Content uploaded by Angamuthu Selvapandiyan
Author content
All content in this area was uploaded by Angamuthu Selvapandiyan on May 09, 2014
Content may be subject to copyright.
Analysis of chloroplast transformed tobacco plants with cry1Ia5 under
rice psbA transcriptional elements reveal high level expression of Bt toxin
without imposing yield penalty and stable inheritance of transplastome
Vanga Siva Reddy
1,
*, Sadhu Leelavathi
1
, Angamuthu Selvapandiyan
2
, Rajagopal Raman
1
,
Ferraiolo Giovanni
3
, Vijaya Shukla
1
and Raj Kamal Bhatnagar
1
1
International Centre for Genetic Engineering and Biotechnology (ICGEB), P.O.Box. 10504, Aruna Asaf Ali
Marg, New Delhi, 67, India;
2
Laboratory of Bacterial, Parasitic and unconventional agents, CBER, Foods
and Drug Administration, Bethesda, MD 20892, USA;
3
ICGEB, Area Science Park, Padriciano 99, 34012
Trieste, Italy; *Author for correspondence (e-mail: vsreddy@icgeb.res.in; fax: +91–11-616 2316)
Received 26 April 2001; accepted in revised form 19 February 2002
Key words: Bacillus thuringiensis, Chloroplast transformation, Cry1Ia5, Homologus recombination, insect resis-
tance, Maternal inheritance
Abstract
Stable inheritance and sustained-high level expression of foreign genes in the progeny are the most critical fac-
tors for successful application of genetic engineering in agriculture. In this study, we have transformed cry1Ia5
into tobacco chloroplasts and studied the expression, inheritance and resistance offered against Helicoverpa ar-
migera over two generations. Under rice chloroplast transcription elements, the Cry1Ia5 protein accumulated up
to 3% of total soluble protein in leaf tissue which is ⬃300 folds more when compared to the expression of the
same protein in the nuclear transformed plants. Transgenic plants offered complete protection against larvae of
H. armigera, irrespective of development stage. Analysis of T0, T1 and T2 generation plants revealed site-spe-
cific integration, maternal inheritance and uniform expression of transgenes without imposing any yield penalty.
Our results suggest that the overexpression of insecticidal toxin coding genes in chloroplasts would be an effec-
tive strategy to delay the emergence of resistance among phytophagous pests.
Introduction
The soil bacterium, Bacillus thuringiensis (Bt) pro-
duce a variety of crystal proteins (Cry proteins) with
insecticidal activity against a large group of insects
belonging to orders of Lepidoptera, Coleoptera or
Diptera (Schnepf et al. 1998). The specificity of these
insecticidal Cry proteins has made cry genes attrac-
tive candidates for genetic engineering of crop plants
for protection against insect predation (Brunke and
Meeusen 1991; Tabashnik 1997). However, the native
cry genes express poorly when introduced into plant
nuclear genome (Vaeck et al. 1987). Improvement in
the expression levels of Cry proteins in plants was
achieved by the modification of potential eukaryotic
message destabilizing sequences (Murray et al. 1991),
by introducing truncated forms of cry genes and
through the modification by eliminating the mRNA
destabilizing sequences (Perlak et al. 1991). Consid-
erable increase in the expression of Cry protein (ca.
0.8% of soluble protein) was also obtained through
promoter optimization, prote in targeting (Wong et al.
1992) and codon optimization of the entire Bt gene(s)
to conform the codon usage of the recipient plant
(Fujimoto et al. 1993; Nayak et al. 1997; Wunn et al.
1996). However, to control predation by insects and
to delay the emergence of resistance using transgenic
approach, these expression levels are still low and
may be effective only when pest populations remain
at a low density (McGaughey and Whalon 1992). In
this context, chloroplast transformation that allow
high level expression of foreign genes offer an advan-
tage over the nuclear transformation (Boynton et al.
1988; Daniell et al. 1998; Svab and Maliga 1993).
259
Molecular Breeding 9: 259–269, 2002.
© 2002 Kluwer Academic Publishers. Printed in the Netherlands.
XPS 0093561TX (MOLB) – product element MOLB539 – Grafikon
Transformation of cry1A(c) into chloroplast genome
was shown to express at very high levels reaching up
to 3–5% of total soluble protein. Transplastomic
plants were shown to confer resistance against 3
rd
in-
star stage larvae of Heliothis virescens, Helicoverpa
zea and Spodoptera exigua (McBride et al. 1995).
Similarly, cry2Aa2 was overexpressed through chlo-
roplast transformation and tranplastomic plants were
shown to confer resistance against susceptible as well
as Bt resistant 2
nd
–3
rd
instar larvae of H. virescens,
H. zea and S. exigua (Kota et al. 1999). Recently, an
extraordinarily high level expression (45% of tsp)
was achieved for Cry2Aa2 when the entire bacterial
operon that also code for a putative chaperon was
transformed into tobacco chloroplasts (deCosa et al.
2001).
The American bollworm (Helicoverpa armigera,),
a polyhagous pest, causes extensive damage to many
economically important crops all over the world (Cox
and Forrester 1992; Gahukar 1991). In recent times,
this pest has developed resistance to most commonly
used chemical insecticides (Dennis 1983; Heckel et
al. 1997; Jadhav and Armes 1996). We have previ-
ously cloned and characterized a cry1Ia5 gene from
an Indian isolate of B. thuringiensis (EMBL accession
number Y08920). When expressed in tobacco plants
through nuclear transformation, Cry1Ia5 offered com-
plete protection against the neonate stage larvae of H.
armigera (Selvapandiyan et al. 1998). Here we report
an overexpression of native unmodified cry1Ia5 in
tobacco through chloroplast transformation. The ex-
pression and inheritance pattern of transgenes and the
resistance offered by cry1Ia5 expressing plants
against various stages of H. armigera larvae were as-
sessed. We have also carefully monitored, for two
generations, the consequence of high level expression
of insecticidal protein in chloroplasts on various ag-
ronomic factors associated with growth and yield of
the transgenic plants.
