of the vacuolar membrane called scintil-

lons. The cellular localization and ultrastructural features of these subcellu-

lar organelles have been elucidated using immunocytochemical techniques

(Nicolas et al., 1987a). These small (about 0.5 µm) spherical organelles,

about 400 per cell, (Fogel and Hastings, 1972; Nicolas et al., 1987b; Fritz

et al., 1990) have a specialized dense matrix and are topologically a part of

the cytoplasmic compartment, since as above said, they occur as evagina-

tions protruding into the cell vacuole. The action potential extrudes hydrogen

ions into the scintillons and lower their pH from 8 to 6. Under these acidic

conditions, luciferin is released from its binding protein and is thus acti-

vated. Luciferase catalyses the oxidation of luciferin, resulting in light and

an intermediate called oxyluciferin. Energy in the form of ATP must be

provided to the system to regenerate luciferin.

The most studied of the many bioluminescent dinoflagellates is Gonyaulax

polyedra. Because its luciferin reacts with the luciferases of all dinoflagellates

tested so far, it is likely to be representative of the group at large. The struc-

ture of dinoflagellate luciferin, determined from Pyrocystis lunula, shows

no similarity to any other luciferin (Nakamura et al., 1989). It is a linear

tetrapyrrole probably derived from chlorophyll and very sensitive to autoxi-

dation. The site of oxidation on the chromophore depends on whether

377

L. BARSANTI ET AL.

the reaction is luciferase-catalyzed, and luminescence accompanies only

the enzymatic reaction. The reaction product is not fluorescent, in contrast

to unoxidized luciferin, which fluoresces brightly with a spectrum matching

that of the bioluminescence (Ȝ

max

about 470 nm) (Hastings, 1978; Wilson

and Hasting, 1998). This paradox is not yet resolved. One possibility is that

the bioluminescence is emitted by an excited transient intermediate, as in

the bacterial reaction. Another is that an excited state formed in the reaction

transfers its energy to still unreacted luciferin. However, studies indicate

that only one luciferin molecule is required for light emission and the bio-

luminescence intensity in the in vitro reaction decays monoexponentially.

Two proteins are involved in Gonyaulax bioluminescence. One is a luciferin

binding protein (LBP), a dimer of two identical 75.5 kDa subunits, which

sequesters luciferin at a physiological pH, protecting it from autoxidation,

and releases it as the pH drops to 6 (Morse et al., 1989). The other, a luci-

ferase (LCF) (137 kDa), is inactive at pH 8 and becomes active exactly in

the pH range at which the LBP makes luciferin available for the reaction.

The two proteins and luciferin are tightly packaged inside the scintillons

(Nicolas et al., 1991, Desjardins and Morse, 1993).

Bioluminescence is an expression of circadian rhythmicity, a pheno-

menon regulated on a daily cycle. In the absence of light, dinoflagellates exhibit

peaks and valleys of bioluminescence. However, the biological clock can

be ‘entrained’ by light exposure, shifting the peaks of luminescence to

different times of day. Circadian control of cellular processes represents an

adaptive advantage for dinoflagellates because they are vertical migrators

in the water column. By keeping time, they can anticipate sunrise and be

poised to start photosynthesizing at the surface as soon as light is available.

Luminescence in G. polyedra and other dinoflagellates is regulated by

an endogenous circadian clock, and is maximum during the dark (night)

phase with light emission that can be 100 times brighter at night than during

the day, (Johnson and Hastings, 1986). Remarkably, both luciferase and

luciferin-binding protein in G. polyedra are destroyed at the end of the night

phase and then synthesized again in the next cycle. Moreover, the scintil-

lons themselves are broken down and reformed each day (Fritz et al., 1990;

Suk Seo and Fritz, 2000); the circadian cycle may actually be viewed as a

daily differentiation of certain cellular processes. Synthesis and destruction

is not the only mode of regulation, even in dinoflagellates. For example,

in Pyrocystis, the amount of luciferase remains constant over the cycle

(Knaust et al., 1998), but its cellular location and responsiveness change

from night to day (Widder and Case, 1982).

Bioluminescence represents a community beneficial gain (Burkenroad,

1943; Esaias and Curl, 1972; Abrahams and Townsend, 1993). In this way,

the “burglar alarm” hypothesis states that dinoflagellates which sense a

378

HOW ODD ALGAE CAN BE

predator emit a flash to alarm a secondary predator that will spot and eat

the first predator. In this way, dinoflagellate bioluminescence increases

predation on crustacean grazers by fishes, hence reducing the grazing

pressure on dinoflagellates.

6. Conclusions

In this review are described some oddities and curiosities of the algal world;

however, algae should not be considered only as curious creatures with

marginal roles in specific niches of the environment, since they do possess

specific and important roles in global ecology and in the dynamic equi-

librium of the biosphere. They have played key roles in shaping Earth’s

biogeochemistry and contemporary human economy, and these roles are

becoming ever more significant as human impacts on ecosystems results in

massive alteration of biogeochemical cycling of chemical elements. Just

think about the Earth’s initial atmosphere, 80% N

, 10% CO/CO

, 10% H

(by volume): no free O

appeared until the development of oxygenic photo-

synthesis by cyanobacteria, transforming the atmosphere composition in

the actual 78% N

, 21% O

0.036% CO

and other minor gases. Or the

petroleum and natural gas we consume as fuels, plastics, dyes, etc… in our

everyday life; these fossilized hydrocarbons are mostly formed by the de-

position of organic matter consisting of the remains of several freshwater

marine microalgae. These remains contain bacterially- and chemically resis-

tant, high aliphatic biopolymers (algaenans) and long-chain hydrocarbons

that are selectively preserved upon sedimentation and diagenesis and make

significant contribution to kerogens, a source of petroleum under appropri-

ate geochemical condition. Moreover, we are still using the remains of

calcareous microorganisms, deposited over millions of years in ancient ocean

basins, for building material. Diatomaceous oozes are mined as addictives

for reflective paints, polishing materials, abrasives and for insulation. The

fossil organic carbon, skeletal remains, and oxygen are the cumulative

remains of algae export production that has occurred uninterrupted for over

3 billions years in the upper ocean.

Algae have been utilized by man for hundreds of years as food for

humans, fodder, remedies and fertilizers. Ancient records show that people

collected macroalgae for food as long as 500 BC in China and one thousand

of years later in Europe, whereas microalgae such as Arthrospira have a

history of human consumption in Mexico and Africa. In the fourteenth

century the Atzecs harvested Arthrospira from Lake Texcoco and used to

make a sort of dry cake called tecuitlatl, and very likely the use of this

cyanobacterium as food in Chad dates back to the same period, or even ear-

lier, to the Kanem Empire (Ninth century).

379

L. BARSANTI ET AL.

Nowadays, algae are commercially exploited for the extraction of hydro-

colloids, as food for humans and animals, fertilizers, cosmetics, nutraceutical

and farmaceutical. Moreover, as million years ago, they are still important

for the biogeochemical cycling of the chemical elements they uptake, assi-

milate, and produce such as Carbon, Oxygen, Nitrogen, Phosphorus, Silicon

and Sulfur. Surging oil prices and shortage of biofuel feed stocks are re-

viving interest in making fuel from algae that could serve as both a viable

energy source and a carbon sink. They are able to produce high level of

hydrocarbons, offering orders of magnitude greater resource potential for

natural oils than any terrestrial crop. In addition, algae consume carbon

dioxide as they grow, so they could be used to capture CO

from power

stations and other industrial plants that would otherwise go into the atom-

sphere (Haag, 2007).

References

Aalbaek, B., Jensen, H.E., and Huda, A.. 1998. Identification of Prototheca from bovine

mastitis in Denmark. APMIS 106: 483–488.

Abrahams, M.V., and Townsend L.D. 1993. Bioluminescence in dinoflagellates: a test of the

burglar alarm hypothesis. Ecology, 74: 258– 260.

Aiello, A. 1985. Sloth hair: unanswered questions. In: The Evolution and Ecology of

Armadillos, Sloths and Vermilinguas. pp. 213–218. Montgomery G.G. Editor. Smithsonian

Institution Press, Washington and London.

Aitchison, C.W. 2001. The effect of snow cover on small animals. In: Snow Ecology.

pp. 229–265. Cambridge University Press: Cambridge.

Albertano, P., Barsanti, L., Passarelli, V., and Gualtieri, P. 2001. A complex photoreceptive

structure in the cyanobacterium Leptolyngbya sp. Micron. 31: 27–34.

Albertano, P., Bruno, L., D’Ottavi, D., Moscone, D., and Palleschi, G. 2000. Effect of

photosynthesis on pH variation in cyanobacterial biofilms from Roman catacombs.

