ArticlePDF Available

Phylogeny of the genus Pythium and description of new genera

September 2010
Mycoscience 51(5):337-365

September 2010
51(5):337-365

DOI:10.1007/s10267-010-0046-7

Authors:

Shihomi Uzuhashi

RIKEN

Makoto Kakishima

University of Tsukuba

Phylogeny of the genus Pythium is analyzed based on sequences of the large subunit ribosomal DNA D1/D2 region and cytochrome oxidase II gene region of Pythium isolates and comprehensive species of related taxa belonging to the Oomycetes. The phylogenetic trees show that the genus Pythium is a highly divergent group and divided into five well- or moderately supported monophyletic clades. Each clade is characterized by sporangial morphology such as globose, ovoid, elongated, or filamentous shapes. Based on phylogeny and morphology, the genus Pythium (s. str.) is emended, and four new genera, Ovatisporangium, Globisporangium, Elongisporangium, and Pilasporangium, are described and segregated from Pythium s. lato. KeywordsMolecular phylogeny-rDNA-Sporangia-Taxonomy

GenBank accession numbers and references of taxa used in this study

…

continued

…

Figures - uploaded by Shihomi Uzuhashi

Content may be subject to copyright.

Content uploaded by Shihomi Uzuhashi

Content may be subject to copyright.

FULL PAPER

Phylogeny of the genus Pythium and description of new genera

Shihomi Uzuhashi

•

Motoaki Tojo

•

Makoto Kakishima

Received: 7 July 2009 / Accepted: 1 February 2010 / Published online: 10 April 2010

Ó The Mycological Society of Japan and Springer 2010

Abstract Phylogeny of the genus Pythium is analyzed

based on sequences of the large subunit ribosomal DNA

D1/D2 region and cytochrome oxidase II gene region of

Pythium isolates and comprehensive species of related taxa

belonging to the Oomycetes. The phylogenetic trees show

that the genus Pythium is a highly divergent group and

divided into ﬁve well- or moderately supported mono-

phyletic clades. Each clade is characterized by sporangial

morphology such as globose, ovoid, elongated, or ﬁla-

mentous shapes. Based on phylogeny and morphology, the

genus Pythium (s. str.) is emended, and four new genera,

Ovatisporangium, Globisporangium, Elongisporangium,

and Pilasporangium, are described and segregated from

Pythium s. lato.

Keywords Molecular phylogeny  rDNA  Sporangia 

Taxonomy

Introduction

The genus Pythium belongs to the family Pythiaceae, order

Pythiales, class Oomycetes, phylum Oomycota, and king-

dom Chromista (Kirk et al. 2008). The genus is widely

distributed throughout the world, and appropriately 150

species have been described (Kirk et al. 2008). The

members are amphibious and ubiquitous and occupy sev-

eral ecological niches (van der Plaa

ts-Niterink 1981).

Several species are known as pathogens of various plants,

and many of them show much wider host ranges than those

of other related genera, such as Phytophthora. They gen-

erally cause rot of fruit, roots, and stems, and pre- or

postemergence damping-off of seeds and seedlings. Other

pathogenic species are restricted to one or closely related

host species; for example P. porphyrae M. Takah. &

M. Sasaki causes red rot of marine red algae (Takahashi

et al. 1977). A few species can cause disease in restricted

environments; for example P. okanoganense P. E. Lipps

causes snow rot under snow (Lipps 1980). In addition to

these plant pathogens, P. guiyangense X. Q. Su is a parasite

of mosquito larvae (Su 2006) and P. insidiosum De Cock,

L. Mend., A. A. Padhye, Ajello & Kaufman is a mam-

malian pathogen (de Cock et al. 1987). On the other hand,

many species are known to inhabit various soils, such as

cultivated and uncultivated ﬁelds including forest, pastures,

or arid places as saprophytes; however, Pythium species in

uncultivated ﬁelds have not been the subject of much

study. Consequently, the distribution, ecological roles, and

physiological features of the species have not been sufﬁ-

ciently elucidated. Recently, many new Pythium species

have been described based on strains isolated from uncul-

tivated ﬁelds or seminatural environments in several

countries (Nechwatal and Oßwald 2003; Allain-Boule

et al.

2004; Ko et al.

2004; Nechwatal et al. 2005; Nechwatal and

Mendgen 2006; Paul 2006; Belbahri et al. 2008; de Cock

et al. 2008; Moralejo et al. 2008; Paul and Bala 2008;

Uzuhashi et al. 2009). This suggests that more unidentiﬁed

species exist in soils of uncultivated ﬁelds, and thus a

survey of Pythium species is warranted. Investigations of

S. Uzuhashi (&)  M. Kakishima

Graduate School of Life and Environmental Sciences,

University of Tsukuba, Tsukuba, Ibaraki 305-8572, Japan

e-mail: maruto@sakura.cc.tsukuba.ac.jp

M. Kakishima

e-mail: kaki@sakura.cc.tsukuba.ac.jp

M. Tojo

Graduate School of Life and Environmental Sciences,

Osaka Prefecture University, Osaka 599-8531, Japan

e-mail: tojo@plant.osakafu-u.ac.jp

123

Mycoscience (2010) 51:337–365

DOI 10.1007/s10267-010-0046-7

Pythium species in these relatively unexplored habitats are

important to understand not only their ecological roles and

physiological features but also the taxonomy and phylog-

eny of the genus.

The genus Pythium has the following morphological

characteristics (van der Plaa

ts-Niterink 1981): Hyphae are

hyaline and coenocytic without cross septa. Two types of

sporangia are present, ﬁlamentous and globose. Zoospores

develop in a vesicle, which is formed at the tip of a dis-

charge tube derived from a sporangium. Oospores are

formed in smooth or ornamented oogonia after fertilization

with paragynous or hypogynous antheridia. The oospore

ﬁlls the whole oogonium (plerotic) or has some space

between the walls of the oogoniu and oospore (aplerotic).

The formation of zoospores within a vesicle is character-

istic of Pythium and different from morphologically similar

genera, such as Phytophthora and Halophytophthora.On

the other hand, the process of zoospore formation is also

similar in the genus Lagenidium, but this genus shows

endobiotic and holocarpic features that have not been

reported in any Pythium species (Dick 2001a).

The genus Pythium was originally described by

Pringsheim in 1858, and P. monospermum Pringsh. was

selected as the type species. Since then, the classiﬁcation

has been changed by several researchers based on mor-

phological characteristics. Fischer (1892) divided the genus

into three subgenera, Aphragmium, Nematosporangium,

and Sphaerosporangium, based on sporangial morphology.

The ﬁrst subgenus was composed of species with nonin-

ﬂated ﬁlamentous sporangia without a septum that delim-

ited sporangia and hypha. The second subgenus included

species with ﬁlamentous sporangia delimited from the

vegetative hyphae by septa. The last subgenus was char-

acterized by (sub-)globose sporangia delimited by septa

from the vegetative hyphae. Schro

ter (1897) ﬁrst empha-

sized the importance of differences between ﬁlamentous

and globose shapes and combined two subgenera,

Aphragmium and Nematosporangium, into one genus,

Nematosporangium, and treated Sphaerosporangium as the

genus Pythium. Two subgenera, Eupythium and Artotrogus

were also placed within the genus Pythium by Schro

ter

(1897) based on the structure of the oogonial wall. Sub-

sequently, several Pythium species were transferred to

Nematosporangium (Sideris 1931; Yachevskij and

Yachevskij 1931); however, the genus Nematosporangium

was considered an illegitimate taxon because the type

species of Pythium,

P. monospermum, deﬁned by Prings-

heim, was included in Nematosporangium. Therefore, all

members are included in the genus Pythium in the current

taxonomy (van der Plaa

ts-Niterink 1981); however, it is

clear that Pythium is composed of two morphological

groups clearly differentiated from each other by

ﬁlamentous or globose sporangia, thus the infrageneric

classiﬁcation of Pythium should be examined in detail.

Taxonomy of Pythium species is generally based on

morphological characteristics, such as the shape and size of

sporangia and oogonia, the extent of oospore in the oogo-

nium (plerotic or aplerotic), the number of antheridia per

oogonium, and the position of the antheridium in relation to

the oogonium (Waterhouse 1963; van der Plaa

ts-Niterink

1981; Dick 1990). However, members of Pythium are con-

sidered a very difﬁcult group for species delimitation and

identiﬁcation because these characteristics are often very

similar among different species and sometimes not formed

on an agar medium. Therefore, recently, molecular methods

have been used for species identiﬁcation to supplement the

morphological taxonomy by many researchers who have

mainly analyzed the ribosomal DNA (rDNA) region. The

results revealed that sequences of the rDNA internal tran-

scribed spacer (ITS) region were very different among

Pythium species (Wang and White 1997; Matsumoto et al.

1999;Le

vesque and de Cock 2004; Kageyama et al. 2005).

Thus, sequence data of this region had been frequently used

to identify and classify Pythium species.

Molecular data have also been used for phylogenetic

analyses of Pythium and related genera based on the rDNA

large subunit (LSU) D1/D2 and ITS, b-tubulin, or mito-

chondrial cytochrome oxidase II (coxII) gene (Briard et al.

1995; Matsumoto et al. 1999; Panabieres et al. 1997;

Martin 2000; Petersen and Rosendahl 2000; Dick 2001b;

Voglmayr 2003; Villa et al. 2006; Belbahri et al. 2008).

Many reports have shown that Pythium appears to be a

nonmonophyletic group that includes several monophyletic

groups, and the species are clustered according to sporan-

gial morphology. One monophyletic group is characterized

by ﬁlamentous inﬂated or noninﬂated sporangia and

another group by globose sporangia. These results reveal

that the genus consists of several groups supported by both

morphology and phylogeny. Thus, this suggests the

necessity of taxonomic revision of the genus.

The objective of this study was to clarify the taxonomy

of the genus Pythium by morphological and phylogenetic

examinations based on Pythium isolates (Table 1). For this

purpose, Pythium species were isolated from various soil

samples collected from cultivated and uncultivated ﬁelds in

Japan and were analyzed phylogenetically based on the

sequences of two different genes, LSU rDNA D1/D2

region and coxII. To evaluate the phylogenetic relationship

between Pythium and other genera and phylogenetic rela-

tionships among Pythium species, comprehensive sequence

data from the GenBank database were used for analyses.

Based on the relationships between morphology and phy-

logeny, taxonomy of the genus Pythium is revised, and a

new taxonomic revision is proposed.

338 Mycoscience (2010) 51:337–365

123

Table 1 Species and GenBank accession number of the Pythium isolates used in this study

Isolate no. Isolate origin Species

GenBank accession No.

Origin International Substrate Locality ITS D1/D2 coxII

Pythium

UZ352 MAFF 241099 Soil (uncultivated) Hokkaido, Japan P. acanthicum AB468763 AB468698 AB468889

UZ364 MAFF 241100 Soil (uncultivated) Hokkaido, Japan P. acanthicum AB468764 AB468699

UZ051 MAFF 241101 Soil (cultivated) Nganano, Japan P. aphanidermatum AB468765 AB468700 AB468890

UZ216 MAFF 240154,

NBRC 103117

Soil (cultivated) Gunma, Japan P. aquatile AB359909 AB468701 AB468891

UZ264 MAFF 240156,

NBRC 103118

Soil (cultivated) Okinawa, Japan P. catenulatum AB468766 AB468702 AB468892

UZ159 MAFF 241102 Soil (cultivated) Kyoto, Japan P. dissotocum AB468767 AB468703 AB468893

UZ357 MAFF 241115 Soil (uncultivated) Hokkaido, Japan P. torulosum AB468780 AB468718 AB468905

OPU1445 MAFF 241116 Orchard grass Hokkaido, Japan P. vanterpoolii AB468783 AB468721 AB468908

OPU1446 Wheat Hokkaido, Japan P. volutum AB468786 AB468724 AB468911

OPU797 MAFF 241119 Soil (uncultivated) Okinawa, Japan Pythium sp.40 AB468768 AB468704

OPU1448 MAFF 241120 Orchard grass Hokkaido, Japan Pythium sp.41 AB468818 AB468756 AB468937

OPU1449 MAFF 241121 Orchard grass Hokkaido, Japan Pythium sp.42 AB468819 AB468757 AB468938

UZ156 MAFF 241122 Soil (cultivated) Nganano, Japan Pythium sp.2 AB468787 AB468725 AB468912

UZ190 MAFF 241125 Soil (cultivated) Hokkaido, Japan Pythium sp.3 AB468790 AB468728 AB468915

UZ379 MAFF 241142 Soil (uncultivated) Fukushima, Japan Pythium sp.16 AB468807 AB468745 AB468929

UZ419 MAFF 241147 Soil (uncultivated) Fukuoka, Japan Pythium sp.23 AB468812 AB468750 AB468933