Materials and methods
Construction of tobacco plastid expression vectors
The plastid transformation vector, pVSR326 (Figure
1A), was constructed using the rrn and psbA promot-
ers and 3⬘untranslated regions of psbA and rbcL gene
from rice plastome primary clones (Hiratsuka et al.
1988). The selectable aadA and reporter uidA (Jeffer-
son et al. 1989) genes were cloned from pUC-atpX-
AAD (Goldschmidt-Clermont 1991) and
pGUSN358-S (Clontech, (Farrell and Beachy 1990))
plasmids, respectively. The tobacco plastid genome
sequences spanning rbcL-accD genes (Shimozaki et
al. 1986) were used for targeting chimeric aadA and
uidA genes into tobacco plastid DNA.
The rice psbA gene promoter, 5⬘psbA, (nucle-
otides 1615 –1,141, EMBL Acc. No. X15901) was
PCR amplified using pRB7 template DNA and SR01
(5⬘aaaactgcagtcgACTTTCACAGTTTC-
CATTCTGAA) –SR02 (5⬘catgcCATGGTAA-
GATCTTGGTTTATT) primer combination. All poly-
merase chain reactions (PCR) were carried out using
Pfu polymerase (Stratagene). The amplified DNA was
digested with restriction endonucleases SalI-NcoI and
inserted upstream of the uidA gene in the plasmid
pGUSN358-S to create pVSR100 intermediate vector.
A multiple cloning site (MCS) was introduced into
pVSR100 using SR03 (5⬘AATTGAGCTCGAGG-
TACCGCGGTCTAGAAGCTT) –SR04 (5⬘AAT-
TAAGCTTCTAGACCGCGGTACCTCGAGCTC)
primers. The SR03 and SR04 primers are comple-
mentary to each other and provide cohesive ends that
are compatible to EcoRI digested pVSR100 vector.
The SR03 and SR04 oligos were designed in such a
way that the EcoRI site is not recreated upon ligation
in the vector. The resulting plasmid was named as
pVSR200. The 3⬘end of rice psbA gene, 3⬘psbA,
(nucleotides 81–134,233, EMBL Acc. No. X15901)
fragment was amplified using pRB7 template DNA
and primers SR05 (5⬘attcgagctctaattaattaaG-
GCTTTTCTGCTAACATATAG) and SR06 (5⬘gggg-
tacCATCATTTATTGGCAAA). The amplified 3⬘end
of psbA gene fragment was digested with SacI-KpnI
and cloned into pVSR200 to create pVSR300.
The 16S rRNA operon promoter, (5⬘rrn) from rice
(nucleotides 91, 100 –91, 216, EMBL Acc. No.
X15901) was PCR amplified using pRP7 template
and primers SR07 (5⬘cgcctggggtacCTCCCCCCGC-
CACGATCG) and SR08 (5⬘ggatcctccctacaactTC-
CAAGCGCTTCAGATTATTAG). The SR08 primer
was designed to contain tobacco rbcL gene ribosome
binding site for efficient translation of selectable aadA
gene. The amplified DNA was digested with KpnI-
BamHI and cloned into pBluescript II SK+ (Strat-
agene) vector to create pBS16S. The 3⬘end of rbcL
gene, 3⬘rbcL, (nucleotides 55, 529 –55, 784, EMBL
Acc. No. X15901) was amplified using pRP1 tem-
plate DNA and SR11 (5⬘AAGGTAGTTG-
GCAAATAACTCGAGACTAAGTG-
GATAAAATTA) and SR10 (5⬘
260
gctctagaTTGTATTTATTTATTGTATTATAC) prim-
ers. The 18 bases from 5⬘end of SR11 primer are
complimentary to the 3⬘end of the aadA gene and the
18 bases from 3⬘end of primer are complimentary to
3⬘end of the rbcL gene. A XhoI restriction site (un-
derlined) has been introduced separating the aadA
coding region and 3⬘rbcL to facilitate easy exchange
of aadA with any other selectable gene of interest.
The amplified fragment, after gel purification, was
used as primer in the “Megaprimer”method of PCR
(Sarkar and Sommer 1990) and SR09 (5⬘cgcggatc-
ctATGGCTCGTGAAGCGGTTATC) primer as the
other primer and pUC-atpX-AAD as template DNA
to amplify aadA coding region along with 3⬘end of
rbcL. The amplified product was digested with Bam-
HI-XbaI and cloned into pBS16S vector in the same
sites to create p16SaadA vector. The aadA chimeric
gene was taken as KpnI-XbaI fragment from
p16SaadA and cloned into pVSR300 vector in the
same sites to create pGUSaadAR vector.
The plastid targeting sequence from tobacco (nu-
cleotides 58, 056 –60, 627; EMBL Acc. No. Z00044)
was PCR amplified using SR12 (5⬘cccaagcttGAAA-
GAGATAAATTGAAC) and SR13 (5⬘ccggaattc-
TATCTGAACTACTC) primers and pTB22 (Shi-
mozaki et al. 1986) as template DNA. The targeting
sequences were disgested with EcoRI-HindIII and
cloned into pUC18 in the same restriction sites to
create pUCFLK plasmid. A XhoI site present in the
targeting sequence (nucleotide 60, 484; EMBL Acc.