J. Appl. Phycol. 12: 379–384.

Anbar A.D., and Knoll A.H. 2002. Protezoic Ocean Chemistry and Evolution: a bioorganic

bridge? Science, 297: 1137–1142.

Anderson, D.C., and Rushforth R.S. 1977. The cryptogramic flora of desert soil crusts in

southern Utah, USA. Nova Hedwigia, 28: 691–729.

Archibald, J.M. 2006. Genome complexity in a lean, mean photosynthetic machine. Proc.

Natl. Acad. Sci. USA, 103: 11433–11434.

Arrigo, K.R., Dieckmann, G.S., Gosselin, M., Robinson, D.H., Fritsen, C.H., and Sullivan,

C. W. 1995. High resolution study of the platelet ice ecosystem in McMurdo Sound,

Antarctica: biomass, nutrient, and production profiles within a dense microalgal bloom.

Mar. Ecol. Prog. Ser. 127: 255–68.

Arrigo, K.R., Robinson, D.H., and Sullivan, C.W. 1993. Vertical profiles of the bio-optical

and photophysiological properties of sea ice microalgae within the platelet layer of

McMurdo Sound, Antarctica. J. Phycol. 98: 173–85.

Arrigo, K.R., Sullivan, C.W., and Kremer, J.N. 1991. A bio-optical model of Antarctic sea

ice. J. Geophys. Res. 96: 10581–92.

380

HOW ODD ALGAE CAN BE

Barger, N.N., Herrick, J.E., Van Zee, J., and Belnap, J. 2006. Impacts of biological crust

disturbance and composition on C and N loss from water erosion. Biogeochemistry 77:

247–263.

Barsanti, L., and Gualtieri, P. 2006. Algae: Anatomy, Biochemistry and Biothechnology.

Barsanti, L., Evangelista, V., Frassanito, A.M., Vesentini, N., Passarelli, V., and Gualtieri, P.

2007. Absorption Microspectroscopy, Theory and application in the case of the

photosynthetic compartment. Micron, 38: 197–213.

Batchelder, H.P., Swift, E., and Van Keuren, J.R., 1992. Diel patterns of planctonic bio-

luminescence in the northern Sargasso Sea. Mar. Biol. 113: 329–339.

Belnap, J. 1993. Recovery rates of cryptobiotic crusts: inoculant use and assessment

methods. Great Basin Nat. 53: 89–95.

Belnap, J., and Gardner, J.S. 1993. Soil microstructure in the soil of the Colorado plateau:

the role of the cyanobacterium Microcoleus vaginatus. Great Basin Nat. 53: 40–47.

Belnap, J., and Gillette, D.A. 1997. Disturbance of biological soil crusts: impacts on

potential wind erodibility of sandy desert soils in southeastern Utah. Land Degradat.

Develop. 8: 355–362.

Belnap, J., and Gillette D.A. 1998. Vulnerability of desert biological soil crusts to wind

erosion: the influences of crust development, soil texture, and disturbance. J. Arid

Environ. 39: 133–142.

Bidigare, R.R., Ondrusek, M.E., Kennicutt II, M.C., Iturriaga, R., Harvey, H.R., Hoham,

R.W., and Macko, S.A. 1993. Evidence for a photoprotective function for secondary

carotenoids of snow algae. J. Phycol., 29: 427–434.

Booth, W.E. 1941. Algae as pioneers in plant succession and their importance in erosion

control. Ecology 22: 22–29.

Borza, T., Popescu, C.E., and Lee, R.W. 2005. Multiple metabolic roles for the non-

photosynthetic plastid of the green alga Prototheca wickerhamii. Eukaryotic Cell 4:

253–261.

Breder, R.B. 1927. The courtship of the spotted salamander. Zool. Soc. Bull. N.Y. 30: 50–56.

Brock, T.D. 1967. Micro-organisms adapted to high temperature. Nature, 214: 882–885.

Brock, T.D. 1978. Thermophilic microorganism and life at high temperatures. Springer

Verlag, NY.

Brotherson, J.D., and Rushforth, S.R. 1983. Influence of cryptogamic crusts on moisture re-

lationships of soil in Navajo National Monument, Arizona. Great Basin Nat. 43: 73–78.

Brown, C.W., and Yoder, J.A. 1994 Coccolithophorid blooms in the global ocean.

J. Geophys. Res., 99: 7467–7482.

Bunt, J.S. 1968. Some characteristics of microalgae isolated from Antarctic sea ice. Antarct.

Res. Ser. 11: 1–14.

Bunt, J.S., and Lee C.C. 1970. Seasonal primary production in Antarctic sea ice.

J. Mar. Res.

28: 304–20.

Burkenroad, M.D. 1943. Luminescence burglar alarm hypothesis. J. Mar. Res. 5: 161–164.

Carmichael, W.W. 2001. Health effects of toxin-producing cyanobacteria: the Cyano HABs.

Human Ecol. Risk Assess 7: 1393–1407.

Castenholz, R.W. 1996. Endemism and biodiversity of termophilic cyanobacteria. Nova

Hedvigia, 112: 33–47.

Castenholz, R.W. 1999. Thermophilic blue-green algae and thermal environment. Bacteriol.

Rev. 33: 476–504.

Cinilia, C., Yoon, H.S., Pollio, A., Pinto, G., and Bhattacharya, D. 2004. Hidden biodiver-

sity of the extremophilic Cyanidiales red algae. Mol. Ecol. 13: 1827–1838.

381

Baker, H. 1753. On some luminous water insects. In: Employment for the Microscope.

pp. 399. 3rd edition, 1785, London. (as cited in Harvey, 1957).

Taylor and Francis, Boca Raton, Florida, USA.

L. BARSANTI ET AL.

Colombo-Pallotta, M.F., García-Mendoza, E., and Ladah, L. 2006. Photosynthetic perfor-

mance, light absorption and pigment composition of Macrocystis pyrifera (Laminariales,

Phaeophyceae) blades from different depths. J. Phycol. 42: 1225–1234.

Costa, E.O., Carciofi, A.C., Melville, P.A., Prada, M.S., and Schalch, U. 1996. Prototheca

sp. outbreak of bovine mastitis. Zentralbl. Veterinarmed. B 43: 321–324.

Cota, G. F. 1985. Photoadaptation of High Arctic ice algae. Nature (Lond.) 315: 219–22.

Courties, C., Vaquer, A., Troussellier, M., and Lautier, J. 1994. Smallest eukaryotic orga-

nism. Nature 370: 255

Chuck, A., Tyrrell, T., Totterdell, I.J., and Holligan, P.M. 2005. The oceanic response to

carbon emissions over the next century: investigation using three ocean carbon cycle

models. Tellus 57B: 70–86.

Cuhna, L.T., Pugine, S.P., Valle, C.R., Ribeiro, A.R., Costa, E.J.X., and De Melo, M.P.

2006. Effect of Prototheca zopfii on neutrophil function from bovine milk.

Mycopathologia 162: 421–426.

Cussatlegras, A.S., and Le Gal P. 2004. Bioluminescence of the dinoflagellate Pyrocystis

noctiluca induced by laminar and turbulent couvette flow. J. Exp. Marin Biol Ecol. 310:

227–246.

Dayton, P.K., Rebilliard, G.A., and DeVries, A.L. 1969. Anchor ice formation in McMurdo

Sound, Antarctica, and its biological effects. Science 163: 273–4.

Dayton, P.K. 1985. Ecology of kelp community. Annu. Rev. Ecol. Syst. 16: 215–245.

De Quatrefages, A. 1850. Observations sur les noctiluques. Ann. Sci. Nat. Zool. 14: 236–281.

Dean, T.A. 1985. The temporal and spatial distribution of underwater quantum irradiation in

a Southern California kelp forest. Estuarine Coastal Shelf Science 21: 835–844.

DeNicola, D.M. 1996. Periphyton responses to temperature at different ecological levels. In:

Algal Ecology: freshwater bentic ecosystems. pp. 149–181. Stevenson, R.G., Bothwell,

M.L. and Lowe, R.L., Eds., Academic Press Sand Diego, Ca, USA.

Derelle, E., Ferraz, C., Rombauts, S., Rouzé, P., Worden, A.Z., Robbens, S., Partensky, F.,

Degroeve, S., Echeynié, S., Cooke, R., Saeys, Y., Wuyts, J., Jabbari, K., Bowler, C.,

Panaud, O., Piégu, B., Ball, S.G., Ral, J.P., Bouget, F.Y., Piganeau, G., De Baets, B.,

Picard, A., Delseny, M., Delaille, J., Van de Peer, Y., and Moreau, H. 2006. Genome

analysis of the smallest free-living eukaryote Ostreococcus tauri unveils many unique

features Proc. Natl. Acad. Sci. USA 103: 11647–11652.