UZ655 MAFF 241151 Soil (uncultivated) Miyagi, Japan Pythium sp.28 AB468816 AB468754 AB468935

ZSF0011 Soil (uncultivated) Nganano, Japan Pythium sp.43 AB468820 AB468758 AB468939

ZSF0093 Soil (uncultivated) Nganano, Japan Pythium sp.47 AB468824 AB468762

Ovatisporangium

UZ215 MAFF 241117 Soil (cultivated) Gunma, Japan O. vexans = P. vexans AB468784 AB468722 AB468909

UZ309 MAFF 241118 Soil (uncultivated) Kyoto, Japan O. vexans = P. vexans AB468785 AB468723 AB468910

UZ230 MAFF 241127 Soil (uncultivated) Nagano, Japan Ovatisporangium sp.1 AB468792 AB468730 AB468917

UZ248 MAFF 241128 Soil (uncultivated) Okinawa, Japan Ovatisporangium sp.2 AB468793 AB468731 AB468918

UZ287 MAFF 241138 Soil (cultivated) Okinawa, Japan Ovatisporangium sp.3 AB468803 AB468741 AB468925

UZ392 MAFF 241144 Soil (uncultivated) Fukuoka, Japan Ovatisporangium sp.4 AB468809 AB468747

UZ612 MAFF 241149 Soil (uncultivated) Nagano, Japan Ovatisporangium sp.5 AB468814 AB468752

Globisporangium

UZ067 MAFF 241103 Soil (cultivated) Nagano, Japan G. irregulare = P. irregulare AB468769 AB468705

UZ370 MAFF 241104 Soil (cultivated) Hokkaido, Japan G. irregulare =

P. irregulare AB468770 AB468706 AB468894

OPU1450 MAFF 241105 Wheat Hokkaido, Japan G. iwayamae = P. iwayamae AB299388 AB468707 AB468895

UZ233 MAFF 240155,

NBRC 103881

Soil (uncultivated) Nagano, Japan G. macrosporum =

P. macrosporum

AB359910 AB468708 AB468896

UZ041 MAFF 241106 Soil (cultivated) Nagano, Japan G. nunn = P. nunn AB468771 AB468709 AB468897

OPU1443 MAFF 241107 Orchard grass Hokkaido, Japan G. okanoganense =

P. okanoganense

AB468817 AB468755 AB468936

OPU1438 MAFF 241108 Wheat Hokkaido, Japan G. paddicum = P. paddicum AB468772 AB468710 AB468898

OPU466 CBS 157.64 Soil Adelaide,

Australia

G. paroecandrum =

P. paroecandrum

AY598644 AY598644

UZ354 MAFF 241109 Soil (uncultivated) Hokkaido, Japan G. rostratiﬁngens =

P. rostratiﬁngens

AB468773 AB468711 AB468899

OPU1440 MAFF 241110 Wheat Hokkaido, Japan G. rostratiﬁngens =

P. rostratiﬁngens

AB468774 AB468712 AB468900

OPU1441 MAFF 241111 Wheat Hokkaido, Japan G. rostratum = P. rostratum AB468775 AB468713 AB468901

UZ150 MAFF 240027 Soil (cultivated) Gunma, Japan G. spinosum = P. spinosum AB468776 AB468714 AB468902

UZ405 MAFF 241112 Soil (cultivated) Fukuoka, Japan G. spinosum = P. spinosum AB468777 AB468715

Mycoscience (2010) 51:337–365 339

123

Materials and methods

Isolation and morphological observation

Pythium species were isolated from 79 soil samples col-

lected in 18 prefectures of Japan. Among these samples, 40

were from cultivated ﬁelds and 39 from uncultivated ﬁelds,

such as forests, marshes, naturally grown weeds, and

roadsides. The isolations from soil samples and morpho-

logical observations were performed by methods described

previously (Uzuhashi et al. 2008, 2009).

DNA extraction, ampliﬁcation, and sequencing

The 69 isolates of Pythium were chosen for molecular

phylogenetic analyses based on their morphological

Table 1 continued

Isolate no. Isolate origin Species

GenBank accession No.

Origin International Substrate Locality ITS D1/D2 coxII

UZ174 MAFF 241113 Soil (cultivated) Kagoshima,

Japan

G. splendens = P. splendens AB468778 AB468716 AB468903

UZ307 MAFF 241114 Soil (uncultivated) Kyoto, Japan G. sylvaticum = P. sylvaticum AB468779 AB468717 AB468904

G. ultimum = P. ultimum

OPU465 CBS 219.65 Chenopodium

album

USA Var. sporangiiferum AY598656 AY598656

UZ056 MAFF 240024 Soil (cultivated) Nagano, Japan Var. ultimum AB468781 AB468719 AB468906

Py-2 MAFF 240295 Lettuce Hyogo, Japan G. uncinulatum =

P. uncinulatum

AB468782 AB468720 AB468907

UZ164 MAFF 241123 Soil (cultivated) Fukushima, Japan Globisporangium sp.1 AB468788 AB468726 AB468913

UZ182 MAFF 241124 Soil (cultivated) Kumamoto, Japan Globisporangium sp.2 AB468789 AB468727 AB468914

UZ213 MAFF 241126 Soil (uncultivated) Gunma, Japan Globisporangium sp.3 AB468791 AB468729 AB468916

UZ318 MAFF 241141 Soil (uncultivated) Hokkaido, Japan Globisporangium sp.3 AB468806 AB468744 AB468928

UZ400 MAFF 241145 Soil (uncultivated) Fukuoka, Japan Globisporangium sp.3 AB468810 AB468748 AB468931

UZ249 MAFF 241129 Soil (uncultivated) Okinawa, Japan Globisporangium sp.4 AB468794 AB468732 AB468919

UZ252 MAFF 241130 Soil (uncultivated) Okinawa, Japan Globisporangium sp.5 AB468795 AB468733

UZ253 MAFF 241131 Soil (uncultivated) Okinawa, Japan Globisporangium sp.6 AB468796 AB468734 AB468920

UZ260 MAFF 241132 Soil (uncultivated) Okinawa, Japan Globisporangium sp.7 AB468797 AB468735 AB468921

UZ263 MAFF 241133 Soil (cultivated) Okinawa, Japan Globisporangium sp.8 AB468798 AB468736

UZ284 MAFF 241136 Soil (cultivated) Okinawa, Japan Globisporangium sp.8 AB468801 AB468739 AB468924

UZ275 MAFF 241134 Soil (uncultivated) Okinawa, Japan Globisporangium sp.9 AB468799 AB468737 AB468922

UZ277 MAFF 241135 Soil (cultivated) Okinawa, Japan Globisporangium sp.10 AB468800 AB468738 AB468923

UZ285 MAFF 241137 Soil (cultivated) Okinawa, Japan Globisporangium sp.11 AB468802 AB468740

UZ290 MAFF 241139 Soil (cultivated) Okinawa, Japan Globisporangium sp.12 AB468804 AB468742 AB468926

UZ304 MAFF 241140 Soil (uncultivated) Ibaraki, Japan Globisporangium sp.13 AB468805 AB468743 AB468927

UZ382 MAFF 241143 Soil (uncultivated) Nagano, Japan Globisporangium sp.14 AB468808 AB468746 AB468930

UZ416 MAFF 241146 Soil (uncultivated) Fukuoka, Japan Globisporangium sp.15 AB468811 AB468749 AB468932

UZ594 MAFF 241148 Soil (uncultivated) Aichi, Japan Globisporangium sp.16 AB468813 AB468751

UZ636 MAFF 241150 Soil (uncultivated) Miyagi, Japan Globisporangium sp.17 AB468815 AB468753 AB468934

ZSF0030 Soil (uncultivated) Nagano, Japan Globisporangium sp.18 AB468821 AB468759 AB468940

ZSF0069 Soil (uncultivated) Nagano, Japan Globisporangium sp.19 AB468823 AB468761 AB468942

Elongisporangium

ZSF0056 NBRC 103814 Soil (uncultivated) Nagano, Japan Elongisporangium

sp.1 AB468822 AB468760 AB468941

Pilasporangium

UZ300 MAFF 241059 Soil (uncultivated) Wakayama, Japan Pi. apinafurcum = Py.

apinafurcum

AB458660 AB458651 AB458820

UZ301 MAFF 241060 Soil (uncultivated) Wakayama, Japan Pi. apinafurcum = Py.

apinafurcum

AB458657 AB458652 AB458818

Numbers following unidentiﬁed isolates indicate morphological groups

340 Mycoscience (2010) 51:337–365

123

characteristics. Some of them were deposited in the

Microbiological Genebank, National Institute of Agrobio-

logical Sciences (MAFF), Japan, and the Biological

Resource Center, National Institute of Technology and

Evaluation (NBRC), Japan, as shown in Table 1. DNA

extractions from these isolates and ampliﬁcation of the

LSU D1/D2 region of the rDNA were prepared by a

method described previously (Uzuhashi et al. 2008, 2009).

The coxII gene was ampliﬁed with the primer pair of FM66

TAGGATTTCAAGATCCTGC 3

) and FM58 (5

CCACAAATTTCACTACATTGA 3

) described by Martin

(2000). Reaction mixtures contained 2.5 llof109 Ex Taq

buffer (20 mM Tris–HCl, pH 8.0; 100 mM KCl), 2.0 llof

2.5 mM deoxyribonucleotide triphosphate (dNTP) mixture,

2.5 llof2lM each primer, 0.125 ll of Taq polymerase

(Takara Bio, Shiga, Japan), 1.0 ll of template DNA, and

14.5 ll sterile distilled water. Ampliﬁcation was carried

out in a polymerase chain reaction (PCR) System 9700

(Applied Biosystems, Tokyo, Japan) according to the fol-

lowing ampliﬁcation program: an initial denaturation at

95°C for 5 min, followed by 40 cycles including denatur-

ation at 94°C for 1 min, annealing at 52°C for 1 min,

extension at 72°C for 1 min, and the ﬁnal extension step at

72°C for 7 min. PCR products were puriﬁed with Wizard

SV Gel and PCR Clean-Up System (Promega, Tokyo,

Japan) following the manufacturer’s instructions and then

used for sequence analysis. All sequence reactions were

performed as previously described (Uzuhashi et al. 2008).

All sequence data has been deposited in the GenBank

(Table 1).

Molecular phylogenetic analyses

All isolates used for molecular phylogenetic analyses are

listed in Table 1. In addition to the species isolated in this

study, phylogenetically diverse Pythium species were

chosen based on a previous study (Le

vesque and de Cock

2004). Other organisms belonging to the Oomycetes were

chosen mainly based on the results of a report by

Riethmu

ller et al. (2002) and analyzed (Table 2). Sapr-

omyces elongatus (Cornu) Thaxt. (Rhipidiales in the

Rhipidiomycetidae) was chosen as the outgroup on the

basis of the results of previous studies (Riethmu

ller et al.

1999; Petersen and Rosendahl 2000). All sequence data

were aligned initially using ClustalX (Thompson et al.

1997) and then visually checked and reﬁned with MacC-

lade 4 (Maddison and Maddison 2000). The complete

alignments were deposited in TreeBASE as SN4688

(D1/D2) and SN4689 (coxII). All neighbor-joining (NJ)

analyses (Saitou and Nei 1987) were performed using

PAUP* 4.0b10 (Swofford 2002). The aligned data were

ﬁrstly analyzed with Modeltest version 3.7 (Posada and

Crandall 1998) using the Akaike information criterion

(AIC; Akaike 1974) to ﬁnd the most appropriated model of

DNA substitution, which was then used to calculate the NJ

tree. Support for internal tree nodes was obtained using

bootstrap analysis of 100 replicates. All maximum likeli-

hood (ML) analyses were performed using RAxML soft-

ware version 2.2.3 (Stamatakis 2006). One hundred

random sequence additions, as well as 100 bootstrap rep-

licates, were computed with RAxML version 2.2.3 using

the GTRMIX algorithm. All phylogenetic trees were

visualized by TREEVIEW version 1.6.6 (Page 1996).

Results and discussion

Identiﬁcation of isolates

The 554 isolates of Pythium were obtained from 79 soil

samples. Among them, 314 isolates were obtained from

cultivated ﬁelds, and the other 240 isolates were obtained

from uncultivated ﬁelds. Based on the morphological

characteristics observed, the 356 isolates were identiﬁed

into 18 species. The other 198 isolates could not be iden-

tiﬁed either because an asexual or sexual stage was not

observed or they had unique morphological characteristics

differing from those of reported species despite forming

several organs of both stages. Further taxonomic exami-

nation of these isolates, such as whether or not these iso-

lates should be considered as new species, are necessary in

the future. Most isolates from cultivated ﬁelds were iden-

tiﬁed, whereas more than half of the isolates obtained from

uncultivated ﬁelds were not identiﬁed. Although the

number of identiﬁed isolates was greater in cultivated ﬁelds

than in uncultivated ﬁelds, the number of species identiﬁed

was almost the same between the two types of ﬁelds. These

results suggest that more diverse Pythium species occupied

uncultivated ﬁelds than cultivated ﬁelds, and many Pyth-

ium isolates from uncultivated ﬁeld could not be identiﬁed

to species.