No. Z00044) has been removed through sitedirected
mutagenesis in order to make XhoI site present be-
tween aadA coding region and 3’end of rbcL as
unique site in the vector pVSR326. Further, a ClaI
site containing linker (5⬘GATCATCGAT) was in-
serted into pUCFLK in between BamHI sites (nucle-
otides 59, 286 and 59, 306; EMBL Acc. No. Z00044)
to create pUCFLKC. plastid transformation vector,
pVSR326, was created by introducing chimeric aadA
and uidA containing sequences from pGUSaadAR as
HindIII fragment at ClaI site of pUCFLKC after treat-
ing both the fragements with Klenow to generate
blunt ends. Convenient restriction sites (underlined)
with few extra bases were introduced into primers for
easy cloning. Standard procedures were followed for
PCR (Saiki et al. 1988) and cloning (Sambrook and
Fritsch 1989).
The vector p326cryV was a derivative of
pVSR326. The cry1Ia5 coding region was PCR am-
plified from a plant nuclear trasnformation vector
pBS-B5 (Selvapandiyan et al. 1998) using CRY-V5
Figure 1. Chloroplast transformation vectors carrying uidA or
cry1Ia5 genes and molecular analysis to show the integration of
cry1Ia5 into tobacco chloroplast genome. A). Restriction map of
vector pVSR326. B). Restriction map of p326cryV, partial chloro-
plast DNA maps of tobacco (cpDNA) and the transformed tobacco
plant (Nt. 326cryV-1). Both the vectors contained aadA selectable
marker under the regulation of rice rrn promoter (5⬘rrn) and rbcL
terminator (3⬘rbcL). The uidA or cry1Ia5 genes were placed under
the regulation of rice 5⬘and 3⬘psbA elements. Double head arrow
indicate the size of the DNA fragment expected when digested with
ClaI (C), SalI (Sa), NcoI (N) and-SacI (S). The chimeric cry1Ia5
and aadA genes were flanked by tobacco rbcL and accD gene se-
quences for site-specific integration into tobacco plastid genome.
Dashed arrow indicate the direction and size of thecry1Ia5 tran-
script. C). Southern hybridization of a representative plant DNA
transformed with p326cryV vector to confirm the stable integration
of cry1Ia5 and aadA genes into tobacco chloroplasts. Genomic
DNA isolated from wild type (1) and chloroplast transformed spec-
tinomycin resistant Nt. 326cryV-1 (2) plants was digested with rel-
evant restriction enzymes and hybridized with cry1Ia5, aadA and
rbcl-accD targeting DNA probes.
261
(5⬘cgcggatccATGGAACTAAAGAATCAAGA-
TAAGCA) and CRY-V3 (5⬘cgcggatcccgagctcgtc-
gaCTACATGTTACGCTCAATATG, under lined se-
quence conatined SacI and SalI sites next to each
other) primers and cloned at NcoI –SacI sites of
pVSR326 by replacing uidA gene.
Plastid transformation and plant regeneration
Tobacco (Nicotiana tabacum cv. Petit Havana) was
transformed using particle delivery system PDS1000
(BioRad) according to the method described by (Svab
and Maliga 1993). In brief, vector DNA coated on to
tungsten particles (M17 Bio-Rad) was bombarded on
the in vitro grown tobacco leaf placed on RMOP me-
dium (Svab and Maliga 1993), a modified MS me-
dium (Murashige and Skoog 1962), containing 0.1
mg/l thiamine, 100 mg/l inositol, 3% sucrose, 1 mg/l
BA and 0.1 mg/l NAA, 0.6% agar, pH 5.8). Trans-
formed shoots were selected on RMOP medium con-
taining 500 mg/l spectinomycin dihydrochloride.
Three additional cycles of regeneration on spectino-
mycin (500 mg/l) containing RMOP medium was car-
ried out to obtain homotransplastomic plastid contain-
ing plants (Svab and Maliga 1993).
Insect bioassays
Helicoverpa armigera were reared from eggs (sup-
plied by the Division of Entomology, IARI, New
Delhi) which were kept for hatching at 27 ± 1 °C and
80 ± 5% R.H. Immediately after hatching they were
provided with artificial diet which was replenished
every day. After the second instar, the insects were
reared individually. Leaves of transgenic plants were
excised at the bolting stage and subjected to insect
bioassay. The leaves were cleaned with 0.01% Triton
X-100 to wet the surface and washed thrice with ster-
ile water. Leaves were cut to the size of 15.9 cm
2
(2.85 cm radius) and placed over a moistened filter
paper of the same size on a 60 × 15 mm petri plate.
Five neonate larvae were released on each leaf disc
and the petri plate sealed with parafilm. These were
kept at 27 ± 1 °C, 65% R.H. and 14 h light and 10 h
dark photoperiod. Each treatment was replicated
thrice and the same procedure was followed for as-
saying the leaves against 2
nd
and 3
rd
instar larvae.
Observations on larval mortality were recorded at 5
h, 24 h and 48 h post release of the insects. Compa-
rable treatments were done on larvae of non-trans-
formed plants to serve as control. A choice bioassay
was also conducted on whole plants, just before the
bolting stage, by enclosing three transgenic plants and
one non-transgenic plant in a green house chamber.
Fifth instar larvae were released on each of the plant
and observations taken after 5 h, 24 h, and 48 h for
mortality and leaf area consumed. The above experi-
ments on leaf discs and whole plant bioassay were
performed on two different occasions with similar
treatment and replication controls. All the experi-
ments were conducted on T1 and T2 generation
plants.