Desjardins, M., and Morse, D. 1993. The polypeptide components of scintillons, the bio-

luminescence organelles of the dinoflagellates Gonyaulax polyedra. Biochem. Cell Biol.

71: 176–82.

Dieckmann, G.S., Arrigo, K.R., and Sullivan, C.W. 1992. A high resolution sampler for

nutrient and chlorophyll a

profiles in the sea ice platelet layer and underlying water

column belowfast ice in polar oceans: preliminary results. Mar. Ecol. Prog. Ser. 80:

291–300.

Dietrich, F.S., Voegeli, S., Brachat, S., Lerch, A., Gates, K., Steiner, S., Mohr, C., Pohlmann, R.,

Luedi, P., Choi, S., Wing, R.A., Flavier, A., Gaffney, T.D., and Philippsen, P. 2004. The

Ashbya gossypii Genome as a Tool for Mapping the Ancient Saccharomyces cerevisiae

Genome. Science 304: 304–307.

Di Persio, J.R. 2001. Prototheca and Protothecosis. Clin. Microbiol. Newslett. 23: 115–120.

Dong G.R., Li C.Z., Jin T., Gao S.Y., and Wu, D. 1987. Some results on soil wind-tunnel

imitating experiment. Chinese Science Bulletin 32: 297–301.

Duellman, W.E., and Trueb, L. 1994. Biology of Amphibians. The John Hopkin University

Press, Maryland, USA.

Duelmann, W.E., and Trueb, L. 1986. Eggs and development. In: Biology of Amphibians,

pp. 109–140. McGraw-Hill Book Co. N.Y.

382

HOW ODD ALGAE CAN BE

Edwards, M.R., Hauer, C.A., Stack, R.F., Eisele L.E., and MacColl, R. 1997. Thermopilic

C-phycocyanin: effect of temperature, monomer stability and structure. Biochim.

Biophys. Acta 1321: 157–164.

Edwards, M.R., MacColl, R., Williams, E.C., and Eisele, L.E. 1996. Some physical

properties of an unusual C-phycocyanin isolated from a photosynthetic thermophile.

Biochim. Biophys. Acta 1276: 64–70.

Eisele, L.E., Bakhru, S.H., Liu, X., MacColl R., and Edwards, M.R. 2000. Studies on C-

phycocianin from Cyanidium caldarium, a eukaryote at the extremes of habitat. Biochim.

Biophys. Acta 1456: 99–107.

Ernst, C.H., and Norris, J.M. 1978. Observations on the algal genus Basicladia and the red-

bellied turtle, Chrysemys rubriventris. Estuaries. 1: 54–57.

Esaias, W.E., and Curl, H.C. 1972. Effects of dinoflagellate luminescence on copepod

ingestion rates. Limnol. Oceanogr. 17: 901–906.

Evans, R.D., and Johansen, J.R. 1999. Microbiotic crusts and ecosystem processes. Crit. Rev.

Plant Sci. 18: 183–225.

Fasham, M.J.R. 2003. Ocean Biogeochemistry. Springer-Verlag, Berlin.

Fletcher, J.E., and Martin, W.P. 1948. Some effects of algae and moulds in the rain crust of

desert soils. Ecology 29: 95–100.

Fogel, M., and Hastings, J.W. 1972. Bioluminescence: mechanism and mode of control of

scintillon activity. Proc. Natl. Acad. Sci. U.S.A. 69: 690– 693.

Fogg, G.E. 1969. Survival of algae under adverse conditions. Symposia for the Society of

Experimental Biology. 23: 123–142.

Freidenburg, L.K., and Skelly, D.K. 2004. Microgeographical variation in thermal reference

by an amphibian. Ecol. Lett. 7: 369–373.

Fritz, L., Morse, D., and Hastings, J.W. 1990. The circadian bioluminescence rhythm of

Gonyaulax is related to daily variations in the number of light-emitting organelles.

J. Cell. Sci. 95: 321–328.

Fukushima, H., Toratani, M., and Saitoh, S. 2000. Spectral reflectance of coccolithophore

blooming in the Bering sea: comparison of ship-measurements and sea-wide field-of-

view scanner observations. In: Proceedings of International Symposium on Remote

Sensing. pp. 263–270. Corean Society of Remote Sensing.

Gabric A., Gregg W., Najjar R., Erickson D., and Matrai, P. 2001. Modeling the bio-

geochemical cycle of dimethylsulfide in the upper ocean: a review. Chemosphere –

Global Change Science. 3: 377–392.

Gattuso, J.-P., Gentili, B., Duarte, C.M., Kleypas, J.A., Middelburg, J.J., and Antoine, D.

2006. Light availability in the coastal ocean: impact on the distribution of benthic

photosynthetic organisms and contribution to primary production. Biogeoscience

3: 489–

513.

Gatz, A.J. 1973. Algal entry into the eggs of Ambystoma maculatum. J. Herpetol. 7: 137–138.

Gerard, V. 1982. Growth and utilization of internal nitrogen reserves by the giant kelp

Macrocystis pyrifera in a low-nitrogen ambient. Mar. Biol. 66: 27–35.

Gilbert, P.W. 1942. Observations on the eggs of Ambystoma maculatum with especial

reference to the green algae found within the egg envelopes. Ecology 23: 215–227.

Gilbert, P.W. 1944. The alga–egg relationship in Ambystoma maculatum, a case of

symbiosis. Ecology 25: 366–369.

Gillette, D.A., and Dobrowolski, J.P. 1993. Soil crust formation by dust deposition at

Shaartuz, Tadahik, S.S.K. Atmosphere Environment 27A: 2519–2525.

383

Giese, A.C. 1973. Cell Physiology, 4th ed. W.B. Saunders Co., Philadelphia, USA.

L. BARSANTI ET AL.

Gilmore, D.P., Da Costa, C.P., and Duarte, D.P.F. 2001. Sloth biology: an update on their

physiological ecology, behavior and role as vectors of arthropods and arboviruses. Braz.

J. Med. Biol. Res. 34: 9–25

Giordano, M., Beardall, J., and Raven, J.A. 2005. CO

concentrating mechanisms in algae:

mechanisms, environmental modulation and evolution. Annual Rev. Plant Biol. 56:

99–131.

Goodman, D. 1971. Ecological Investigations of ice worms on Casement Glacier, South-

eastern Alaska. The Ohio State University Research Foundation, Institute of polar

studies report No. 39: 59.

Grossi, S.M., Kottmeier, S.T., Moe, R.L., Taylor, G.T., and Sullivan, C.W. 1987. Sea ice

microbial communities. VI. Growth and primary production in bottom ice under graded

snow cover. Mar. Ecol. Prog. Ser. 35: 153–64.

Guillou, L., Eikrem, W., Chrétiennot-Dinet, M. J., Le Gall, F., Massana, R., Romari, K.,

Pedrós-Alió, C., and Vaulot, D. 2004. Diversity of Picoplanktonic Prasinophytes Assessed

by Direct Nuclear SSU rDNA Sequencing of Environmental Samples and Novel Isolates

Retrieved from Oceanic and Coastal Marine Ecosystems. Protist 155: 193–214.

Haag, A.L. 2007. Algae bloom again. Nature 447: 520–521.

Hanisak, M.D., and Blair, S.M. 1988. The deep-water macroalgal community of the East

Florida continental shelf (USA). Helgol. Meeresunt. 42: 133–63.

Harrold, C., and Reed D. 1985. Food availability, sea urchin grazing, and kelp forest com-

munity structure. Ecol. 66: 1160–1169.

Harvey, E.N. 1952. Bioluminescence. Academic Press, New York.

Harvey, E.N. 1957. A history of luminescence from the earliest times until 1900. American

Philosophical Society, Philadelphia.

Hasting, J.W. 1978. Bacterial and dinoflagellates luminescent system. In: Bioluminescence

in Action. pp. 129–170. Herring, P.J. Ed. Academic Press Inc., London.

Hastings, J.W., and Morin, J.G. 1991. Bioluminescence. In: Neural and Integrative Animal

Physiology. pp. 131–170. Prosser, C.L. Ed. Wiley-Interscience, NY.

Hay, M.E., Parker, J.D., Burkepile, D.E., Caudill, C.C., Wilson, A.E., Hallinan, Z.P., and

Cheque, A.D. 2004. Mutualism and aquatic community structure: the enemy of my

enemy is my friend. Ann. Rev. Ecol. Sistem. 35: 175–197.

Heil, C.A., Glibert, P.M., and Fan, C. 2005. Prorocentrum minimum (Pavillard) Schiller.

A review of a harmul algal bloom species of growing worldwide importance. Harmul

Algae, 4: 449–470.