Alignment

In phylogenetic analyses based on the D1/D2 region of

LSU rDNA, 208 sequences were analyzed, which included

99 sequences from Pythium isolates (Table 2). The length

of all sequences varied from 545 to 651 bp, and the total

length after alignment was 692 bp. The log likelihood

of the best ML tree recovered by RAxML was

-15897.572501. The base frequencies were A 0.221360,

C 0.177384, G 0.311829, and T 0.289427. In the coxII

gene, 127 sequences were analyzed, which included 75

sequences from Pythium isolates (Table 2). The length

of all sequences varied from 554 to 581 bp, and the

total length after alignment was 581 bp. The log likelihood

Mycoscience (2010) 51:337–365 341

123

Table 2 GenBank accession numbers and references of taxa used in this study

Taxon Isolate no. GenBank accession no. Reference

D1/D2 CoxII

Oomycetes

Albuginales

Albuginaceae

Genus Albugo

A. candida AR 156 AY035539 Riethmu

ller et al. (2002)

A. evolvuli AR 377 DQ007489 Voglmayr and Riethmu

ller (2006)

A. occidentalis AY286220 Hudspeth et al. (2003)

A. tragopogonis AY286221 Hudspeth et al. (2003)

Peronosporales

Peronosporaceae

Genus Basidiophora

B. entospora HV 123 AY035513 Riethmu

ller et al. (2002)

HV 123 DQ365699 Go

ker et al. (2007)

Genus Bremia

B. lactucae HV 704 AY035507 Riethmu

ller et al. (2002)

HV 759 DQ365701 Go

ker et al. (2007)

Genus Halophytophthora

H. avicenniae CBS 188.85 AY598668 Le

vesque and de Cock (2004)

H. polymorphica CBS 680.84 AY598669 Le

vesque and de Cock (2004)

Genus Hyaloperonospora

H. barbareae MG 13-6 AY035499 Riethmu

ller et al. (2002)

H. brassicae MG 12-10 AY035503 Riethmu

ller et al. (2002)

H. dentariae MG 5-8 AY035505 Riethmu

ller et al. (2002)

H. erophilae MG 19-4 DQ365705 Go

ker et al. (2007)

H. niessliana MG 4-1 AY035498 Riethmu

ller et al. (2002)

H. parasitica AR 154 AY035501 Riethmu

ller et al. (2002)

MG 5-8 DQ365708 Go

ker et al. (2007)

H. thlaspeos-arvensis MG 15-2 AY035502 Riethmu

ller et al. (2002)

Genus Paraperonospora

P. leptosperma HV 383 AY035515 Riethmu

ller et al. (2002)

HV 383 DQ365712 Go

ker et al. (2007)

Genus Peronospora

P. aestivalis HV 167 AY035482 Riethmu

ller et al. (2002)

MG 18-4 DQ365714 Go

ker et al. (2007)

P. alsinearum HV 6a AY035472 Riethmu

ller et al. (2002)

P. aparines MG 4-5 AY035484 Riethmu

ller et al. (2002)

MG 4-5 DQ365717 Go

ker et al. (2007)

P. arvensis MG 15-10 AY035491 Riethmu

ller et al. (2002)

MG 15-9 DQ365719 Go

ker et al. (2007)

P. boni-henrici AR 167 AY035475 Riethmu

ller et al. (2002)

MG 7-4 DQ365720 Go

ker et al. (2007)

P. bulbocapni AF119599 Riethmu

ller et al. (1999)

P. calotheca HV 83 AY035483 Riethmu

ller et al. (2002

)

MG 6-2 DQ365721 Go

ker et al. (2007)

P. conglomerata HV 27 AY035489 Riethmu

ller et al. (2002)

MG 18-11 DQ365723 Go

ker et al. (2007)

P. ﬁcariae AF119600 Riethmu

ller et al. (1999)

342 Mycoscience (2010) 51:337–365

123

Table 2 continued

Taxon Isolate no. GenBank accession no. Reference

D1/D2 CoxII

P. hiemalis HV 5a AY035469 Riethmu

ller et al. (2002)

MG 4-4 DQ365724 Go

ker et al. (2007)

P. lamii MG 14-1 AY035494 Riethmu

ller et al. (2002)

MG 14-2 DQ365725 Go

ker et al. (2007)

P. myosotidis MG 1-4 AY035473 Riethmu

ller et al. (2002)

P. potentillae-sterilis MG 14-5 AY035486 Riethmu

ller et al. (2002)

P. pulveracea MG 9-5 AY035470 Riethmu

ller et al. (2002)

P. rumicis HV 300 AY035476 Riethmu

ller et al. (2002)

P. sanguisobae MG 12-6 AY035487 Riethmu

ller et al. (2002)

MG 12-2 DQ365729 Go

ker et al. (2007)

P. silvestris AR 194 AY035490 Riethmu

ller et al. (2002)

P. sparsa MG 14-9 AY035488 Riethmu

ller et al. (2002)

P. trifolii-alpestris MG 9-10 AY035481 Riethmu

ller et al. (2002)

P. trifolii-hybridi MG 13-8 AY035480 Riethmu

ller et al. (2002)

P. trifolii-minoris MG 11-9 AY035479 Riethmu

ller et al. (2002)

P. trivialis MG 6-4 AY035471 Riethmu

ller et al. (2002)

MG 6-4 DQ365733 Go

ker et al. (2007)

P. variabilis MG 8-6 AY035477 Riethmu

ller et al. (2002)

MG 8-6 DQ365734 Go

ker et al. (2007)

Genus Phytophthora

P. boehmeriae PD_00181 EU080166 Blair et al. (2008)

325 AY129177 Martin and Tooley (2003)

P. cactorum PD_00929 EU080282 Blair et al. (2008)

MG 34-2 DQ365737 Go

ker et al. (2007)

P. capsici PD_00009 EU080856 Blair et al. (2008)

AR 244 DQ365739 Go

ker et al. (2007)

P. cinnamomi PD_00394 EU080457 Blair et al. (2008)

Cn-2 AY129182 Martin and Tooley (2003)

P. citricola SB2084 AY129184 Martin and Tooley (2003)

P. citrophthora PD_00041 EU080542 Blair et al. (2008)

P. clandestina PD_00134 EU079871 Blair et al. (2008)

P. erythroseptica PD_00014 EU079832 Blair et al. (2008)

ATCC 36302 AY129191 Martin and Tooley (2003)

P. europaea PD_00082 EU079486 Blair et al. (2008)

P. gonapodyides PD_00040 EU080535 Blair et al. (2008)

393 AY129197 Martin and Tooley (2003)

P. heveae PD_00073 EU080800 Blair et al. (2008)

MG 25-8 DQ365742 Go

ker et al. (2007)

P. ilicis PD_00133 EU079864 Blair et al. (2008)

343 AY129202 Martin and Tooley (2003

)

P. insolita PD_00175 EU080180 Blair et al. (2008)

MG 33-8 DQ365744 Go

ker et al. (2007)

P. multivesiculata PD_00001 EU080070 Blair et al. (2008)

MG 33-6 DQ365748 Go

ker et al. (2007)

P. nicotianae PD_01305 EU080889 Blair et al. (2008)

Pn-17 AY129215 Martin and Tooley (2003)

P. palmivora 329 AY129217 Martin and Tooley (2003)

Mycoscience (2010) 51:337–365 343

123

Table 2 continued

Taxon Isolate no. GenBank accession no. Reference

D1/D2 CoxII

P. quercina PD_00035 EU080489 Blair et al. (2008)

MG 34-3 DQ365751 Go

ker et al. (2007)

P. ramorum PD_00058 EU080688 Blair et al. (2008)

CBS 101553 EU427471 Martin (2008)

P. syringae PD_00044 EU080562 Blair et al. (2008)

IMI 296829 AY129224 Martin and Tooley (2003)

Genus Plasmopara

P. baudysii HV 571 AY035517 Riethmu

ller et al. (2002)

P. densa MG 6-1 AY035525 Riethmu

ller et al. (2002)

MG 1-6 DQ365754 Go

ker et al. (2007)

P. geranii HV 6.4.P.P AY035520 Riethmu

ller et al. (2002)

P. halstedii AR 151 AY035523 Riethmu

ller et al. (2002)

P. megasperma HV B.M.4.4 AY035516 Riethmu

ller et al. (2002)

MG 39-4 DQ365755 Go

ker et al. (2007)

P. obducens HV 5.4.P.O AY035522 Riethmu

ller et al. (2002)

HV 306 DQ365757 Go

ker et al. (2007)

P. pimpinellae HV 634 AY035519 Riethmu

ller et al. (2002)

P. pusilla MG 8-10 AY035521 Riethmu

ller et al. (2002)

MG 8-10 DQ365759 Go

ker et al. (2007)

P. sii HV 550 AY035518 Riethmu

ller et al. (2002)

P. viticola AR 150 AY035524 Riethmu

ller et al. (2002)

MG 11-5 DQ365760 Go

ker et al. (2007)

Genus Plasmoverna

P. isopyri-thalictroidis HV 266 AY035526 Riethmu

ller et al. (2002)

P. pygmaea AF119605 Riethmu

ller et al. (1999)

Genus Pseudoperonospora

P. cubensis HV 221 h AY035496 Riethmu

ller et al. (2002)

P. humuli HV 129 AY035497 Riethmu

ller et al. (2002)

HV 129 DQ365763 Go

ker et al. (2007)

P. urticae HV 713 DQ365764 Go

ker et al. (2007)

Genus Viennotia

V. oplismeni HV isol. 11 AY035527 Riethmu

ller et al. (2002)

Pythiales

Pythiaceae

Genus Lagenidium

L. callinectes ATCC 24973 AB285217 –

ATCC 200337 AF290308 Cooke et al. (2000)

L. chthamalophilum AF235946 Petersen and Rosendahl (2000)

L. giganteum ATCC 36492 AF086697 Hudspeth et al. (2000)

L. myophilum ATCC 66280 AB285220 –

L. humanum ATCC 76726 AF290310 Cooke et al. (2000)

L. thermophilum ATCC 200318 AB285219 –

ATCC 200318 AF290304 Cooke et al. (2000)

Genus Pythium

P. acrogynum CBS 549.88 AY598638 Le

vesque and de Cock (2004)

P. adhaerens

CBS 520.74 AY598619 Le

vesque and de Cock (2004)

P. anandrum CBS 285.31 AY598650 Le

vesque and de Cock (2004)

344 Mycoscience (2010) 51:337–365

123

Table 2 continued

Taxon Isolate no. GenBank accession no. Reference

D1/D2 CoxII

P. angustatum CBS 522.74 AY598623 Le

vesque and de Cock (2004)

P. apleroticum CBS 772.81 AY598631 Le

vesque and de Cock (2004)

P. arrhenomanes CBS 324.62 AY598628 Le

vesque and de Cock (2004)

1993-39 AF196586 –

P. boreale CBS 551.88 AY598662 Le

vesque and de Cock (2004)

CBS 551.88 EF408876 –

P. capillosum CBS 222.94 AY598635 Le

vesque and de Cock (2004)

P. caudatum ATCC 58383 AF290309 Cooke et al. (2000)

P. conidiophorum CBS 223.88 AY598629 Le

vesque and de Cock (2004)

P. cucurbitacearum CBS 748.96 AY598667 Le

vesque and de Cock (2004)

P. cylindrosporum CBS 218.94 AY598643 Le

vesque and de Cock (2004)

P. deliense 1989-19 AF196589 –

P. dimorphum CBS 406.72 AY598651 Le

vesque and de Cock (2004)

P. echinulatum CBS 281.64 AY598639 Le

vesque and de Cock (2004)

P. graminicola CBS 327.62 AY598625 Le

vesque and de Cock (2004)

ATCC 96234 AB160849 –

P. helicandrum CBS 393.54 AY598653 Le

vesque and de Cock (2004)

P. helicoides CBS 286.31 AY598665 Le

vesque and de Cock (2004)

CBS 167.68 AB257273 Kageyama et al. (2007)

P. heterothallicum CBS 450.67 AY598654 Le

vesque and de Cock (2004

)

ATCC 18198 AF196595 –

P. inﬂatum CBS 168.68 AY598626 Le

vesque and de Cock (2004)

MAFF 305863 DQ071379 Villa et al. (2006)

P. insidiosum CBS 574.85 AY598637 Le

vesque and de Cock (2004)

ATCC 58643 AF196597 –

P. intermedium CBS 266.38 AY598647 Le

vesque and de Cock (2004)

MAFF 305570 DQ071380 Villa et al. (2006)