Nuclic acid analysis
Total DNA isolated from transgenic and wild type
plants (Mettler 1987) was digested with relevant re-
striction endonucleases, resolved on 0.8% agarose
gels and transferred on to nylon membrane. About 3
g of total RNA isolated from leaf tissue (Hughes and
Galam 1988) was separated in denaturing formalde-
hyde agarose gel (1.5%) and blotted on to nylon
membranes. The membranes were UV crosslinked
and then probed with
32
P labeled cry1Ia5, aadA cod-
ing regions isolated from p326cryV and rbcL-accD
fragment from pUCFLK. In addition, PCR generated
and gel purified psbA (nucleotides 271–1,800; EMBL
Acc. No. Z00044 using 5⬘TAACATTAGCAAGAA-
GAGAAAC – 5⬘CGAAATTCTAATTTTCTGTAG
primers), 16S rRNA (nucleotides 102,776–103,036;
EMBL Acc. No. Z00044 using 5⬘CCTGGCTCAG-
GATGAACGCT – 5⬘TTCATGCAGGCGAGTTG-
CAGCC), and rice rbcL terminator region (XhoI –
XbaI fragment from p326cryV) were also as probes
in the Southern hybridization analysis of progeny
plants. Standard procedures were followed for hybrid-
ization (Sambrook and Fritsch 1989) and membranes
were subjected to autoradiography.
Western blot analysis
Soluble leaf protein extracted from the greenhouse
grown Nt. 326cryV-1 and wild type plants in the ex-
traction buffer (50 mM Tris-HCl pH 7.0, 5 mM DTT,
1mMNa
2
EDTA, 0.1% SDS, 0.1% Triton X-100) was
subjected to SDS-PAGE (Laemmli 1970), electroblot-
ted on to nitrocellulose membranes, blocked with bo-
vine serum albumin (BSA), incubated by anti-
Cry1Ia5 polyclonal antibodies raised in rabbits and
detected by goat anti-rabbit alkaline phosphatase con-
jugated antibodies (Sigma). Protein concentration was
262
determined with the Bradford reagent (BioRad) using
BSA as standard.
Analysis of progeny for growth and yield related
parameters
Data were recorded for plant height, seed germina-
tion, days to flower, pods per plant and the weight of
the pods. Seeds were germinated on MS medium
(Murashige and Skoog 1962) containing spectinomy-
cin and streptomycin (500 mg/L each) in petri dishes.
Data was also obtained for fresh and dry weight of
leaf. Leaf size was calculated by placing the leaf on a
graph paper. The chlorophyll content was measured
as described by Arnon (1949).
Results
Expression vector for cry1Ia5 in tobacco
chloroplasts
For high level expression, the cry1Ia5 gene was
cloned into a chloroplast transformation vector
pVSR326 (Figure 1A) by replacing the repoter uidA
gene. The cry1Ia5 is under the regulation of rice psbA
5⬘and 3⬘regulatory sequences (Figure 1B). The rice
psbA 5⬘and 3⬘untranslated regions (UTR) share 53%
and 34% base identity with the corresponding UTR’s
of tobacco. The rbcL-accD gene sequences derived
from tobacco plastid genome were provided in the
vector flanking the chimeric cry1Ia5 and aadA genes
for site-specific integration through two homologous
recombinations. The direction and the size of tran-
scripts from cry1Ia5 and aadA genes, a possible
mechanism for transgene integration into tobacco
plastome and the location of relevant restriction en-
zymes are shown in Figure 1B.
Transformation and regeneration of stable
transplastomic plants
The particle bombardment of leaf tissue with DNA of
vectors pVSR326 and p326cryV was followed for
chloroplast transformation under spectinomycin se-
lection. Homotransplastomic lines were established
by repeating regeneration process three times from
the leaf tissues of primary transformants under spec-
tinomycin selection. Out of 25 green shoots regener-
ated on spectinomycin selection from 20 bombard-
ments using vector p326cryV DNA, a total of 23
plants were found to be positive for the presence of
cry1Ia5 and aadA gene sequences. In a parallel ex-
periment, out of 23 green shoots obtained from the
20 bombardments using vector pVSR326, 18 plants
were uidA positive.
Stable integration of cry1Ia5 and aadA into plastid
genome
Southern hybridization analysis using cry1Ia5, aadA
and rbcL-accD probes individually confirmed the sta-
ble integration of vector DNA into tobacco plastid
genome (Figure 1C). The total genomic DNA isolated
from Nt. 326cryV-1 and wild type plants was digested
with ClaI, SalI and NcoI-SacI restriction enzymes and
probed with cry1Ia5, aadA and rbcL-accD gene
probes. As shown in Figure 1C, the size of DNA
fragments hybridized to the cry1Ia5 and aadA in Nt.
326cryV-1 plant were in agreement with the expected
size DNA fragments. Presence of 3.4 kb signal in the
wild-type plant (Figure 1C, lane 1) and 7.4 kb signal
in Nt. 326cryV-1 plant (Figure 1C, lane 2) when
probed with the rbcL-accD sequences confirmed the
site-specific integration of cry1Ia5 and aadA. The ab-
sence of 3.4 kb signal in Nt. 326cryV-1 plant is a
confirmation for the homoplasmic nature of the trans-
plastome. Similar site-specific integration of uidA and
aadA genes were observed in the Southern hybridiza-
tion analysis for the GUS positive plants obtained
from the bombardment of vector pVSR326 (data not
shown).
Expression of Cry1Ia5 protein and insecticidal
activity
Northern blot analysis was performed to confirm the
transcription of chimeric cry1Ia5 gene and the results
are presented in Figure 2. As can be seen in Figure 2,
a 2.1 kb transcript corresponding to the expected size
of cry1Ia5 was observed in the RNA isolated from Nt.