Hepburn, C.D., and Hurd, C.L. 2005. Conditional mutualism between the giant kelp

Macrocystis pyrifera and colonial epifauna. Mar. Ecol. Prog. Ser. 302: 37–48.

Hickman, G.D., Staples, R.F., and Lynch, R.V. 1980. Bioluminescence of the World’s Oceans:

technical assessment. Applied Science Technology Report, ASTR-R-080880.

Hodges, R.T., Holland, J.T.S., Neilson, F.J.A., and Wallace, N.M., 1985. Prototheca zopfii

mastitis in a herd of dairy cows. N. Z. Vet. J. 33

: 108–111.

Hoham, R.W., and Blinn, D.W. 1979. Distribution of cryophilic algae in an arid region, the

American Southwest. Phycologia. 18: 133–145.

Hu, C., Liu, Y., Song, L., and Zhang, D. 2002. Effect of desert soil algae on the stabilization

of fine sands. J. Appl. Phycol. 14: 281–292.

Hu, C., Zhang, D., Huang, Z., and Liu, Y. 2003. The vertical microdistribution of cyano-

bacteria and green algae within desert crusts and the development of the algal crusts.

Plant Soil 257: 97–111.

Hu, M.C., Liu, Y.Z., Wu, L., Yang, Z.T., and Wu, D. 1991. A experimental study in wind

Tunnel on wind erosion of soil in Korqin Sandy Land. Chinese J. Desert Research

11: 22–29.

384

HOW ODD ALGAE CAN BE

Iacoviello, V., deGirolami, P., Lucarini, J., Sutker, K., Williams, M., and Wanke, C. 1002.

Protothecosis complicating prolonged endotracheal intubation: case report and literature

review. Clin. Infect. Dis. 15: 959–967.

Iida, T., Saitoh, S.I., Miyamura, T., Toratani, M., Fukushima, H., and Shiga, N. 2002. Tem-

poral and spatial variability of coccolitophore blooms in the eastern Bering sea, 1998-

2001. Prog. Oceanogr. 55: 165-175.

Ito, K., Ikebe, M., Kashiyama, T., Mogami, T., Kon, T., and Yamamoto, K. 2007. Kinetic

Ito, K., Kashiyama, T., Shimada, K., Yamaguchi, A., Awata, J., Hachikubo, Y., Manstein,

D.J., and Yamamoto, K. 2003. Recombinant motor domain constructs of Chara corallina

myosin display fast motility and high ATPase activity. Biochem. Biophys. Res. Commun.

312: 958–964.

Janosi, S., Ratz, F., Szigeti, G., Kulcsar, M., Kerenyi, J., Lauko, T., Katona, F., and

Huszenicza, G., 2001. Review of the microbiological, pathological, and clinical aspects

of bovine mastitis caused by the alga Prototheca zopfii. Vet. Q. 23: 58–61.

Johansen, J.R. 1993. Cryptogamic crusts of semiarid and arid lands of North America.

J. Phycol. 29: 140–147.

Johnson, C.H., and Hastings, J.W. 1986. The elusive mechanism of the circadian clock. Am.

Sci. 74: 29–36.

Jordan, R.W., and Chamberlain A.H.L. 1997. Biodiversity among haptophyte algae.

Biodivers. Conservat. 6: 131–152.

Joshi, K., Gavin, J., and Wheeler, E. 1975. The ultrastructure of Prototheca wickerhamii.

Mycopathologia 56: 9–13.

Kachar, B., and Reese, T.S. 1988. The mechanism of cytoplasmic streaming in chara-

cean algal cells: sliding of endoplasmic reticulum along actin filaments. J. Cell Biol. 106:

1545–1552

Kamitsubo, E. 1966. Motile protoplasmic fibrils in cells of Characeae. II. Linear fibrillar

structure and its bearing on protoplasmic streaming. Proc. Japan Acad. 42: 640–643.

Kashiyama, T., Kimura, N., Mimura, T., and Yamamoto, K. 2000. Cloning and characteri-

zation of a myosin from characean alga, the fastest motor protein in the world.

J. Biochem. 127: 1065–1070.

Kawecka, B. 1986. Ecology of snow algae. Pol. Polar Res., 7: 407–415.

Kikuchi, Y. 1994. Glaciella, a new genus of freshwater Canthocampyidae (Copepoda

Harpacticoida) from a glacier in Nepal, Himalayas, Hydrobiologia, 192–193: 59– 66.

Knaust, R., Urbig, T., Li, L., Taylor, W., and Hastings, J.W. 1998. The circadian rhythm of

bioluminescence in Pyrocystis is not due to differences in the amount of luciferase: a

comparative study of three bioluminescent marine dinoflagellates. J. Phycol. 34: 167–72.

Koenig, D., and Ward, H. 1983. Prototheca zopfii Kruger strain UMK-13 growth on acetate

or n-alkanes. Appl. Environ. Microbiol. 45: 333–336.

Kofoid, C.A. 1911. Dinoflagellata of the San Diego region. IV. The genus Gonyaulax, with

notes on its skeletal morphology and a discussion of its generic and specific characters.

Univ. Calif. Pub. Zool., 8: 188–269.

Kohshima, S., Seko, K., and Yoshimura, Y. 1993. Biotic acceleration of glacier melting in

Yala Glacier, Langtang region, Nepal Himalaya. Snow and Glacier Hydrology.

Proceeding of the Kathumandu Symposium, November 1992 IAHS Publication 218:

309–316.

Kohshima, S. 1984. A novel cold-tolerant insect found in a Himalayan glacier. Nature 310:

225–227

Kol, E. 1969. The red snow of Greenland. II. Acta Bot. Acad. Sci. Hung. 15: 281–289.

385

19545.

mechanism of the fastest motor protein, Chara myosin. J. Biol. Chem. 282: 19534–

L. BARSANTI ET AL.

Kol, E., and Eurola, S. 1974. Red snow algae from Spitsbergen. Astarte 7: 61–66.

Krcméry, V. Jr. 2000. Systemic chlorellosis, an emerging infection in humans caused by

algae. Int. J. Antimicrob. Agents 15: 235–237.

Kruger, W. 1894. Kurt charakteristik einiger niederer organismen in safttlusse der laubba-

ume. Hedwigia 33: 216–251.

Kutser, T., Metsamaa, L., Strombek, N., and Vahtmae, E. 2006. Monitoring cyanobacterial

bloom by satellite remote sensing. Estuarine Coastal Shelf Science, 67: 303–312.

Laeng, R.H., Egger, C., Schaffner, T, Borisch, B., and Pedrinis, E. 1994. Protothecosis in an

HIV-positive patient. Am. J. Surg. Pathol. 18: 126l–1264.

Lapointe, B.E. 1997. Nutrient thresholds for bottom-up control of macroalgal blooms on

coral reefs in Jamaica and southeast Florida. Limnol Oceanogr 42: 1119–1131.

Lass-Flörl, C., and Mayr, A. 2007. Human protothecosis. Clin. Microbiol. Rev. 20: 230–242.

Lerche, M., 1952. Eine durch Algen (Prototheca) hervorgerufene Mastitis der Kuh. Berl.

Mu¨nch. Tierarztl.Wochenschr. 4: 64–69.

Lewbel, G.S., Wolfson, A., Gerrodette, T., Lippincott, W.H., Wilson, J.L., and Littler, M. M.

1981. Shallow-water benthic communities on California’s outer continental shelf. Mar.

Ecol. Prog. Ser. 4: 159–68.

Lewin, R.A., and Robinson P.T. 1979. The greening of polar bears in Zoos. Nature, 278:

445–447.

Leya, T., Muller, T., Ling, H.U., and Fuhr, G. 2000. 1 Taxonomy and Biophysical Properties

of Cryophilic Microalgae and Their Environmental Factors in Northwest Spitsbergen,

Svalbard. Proceeding of 57th Easter Snow Conference, Syracuse, New York, USA.

Li, X.R., Wang, X.P., Li, T., and Zhang, J.-G. 2002. Microbiotic soil crust and its effect on

vegetation and habitat on artificially stabilized desert dunes in Tengger Desert, North

China. Biol Fertil Soils 35: 147–154.PER

Ling, H.U., and Seppelt, R.D. 1990. Snow algae of the Windmill Islands, continental

Antarctica. Mesotaenium berggrenii (Zygnematales, Chlorophyta), the algae of grey

snow. Antarctic Science, 2: 143–148.

Lissner, A.L., and Dorsey, J.H. 1986. Deep-water biological assemblages of a hard-bottom

bank-ridge complex of the southern California continental borderland. Bull. South. Calif.

Acad. Sci. 85: 87–101.