P. mastophorum CBS 375.72 AY598661 Le

vesque and de Cock (2004)

P. monospermum CBS 158.73 AY598621 Le

vesque and de Cock (2004)

AR 213 DQ365765 Go

ker et al. (2007)

P. multisporum CBS 470.50 AY598641 Le

vesque and de Cock (2004)

P. myriotylum 1993-43 AF196608 –

P. nodosum MAFF 305905 DQ071399 Villa et al. (2006)

P. oedochilum CBS 292.37 AY598664 Le

vesque and de Cock (2004)

CBS 252.70 AB108012

P. oligandrum CBS 382.34 AY598618 Le

vesque and de Cock (2004)

81-10 AF196610 –

P. ostracodes CBS 768.73 AY598663 Le

vesque and de Cock (2004)

CBS 768.73 AB108013 Kageyama et al. (2007)

P. paroecandrum CBS 157.64 DQ071391 Villa et al. (2006)

P. perplexum CBS 674.85 AY598658 Le

vesque and de Cock (2004)

P. pleroticum CBS 776.81 AY598642 Le

vesque and de Cock (2004)

P. polymastum CBS 881.70 AY598660 Le

vesque and de Cock (2004)

P. prolatum CBS 845.68 AY598652 Le

vesque and de Cock (2004)

P. sulcatum ATCC 24735 AF196620 –

P. undulatum AR 55 AF119603 Riethmu

ller et al. (1999)

MG 33-2 DQ365766 Go

ker et al. (2007)

Mycoscience (2010) 51:337–365 345

123

Table 2 continued

Taxon Isolate no. GenBank accession no. Reference

D1/D2 CoxII

Ripidiales

Rhipidiaceae

Genus Sapromyces

S. elongatus AR 9 AF119618 Riethmu

ller et al. (2002)

AF086700 Hudspeth et al. (2000)

Leptomitales

Leptomitaceae

Genus Apodachlya

A. brachynema AR 93 AF119590 Riethmu

ller et al. (2002)

A. pyrifera AF086695 Hudspeth et al. (2000)

Genus Leptomitus

L. lacteus AR 80 AF119597 Riethmu

ller et al. (2002)

ATCC 38076 AF086696 Hudspeth et al. (2000)

Saprolegniales

Leptolegniaceae

Genus Aphanomyces

A. laevis AR 47 AF119586 Riethmu

ller et al. (2002)

A. stellatus AR 51 AF119587 Riethmu

ller et al. (2002)

Genus Leptolegnia

L. caudata AF218176 Leclerc et al. (2000)

Genus Pachymetra

P. chaunorhiza CBS 960.87 AF119598 Riethmu

ller et al. (2002)

Genus Plectospira

P. myriandra CBS 523.87 AF119606 Riethmu

ller et al. (1999)

Saprolegniaceae

Genus Achlya

A. americana AR 26 AF119574 Riethmu

ller et al. (2002)

A. caroliniana AR 97 AF119576 Riethmu

ller et al. (2002)

A. colorata CBS 545.67 AF119577 Riethmu

ller et al. (

2002)

A. dubia CBS 546.67 AF119578 Riethmu

ller et al. (2002)

A. klebsiana CBS 101.49 AF119579 Riethmu

ller et al. (2002)

A. papillosa CBS 101.52 AF119580 Riethmu

ller et al. (2002)

A. racemosa AR 48 AF119581 Riethmu

ller et al. (2002)

A. radiosa AR 2 AF119582 Riethmu

ller et al. (2002)

A. spinosa AR 95 AF119583 Riethmu

ller et al. (2002)

A. treleaseana CBS 575.67 AF119584 Riethmu

ller et al. (2002)

Genus Aplanes

A. androgynus AF119588 Riethmu

ller et al. (2002)

Genus Aplanopsis

A. spinosa CBS 112.61 AF119589 Riethmu

ller et al. (2002)

Genus Brevilegnia

B. bispora CBS 569.67 AF119591 Riethmu

ller et al. (2002)

B. megasperma AR 4 AF119592 Riethmu

ller et al. (2002)

Genus Calyptralegnia

C. achlyoides AR 5 AF119593 Riethmu

ller et al. (2002)

Genus Dictyuchus

D. monosporus CBS 467.81 AF119595 Riethmu

ller et al. (2002)

346 Mycoscience (2010) 51:337–365

123

of the best ML tree recovered by RAxML was

-13011.219625. The base frequencies were A 0.314994,

C 0.111223, G 0.166925, and T 0.406857.

Phylogenetic position of Pythium

All phylogenetic trees constructed in this study based on

two different regions, rDNA D1/D2 and coxII, and two

different methods, ML and NJ, showed a basal division of

Oomycetes into two lineages with strong or moderate

support (Figs. 1, 2). One lineage was composed of the

Albuginales, Peronosporales, and Pythiales, including the

genus Pythium. Another was composed of the Leptomitales

and Saprolegniales. The same phylogenetic relationship

between two subclasses was reported by several previous

investigations based on LSU rDNA (Petersen and Rosen-

dahl 2000; Riethmu

ller et al. 2002), small subunit (SSU)

rDNA (Dick 1999), and coxII (Hudspeth et al. 2000).

Within the lineage including Pythium, the genus Pyth-

ium was clearly differentiated from the other genera ana-

lyzed, but it appeared to be a nonmonophyletic group

including several monophyletic groups. The genus includes

very divergent members phylogenetically, which is clear

when compared with those of the other genera. The genus

Pythium is placed in an intermediate position between

Lagenidium, and Phytophthora or Halophytophthora in

D1/D2 phylogenetic tree. Thus, it is suggested that the

genus is an ancestor of Phytophthora or Halophytophthora

(Fig. 1). A similar phylogenetic position of Pythium was

not shown in the coxII analyses, but the phylogenetic

position of Pythium in coxII trees was not resolved because

most of the basal branches were not supported signiﬁcantly

(Fig. 2). In contrast to the relationships between genera of

Pythiales, Peronosporales appeared to be a monophyletic

group, with signiﬁcant support in D1/D2 analyses (Fig. 1).

Phylogeny of Pythium

Previous phylogenetic analysis based on most sequence

data of Pythium (116 species) was reported by Le

vesque

and de Cock (2004). This study divided Pythium into 11

clades, A–K. Because at least one species was chosen from

each clade and was analyzed with many isolates obtained

from soils in this study, it was suggested that the most

morphologically or phylogenetically divergent Pythium

species were analyzed. Thus, it was expected that the

Table 2 continued

Taxon Isolate no. GenBank accession no. Reference

D1/D2 CoxII

D. sterilis ATCC 44890 AF086691 Hudspeth et al. (2000)

Genus Isoachlya

I. toruloides AF235947 Petersen and Rosendahl (2000)

Genus Protoachlya

P. paradoxa ATCC 44892 DQ393493 Hulvey et al. (2007)

P. Polyspora ATCC 28092 DQ393492 Hulvey et al. (2007)

Genus Pythiopsis

P. cymosa AF218172 Leclerc et al. (2000)

ATCC 26880 AF086689 Hudspeth et al. (2000)

Genus Saprolegnia

S. anisospora CBS 537.67 AF119609 Riethmu

ller et al. (2002)

S. diclina AR 12 AF119610 Riethmu

ller et al. (2002)

S. eccentrica CBS 551.67 AF119611 Riethmu

ller et al. (2002)

S. ferax AR 16 AF119612 Riethmu

ller et al. (2002)

ATCC 36051 AF086690 Hudspeth et al. (2000)

S. hypogyna CBS 869.72 AF119613 Riethmu

ller et al. (2002)

S. litoralis CBS 535.67 AF119614 Riethmu

ller et al. (2002)

S. monilifera CBS 558.67 AF119615 Riethmu

ller et al. (2002)

S. parasitica IFO 32780 DQ071421 Villa et al. (2006)

Genus Scoliolegnia

S. asterophora AR 94 AF119619 Riethmu

ller et al. (2002)

Genus Thraustotheca

T. clavata AR 10 AF119620 Riethmu

ller et al. (2002

)

Mycoscience (2010) 51:337–365 347

123

phylogeny of Pythium was more appropriately evaluated in

this study than in previous studies. As a result, Pythium

was divided into ﬁve well- or moderately supported clades

(1–5) common to all phylogenetic trees, although tree

topologies among clades were slightly different among

trees. Each of the ﬁve clades corresponded to one clade or

one group clustered of several clades of 11 clades (A–K) in

a previous study (Le

vesque and de Cock 2004). Detail

relationships between the ﬁve clades in this study (1–5) and

11 clades in the previous study (A–K; Le

vesque and de

Cock 2004) are also discussed.

Clade 1 was composed of six species and ﬁve unidentiﬁed

Pythium isolates in D1/D2 analyses. This clade was strongly

supported by bootstrap values (BV) of 96% in ML and 98%

in NJ analyses (Fig. 1). A single clade comparable with

clade 1 was also detected in the coxII trees, and it was sup-

ported by 98% BV (ML) and 100% BV (NJ; Fig. 2). Con-

sidering the species included in this clade, it was shown that

this clade was comparable with clade K of the previous study

(Le

vesque and de Cock 2004). According to the previous

study, two species, P. chamaehyphon Sideris and P. indig-

oferae E. J. Butler, are also included in this clade.

Clade 2 was composed of only one species, P. apina-

furcum Uzuhashi & Tojo, and was only distantly related to

the other clades, sufﬁcient to be an independent phyloge-

netic group. Among eight P. apinafurcum isolates obtained

in this study, D1/D2 sequences of all isolates were identi-

cal, whereas coxII showed two sequence patterns among

the isolates regardless of their origins. Therefore, two

isolates with different coxII sequences were analyzed. As a

result, a monophyletic group composed of only two isolates

was detected, with signiﬁcant support of 96% BV (ML)

and 100% BV (NJ). As in the D1/D2 analyses, this clade

was distantly related to the other clades of Pythium. The

phylogenetic position of clade 2 had not been detected in

any previous studies, including that of Le

vesque and de

Cock (2004). Therefore, P. apinafurcum was phylogeneti-

cally unique within Pythium.

Clade 3 consisted of 21 species and nine unidentiﬁed

Pythium isolates in the D1/D2 analyses. This clade was

supported by 93% BV (ML) and 99% BV (NJ), although

one species of Lagenidium, La. myophilum Hatai & Law-

hav., was also included in this clade because the D1/D2

sequence of this species (AB285220) was identical to that

of P. capillosum B. Paul (AY598635). However, the other

species of Lagenidium analyzed in this study, La.

chthamalophilum T.W. Johnson, La. callinectes Couch, La.

thermophilum

K. Nakam., Miho Nakam., Hatai & Zafran,

formed a well-supported clade, which was located in a

distiant position from La. myophilum. Therefore, it is

doubtful that the sequence data for La. myophilum are of a

Lagenidium species. A single clade comparable with clade

3 was also detected in the coxII trees and supported by 86%

BV in the NJ analysis, but it was not supported in the ML

tree. In the coxII analyses, three Pythium species, P. del-

iense Meurs, P. myriotylum Drechsler, and P. sulcatum

R. G. Pratt & J. E. Mitch., were also included in this clade.

Clade 3 consisted of species classiﬁed into clades A, B,

C, and D in the previous study (Le

vesque and de Cock

2004). Each subclade equaling four clades (A–D) was also

detected in D1/D2 phylogenetic trees in this study. Fur-

thermore, these four clades (A–D) were also detected as a

monophyletic group with signiﬁcant support in the previ-

ous study, which is comparable with clade 3 (Le

vesque and

de Cock 2004). Therefore, there is little doubt that the

members of clade 3 represent a monophyletic group.

According to the previous study (Le

vesque and de Cock

2004), P. amasculinum Y. N. Yu, P. aristosporum

Vanterp., P. chondricola De Cock, P. coloratum Vaartaja,

P. conidiophorum Jokl, P. diclinum Tokun., P. dissimile

Vaartaja, P. ﬂevoense Plaa

ts-Nit., P. folliculosum B. Paul,

P. grandisporangium Fell & Master, P. hydnosporum

(Mont.) J. Schro

t., P. lutarium Ali-Shtayeh, P. marinum

Sparrow, P. pachycaule Ali-Shtayeh, P. periilum Drechs-

ler, P. periplocum Drechsler, P. plurisporium Abad, Shew,

Grand & L. T. Lucas, P. porphyrae, P. pyrilobum Vaartaja,

P. scleroteichum Drechsler, P. sulcatum R. G. Pratt &

J. E. Mitch., P. tracheiphilum Matta, and P. zingiberis

M. Takah. were also included in this clade.

Clade 4 consisted of 28

Pythium species and 22

unidentiﬁed Pythium spp. isolates in the D1/D2 analyses.

The Albugo clade was also included in clade 4 in the ML

tree. However, clade 4 was not closely related to Albugo

because the phylogenetic position of Albugo was not

resolved due to long branches. A single clade comparable

with clade 4 was also detected in the coxII analyses,

although signiﬁcant support was not obtained. A BV

greater than 50% was shown in the NJ tree (53%).