326cryV-1 plant when probed with the coding region
of cry1Ia5. In Western blotting analysis to detect the
presence of Cry1Ia5 protein in the transformed plants,
a band corresponding to 82 kDa reacted with the
polyclonal antibodies raised against Cry1Ia5 and was
present only in the plastid transformed plants (Fig-
ure 3, lane 1). A comparison of the intensity of
Cry1Ia5 protein with E. coli expressed Cry1Ia5 (Fig-
ure 3, lane 3) estimates the level of expression to be
ca. 3% of the total leaf soluble protein.
263
In a petri plate bioassay, 30% of leaf area was
consumed in non-transformed (control) plants by 5 h
while after 24 h entire leaf was consumed by 3
rd
in-
star larvae. On the other hand no insect damage was
observed on the leaves of transgenic plants, impor-
tantly all the released larvae were dead. Similar re-
sults were obtained for neonate (Figure 4A) and 2
nd
instar larvae, where damage to the control plants was
lesser in 5h due to the younger larvae used in the bio-
assay. After 48 h 80% of leaf area was consumed in
control plants and no visible damage took place in the
transformed plants leaf (Figure 4A). Identical results
were observed when the experiments were conducted
on two different occasions (results not shown). When
whole plants were exposed to H. armigera 5
th
instar
larvae, transgenic plants suffered zero damage in
terms of leaf area consumption while the control plant
suffered 10–20% reduction in leaf area within5hof
exposure (Figure 4B) and 80–90% leaf area was eaten
up in 72 h. The larvae released on Nt.326cryV-1
plants eventually died.
Analysis of T1 generation for inheritance and
expression of transgenes
Seeds obtained from the self fertilized wild type, Nt.
326cryV-1 plants and from their reciprocal crosses
were germinated on MS medium containing spectino-
mycin and streptomycin (500 mg/l each). It was ex-
pected that the seedlings carrying aadA gene confer
resistance to spectinomycin and streptomycin and re-
main green on the antibiotics containing plates while
Figure 2. Northern blot analysis to confirm the expression of
cry1Ia5 gene in tobacco chloroplasts. Total RNA isolated from Nt.
326cryV-1 (1) and wild type (2) plants were resolved on agarose
gel, blotted on to nylon membrane and hybridized with cry1Ia5
probe. A transcript of 2.1 kb size is observed in the transformed
plant.
Figure 3. Western blot analysis of total soluble proteins (40
g)
extracted from Nt. 326cryV-1 (lane 1) and a wild type (lane 2) plant
leaves were separated on 7.5% SDS-PAGE and probed with anti-
Cry1Ia5 antibodies. Arrow indicate a 82 kDa band present in the
representative transgenic plant. Lane 3 contained 0.5
gofE. coli
expressed Cry1Ia5. M. Prestained molecular marker (BioRad).
Figure 4. A. Representative leaves showing the damage caused
after 48 h of feeding by H. armigera larvae (1
st
instar stage). B.
Transplastomic plants showing the damage after5hoffeeding by
H. armigera larvae (5
th
instar stage). Note the minimum damage
caused to the transgenic progeny plant leaves (Nt. 326cryV-1)
when compared to wild type plant leaves.
264
progeny derived from wild type and the plants not in-
heriting the aadA turn to white. The progeny obtained
from selfing of Nt. 326cryV-1 and from a cross where
Nt. 326cryV-1 plant was used as a female parent, the
seedlings remained green, indicating the maternal in-
heritance of aadA gene among the plastid transformed
plants (Figure 5A). On the other hand, the seedlings
derived from a cross between wild type as a female
parent and Nt. 326cryV-1 as a male parent were white
on antibiotics containing petri dish (Figure 5A), con-
firming further the maternal inheritance of aadA in
the plastid transformed plants. The T0 seed germina-
tion was not affected by high level expression of
cry1Ia5 in chloroplasts. In a histochemical assay in-
volving the progeny from a selfed and reciprocal
crosses in involving Nt. 326–37 (obtained from the
transformation of vector pVSR326) and Wt plants,
the GUS expression was observed in the green tissues
and the non-green tissues have no detectable GUS
activity. In the flowers of Nt. 326–37 plant, when ob-
served under the microscope, only green sepals,
stigma and margins of petals showed GUS activity
and all non-green tissues such as petals, stamen, an-
thers and style lacked any visually detectable GUS
activity (Figure 5B). In the selfed progeny from the
Nt. 326–37 and from a cross where Nt. 326–37 was a
female parent, GUS activity was observed only in
true leaves and in green cotyledonory leaves (Figure
5C). There was no GUS activity in the roots. Also,
GUS activity was completely absent in all the tissues
examined in the seedlings derived from a cross be-
tween Nt. 326–37 (male parent) and wild type (fe-
male parent) irrespective of the presence/absence of
spectinomycin in the germinating Petri dish (Figure
5C). The specific activity of GUS in roots, leaf, stem,
petals, sepals and pollen was found to be 12, 1455,
280, 55, 900 and 5 picomoles of MU/min/
g of pro-
tein, respectively.
Analysis of T1 generation for genome stability
In order to detect any possible rearrangements and/or
deletions in the plastid genome due to recombination
between native and duplicated rrn and psbA promoter
and psbA and rbcL 3⬘UTR regions used to express
uidA/cry1Ia5 genes, samples of total plant DNA iso-
lated from single seedlings raised from twenty eight
independently transformed lines were analyzed by
Southern hybridization. The Southern hybridization
using tobacco psbA (Figure 5D), 16S rRNA (Figure
5E) and rice 3⬘rbcL (Figure 5F) probes confirmed the
lack of any rearrangements due to recombinations be-
tween the rice and tobacco regulatory regions. Simi-
lar results were obtained for the Nt. 326cryV-1 selfed
progeny plants (data not shown).