Littler, M.M., Littler, D.S., Blair, S.M., and Norris, J.N. 1985. Deepest Known Plant Life

Discovered on an Uncharted Seamount. Science, 227: 57–59.

Liu, Y.D., and Ley, S.H., 1993. On soil algae and their physiological ecology. Acta

Hydrobiologica Sinica 17: 272–277.

Liu, Y.D., Song, L.R., Shen, Y.W., Li, D.H., Hu, C.X., Huang, Z.B., Hu, Z.L., and Zhu, Y.Z.

2001. Potential of terrestrial microalgae and cyanobacteria in environmental technology.

In: Photosynthetic Microorganism in Environmental Biotechnology. pp. 195–216.

Kojima, H. and Lee, Y.K., Eds., Springer, Hong Kong.

Liu, Y.Z., Dong, G.R., and Li, C.Z. 1994. A study on the factors influencing soil erosion

through wind tunnel experiments. Chinese J. of Arid Land Research 7: 359–367.

Lizotte, M.P., and Sullivan C.,W. 1992. Biochemical composition and photosynthate distri-

bution in sea ice microalgae of Mc-Murdo Sound, Antarctica: evidence for nutrient stress

during the spring bloom. Antarct. Sci. 4: 23–30.

Lizotte, M.P., Robinson, D.H., and Sullivan, C.W. 1998. Algal pigment signatures in

Antarctic sea ice. In: Antarctic Sea Ice: Biological Processes, Interactions and Vari-

ability. Antarctic Research Series 73. pp. 93–106. Lizotte, M.P. and Arrigo, K.R., Eds.

American Geophysical Union, Washington, D.C.

Lobban, C.S., and Harrison, P.J. 1994. Seaweeds Ecology and Physiology. Cambridge

University Press, Cambridge, UK.

386

HOW ODD ALGAE CAN BE

Lomans, B.P., van der Drift, C., Pol, A., and Op den Camp, H.J.M. 2002. Microbial cycling

of volatile organic sulfur compounds. Cell. Molec. Life Scienc. 59: 575–588.

Loope, W.L., and Gifford, G.F. 1972. Influence of a soil microfloral crust on select proper-

ties of soils under pinyon-juniper in southeastern Utah. J. Soil Wat. Conser. 27: 164–167.

Machado, G., and Moreira, Vital, D. 2001. On the occurrence of epizoic cyanobacteria and

liverworts on a neotropical harvestman (Aracnida: Opiliones). Biotropica, 33: 535–538.

Markager, S., and Sand-Jensen, K. 1992. Light requirements and depth zonation of marine

macroalgae. Mar. Ecol. Prog. Ser. 88: 83–92.

Maxwell, C.D., and McKenna Neuman, C. 1994. Photoautotrophs and microaggregation of

sand in a freshwater beach-dune complex: implication for sediment transport by wind.

Soil Biol. Biochem. 26: 221–233.

Metting, B. 1981. The systematics and ecology of soil algae. Bot. Rev. 47: 195–312.

Moller, A., Truyen, U., and Roesler, U. 2007. Prototheca zopfii genotype 2. The causative

agent of bovine protothecal mastitis? Vet. Microbiol. 120: 370–374.

Morris, G.J., Coulson, G.E., Clarke, K.J., Grout, B.W.W. and Clarke, A. 1981. Freezing

injury in Chlamydomonas: a synoptic approach. In: Effects of Low Temperatures on

Biological Membranes. pp. 285–306. Morris, G. J. and Clarke, A., Eds. Academic Press,

London.

Morse, D., Pappenheimer, A.M., and Hasting, J.W. 1989. Role of luciferin binding protein in

the circadian luminescent reaction of Gonyaulax polyedra. J. Biol. Chem. 264: 11822–

11826.

Mucher, H.J., Chartres, C.J., Tongway, D.J., and Greene, R.S.B. 1988. Micromorphology

and significance of surface crusts of soils in rangelands near Cobar, Australia. Geoderma

42: 227–244.

Müller, T., Leya, T., and Fuhr, G. 2001. Persistent snow algal fields in Spitsbergen: field

observations and a hypothesis about the annual cell circulation. Arct. Antarct. Alp. Res.

1: 42–51.

Müller, T., Bleiß, W., Martin, C. -D., Rogaschewski, S., and Fuhr, G. 1998. Snow algae from

north Svalbard: their identification, distribution, pigment and nutrient content. Polar

Biology, 20: 14–32.

Nakamura, H., Kishi, Y., Shimoumura, O., Morse, D., and Hasting, J.W. 1989. Structure of

dinoflagellates luciferin and its enzymatic and non-enzymatic air-oxidation products.

J. Am. Chem. Soc. 111: 7607–7611.

Neil, H. 2001. Back to the future: productivity upheaval in a warming ocean. Water &

Atmosphere 9 (4).

Neil, W.T., and Ross Allen, E. 1954. Algae on turtles: some additional considerations. Ecol.

35: 581–584.

Nelson, W.A., and Ryan K.G. 1986. Palmophyllum umbracola sp. nov. (Chlorophyta) from

offshore islands of northern New Zealand. Phycologia, 25: 168–77.

Nicolas, M.T., Morse, D., C.H., Bassot, J.M., Hastings, W. 1991. Colocalization of luciferin

binding protein and luciferase to the scintillons of Gonyoulax polyedra revealed by

double immunolabeling after fast-freeze fixation. Protoplasma 160: 159–166.

Nicolas, M.T., Nicolas, G., Johnson, C.H., Bassot, J.M., and Hastings, W. 1987a. Characteri-

zation of the bioluminescent organelles in Gonyaulax polyedra (dinoflagellates) after fast

freeze fixation and antiluciferase immunogold staining. J. Cell Biol. 105: 723– 735.

Nicolas, M.T., Sweeney, B.M., and Hastings, J.W. 1987b. The ultrastructural localization of

luciferase in three bioluminescent dinoflagellates, two species of Pyrocystis, and Noctiluca,

using antiluciferase and immunogold labelling. J. Cell Science 87, 189–196.

387

L. BARSANTI ET AL.

Noland, R., and Ultsch, G.R. 1981. The roles of temperature and dissolved oxygen in micro-

habital selection by the tadpoles of a frog (Rana pipiens) and a toad (Bufo terrestris).

Copeia, 1981: 645–652.

Normandin, R.F. and Taft, C.E. 1959. A new species of Basicladia from the snail Viviparus

malleatus reeve. Ohio J. Science. 59: 58–62.

North, W. 1971. Growth of individual fronds of the mature giant kelp, Macrocystis. In: The

biology of giant kelp beds (Macrocystis) in California. pp. 123–168. North, W.J., Ed.

Beihefte zur Nova Hedwigia 32. J. Cramer. Lehre.

Nothnagel, E.A., and Webb W.W. 1982. Hydrodynamic models of viscous coupling between

motile myosin and endoplasm in characean algae. J. Cell Biol. 94: 444–454.

Nozaki, H., Ohta, N., Morita, E., and Watanabe, M.M. 1998. Toward a natural system of

species in Chlorogonium (Volvocales Chlorophyta): a combined analysis of morpho-

logical and rbcL gene sequence data. J. Phycol. 34: 1024–1037.

Orr, H. 1888. Note on the development of amphibians, chiefly concerning the central nervous

system; with additional observations on the hypophysis, mouth, and the appendages and

skeleton of the head. Q. J. Microsc. Sci. 29: 295–324.

Palmisano, A.C., and Sullivan, C.W. 1985. Pathways of photosynthetic carbon assimilation

in sea-ice microalgae from Mc-Murdo Sound, Antarctica. Limnol. Oceanogr. 30: 674–8.

Palmisano, A.C., SooHoo, J.B., and Sullivan, C.W. 1987b. Effects of four environmental

variables on photosynthesis-irradiance relationships in Antarctic sea-ice microalgae.

Mar. Biol. 94: 299–306.

Palmisano, A.C., SooHoo, J.B., Moe, R.L., and Sullivan, C.W. 1987a. Sea ice microbial

communities. VII. Changes in under-ice spectral irradiance during the development of

Antarctic sea ice microalgal communities. Mar. Ecol. Prog. Ser. 35: 165–73.

Pinder, A.W., and Friet, S.C. 1994. Oxygen transport in egg masses of the amphibians Rana

sylvatica and Ambystoma maculatum. Convection, diffusion and oxygen production by

algae. J. exp. Biol. 197: 17–30.

Pore, S. 1985, Prototheca taxonomy. Mycopathologia, 90: 129-139.

Pore, S. 1986, The association of Prototheca spp. with slime flux in Ulmus americana and

other trees. Mycopathologia, 94

: 67–73.

Pore, S. 1998a. Prototheca and Chlorella species. In:

Topley and Wilson’s Microbiology

and microbial infections. pp. 631–643. Collier, L.H., Balows, A., and Sussman, M., Eds.