Clade 4 included species belonging to ﬁve clades (E, F, G,

I, and J) of the previous study (Le

vesque and de Cock 2004).

A subclade identical to the ﬁve clades (clade E, F, G, I, and J)

was detected in clade 4, with strong to moderate support in

the D1/D2 trees. One exception was shown in clade I. How-

ever, most subclades identical to the ﬁve clades were not

detected in coxII analyses. Furthermore, members of clade 4

were not detected as a monophyletic group in the previous

study (Le

vesque and de Cock 2004), although all members

were closely related. As the tree topology within clade 4

Fig. 1 Phylogenetic tree of Pythium and related genera belonging to

the Peronosporomycetes based on rDNA LSU D1/D2 sequences.

Branch lengths were estimated with RAxML under maximum

likelihood. Numbers on branches represent bootstrap values (BV)

greater than 50%. Maximum likelihood (ML) BV from 100 replicates

conducted with RAxML (left) and neighbor-joining (NJ) BV from

100 replicates conducted with PAUP* (right) are shown. Numbers

following the species name indicate GenBank accession numbers

348 Mycoscience (2010) 51:337–365

123

Plasmopara

Plasmoverna

Bremia

Basidiophora

Paraperonospora

Hyaloperonospora

Viennotia

Peronospora

Pseudoperonospora

Phytophthora

Halophytophthora

Clade 1

Clade 2

Clade 3

Clade 4

Clade 5

Lagenidium

Pythium Pringsh.

Saprolegniales

Leptomitales

0.1 substitutions/site

Pl. sii AY035518

Pl. baudysii AY035517

Pl. pimpinellae AY035519

Pl. viticola AY035524

Pl. densa AY035525

Pl. halstedii AY035523

Pl. megasperma AY035516

Pl. pusilla AY035521

Pl. geranii AY035520

Pl. obducens AY035522

Pl. isopyli-thalictroidis AY035526

Pl. pygmaea AF119605

Br. lactucae AY035507

Ba. entospora AY035513

Pa. leptosperma AY035515

Hy. niessliana AY035498

Hy. thlaspeos-arvensis AY035502

Hy. parasitica AY035501

Hy. brassicae AY035503

Hy. dentariae AY035505

Hy. barbareae AY035499

Vi. oplismeni AY035527

Pe. arvensis AY035491

Pe. conglomelata AY035489

Pe. silvstris AY035490

Pe. sanguisobae AY035487

Pe. sparsa AY035488

Pe. rumicis AY035476

Pe. ficariae AF119600

Pe. hiemalis AY035469

Pe. pulveracea AY035470

Pe. myosotidis AY035473

Pe. boni-henrici AY035475

Pe. variabilis AY035477

Pe. lamii AY035494

Pe. trivialis AY035471

Pe. bulbocapni AF119599

Pe. trifolii-hybrid AY035480

Pe. alsinearum AY035472

Pe. trifolii-alpestris AY035481

Pe. trifolii-minoris AY035479

Pe. aestivalis AY035482

Pe. potentillae-sterilis AY035486

Pe. calotheca AY035483

Pe. aparines AY035484

Globisporangium sp.18 ZSF0030

Ps. humuli AY035497

Ps. cubensis AY035496

Ph. clandestina EU079871

Ph. nicotianae EU080889

Ph. cactorum

EU080282

Ph. quercina EU080489

Ph. gonapodyides EU080535

Ph. europaea EU079486

Ph. cinnamomi EU080457

Ph. heveae EU080800

Ph. ilicis EU079864

Ph. citrophthora EU080542

Ph. capsici EU080856

Ph. multivesiculata EU080070

Ph. ramorum EU080688

Ph. syringae EU080562

Ph. erythroseptica EU079832

Ph. insolita EU080180

Ph. boehmeriae EU080166

Ha. avicenniae AY598668

Ha. polymorphica AY598669

Ov. oedichilum AY598664

Ov. boreale AY598662

Ov. ostracodes AY598663

Ovatisporangium sp.1 UZ230

Ov. helicoides AY598665

Ovatisporangium sp.5 UZ612

Ovatisporangium sp.2 UZ248

Ov. cucurbitacearum AY598667

Ovatisporangium sp.3 UZ287

Ov. vexans UZ215

Ovatisporangium sp.4 UZ392

Ov. vexans UZ309

Pi. apinafurcum UZ300

Pythium sp.41 OPU1448

Py. vanterpoolii OPU1445

Py. volutum OPU1446

Py. arrhenomanes AY598628

Pythium sp.3 UZ190

Pythium sp.47 ZSF0093

Py. conidiophorum AY598629

Py. catenulatum UZ264

Py. torulosum UZ006

Pythium sp.16 UZ379

Py. angustatum AY598623

Py. inflatum AY598626

Py. graminicola AY598625

Pythium sp.2 UZ156

Py. apleroticum AY598631

Pythium sp.23 UZ419

Py. dissotocum UZ159

Py. aquatile UZ216

Pythium sp.42 OPU1449

La. myophilum AB285220

Py. capillosum AY598635

Pythium sp.43 ZSF0011

Py. adhaerens AY598619

Py. monospermum AY598621

Py. aphanidermatum UZ051

Py. acanthicum UZ364

Py. acanthicum UZ352

Py. oligandrum AY598618

Pythium sp.28 UZ655

Pythium sp.40 OPU797

Py. insidiosum AY598637

Globisporangium sp.16 UZ594

Globisporangium sp.17 UZ636

Gl. pleroticum AY598642

Globisporangium sp.12 UZ290

Globisporangium sp.7 UZ260

Globisporangium sp.9 UZ275

Gl. multisporum AY598641

Globisporangium sp.13 UZ304

Gl. rostratifingens UZ354

Gl. rostratifingens OPU1440

Globisporangium sp.15 UZ416

Gl. rostratum OPU1441

Gl. acrogynum AY598638

Gl. echinulatum AY598639

Globisporangium sp.2 UZ182

Globisporangium sp.11 UZ285

Globisporangium sp.6 UZ253

Gl. perplexum AY598658

Gl. nunn UZ041

Globisporangium sp.10 UZ277

Gl. mastophorum AY598661

Gl. polymastum AY598660

Gl. uncinulatum Py-2

Globisporangium sp.5 UZ252

Gl. paroecandrum OPU466

Gl. cylindrosporum AY598643

Globisporangium sp.14 UZ382

Gl. sylvaticum UZ307

Gl. spinosum UZ150

Gl. spinosum UZ405

Globisporangium sp.3 UZ213

Gl. intermedium AY598647

Globisporangium sp.3 UZ400

Globisporangium sp.3 UZ318

Gl. irregulare UZ370

Gl. irregulare UZ067

Globisporangium sp.19 ZSF0069

Sa. elongatus AF119618

Gl. macrosporum UZ233

Globisporangium sp.1 UZ164

Gl. iwayamae

OPU1450

Gl. paddicum OPU1438

Gl. okanoganense OPU1441

Globisporangium sp.4 UZ249

Globisporangium sp.8 UZ284

Gl. heterothallicum AY598654

Globisporangium sp.8 UZ263

Gl. ultimum var. ultimum UZ056

Gl. ultimum var. sporangiiferum OPU465

Gl. splendens UZ174

El. dimorphum AY598651

Elongisporangium sp.1 ZSF0056

El. prolatum AY598652

El. helicandrum AY598653

El. anandrum AY598650

La. chthamalophilum AF235946

La. callinectes AB285217

La. thermophilum AB285219

Ac. caroliniana AF119576

Ac. klebsiana AF119579

Ac. americana AF119574

Th. clavata AF119620

Ac. dubia AF119578

Is. toruloides AF235947

Br. bispora AF119591

Di. monosporus AF119595

Br. megasperma AF119592

Ac. colorata AF119577

Ac. racemosa AF119581

Ac. radiosa AF119582

Ac. treleaseana AF119584

Ap. androgynus AF119588

Ac. papillosa AF119580

Ap. spinosa AF119589

Ac. spinosa AF119583

Ca. achlyoides AF119593

Le. caudata AF218176

Sa. hypogyma AF119613

Sa. diclina AF119610

Pr. polyspora DQ393492

Sa. ferax AF119612

Sa. litoralis AF119614

Sa. monilifera AF119615

Sa. anispora AF119609

Sa. eccentrica AF119611

Pl. myriandra AF119606

Pa. chaunorhiza AF119598

Ap. stellatus AF119587

Ap. laevis AF119586

Sc. asterophora AF119619

Pr. paradoxa DQ393493

Py. cymosa AF218172

Ap. brachynema AF119590

Le. lacteus AF119597

Al. candida AY035539

Al. evolvuli DQ007489

El. undulatum AF119603

77/83

92/100

98/100

93/99

85/85

76/100

100/100

89/97

82/97

96/98

91/93

95/100

100/100

73/-

93/99

73/91

66/-

58/97

100/100

64/98

67/97

71/-

99/100

100/100

98/100

90/100

97/100

99/100

89/81

54/90

91/58

98/100

69/55

91/67

100/100

100/99

61/-

63/77

83/76

100/-

100/100

97/99

90/99

89/59

100/100

74/80

92/-

100/100

Lagenidium

Albugo

Mycoscience (2010) 51:337–365 349

123

largely differed among the trees constructed in this and the

previous study, the relationships among members of the

clade were not resolved. Considering the low support for this

clade and unclear relationships among isolates in this clade,

it is unclear whether members of clade 4 form a monophy-

letic group. Further phylogenetic analyses, including more

isolates, are needed to resolve the phylogeny of the clade

and relationships among clades. First, the isolation of

various isolates, including new species, is necessary.

According to the previous study (Le

vesque and de Cock

2004), P. acanthophoron Sideris, P. buismaniae Plaa

ts-Nit.,

P. debaryanum R. Hesse, P. erinaceum J. A. Robertson,

P. hypogynum Middleton, P. kunmingense Y. N. Yu, P. ma-

millatum Meurs, P. marsipium Drechsler, P. middletonii

Sparrow, P. minor Ali-Shtayeh, P. nagaii S. Ito & Tokun.,

P. orthogonon Ahrens, P. radiosum B. Paul, and P. violae

Chesters & Hickman were also included in this clade.

Clade 5 consisted of ﬁve species and one Pythium sp.

isolate in the D1/D2 analyses. A single clade comparable

with clade 5 was also detected in the coxII phylogenetic

trees, although only two isolates were analyzed. This clade

was supported by high BV greater than 98% in all of

phylogenetic trees. This clade was comparable with clade

H in the previous study (Le

vesque and de Cock 2004). As

in the previous study (Le

vesque and de Cock 2004), clade 5

was closely related to clade 4 and clustered with clade as

monophyletic group in the D1/D2 analyses.

Relationships between phylogeny and morphology

in Pythium

Principal relationships between molecular phylogeny and

morphological relationships within Pythium are shown in

Fig. 3. This ﬁgure was developed from the phylogeny based

on the D1/D2 ML tree and morphological characteristics.

The shape of sporangium, formation of papilla, proliferation

and zoospores, structure of oogonium, extent of oospores

within the oogonium, and the number of antheridia per

oogonium are shown. In addition to all isolates analyzed

here, the morphological characteristics of other species in

each clade suggested by results of the previous study

(Le

vesque and de Cock 2004) were also considered in the

examination.

Clade 1

The isolates of clade 1 formed sporangia of various shapes,

such as (ob-)ovoid, (sub-)globose, lemon-shaped, or cla-

vate. However, ovoid was the most common shape among

the isolates and was frequently formed in each isolate.

Sporangia with apical or lateral papilla and/or one to three

or more germ tubes were observed in most species in this

clade (Fig. 4a–f). Zoospores were formed in all isolates,

and internal proliferations were also observed in most

species (Fig. 4g–i).

In the sexual stage, the surface of oogonia was smooth in

all isolates. One exception is known in P. carbonicum

Paul, which is shown to be included in clade K corre-

sponding to clade 1 (de Cock et al. 2008). This species

formed both smooth and ornamented oogonia with small

projections (Paul 2003). Although oogonia and oospores

were generally colorless in most species in this clade, yel-

lowish oogonia or oospores were observed in two unidenti-

ﬁed isolates, UZ287, UZ392, and two isolates of P. vexans

de Bary and were known in P. helicoides Drechsler (van der

Plaa

ts-Niterink 1981). Antheridia were monoclinous or

diclinous and were mainly divided into two types in terms of

both their shape and attachment to the oogonium. One type

of antheridia was bell-shaped and had broad contact with the

oogonium (Fig. 4j). Another was small and had apical con-

tact with the oogonium (Fig. 4k). One exception was

observed in the UZ230 isolate, in which an antheridium was

absent, or many antheridia were produced per oogonium,

showing undeﬁned shapes or encircling an oogonium.