Analysis of T1 generation for growth and yield
related parameters
All spectinomycin resistant T0 plants were transferred
to the greenhouse to allow them to flower and set
seeds. The T1 generation plants obtained from the self
pollination of T0 plants and from the reciprocal
crosses with wild type plant were grown to maturity
in the greenhouse conditions and various critical pa-
rameters associated with growth and yield were re-
corded (Table 1). All transplastomic plants appeared
similar in both morphology and fruiting to non-trans-
genic tobacco plants raised under same growth con-
ditions. There was no significant difference between
the transplastominc plants and wild type plants for
plant height, flowering time and leaf size, indicating
lack of any adverse affect on the growth of the plants
due to high level expression of Cry1Ia5 in chloro-
plasts. Similarly, the chlorophyll content of the trans-
plastomic and non-transplastomic plants was not af-
fected due to high level expression of Cry1Ia5 in
chloroplasts. Importantly, there was no change in
yield related parameters such as number of pods per
plant and the weight of the pods in the transformed
plants when compared to wild type plants under
greenhouse conditions.
Discussion
Stable integration, inheritance of transgenes to prog-
eny and sustained-high level expression of foreign
genes in the progeny are most important critical fac-
tors for practical application of genetic engineering in
agriculture. While plethora of information is available
on the expression/silencing of transgenes in the prog-
eny for a number of nuclear transformed plants (In-
gelbrecht et al. 1991; Matzke and Matzke 1998; Van
Houdt et al. 2000), hardly any information is avail-
able for chloroplast transformed genes. Therefore, we
carried out detailed molecular, biochemical and ge-
netic analysis to verify the site-specific integration,
maternal inheritance, uniform expression of trans-
genes in the T1 and T2 generation plants. Analysis of
Cry1Ia5 protein confirmed the uniform, high level ex-
pression (up to 3% of the total soluble protein) of
265
Figure 5. Expression and maternal inheritance of aadA and uidA in the chloroplast transformed plant progeny. A). Phenotype of the seed-
lings from reciprocal crosses and selfed seed when grown on spectinomycin containing medium. While the seedlings from self fertilization
of Nt. 326cryV-1 and from a cross where Nt. 326cryV-1 was a female parent remained green, the seedlings from a cross where Nt. 326cryV-1
was a male parent turned to white due to lack of aadA transmission. Histochemical assay to detect GUS expression in the Nt. 326–37 flower
tissue (B), and in the seedlings (C). From left to right: Representative seedling from a Wild type plant, from a cross where Nt. 326–37 was
a male parent, female parent and from self fertilization. D-F). Southern hybridization to show the stable plastid genome among the progeny
plants. The total genomic DNA was digested with EcoRI and probed with tobacco psbA (D) and rice 3⬘rbcL (E) probes. F). Genomic DNA
digested with BamHI and hybridized with tobacco 16S rDNA probe. Arrow indicates the expected size signal in the absence of any rear-
rangements in the genome. Note the uniform hybridization pattern in all the transformed lines. Lane 1 represents wild type plant and lanes
2–29 represent twenty-eight independent progeny plants.
266
cry1Ia5 in all the independently transformed plants
and is ⬃300 fold higher when compared to the ex-
pression of the same gene in the nuclear transformed
plants (Selvapandiyan et al. 1998). Unlike all the pre-
vious studies that employed regulatory sequences
from tobacco to express Bt genes in tobacco (deCosa
et al. 2001; Kota et al. 1999; McBride et al. 1995),
we have used the psbA gene regulatory sequences
from rice to express cry1Ia5 in tobacco to avoid any
further possible homologous recombinations that
were occasionally observed between the introduced
and native promoter and terminator sequences (Fis-
cher et al. 1996; Goldschmidt-Clermont 1991;
Iamtham and Day 2000; Svab and Maliga 1993). The
Southern hybridization analysis on the progeny plants
confirmed the presence of stable genome and no re-
arrangements were detected.
In a leaf-disc bioassay, the cry1A(c) expressing
tobacco was shown to confer resistance against 3
rd
instar stage larvae of Heliothis virescens, Helicoverpa
zea and Spodoptera exigua (McBride et al. 1995).
Similarly, the cry2Aa2 expressing tobacco was shown
to confer resistance against susceptible and Bt resis-
tant 2
nd
and 3
rd
instar larvae of H. virescens, H. zea
and S. exigua (Kota et al. 1999). In this study, our re-
sults demonstrated that the chloroplast transformed
plants with cry1Ia5 offer complete protection against
the most advanced stage (5
th
instar) larvae of H. ar-
migera. The expression of Cry1Ia5 and level of pro-
tection remained the same in T1 and T2 generation
plants. Our data indicate that there were no signifi-
cant differences for any of the parameters analyzed
and no yield penalty was associated with the high
level expression, an important consideration for any
application. Moreover, overexpression of Cry pro-
teins in leaves under psbA promoter, as it happens in
the chloroplast transformed plants, should be a pre-
ferred choice, especially against phytophagous insects
feeding on green leaf tissues.
In conclusion, we have achieved high level expres-
sion of unmodified cry1Ia5 through chloroplast trans-
formation in tobacco plants under rice plastid tran-
scription elements, a critical step to avoid possible
emergence of resistance in insect pests in the fields
grown Bt transgenic crops. We have demonstrated the
stable integration of transgenes and their maternal in-
heritance. The transplastomic plants exhibited normal
growth and development and offered complete pro-
tection against all developmental stages of H. armig-
era larvae.