Oxford University Press, Oxford.

Pore, S. 1998b. Prototheca. In: The yeasts, a taxonomic study. pp. 883–887. Kurtzman, C.P.

and Fell, J.W., Eds. Elsevier, New York.

Pore, S., Barnett, E., Barnes, W., and Walker, J. 1983. Prototheca ecology. Mycopathologia,

81: 49–62.

Ramesh, M.A., Malik, S.B., and Logsdon, J.M.Jr. 2005. A phylogenomic inventory of

meiotic genes: Evidence for sex in Giardia and an early eukaryotic origin of meiosis.

Current Biology 15: 185–191.

Riegman, R., Noordeloos, A.A.M., and Cadee, G.C. 1992. Phaeocystis blooms and eutro-

phication of the continental coastal zones of the North Sea. Mar. Biol. 112: 479–484.

Robinson, D.H., Arrigo, K.R., Iturriaga, R. and Sullivan, C.W. 1995. Microalgal light-

harvesting in extreme low-light environments in McMurdo Sound, Antarctica. J. Phycol.

31: 508–20.

Roessler, P.G. 1990. Environmental control of glycerolipid metabolism in microalgae:

commercial implications and future research directions. J. Phycol., 26: 393–399.

Rohr, L., Hyman, M., Fallon, S., and Latz, M.I. 2002. Bioluminescence flow visualization in

the ocean: an initial strategy based on laboratory experiments. Deep-Sea Res., Part 1,

Oceanogr. Res. Pap. 49: 2009–2033.

388

HOW ODD ALGAE CAN BE

Rohr, L., Latz, M.I., Fallon, S., Nauen, J.C., and Hendricks, E., 1998. Experimental

approaches toward interpreting dolphins-stimulated bioluminescence. J. Exp. Biol. 201:

1447–1460.

Ryan, K.G., McMinn, A., Mitchell, K.A., and Trenerry, L. 2002. Mycosporine-Like amino

acids in Antarctic Sea ice algae, and their response to UVB radiation. Z. Naturforsch. 57:

71–477.

Sage, R.F. 2004. The evolution of C4 photosynthesis. New Phytol. 161: 341–370.

Salthe, S.N. 1963. The egg capsules in the Amphibians. J. Morph., 113: 161–171.

Samsonoff, W.A., and MacColl R., 2001. Biliproteins and phycobilisomes from cyano-

bacteria and red algae at the extremes of habitat. Arch. Microbiol. 176: 400–405.

Sarmiento, J.L., and Gruber, N. 2004. Ocean Biogeochemical Dynamics. Princeton University

Press, Princeton, USA.

Sears, J. R., and Cooper, R.A. 1978. Descriptive ecology of offshore, deep-water, benthic

algae in the temperate western North Atlantic. Ocean. Mar. Biol. 44: 309–14.

Seliger, H.H., Biggley, W.H., and Swift, E., 1969. Absolute values of photon emission from

the marine dinoflagellates Pyrodinium bahamense, Gonyaulax polyedra and Pyrocistis

lunula. Photochem. Photobiol. 10: 227– 232.

Sellmer, K.G., Doucette, G.J., and Kirkpatrick, G.J. 2003. Harmuful algal blooms: causes,

impacts and detections. J. Ind. Microbiol. Biotechnol. 30: 383–406.

Shields L.M., and Durrell, L.W. 1964. Algae in relation to soil fertility. Bot. Rev. 47: 195–312.

Smayda, T.J. 1990. Novel and nuisance phytoplankton blooms in the sea: evidence for a

global epidemic. In: Toxic marine phytoplankton. pp. 29–40. Graneli, E., Sundstrom, B.,

Edler, L., and Anderson, D.M., Eds., Elsevier, New York.

Smetacek, V., Scharek, R., Gordon, L.I., Eichen, H., Fuhrbach, E., Rohardt, G. and Moore,

S. 1992. Early spring phytoplankton blooms in ice platelet layers on the southern

Weddell Sea, Antarctica. Deep-Sea Res. 39: 153–68.

SooHoo, J.B., Palmisano, A.C., Kottmeier, S.T., Lizotte, M.P., SooHoo, S.L. and Sullivan,

C.W. 1987. Spectral light absorption and quantum yield of photosynthesis in sea ice

microalgae and a bloom of Phaeocystis pouchetii in McMurdo Sound, Antarctica. Mar.

Ecol. Prog. Ser. 39: 175–89.

Spalding, H.. Foster, M.S. and Hein, J.N. 2003. Composition, Distribution, and abundance of

deep water (30 m) macroalgae in central California. J. Phycol. 39: 273–284

St. Clair L.L., Johansen J.R. and Webb, B.L. 1986. Rapid stabilization of fire-disturbed sites

using a soil crust slurry: inoculation studies.

Reclamation and Revegetation Research 4:

261–269.

Suk Seo, K., and Fritz, L. 2000. Cell ultrastructural changes correlate with circadian rhythms

in Pyrocystis lunula (Pyrrophyta). J. Phycol. 36: 351–358.

Sweeney, B.M. 1963. Bioluminescence. Biol. Bull. 125: 177–180.

Swift, E., Biggley, W.H., and Seliger, H.H. 1973. Species of oceanic dinoflagellates in the

genera Dissodinium and Pyrocystis: interclonal and interspecific comparisons of the

color and photon yield of bioluminescence. J. Phycol. 9: 420– 426.

Swift, E., Lessard, E.J., and Biggley, W.H. 1985. Organisms associated with epipelagic

bioluminescence in the Sargasso and the Gulf Stream. J. Plankton Res. 7: 831–848.

Takeuchi, N., Kohshima. S., and Seko K. 2001. Structure, formation, darkening process of

albedo reducing material (cryoconite) on a Himalayan glacier: a granular algal mat growing

on the glacier. Arctic Antarctic Alp. Res. 33: 115–122.

Takeuki, N., 2001. The altitudinal distribution of snow algae on an Alaska glacier (Gulkana

Glacier in Alaska Range). Hydrol. Process. 15: 3447:3459.

Thiele, D., and Bergman, A. 2002. Protothecosis in human medicine. Int. J. Hyg. Environ.

Health. 204: 297–302.

389

L. BARSANTI ET AL.

Thomas, W.H. 1972. Observation on snow algae in California. J. Phycol. 8: 1–9.

Thomas, D.N., and Dieckmann, G.S. 2002. Antarctic sea ice – a habitat for extremophiles.

Science. 295: 641–644.

2:35).

Tumlison, R., and Trauth, S.E. 2006. A novel facultative mutualistic relationship between

bufonid tadpoles and flagellated green algae. Herpet. Conserv. Biol. 1: 51–55.

Tyrrell, T. 2002. Emiliana huxley blooms and the conditions that induce them. In: Pro-

ceedings of First International Coccolithophores Conference. Swiss Federal Institute of

Technology, Zurich.

Ueno, R., Urano, N., and Suzuki, M. 2003. Phylogeny of the non-photosynthetic green

micro-algal genus Prototheca (Trebouxiophyceae, Chlorophyta) and related taxa inferred

from SSU and LSU ribosomal DNA partial sequence data. FEMS Microbiol. Lett. 223:

275–280.

Ultsch, G.R., Bradford, D.F., and Freda, J. 1999. Physiology: coping with the environment.

In: Tadpoles: the biology of anuran larvae. pp. 189–214. McDiarmid, R.W. and Altig, R.,

Eds., University of Chicago Press, Chicago, USA.

Van Dolah, F.M. 2000. Diversity of marine and freshwater algal toxins. In: Seafood and

freshwater toxins: pharmacology, physiology, and detection. pp. 19–43. Botana, L.M.

Ed., Dekker, New York.

Ward, D., and Sexton, O.J. 1981. Anti-predator role of salamander egg membranes. Copeia

3: 724–726.

Weeks, S.J., Pitcher, G.C., and Bernard, S. 2004. Satellite monitoring of the evolution of

a coccolithophorid bloom in the southern Benguela upwelling system. Oceanography

17: 83–89.

Widder, E.A., and Case, J.F., 1982. Distribution of subcellular bioluminescence sources in a

dinoflagellate, Pyrocystis fusiformis. Biol. Bull. 162: 423–48.

Williams, J.D., Dobrowolsk, J.P., West, N.E., and Gillette, D.A. 1995. Microphytic crust

influence on wind erosion. Transactions of the ASAE 38: 131–137.

Wilson, T., and Hasting, J.W. 1998. Bioluminescence. Ann. Rev Cell Dev. Biol. 14: 197–230

Winn-Williams, D.D. 2000. Cyanobacteria in deserts—life at the limit? In: The ecology of

cyanobacteria. pp. 341–346. Whitton, B.A. and Potts, M., Eds., Kluwer Academic Press,

Dordrecht, The Netherlands.