Oospores were aplerotic or plerotic, and both types were

observed among or within an isolate. Because morphologi-

cal characteristics of the sexual stage largely varied not only

among isolates but also within single isolates, this clade was

characterized by the ovoid sporangia with or without

papillae and the frequent formation of zoospores.

One remarkable exception of the morphological char-

acteristics in clade 1 was known in P. indigoferae.

Although this species was included in clade K by a pre-

vious study (Le

vesque and de Cock 2004), it was known to

form ﬁlamentous inﬂated sporangia (van der Plaa

ts-Niter-

ink 1981). This morphology, which is inconsistent with the

characteristics of this clade, was also pointed out in a

previous study (Le

vesque and de Cock 2004). However,

the previous study concluded that further examination for

the species was impossible because the strain of the species

(CBS 261.30) no longer forms sporangia. Therefore, the

inconsistent morphological characteristics of the species

could not be resolved here.

Clade 2

Clade 2 comprises only one species, P. apinafurcum. Thus,

the morphological characteristics of the clade are identical

Fig. 2 Phylogenetic tree of Pythium and related genera belonging to

the Peronosporomycetes based on partial cytochrome oxidase II gene

sequences. Branch lengths were estimated with RAxML under

maximum likelihood (ML). Numbers on the branches represent

bootstrap values (BV) greater than 50%. ML BV from 100 replicates

conducted with RAxML (left) and neighbor-joining (NJ) BV from

100 replicates conducted with PAUP* (right) are shown. Numbers

following the species name indicate GenBank accession numbers

350 Mycoscience (2010) 51:337–365

123

0.1substitutions/site

Gl. paddicum OPU1438

Gl. iwayamae OPU1450

Gl. okanoganense OPU1443

Gl. macrosporum UZ233

Globisporangium sp.3 UZ213

Globisporangium sp.3 UZ400

Globisporangium sp.14 UZ382

Gl. paroecandrum DQ071391

Gl. spinosum UZ150

Globisporangium sp.18 ZSF0030

Gl. intermedium DQ071380

Globisporangium sp.19 ZSF0069

Gl. sylvaticum UZ307

Globisporangium sp.1 UZ164

Gl. irregulare UZ370

Globisporangium sp.3 UZ318

Globisporangium sp.9 UZ275

Globisporangium sp.13 UZ304

Globisporangium sp.12 UZ290

Globisporangium sp.7 UZ260

Globisporangium sp.17 UZ636

Gl. rostratifingens UZ354

Gl. rostratifingens OPU1440

Gl. rostratum OPU1441

Globisporangium sp.6 UZ253

Globisporangium sp.15 UZ416

Globisporangium sp.2 UZ182

Globisporangium sp.10 UZ277

Gl. nunn UZ041

Gl. nodosum DQ071399

Globisporangium sp.4 UZ249

Gl. uncinulatum Py-2

Gl. heterothallicum AF196595

Globisporangium sp.8 UZ284

Gl. ultimum var. ultimum UZ056

Gl. splendens UZ174

Pythium sp.41 OPU1448

Py. volutum OPU1446

Py. vanterpoolii OPU1445

Pythium sp.3 UZ190

Py. arrhenomanes AF196586

Py. inflatum DQ071379

Py. graminicola AB160849

Py. catenulatum UZ264

Py. torulosum UZ357

Pythium sp.16 UZ379

Py. sulcatum AF196620

Py. myriotylum AF196608

Py. deliense AF196589

Py. aphanidermatum

UZ051

Py. insidiosum AF196597

Py. monospermum DQ365765

Py. dissotocum UZ159

Pythium sp.23 UZ419

Pythium sp.2 UZ156

Py. aquatile UZ216

Py. caudatum AF290309

Pythium sp.40 OPU1449

Py. oligandrum AF196610

Pythium sp.28 UZ655

Py. acanthicum UZ352

Pythium sp.43 ZSF0011

La. callinectes AF290308

La. thermophilum AF290304

La. humanum AF290310

La. giganteum AF086697

El. undulatum DQ365766

Elongisporangium sp.1 ZSF0056

Pe. boni-henrici DQ365720

Pe. trivialis DQ365733

Pe. hiemalis DQ365724

Pe. variabilis DQ365734

Pe. sanguisobae DQ365729

Pe. conglomerata DQ365723

Pe. aparines DQ365717

Pe. calotheca DQ365721

Pe. lamii DQ365725

Pe. aestivalis DQ365714

Pe. arvensis DQ365719

Ps. urticae DQ365764

Ps. humli DQ365763

Pl. megasperma DQ365755

Pl. pusilla DQ365759

Pl. viticola DQ365760

Pl. obducens DQ365757

Pl. densa DQ365754

Pa. leptosperma DQ365712

Br. lactucae DQ365701

Ba. entospora DQ365699

Hy. parasitica DQ365708

Ph. ramorum EU427471

Ph. ilicis AY129202

Ph. boehmeriae AY129177

Ph. heveae DQ365742

Ph. insolita DQ365744

Ph. gonapodyides AY129197

Hy. erophilae DQ365705

Ph. palmivola AY129217

Ph. quercina DQ365751

Ph. multivesiculata DQ365748

Ph. capsici DQ365739

Ph. citricola AY129184

Ph. cinnamomi AY129182

Ph. erythroseptica AY129191

Ph. syringae AY129224

Ph. cactorum DQ365737

Pi. apinafurcum UZ301

Pi. apinafurcum UZ300

Ov. ostracodes AB108013

Ovatisporangium sp.1 UZ230

Ov. boreale EF408876

Ov. oedichilum AB108012

Ov. vexans UZ215

Ov. vexans UZ309

Ovatisporangium sp.3 UZ287

Ov. helicoides AB257273

Ovatisporangium sp.2 UZ248

Sa. ferax AF086690

Py. cymosa AF086689

Sa. parasitica DQ071421

Di. sterilis AF086691

Ap. pyrifera AF086695

Le. lacteus AF086696

Sa. elongatus AF086700

Ph. nicotianae AY129215

Al. occidentalis AY286220

Al. tragopogonis AY286221

52/77

52/75

96/100

67/72

95/100

50/82

64/62

87/99

74/84

51/100

100/100

98/100

100/100

100/-

99/100

98/100

95/100

99/100

-/57

100/100

Clade 1

Clade 2

Clade 5

Clade 3

Clade 4

Leptomitales

Saprolegniales

Albug

Pythium Pringsh.

Lagenidium

Peronospora

Pseudoperonospora

Plasmopara

Paraperonospora

Bremia

Basidiophora

Phytophthora

Hyaloperonospora

Phytophthora

-/53

-/86

96/100

Mycoscience (2010) 51:337–365 351

123

to those of the species. This species was characterized by

complexly branched secondary hyphae (Fig. 5b) and

oogonium, within which two oospores were frequently

observed (Fig. 5f). The other morphological characteristics

were sickle-shaped appressoria, globose nonproliferationg

sporangia, smooth oogonia, and plerotic or aplerotic

oospores (Fig. 5a, c–e). Zoospores were rarely observed.

Clade 3

Most species in clade 3 formed one characteristic, deﬁned

as ﬁlamentous sporangia, although various shapes were

observed; that is, sporangia that did not differ from vege-

tative hyphae (noninﬂated), consisting of a lobate or toru-

loid inﬂated element, or catenulate globose elements, were

observed among isolates (Fig. 6a–f). A few exceptions

were shown in OPU797 and ZSF0093 unidentiﬁed isolates

in this study and were known in P. tracheiphilum, P. sal-

pingophorum Drechsler and P. conidiophurum (van der

Plaa

ts-Niterink 1981). The OPU797 isolate formed unique

ovoid- or pyriform-shaped sporangia. The tip of the spo-

rangia intensively elongated and often reached 150 lmor

more (Fig. 6g). This feature was rarely observed in other

Pythium species. This isolate also sometimes formed spo-

rangia-like ﬁlamentous shapes on the same agar medium.

The ZSF0093 isolate formed subglobose sporangia, which

were often contiguous as a chain (Fig. 6f). Unlike the

catenulate sporangia shown in several species within the

clade, the shapes were generally ellipsoid rather than glo-

bose. A similar shape of sporangia was also known in

P. tracheiphilum, although the catenulate feature was not

shown in this species (van der Plaa

ts-Niterink 1981). Two

species, P. conidiophorum and P. salpingophorum, show

similar morphological characteristics of globose sporangia

(van der Plaa

ts-Niterink 1981). According to our and pre-

vious studies, it was suggested that the three species,

P. tracheiphilum, P. conidiophorum, and P. salpingopho-

rum, and an isolate, ZSF0093, having (sub-)globose spo-

rangia, were phylogenetically closely related (Le

vesque

and de Cock 2004). Zoospores were observed in most

species in clade 3 regardless of the shape of sporangia.

When zoospores were observed, discharge tubes originat-

ing from sporangia tended to be longer than those of glo-

bose or ovoid sporangia and were 300 lm or more

(Fig. 6h). The shapes or sizes of ﬁlamentous sporangia

varied largely among or within isolates. Because the

number of zoospores formed in a vesicle reﬂected

the amount of protoplasm in the original sporangium, the

number of zoospores in a vesicle was more variable than in

globose sporangia, varying from two to about 40 or more.

A sexual stage was not observed in two isolates, UZ156

and UZ190. In the other isolates, oogonia of most species

had a smooth surface, but a few isolates, P. acanthicum

Drechsler, P. oligandrum Drechsler, and UZ655, formed

oogonia with ornamented walls with acute spines (Fig. 6i).

All isolates with ornamented oogonia clustered in a

monophyletic group within clade 3, which was comparable

with clade D in the previous study (Le

vesque and de Cock

2004), revealing that species with ornamented oogonia

were phylogenetically closely related. The extent of

oospores within an oogonium, such as plerotic or aplerotic,

and the number of antheridia per oogonium varied among

or within isolates in this clade. Therefore, this clade was

clearly characterized by ﬁlamentous sporangia, although

one subclade was characterized by ornamented oogonia.

Clade 4

Most species within clade 4 formed globose sporangia

similar to those of clade 2 (Fig. 7a, b), although no spo-

rangia were observed in two isolates, UZ253 and UZ290.

Other shapes, such as ovoid, pyriform, ellipsoid, and

cylindrical, were also observed in many isolates. Sporangia

with papilla were only observed in UZ275 and UZ304

isolates and also known in P. marsipium (van der Plaa

ts-

Niterink 1981). Although the structure was also known in

P. rostratiﬁngens De Cock & Le

vesque (de Cock and

vesque 2004), it was not observed in two isolates iden-

tiﬁed as this species, UZ354 and OPU1440. Zoospores

were observed or known in less than half of all isolates

within the clade, much fewer than in other clades. When

zoospores were produced, the discharge tube was generally

shorter than that of ﬁlamentous sporangia (Fig. 7c). Pro-

liferating sporangia were formed in UZ275 and UZ304

isolates (Fig. 7d) and described in the reports in P. multi-

sporum Poitras and P. middletonii (van der Plaa

ts-Niterink

1981). Unlike in the monograph by van der Plaa

ts-Niterink

(1981), the OPU1443 isolate of P. okanoganense did not

form this structure.