Acknowledgements
We thank M. Sugiura, Nagoya University, for provid-
ing rice and tobacco chloroplast library primary
clones, M. Goldschmidt-Clermont, University of
Geneva, for pUC-atpX-AAD plasmid and P. Maliga,
Waksman Institute, for providing seeds of tobacco
“Petit Havana”. Excellent technical assistance of N.
Arora is gratefully acknowledged.
References
Arnon D.I. 1949. Copper enzymes in isolated chloroplasts:
polyphenol oxidase in Beta vulgaris. Plant Physiol. 24: 1–15.
Bendich A.J. 1987. Why do chloroplasts and mitochondria contain
so many copies of their genome? BioEssays 6: 279–282.
Table 1. Comparison between chloroplast transformed and wild type plants for growth and yield parameters.
Parameter Wild type Transplastomic plant (Nt. 326cryV-1)
Plant height (cm) 106.3 ± 6.88 106.8 ± 8.35
Number of days to flower 116.1 ± 3.07 117.5 ± 2.17
Size of leaf
*
(sq. cm) 272.3 ± 7.57 269.5 ± 8.53
Number of pods per plant 81.5 ± 11.68 82.3 ± 11.40
Fresh weight of the leaf (g) 7.2 ± 0.80 7.2 ± 0.75
Dry weight of the leaf (g) 0.38 ± 0.08 0.42 ± 0.08
Chlorophyll content (a + b)
¶
124.63 ± 8.79 122.04 ± 7.49
Weight of the pod (mg) 175.9 ± 8.84 176.2 ± 6.55
Germination of T0 plant seeds (%) 89 86
*
The average size of the 8th leaf
¶
Total chlorophyll content (
g/gm fresh weight of leaf)
267
Bogorad L. 2000. Engineering chloroplasts: an alternative site for
foreign genes, proteins, reactions and products. Trends Biotech-
nol. 18: 257–263.
Boynton J.E., Gillham N.W., Harris E.H., Hosler J.P., Johnson
A.M., Jones A.R. et al. 1988. Chloroplast transformation in
Chlamydomonas with high velocity microprojectiles. Science
240: 1534–1537.
Brunke K.J. and Meeusen R.L. 1991. Insect control with geneti-
cally engineered crops. Trends Biotechnol. 9: 197–200.
Cox P.G. and Forrester N.W. 1992. Economics of insect resistance
management in Heliothis armigera (Lepidoptera: Noctridoe) in
Australia. J. Econ. Ent. 85: 1539–1550.
Daniell H., Datta R., Varma S., Gray S. and Lee S.B. 1998. Con-
tainment of herbicide resistance through genetic engineering of
the chloroplast genome. Nat. Biotechnol. 16: 345–348.
deCosa B.D., Moar W., Lee S.B., Miller M. and Daniell H. 2001.
Overexpression of the Bt cry2Aa2 operon in chloroplasts leads
to formation of insecticidal crystals. Nat. Biotechnol. 19: 71–
74.
Dennis S.H. 1983. Agricultural insect pests of tropics and their
control. Cambridge University Press, London, P 366.
Farrell L.B. and Beachy R.N. 1990. Manipulation of beta-glucu-
ronidase for use as a reporter in vacuolar targeting studies. Plant
Mol. Biol. 15: 821–825.
Fischer N., Stampacchia O., Redding K. and Rochaix J.D. 1996.
Selectable marker recycling in the chloroplast. Mol. Gen.
Genet. 251: 373–380.
Fujimoto H., Itoh K., Yamamoto M., Kyozuka J. and Shimamoto
K. 1993. Insect resistant rice generated by introduction of a
modified delta-endotoxin gene of Bacillus thuringiensis. Bio/
Technology 11: 1151–1155.
Gahukar R.T. 1991. Control of cotton insect mite pests in subtropi-
cal Africa: Current status and future needs. Insect science and
its application 12: 313–338.
Goldschmidt-Clermont M. 1991. Transgenic expression of ami-
oglycoside adenine transferase in the chloroplast: a selectable
marker for site-directed transformation of Chalamydomonas.
Nucl. Acids Res. 19: 4083–4089.
Heckel D.G., Gahaes L.J., Gould F., Daly J.C. and Trowell S. 1997.
Genetics of Heliothis and Helicoverpa resistance to chemical
insecticides and to Bacillus thurengiensis. Pesticide Science 51:
251–258.
Hiratsuka J., Shimada H., Whittier R., Ishibashi T., Sakamoto M.,
Mori M. et al. 1988. The complete sequence of the rice (Oryza
sativa) chloroplast genome: intermolecular recombination be-
tween distinct tRNA genes accounts for a major plastid DNA
inversion during the evolution of the cereals. Mol. Gen. Genet.
217: 185–194.
Hughes D. and Galam G. 1988. Preparation of RNA from cotton
leaves and pollen. Plant Mol. Biol. Rep. 6: 253–257.
Iamtham S. and Day A. 2000. Removal of antibiotic resistance
genes from transgenic tobacco plastids. Nat. Biotechnol. 18:
1172–1176.
Ingelbrecht I., Breyne P., Vancompernolle K., Jacobs A., Van Mon-
tagu M. and Depicker A. 1991. Transcriptional interference in
transgenic plants. Gene. 109: 239–242.
Jadhav D.R. and Armes N.J. 1996. Comparative status of insecti-
cide resistance in the Helicoverpa and Heliothis species (Lepi-
doptera: Noctridoe) of South India. Bulletin of Entomological
Research 86: 525–531.