Wirth, F.A., Passalacqua, J., and Kao, G. 1999. Disseminated cutaneous protothecosis in an

immunocompromised host: a case report and literature review. Cutis 63: 185–l88.

Wu, C.S., and Kam, Y.C. 2005. Thermal tolerance and thermoregulation by taiwanese

rhacophorid tadpoles (Buergeria japonica) living in geothermal hot springs and streams.

Herpetologica, 61: 35–46.

Yamamoto, K., Kikuyama, M., Sutoh-Yamamoto, N., and Kamitsubo, E. 1994. Purification

of actin based motor protein from Chara corallina. Proc. Jpn. Acad. 70: 175–180.

Yamamoto, K., Shimada, K., Ito, K., Hamada, S., Ishijima, A., Tsuchiya, T., and Tazawa, M.

2006. Chara Myosin and the Energy of Cytoplasmic Streaming. Plant Cell Physiol., 47:

1427–1431.

Yokohama, Y. 1981. Distribution of the green light-absorbing pigments siphonaxanthin and

siphonein in marine green algae. Bot. Mar. 24: 637–40.

Yokohama, Y., Kageyama, A., Ikawa, T., and Shimura, S. 1977. A carotenoids characteristic

of chlorophycean seaweeds living in deep coastal waters. Bot. Mar. 20: 433–6.

390

Thompson, R. H. 1972. Algae from the hair of the sloth Bradypus. J. Phycol. 8: 8 (Abstract

HOW ODD ALGAE CAN BE

Yoshimura,Y., Kohshima, S., and Ohtani, S. 1997. A community of snow algae on an Himalayan

glacer: change of algae biomass and community structures with altitude. Arct. Alp. Res.

29: 126–137.

Yoshimura, Y., Kohshima, S., Takeuchi, N., Seko, K., and Fujita, K. 2006. Snow algae in a

Himalayan ice core: new environmental markers for ice core analyses and their cor-

relation with summer mass balance. Annals Glaciol. 43: 148–153.

391

ALGADEC; 285; 286; 292-294; 296;

297

algae; 1; 2; 4; 5; 7-10; 13-15; 18; 20;

29; 31-33; 36-38; 40-43; 45; 46-48;

51-57; 66-68; 78-80; 82-88, 94; 95;

97; 98-102; 134; 144; 145; 147; 149

151; 152; 154-160; 162; 163; 166;

167; 172-176; 179; 181; 195; 198;

208; 210; 216; 218; 221-223; 225;

226; 228-236; 238-240; 243-245;

248-251; 253-260; 261; 272; 278;

279-281; 283; 285; 287-289; 290;

292; 294; 296; 298; 301; 302; 304;

307-310; 313; 353-373; 376; 379;

380-391

algal blooms; 4; 161; 173-177; 210-212;

279; 282; 287; 292; 297-299; 302;

307-310; 373; 389

allelopathy; 17; 32; 38; 100; 159-161;

165-169; 174; 175-177

barley straw; 17; 37; 38; 40; 41

bioassay; 221; 225; 233

bioluminescence; 354; 376-385; 388-390

biosensor; 281; 285; 286; 289; 290; 291;

294-298; 311-314; 317-319; 326-333

blooms; 4; 17; 29; 31; 34; 37; 40; 42; 43;

45-47; 54; 57; 65; 66; 70; 74; 80; 84;

86; 95-97; 100; 104; 116; 119; 135;

136; 161; 172; 175; 176; 177; 197;

207; 208; 211-214; 218; 263; 283;

297; 302; 306-310; 354; 357; 371;

373-376; 381; 386; 389; 390

checklist; 179; 180; 182

cholinesterase; 45; 235-237; 239-244

379; 380; 381; 384; 386; 387; 389;

390

cyanobacteria, toxins; 47

distribution; 1; 41; 43; 73; 95; 96; 115;

195; 197; 203; 207; 213; 214; 216;

219; 239; 265; 287; 303; 309; 348;

349; 354; 356; 360; 362; 364; 365;

370; 371; 382; 383; 384; 386; 387;

389; 390

domoic acid; 93; 95; 98; 104; 109;

120-124; 166; 198; 208-210; 282;

301; 304; 307-309

electrochemistry; 335; 350

endosymbiosis theory; 1

energy consumption; 247; 249-254; 257

environment; 2; 4; 8; 17-19; 22-26; 28;

30; 31; 36; 40; 47; 49; 61; 111; 121;

124; 125; 132; 135; 160; 162; 165;

167; 222; 228; 229; 232; 234; 247;

248; 253; 258-262; 280-283; 290;

298; 301; 319; 340; 346; 354-358;

371; 379; 381; 391

enzymatic assay; 312; 324; 333

cyanobacteria; 12-14; 17-22; 24; 25; 26;

27-32; 34; 37-43; 45-53; 55; 56; 58;

168; 169; 172-175; 177; 211-215;

220; 235; 237; 243; 358-361; 365;

217-220

extreme environments; 8; 354

360; 362; 364; 365; 367; 369; 370;

Estonian lakes; 211-214; 216;

65-69; 73; 78; 80; 99; 111; 160;

INDEX

393

grazers; 17; 28; 30; 34; 39; 159; 161; 379

growth regulator; 247; 256-259

HAB species; 160; 261; 263; 272; 282

HABs; 95; 96; 102; 160; 161; 180; 263;

265; 282; 287; 290; 302; 307; 381

immunosensors; 209; 301; 304; 306-309;

347; 350

laser-doppler spectrometry; 247; 249

lethal dose; 120; 221; 224

liquid, characterization; 335

Mediterranean Sea; 180; 182; 195-197;

209; 210; 261; 269; 272; 273; 282;

301; 308-310; 370

microalgae; 2; 4; 100; 162; 167; 173;

198; 208; 210; 247; 251; 253; 255;

256; 259-261; 272; 286-288; 297;

298; 302; 310; 356; 357; 376;

379-381; 386; 388; 389

Middle Tyrrehnian Sea; 197

molecular techniques; 261; 263; 267;

280; 282

Murcian coast; 179; 180

mutualisms; 354

nature water; 235

nutrients; 4; 8; 10; 22; 25; 35; 48; 79;

160; 173; 219; 288; 295; 372

PCR; 261; 264; 265; 267-283; 299

phosphatases; 17; 27; 46; 51; 61; 62; 93;

108; 109; 140

phosphorus limitation; 17; 22; 26; 27;

166

phycotoxin traceability; 301

phytoplankton; 4; 26; 37; 51-53; 91; 94;

159; 160; 161; 165; 166; 168; 172;

173; 174-179; 181; 182; 186; 195;

196; 198; 199; 207; 208; 210; 211;

213; 218; 219; 261; 262; 264; 266-

268; 270; 271; 272; 273; 274; 277;

279; 281; 288; 297; 298; 398; 301;

302; 307; 308; 309; 369; 371; 373;

374; 389

pigments distribution; 1

potassium dichromate; 247; 249; 252;

254; 256

primers; 261; 262; 264; 265; 268; 269;

270; 272; 274; 275; 277; 278; 298

protothecosis; 354; 367; 368; 382; 386;

390

Pseudo-nitzschia spp.; 93; 197-199; 209;

269; 306- 308

rRNA genes; 262; 278

sandwich hybridisation; 286

saxitoxins; 68; 91; 95; 98-100; 104; 105;

110; 112; 115; 116; 159; 166; 301

speed of movement; 247; 249; 251; 253;

254

Ferry Box; 286; 295; 298

formaldehyde; 181; 311; 312; 314; 320;

326; 332-333

formaldehyde dehydrogenase; 311; 312;

314; 332-333

gene engineering; 312

Gonyostomum semen; 47; 211; 214; 217;

219; 220

INDEX

SW Mediterranean Sea; 179; 195; 196

syndromes; 47; 91; 94; 98; 123; 141; 306

syndromes, therapy; 47

394

123-127; 129; 130; 134; 135; 138-

155; 157-162; 165; 166; 173; 175-

177; 208; 210; 214; 218; 221-226;

228-239; 244; 245; 287; 288; 302;

304; 305; 307-309; 390

treatment; 55; 57; 64-66; 72; 74; 76; 79;

80; 94; 114; 119; 123; 130; 226; 233;

251; 305; 312; 320; 368

ultrastructure; 10; 197; 203; 208; 370;

385

water blooming; 221; 226; 230; 232;

236; 245; 259

water monitoring; 259; 335; 351

yeast; 312

taxonomy; 2; 17; 20-22; 266; 354; 388

toxicity; 17-20; 29-31; 36; 38; 40; 42;

43; 46; 49; 52; 54; 70; 74-76; 91; 94;

99; 100; 101; 103-105; 109; 111; 125;

126; 134; 135; 156; 166; 175; 176;

197-199; 208; 214; 221-226; 229;

233; 236; 244; 247-249; 252; 253;

254; 258; 260; 282; 302; 304; 312;

313

toxins; 4; 17-19; 24; 29; 30; 35-36; 39-

42; 45; 47-49; 51-59; 62-65; 68; 69-

72; 74; 80; 91-95; 97-107; 109-119;

INDEX

395

Aboal Marina

Department of Botany

Faculty of Biology

University of Murcia

Campus de Espinardo

30100, Murcia, Spain

Albertano Patrizia

Department of Biology

University of Rome “Tor Vergata”

Via della Ricerca Scientifica

I-00173, Rome, Italy

Barsanti Laura

Istituto di Biofisica C.N.R.