A sexual stage was not observed in eight isolates,

UZ164, UZ213, UZ290, UZ304, UZ318, UZ400,

ZSF0030, and ZSF0069. Among species in this clade,

three, P. heterothallicum W. A. Campb. & F. F. Hendrix,

P. intermedium de Bary, and P. splendens, are known to be

heterothallic (van der Plaa

ts-Niterink 1981). As in the

previous study, the UZ174 isolate identiﬁed as P. splendens

did not form sexual reproductive organs in culture,

Fig. 3 Relationships between phylogeny and morphology of Pythium

based on the maximum likelihood (ML) phylogenetic tree using

D1/D2 sequences. Sp sporangium morphology (O ovoid, obovoid or

pyriform. G globose, subglobose, ellipsoid or cylindrical. V amor-

phous. E elongated shapes. Fi ﬁlamentous inﬂated. Fn ﬁlamentous

noninﬂated. C catenulate). Pa papilla (1produced). Pr internal

proliferation (1produced). Zo zoospores (1produced). Og surface

wall of oogonia (S smooth. O ornamented). Os oospores (A aplerotic,

P plerotic, NP nearly plerotic). An number of the antheridium per

oogonium (M many antheridia undeﬁned)

352 Mycoscience (2010) 51:337–365

123

Sp Pa Pr Zo Og Os An Species (Isolate)

O + + + S A 1-2(4) Ov. oedichilum

O, G + S P 1 Ov. boreale

O+++S P 1-2Ov. ostracodes

O, G + + + S A 0(1), M Ovatisporangium sp.1 (UZ230)

O + + + S A 1-4 Ov. helicoides

O, G + + + S A 0-3 Ovatisporangium sp.5 (UZ612)

O, G + + + S A,P 1-2 Ovatisporangium sp.2 (UZ248)

+ + S A 1 Ov. cucurbitacearum

O, G + + S P 1(-3) Ovatisporangium sp.3 (UZ287)

O, G, V + + + S P,A 1(2) Ov. vexans (UZ215)

O, G + + S A,P 1(2) Ovatisporangium sp.4 (UZ392)

O, G, V + + S A 1(2) Ov. vexans (UZ309)

G + S P,A 1-3 Pi. apinafurcum (UZ300)

Fi S A(P) 1-3 Pythium sp.41 (OPU1448)

Fi/C + S P 0-2 Py. vanterpoolii (OPU1445)

Fi + S P 1-M Py. volutum (OPU1446)

Fi + S P 4-8 Py. arrhenomanes

Fi + - - - Pythium sp.3 (UZ190)

Fi /C S P 0 Pythium sp.47 (ZSF0093)

G/C + + S P 0-3 Py. salpingophorum

Fi/C, Fn + S A 1 Py. catenulatum (UZ264)

Fi + S P(A) 1-2 Py. torulosum (UZ357)

Fi S P(NP) 1-3 Pythium sp.16 (UZ379)

Fn + S A 1-5 Py. angustatum

Fi + S P 1-2 Py. inflatum

Fi + S P 1-3 Py. graminicola

Fn, Fi + - - - Pythium sp.2 (UZ156)

Fn + S A 1-2 Py. apleroticum

Fn + S A,NP 1-4 Pythium sp.23 (UZ419)

Fn + S A 1-3 Py. dissotocum (UZ159)

Fn + S A 1-3 Py. aquatile (UZ216)

Fi /C S P 1 Pythium sp.42 (OPU1449)

Fn + S A,P 1-6 Py. capillosum

Fi + S A 1-2 Pythium sp.43 (ZSF0011)

Fn + S A 1-4 Py. adhaerens

Fn + S P 1-2 Py. monospermum

Fi + S A 1-2 Py. aphanidermatum (UZ051)

Fi + O P,NP 1(2) Py. acanthicum (UZ364)

Fi + O P,NP 1(2) Py. acanthicum (UZ352)

Fi + O A 1-2 Py. oligandrum

Fi + O A(P) 1-2(3) Pythium sp.28 (UZ655)

Fi, E + S P 1(2) Pythium sp.40 (OPU797)

Fn + S A 1 Py. insidiosum

G S P 0-3 Globisporangium sp.16 (UZ594)

G S P,A 1 Globisporangium sp.17 (UZ636)

G S Gl. pleroticum

(G) - - - Globisporangium sp.12 (UZ290)

G S P,A 1-2 Globisporangium sp.7 (UZ260)

G + + + S A 1-3 Globisporangium sp.9 (UZ275)

G + + S P 1-3 Gl. multisporum

G + + + - - - Globisporangium sp.13 (UZ304)

G + S P 1-2 Gl. rostratifingens (UZ354)

G S P 1-2 Gl. rostratifingens (OPU1440)

G S P 1(2) Globisporangium sp.15 (UZ416)

G S P 1-2(3) Gl. rostratum (OPU1441)

G S(O) P 1 Gl. acrogynum

G + O A,P 1 Gl. echinulatum

G S P 1-3 Globisporangium sp.2 (UZ182)

G + S A 1(-3) Globisporangium sp.11 (UZ285)

S A 1-2(3) Globisporangium sp.6 (UZ253)

G + S A Gl. perplexum

G + S NP(A) 1-3(4) Gl. nunn (UZ041)

G + S A,P 1-3(5) Globisporangium sp.10 (UZ277)

G O A,P 1 Gl. mastophorum

G + O A 1-4 Gl. polymastum

G + O A 1-8 Gl. uncinulatum (Py-2)

G, O + S A 1-2(3) Globisporangium sp.5 (UZ252)

G S A,NP 1-2 Gl. paroecandrum (OPU466)

G S P,A 1-2 Gl. cylindrosporum

(G) S A 1-2 Globisporangium sp.14 (UZ382)

G S P(NP) 1-4 Gl. sylvaticum (UZ307)

G O P,NP 1(-3) Gl. spinosum (UZ150)

G O P(A) 1(-3) Gl. spinosum (UZ405)

G - - - Globisporangium sp.3 (UZ213)

G S A 1-7 Gl. intermedium

G - - - Globisporangium sp.3 (UZ400)

G - - - Globisporangium sp.3 (UZ318)

G S(O) A 1-2 Gl. irregulare (UZ370)

G S(O) A(P) 1-2 Gl. irregulare (UZ067)

G, O - - - Globisporangium sp.19 (ZSF0069)

G, O + - - - Globisporangium sp.18 (ZSF0030)

G, O + S A 1-4 Gl. macrosporum (UZ233)

G - - - Globisporangium sp.1 (UZ164)

G S P,A 1-2 Gl. iwayamae (OPU1450)

G O A 1-2 Gl. paddicum (OPU1438)

G S A,P 1 Gl. okanoganense (OPU1443)

G, O + S 1-M Globisporangium sp.4 (UZ249)

G S 2-M Globisporangium sp.8 (UZ284)

G S A 1-8 Gl. heterothallicum

G S 1-2 Globisporangium sp.8 (UZ263)

G S A 1(2) Gl. ultimum var. ult. (UZ056)

G + S A 1(2) Gl. ultimum var. spo. (OPU465)

G S A 1-2 Gl. splendens (UZ174)

E + + + - - - El. unduratum

E + + O A,P 0 El. dimorphum

E + O P 1 Elongisporangium sp.1 (ZSF0056)

E + O A 1 El. prolatum

E + O 1 El. helicandrum

+++ O P(NP) 0 El. anandrum

Genus Pythium

Genus

Ovatisporangium

Genus

Globisporangium

Genus

Elongisporangiu

Genus

Pilasporangium

Clade 1

Clade 2

Clade 3

Clade 4

Clade 5

Mycoscience (2010) 51:337–365 353

123

suggesting this isolate may be heterothallic. This isolate

formed sexual organs in dual culture with a female isolate

of P. splendens (CBS 266.69) but not in a dual culture with

a male isolates of the species (CBS 462.48), indicating that

the UZ174 isolate was a male isolate of this species. Both

homothallic and heterothallic isolates are known in

P. sylvaticum. The UZ307 isolate identiﬁed as P. sylvati-

cum formed sexual organs in single culture, i.e., the isolate

is homothallic. Ornamented oogonia were known or

observed in several species. The number and shape of the

projections of their ornamented walls largely varied among

species. For example, it was spine-like with a blunt tip

(P. spinosum Sawada), conical with an acute tip (P. unci-

nulatum Plaa

ts-Nit. & I. Blok) or with a blunt tip, with

occasionally branching dichotomously (P. paddicum

Hirane) (Fig. 7f, g, i, j). Unlike the monophyly in clade 3,

the species with ornamented oogonia were located in

scattered positions within the clade.

Various characteristics of antheridial stalks or cells were

also observed among isolates. The three isolates, UZ252,

UZ253, and UZ285, formed swollen antheridial stalks

similar to each other (Fig. 7h). When the antheridium did

not contact the oogonium, its stalk was similar to a

ﬁlamentous inﬂated sporangium. The other three isolates,

UZ249, UZ263, and UZ284, produced many antheridia or

slender antheridial stalks per oogonium surrounding the

oogonium (Fig. 7k). All three isolates were closely related

and formed a single subclade together with P. heterot-

hallicum. Although P. heterothallicum is a heterothallic

species, it produced many antheridia, often forming a

complicated knot around the oogonium in dual culture.

Therefore, this unique feature of the antheridium was also

supported phylogenetically. Oospores were plerotic or

aplerotic, and the features varied among or within isolates

(Fig. 7f–l). Although a few morphological features char-

acterized small subclades, there were no morphological

characteristics of sexual organs common to all isolates

within the clade. Therefore, clade 4 was only characterized

by globose sporangia. However, the number of species

forming zoospores was obviously small in this clade

compared with other clades.

Clade 5

Clade 5 was clearly characterized by very large elongated

clavate sporangia (Fig. 8a, b). These characteristic are not

Fig. 4 Morphology of species

in the genus Ovatisporangium.

Ovoid sporangia with germ

tubes (a Ovatisporangium sp. 1

UZ230, b Ovatisporangium sp.

2 UZ248). c Ovoid sporangium

with a papilla of O. vexans.

d Unique shape of sporangia of

P. vexans. e Globose

sporangium with two germ

tubes of Ovatisporangium sp.2

UZ248. f Clavate sporangium

with papilla of O. vexans.

g Vesicle with zoospores of

Ovatisporangium sp. 1 UZ230.

h Empty sporangium after

zoosporogenesis of O. vexans.

i Internally proliferating

sporangium of Ovatisporangium

sp. 2 UZ248. j Smooth

oogonium with broadly

connected antheridium of

O. vexans. k Smooth oogonium

contacted by antheridium of

Ovatisporangium sp.2 UZ248.

Bar 20 lm

354 Mycoscience (2010) 51:337–365

123

known in any Pythium species. Sporangia with papilla,

internal proliferating sporangia, and zoospores are some-

times observed in most species. Although a sexual stage is

not known in P. undulatum H. E. Petersen, all other species

produced ornamented oogonia (Fig. 8c). There are fewer

antheridia per oogonium than in other clades, which usu-

ally have one or none. Most morphological characteristics

of the asexual and sexual stages are similar within the

clade.

Based on relationships between morphology and phy-

logeny, it was shown that the sporangial morphology cor-

related with the phylogeny of Pythium. Although the same

relationship between phylogeny and sporangial morphol-

ogy had also been suggested in several previous studies

(Briard et al. 1995; Matsumoto et al. 1999;Le

vesque and

de Cock 2004), more detailed variations among shapes

were shown in this study. Previous studies had reported on

two morphological shapes, ﬁlamentous and globose.

However, the globose sporangia were further divided into

three morphological types, globose, ovoid, and elongated

shapes in this study based on the examination of more

species. As a result, three clades, clades 1, 3, and 5, were

clearly differentiated by sporangial morphology: ovoid,

ﬁlamentous, and elongate clavate sporangia, respectively.

Clades 2 and 4 were commonly characterized by globose

sporangia, although they were distinguished from each

other phylogenetically.

Relationships between Pythium and related genera

Clade 1 was closely related to genera of Peronosporales

(Phytophthora and Halophytophthora) in D1/D2 analyses.

A similar phylogenetic relationship was indicated in sev-

eral previous phylogenetic analyses based on the LSU

rDNA (Briard et al. 1995), rDNA ITS (Villa et al. 2006),

and b-tubulin (Villa et al. 2006; Belbahri et al. 2008).

Furthermore, a sister group between clade 1 and a mono-

phyletic group of all genera of Peronosporales, including

Phytophthora and Halophytophthora, was shown in this

study and highly supported by 82% BV (ML) and 97% BV

(NJ) (Fig. 1). Similarities between Pythium species within

clade 1 and Phytophthora have been recognized in various

studies. Ovoid-shaped sporangia with or without papilla

were often formed in Pythium species of clade 1 and sev-

eral Phytophthora species. In molecular characteristics, the

5S rDNA of the Pythium species of clade 1 were linked on

the same strand within the intergenic spacer (IGS) region

(Belkhiri et al. 1992). Although this position has not been

seen in other Pythium species, it is commonly shown in

Phytophthora species (Bedard et al. 2006). This evidence

indicates that the members of clade 1 are clearly differ-

entiated from Pythium species within the other clades and

more closely related to Phytophthora than the other

Pyth-

ium species.

On the other hand, the species of clade 1 were clearly

differentiated from other genera in the linage by the for-

mation of zoospores within a vesicle. Clade 1 was placed

on the more basal line in the linage of Peronosporales. This

hypothesis was also supported by other molecular phylo-

genetic analyses (Riethmu

ller et al. 1999; Cooke et al.

2000; Petersen and Rosendahl 2000). Therefore, it is sug-

gested that the features of the formation of zoospore of

clade 1 are ancestral features in this lineage, i.e., the for-

mation of a vesicle may have disappeared in the evolution

in the lineage.

Clade 2 was placed on a basal line in a monophyletic

group, including clade 1 and genera of Peronosporales in

the D1/D2 analysis. A species of clade 2, P. apinafurcum,

Fig. 5 Morphology of the

genus Pilasporangium.

a Sickle-shape appressoria.

b Complexly branched

secondary hyphae. c Intercalary

globose sporangium.

d Intercalary smooth oogonia in

chain with monoclinous

antheridia and nearly plerotic

oospores. e Smooth oogonium

with diclinous antheridium and

plerotic oospore. f Smooth

oogonium with two oospores.