Jefferson R.A., Kavanagh T.A. and Bevan M.W. 1989. GUS fu-
sions:

-glucuronidase as a sensitive and versatile gene fusion
marker in higher plants. EMBO J. 6: 3901–3907.
Kota M., Daniell H., Varma S., Garczynski S.F., Gould F. and Moar
W.J. 1999. Overexpression of the Bacillus thuringiensis (Bt)
Cry2Aa2 protein in chloroplasts confers resistance to plants
against susceptible and Bt-resistant insects. Proc. Natl. Acad.
Sci. USA 96: 1840–1845.
Laemmli U.K. 1970. Cleavage of structural proteins during the as-
sembly of the head of bacteriophage T4. Nature 227: 680–685.
Matzke A.J. and Matzke M.A. 1998. Position effects and epigenetic
silencing of plant transgenes. Curr. Opin. Plant Biol. 1: 142–
148.
McBride E., Svab Z., Schaaf D.J., Hogan P.S., Stalker D.M. and
Maliga P. 1995. Amplification of a chimeric Bacillus gene in
chloroplasts leads to an extraordinary level of an insecticidal
protein in tobacco. Bio/Technology 13: 362–365.
McGaughey W.H. and Whalon M.E. 1992. Managing insect resis-
tance to Bacillus thuringiensis toxins. Science 258: 1451–1455.
Mettler I.J. 1987. A simple and rapid method for minipreparation
of DNA from tissue cultured plant cells. Plant Mol. Biol. Rep.
5: 346–349.
Murashige T. and Skoog F.A. 1962. A revised medium for rapid
growth and bioassays with tobacco tissue culture. Physiol. Plant
15: 473–497.
Murray E.E., Rocheleau T., Eberle M., Stock C., Sekar V. and
Adang M. 1991. Analysis of unstable RNA transcripts of insec-
ticidal crystal protein genes of Bacillus thuringiensis in trans-
genic plants and electroporated protoplasts. Plant Mol. Biol. 16:
1035–1050.
Nayak P., Basu D., Das S., Basu A., Ghosh D., Ramakrishnan N.A.
et al. 1997. Transgenic elite indica rice plants expressing Cry-
IAc delta-endotoxin of Bacillus thuringiensis are resistant
against yellow stem borer (Scirpophaga incertulas). Proc. Natl.
Acad. Sci. 94: 2111–2116.
Perlak F.J., Fuchs R.L., Dean D.A., McPherson S.L. and Fischhoff
D. 1991. Modification of the coding sequence enhances plant
expression of insect control protein genes. Proc. Natl. Acad.
Sci. 88: 3324–3328.
Saiki R.K., Gelfand D.H., Stofell S., Scharf S.J., Higuchi R., Horn
G.T. et al. 1988. Primer-directed enzymatic amplification of
DNA with a thermostable DNA polymerase. Science 239: 487–
491.
Sambrook J. and Fritsch E.F. 1989. Maniatis: Molecular cloning.
A Laboratory Manual. Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, NY, USA.
Sarkar G. and Sommer S.S. 1990. The “megaprimer”method of
site-directed mutagenesis. Biotechniques 8: 404–407.
Schnepf E., Crickmore N., Van Rie J., Lereclus D., Baum J., Fei-
telson J. et al. 1998. Bacillus thuringiensis and its pesticidal
crystal proteins. Microbiol Mol. Biol. Rev. 62: 775–806.
Selvapandiyan A., Reddy V.S., Kumar P.A., Tewari K.K. and Bhat-
nagar R.K. 1998. Transformation of Nicotiana tabacum with a
native cry1Ia5 gene confers complete protection against Helio-
this armigera. Mol. Breed 4: 473–478.
Shimozaki K., Ohme M., Tanaka M., Wakarugi T., Hayash-ida H.,
Matsubayashi T. et al. 1986. The complete sequence of the to-
bacco chloroplast genome: its gene organization and expres-
sion. EMBO J. 5: 2043–2049.
268
Staub J.M. and Maliga P. 1992. Long regions of homologous DNA
are incorporated into the tobacco plastid genome by transfor-
mation. Plant Cell 4: 39–45.
Svab Z. and Maliga P. 1993. High-frequency plastid transforma-
tion in tobacco by selection for a chimeric aadA gene. Proc.
Natl. Acad. Sci. 90: 913–917.
Tabashnik B.E. 1997. Seeking the root of insect resistance to trans-
genic plants. Proc. Natl. Acad. Sci. 94: 3488–3490.
Vaeck M., Reynaerts A., Hofte H., Jansens S., De Buckeleer M.,
Dean L. et al. 1987. Transgenic plants protected from insect at-
tack. Nature 328: 33–37.
Van Houdt H., Van Montagu M. and Depicker A. 2000. Both sense
and antisense RNAs are targets for the sense transgene-induced
posttranscriptional silencing mechanism. Mol. Gen. Genet.
263: 995–1002.
Wong E.Y., Hironaka C.M. and Fischhoff D.A. 1992. Arabidopsis
thaliana small subunit leader and transit peptide enhance the
expression of Bacillus thuringiensis proteins in transgenic
plants. Plant Mol. Biol. 20: 81–93.
Wunn J., Kloti A., Burkhardt P.K., Biswas G.C., Launis K., Igle-
sias V.A. et al. 1996. Transgenic Indica rice breeding line IR58
expressing a synthetic cryIA(b) gene from Bacillus thuringien-
sis provides effective insect pest control. Bio/Technology 14:
171–176.
Zoubenko O.V., Allison L.A., Svab Z. and Maliga P. 1994. Effi-
cient targeting of foreign genes into the tobacco plastid ge-
nome. Nucl. Acids Res. 22: 3819–3824.
269