Area della Ricerca di Pisa

Via Moruzzi 1

I-56124, Pisa, Italy

Bouza Nieves

Department of Botany

Faculty of Biology

University of Murcia

Campus de Espinardo

30100, Murcia, Spain

Colijn Franciscus

GKSS Research Centre Geesthacht

GmbH

Max-Planck-Street 1

D-21502, Geesthacht, Germany

Coltelli Primo

ISTI C.N.R.

Area della Ricerca di Pisa

Via Moruzzi 1

I-56124, Pisa, Italy

Congestri Roberta

Department of Biology

University of Rome “Tor Vergata”

Via della Ricerca Scientifica

I-00173, Rome, Italy

Demkiv Olha

Institute of Cell Biology

NAS of Ukraine

Drahomanov Str. 14/16

79005, Lviv, Ucraine

Diercks Sonja

GKSS Research Centre Geesthacht

GmbH

Max-Planck-Street 1

D-21502, Geesthacht, Germany

Evangelista Valtere

Istituto di Biofisica C.N.R.

Area della Ricerca di Pisa

Via Moruzzi 1

I-56124, Pisa, Italy

Fistarol Giovana O.

Dept. of Agriculture Engineering,

UFSC, Florianópolis

Brazil

Frassanito Anna Maria

Istituto di Biofisica C.N.R.

Area della Ricerca di Pisa

Via Moruzzi 1

I-56124, Pisa, Italy

Galluzzi Luca

Centro Biotecnologie

Fano Ateneo

University of Urbino “Carlo Bo”,

Via T. Campanella 1

I-61039, Fano, Italy

Gayda Galyna

Institute of Cell Biology

NAS of Ukraine

Drahomanov Str. 14/16

79005, Lviv, Ukraine

LIST OF CONTRIBUTORS

397

LIST OF CONTRIBUTORS

Gonchar Ɇykhailo

Institute of Cell Biology

NAS of Ukraine

Drahomanov Str. 14/16

79005, Lviv, Ukraine

Granéli Edna

University of Kalmar

Dept. of Marine Sciences

S-391 82, Kalmar, Sweden

Gualtieri Paolo

Istituto di Biofisica C.N.R.

Area della Ricerca di Pisa

Via Moruzzi 1

I-56124, Pisa, Italy

Laugaste Reet

Institute of Agricultural

and Environmental Sciences

Estonian University of Life Science,

Centre for Limnology

61117, Rannu, Tartu County Estonia

Medlin Linda K.

Alfred Wegener Institute for Polar

and Marine Research

Am Handelshafen 12

D-27570, Bremerhaven, Germany

Metfies Katja

GKSS Research Centre Geesthacht

GmbH

Max-Planck-Street 1

D-21502, Geesthacht, Germany

Micheli Laura

Department of Chemical Sciences

and Technologies

University of Rome “Tor Vergata”

Via della Ricerca Scientifica

I-00173, Rome, Italy

Moscone Danila

Department of Chemical Sciences

and Technologies

University of Rome “Tor Vergata”

Via della Ricerca Scientifica

I-00173 Rome, Italy

Ott Ingmar

Institute of Agricultural

and Environmental Sciences

Estonian University of Life Science,

Centre for Limnology

61117, Rannu, Tartu County Estonia

Palleschi Giuseppe

Department of Chemical Sciences

and Technologies

University of Rome “Tor Vergata”

Via della Ricerca Scientifica

I-00173, Rome, Italy

Parshykova Tetiana

Kiev National University named Taras

Shevchenko

Volodymyrska st., 60

01017, Kiev, Ukraine

Paryzhak Solomiya

Ivan Franko National University of Lviv

Hrushevs’kyi Str. 4

79005, Lviv, Ukraine

Istituto di Biofisica C.N.R.

Area della Ricerca di Pisa

Via Moruzzi 1

I-56124, Pisa, Italy

Penna Antonella

Centro Biologia Ambientale, University

of Urbino “Carlo Bo”, Viale Trieste 296,

I-61100, Pesaro, Italy

Polizzano Simona

Department of Biology

University of Rome “Tor Vergata”

Via della Ricerca Scientifica

I-00173, Rome, Italy

Rakko Aimar

Institute of Agricultural

and Environmental Sciences

Estonian University of Life Science,

Centre for Limnology

61117, Rannu, Tartu County Estonia

398

Vincenzo Passarelli

LIST OF CONTRIBUTORS

Salomon Paulo S.

University of Kalmar

Dept. of Marine Sciences

S-391 82, Kalmar, Sweden

Scaravelli Dino

Department of Veterinary Public Health

and Animal Pathology,Veterinary

School, University of Bologna

Viale Vespucci 2,

I-47042, Cesenatico (FC), Italy

Schröder Friedhelm

GKSS Research Centre Geesthacht

GmbH

Max-Planck-Street 1

D-21502, Geesthacht, Germany

Schuhmann Wolfgang

Ruhr-Universität

Universitätsstr. 150

D-44780, Bochum, Germany

Scozzari Andrea

Institute of Geoscience and Earth

Resources C.N.R

Area della Ricerca di Pisa

Via Moruzzi, 1

I-56124, Pisa, Italy

Sirenko Lydia A.

Institute of Hydrobiology NAS of

Ukraine

Geroev Stalingrada pr. 12

04210, Kiev, Ukraine

Tretyakov Vadym

Kiev National University named Taras

Shevchenko

Volodymyrska st., 60

01017, Kiev, Ukraine

Vesentini Nicoletta

Istituto di Fisiologia Clinica C.N.R.

Area della Ricerca di Pisa

Via Moruzzi, 1

I-56124, Pisa, Italy

Vlasenko Vitaliy

Institute of Bioorganic and Oil

Chemistry

NAS of Ukraine

Murmanskaya st., 1

02660, Kiev-94, Ukraine

Whitton Brian A.

School of Biological and Biomedical

Sciences

University of Durham

DH1 3LE, UK

Zaccaroni Annalisa

Department of Veterinary Public Health

and Animal Pathology,Veterinary

School, University of Bologna

Viale Vespucci 2,

I-47042, Cesenatico (FC), Italy

399

Monitoring Domoic Acid in Marine Phytoplankton by Disposable Immunosensors

Article

Full-text available

Apr 2017

Spectral reflectance of coccolithophore blooming in the Bering sea: Comparison of ship-measurements and sea-wide field-ofview scanner observations

Article

Jan 2000

Alexandrium minutum Halim and PSP contamination in the northern Adriatic Sea (Mediterranean Sea)

Article

Jan 1996

Red snow algae from Spitsbergen

Article

Jan 1974

Impacts of algal toxins on marine mammals

Chapter

Dec 2002

Detection of toxic Alexandrium catenella (Whedon and Kofoid) Balech in clam production zone of North Lake and Channel, Tunisia

Article

Jan 2005

Fioriture di microalghe potenzialmente tossiche lungo le coste laziali

Article

Jan 2006

Rapid detection of seafood toxins

Chapter

Dec 2002

Distribution of green light-harvesting pigments, siphonaxanthin and siphonein, and their precursors in marine green algae

Article

Jan 1992

Observations on the eggs of Ambystoma maculatum with especial reference to the green algae found within the egg envelopes

Article

P.W. Gilbert

Some effects of algae and molds in the rain-crust of desert soils

Article

Development of Sensors to Trace Toxins from Dinoflagellates and Other Algae to Seafood

Abstract

Recommended publications

A disposable amperometric immunosensor for 2,4-dichlorophenoxyacetic acid

Development of Highly Sensitive Electrochemical Immunosensor Based on Single-walled Carbon Nanotube...

Platinum nanodendrite functionalized graphene nanosheets as a non-enzymatic label for electrochemica...

Detection of Ara h 1 (a major peanut allergen) in food using an electrochemical gold nanoparticle-co...