Bar 20 lm

Mycoscience (2010) 51:337–365 355

123

may be an ancestral species of the lineage, because it is

located in a more basal position (Fig. 1). This species is

characterized by complexly branched secondary hyphae,

forms globose sporangia without papilla, and proliferates

(Uzuhashi et al. 2009). These morphological characteristics

were more similar to those of members of clade 4 than

clade 1. The phylogenetic position of clade 2 in the lineage

indicates that members of this lineage may have evolved

from a P. apinafurcum-like species with globose sporangia.

However, there is some doubt regarding the phylogenetic

position, because clade 2 is composed of only one species.

Therefore, the question of how ovoid sporangia evolved

was not elucidated in this study. Further examination of the

distribution in Pythium species, including clade 2, is nec-

essary to clarify not only the phylogenetic position of clade

2 but also the evolution of several morphological charac-

teristics, such as sporangia.

The shape of ﬁlamentous sporangia in clade 3 was

clearly different from those of Pythium species in other

clades. This difference of sporangial morphology in Pyth-

ium species has been noted by previous research (Fischer

1892; Schro

ter 1897; Sideris 1931) in which species with

ﬁlamentous sporangia were differentiated at the generic

level. Although it was clear that clade 3 was phylogeneti-

cally distantly related to other clades, the phylogenetic

position of clade 3 among Pythium species was has not yet

been elucidated because it differed among trees. Likewise,

the question of how ﬁlamentous sporangia evolved within

Pythium has not been resolved.

Taxonomy

The results of this phylogenetic analyses based on com-

prehensive sequence data of the nuclear rDNA D1/D2

region and mitochondrial gene (coxII) show that the genus

Pythium is a nonmonophyletic group, and the members

include phylogenetically diverse organisms. These results

indicate that taxonomic revisions are necessary in the

genus Pythium. In all phylogenetic trees, Pythium species

were divided into ﬁve strongly or moderately supported

clades. Each clade was characterized by sporangial

Fig. 6 Morphology of the

genus Pythium. Filamentous

inﬂated sporangium (a Pythium

sp. 16 UZ379, b Pythium sp. 43

ZSF0011). c Filamentous

noninﬂated sporangium of

Pythium sp. 2 UZ156.

d Adjacent globose sporangia of

P. catenulatum. e Catenulate

globose sporangia of Pythium

sp. 42 OPU1449. f Adjacent

subglobose sporangia of

Pythium sp. 47 ZSF0093.

g Pyriform sporangium with

elongated tip of Pythium sp. 40

OPU797. h Vesicle with long

discharge tube and zoospores of

Pythium sp. 2 UZ156.

i Ornamented oogonium with

monoclinous antheridium of

P. acanthicum. j Smooth

oogonium with monoclinous

antheridium of Pythium sp. 23

UZ419. k Smooth oogonium

with several antheridia and

plerotic oospore of

P. torulosum. Bars 20 lm(Bar

A for A–G, Bar K for I–K)

356 Mycoscience (2010) 51:337–365

123

morphology. Thus, the sporangial shape is regarded as an

important taxonomic criterion. It was concluded that

morphological and phylogenetic differences among clades

deserve recognition of the generic level according to a

comparison of taxonomic criteria used for related genera.

Among the ﬁve clades, three (1, 3, and 5) were differ-

entiated by their sporangial shapes and were strongly

supported by most phylogenetic trees. Based on these

results, each of their three clades was identiﬁed as a sep-

arate genus. On the other hand, clades 2 and 4 were

Fig. 7 Morphology of the

genus Globisporangium.

a Terminal globose sporangium

of Globisporangium sp. 9

(UZ275). b Intercalary globose

sporangium of Pythium sp.

ZSF0069. c Vesicle with

zoospores of Globisporangium

sp. 9 (UZ275). d Internally

proliferating sporangium of

Globisporangium sp. 9

(UZ275). e Internally

proliferating sporangium of

Globisporangium sp. 13

(UZ304). f Ornamented

oogonium with ﬁnger-like

projection and diclinous

antheridia of P. spinosum.

g Ornamented oogonium with

bold and dichotomous

projections of G. paddicum.

h Smooth oogonium,

antheridium with stalk

complexly lobed, and aplerotic

oospore of Globisporangium sp.

5 UZ252. i Ornamented

oogonium with conical and

acute projections of G.

uncinulatum. j Ornamented

oogonium with ﬁnger-like

projection, monoclinous

antheridia and aplerotic oospore

of G. irregulare. k Smooth

oogonium with many antheridia

of Globisporangium sp. 8

UZ284. l Smooth oogonium

with plerotic oospore of

G. rostratum. Bar 20 lm

Fig. 8 Morphology of the genus Elongisporangium. a Elongated

clavate sporangia of Elongisporangium sp. 1 ZSF0056. b Terminal

elongated clavate sporangium with a papilla of Elongisporangium

sp.1 ZSF0056. c Ornamented oogonium with ebetate projections of

Elongisporangium sp.1 ZSF0056. Bars 20 lm

Mycoscience (2010) 51:337–365 357

123

characterized by globose sporangia and were difﬁcult to

differentiate by morphological characteristics. Although

the monophyly of clade 4 was not resolved, it is clear that

the members of clade 4 are closely related and can be

clearly differentiated from clade 2 and the others phylo-

genetically. Therefore, it was concluded that clade 4 should

be considered a single genus. Further phylogenetic analy-

ses, including more isolates, are needed to resolve the

phylogeny of the clade and relationships among clades.

Likewise, clade 2 is phylogenetically differentiated from

all other clades, including clade 4, having similar globose

sporangia. Thus, it is considered as a separate genus. As a

result, the genus Pythium Pringsh. was divided into ﬁve

genera, four of which are new.

The type species of Pythium deﬁned by Pringsheim

(1858), P. monospermum, was included in clade 3.

Therefore, the genus Pythium was restricted to species

producing ﬁlamentous sporangia clustered as in clade 3.

According to the morphology and phylogeny in this and

previous studies, 57 species were redeﬁned as members of

the genus Pythium.

The ﬁrst new genus, named Ovatisporangium, is char-

acterized by ovoid sporangia (clade 1). It has been debated

whether species belonging to the genus are appropriately

classiﬁed as Pythium (Briard et al. 1995; Panabieres et al.

1997; Dick 2001b; Villa et al. 2006; Belbahri et al. 2008).

Our study resolved this debate by establishing clade 1 as an

independent genus. It is occasionally difﬁcult to differen-

tiate Ovatisporangium species from other species of two

new genera, Globisporangium (clade 4; mentioned below)

and Pilasporangium (clade 2; mentioned below), because

globose sporangia formed in many species of the Ova-

tisporangium, are sometimes formed in species of the two

genera. Therefore, molecular characteristics are a useful

tool for classiﬁcation of species in each genus. Based on

phylogeny and morphology, 15 species were transferred to

Ovatisporangium from Pythium Pringsh.

The second new genus, named Elongisporangium, was

erected for species with elongated clavate sporangia (clade

5). Based on the morphology and phylogeny, ﬁve species

were transferred to this genus from Pythium Pringsh.

The third new genus, named Globisporangium,is

characterized by globose sporangia (clade 4). Because this

shape is similar to those of Ovatisporangium and Pilasp-

orangium (clade 2; mentioned below), molecular phylo-

genetic analyses are often needed to classify each genus. In

contrast to other genera, the monophyly of this new genus

was not strongly supported. Thus, it is suggested that the

genus was composed of phylogenetically various species.

Therefore, further examination of the taxonomy of

Globisporangium may be needed based on morphology or

phylogeny of other species, such as the new species

included in this genus. According to the morphological and

phylogenetic characteristics, 68 species were transferred to

this genus from Pythium Pringsh.

The last new genus, named Pilasporangium, is com-

posed of only one species, P. apinafurcum (clade 2).

Isolation and examination of the morphology and phy-

logeny of many species included in this genus are nee-

ded to clarify the characterization of this genus.

Likewise, in Ovatisporangium and Globisporangium,

molecular phylogenetic analyses are needed to classify

this genus.

Key to genera

1 Sporangia ﬁlamentous,

inﬂated or non-inﬂated

Pythium

Sporangia not ﬁlamentous

2 Sporangia usually globose

2 Sporangia mainly ovoid to pyriform,

sometimes irregularly shape

Ovatisporangium

3 Sporangia clavate to elongate Elongisporangium

3 Sporangia sometimes proliferating Globisporangium

Sporangia not proliferating,

secondary hyphae branched complexly

Pilasporangium

Pythium Pringsh. emend. Uzuhashi, Tojo & Kakish. Fig. 6

Mycelium well developed, often with appressoria.

Hyphae hyaline, aseptate. Sporangia either ﬁlamentous, not

differentiated from the vegetative hyphae, or consisting of

lobate or toruloid inﬂated elements, or occasionally glo-

bose in a chain. Sporangial contents move and form a

vesicle at the tip with an undifferentiated mass of proto-

plasm; this mass then differentiates into a number of

biﬂagellate zoospores. Oogonia (sub-)globose, terminal or

intercalary, with a smooth or ornamented wall. Antheridia

1 to several per oogonium, sometimes absent, monoclin-

ous, diclinous or hypogynous, stalked or sessile, of various

shapes. Oospores usually single, rarely two or more in an

oogonium, plerotic or aplerotic with a thin or thick wall.

Pythium species occur as saprophytes or parasites in

soils, water, or on plant or animal substrates.

Type species: Pythium monospermum Pringsh., Jb.

Wiss. Bot. 1: 288, 1858.

Additional species of the Pythium.

Pythium acanthicum Drechsler, J. Wash. Acad. Sci. 20:

408, 1930.

Pythium adhaerens Sparrow, Ann. Bot., Lond. 45: 258,

1931.

358 Mycoscience (2010) 51:337–365

123

Pythium amasculinum Y. N. Yu, Acta microbiol. sin. 13:

118, 1973.

Pythium angustatum Sparrow, Ann. Bot., Lond. 45: 272,

1931.

Pythium aphanidermatum (Edson) Fitzp., Mycologia 15:

168, 1923.

Pythium apleroticum Tokun., in Ito & Tokunaga, Trans.

Sapporo nat. Hist. Soc. 14: 12, 1935.

Pythium aquatile Ho

hnk, Vero

ff. Inst. Meeresf. Brem-

erhaven 2: 94, 1953.

Pythium aristosporum Vanterp., Ann. appl. Biol. 25:

537, 1938.

Pythium arrhenomanes Drechsler, Phytopathology 18:

874, 1928.

Pythium capillosum B. Paul, Trans. Br. mycol. Soc. 89:

195, 1987.

Pythium catenulatum V. D. Matthews, Stud. Genus

Pythium: 47, 1931.

Pythium caudatum (G.L. Barron) M.W. Dick, Strami-

nipilous Fungi, Systematics of the Peronosporomycetes

Including Accounts of the Marine Straminipilous Protists,

the Plasmodiophorids and Similar Organisms (Dordrecht):

294, 2001.

Pythium chondricola De Cock, Mycotaxon 25: 102,

1986.

Pythium coloratum Vaartaja, Mycologia 57: 417, 1965.

Pythium conidiophorum Jokl, Oesterr Bot. Ztschr. 67:

33, 1918.

Pythium contiguanum B. Paul, FEMS Microbiol. Lett.

183: 108, 2000.

Pythium deliense Meurs, Phytopath. Z. 7: 176, 1934.

Pythium diclinum Tokun., in Ito & Tokunaga, Trans.

Sapporo nat. Hist. Soc. 14: 12, 1935.

Pythium dissimile Vaartaja, Mycologia 57: 421, 1965.

Pythium dissotocum Drechsler, J. Wash. Acad. Sci. 20:

402, 1930.

Pythium ﬂevoense Plaa

ts-Nit., Acta bot. neerl. 21: 636,

1972.

Pythium folliculosum B. Paul, Mycol. helv. 4: 204,

1991.

Pythium graminicola Subramaniam, Bull. Agric. Res.

Inst. Pus. 177: 1, 1928 [as ‘graminicolum’].

Pythium grandisporangium Fell & Master, Can. J. Bot.

53: 2920, 1975.

Pythium hydnosporum (Mont.) J. Schro

t., in de Bary,

Abh. senckenb. naturforsch. Ges. 12: 19, 1879.

Pythium inﬂatum V. D. Matthews, Stud. Genus Pythium:

45, 1931.

Pythium insidiosum De Cock, L. Mend., A. A. Padhye,

Ajello & Kaufman, J. Clin. Microbiol. 25: 345, 1987.

Pythium kasuhmirense B. Paul, FEMS Microbiol. Lett.

282: 253, 2008.

Pythium lutarium Ali-Shtayeh, in Al-Shtayeh & Dick,

J. Linn. Soc., Bot. 91: 309, 1985.

Pythium lycopersicum G. Karaca, G. Tepedelen, &

B. Paul, FEMS Microbiol. Lett. 288: 165, 2008.

Pythium marinum Sparrow, Dansk bot. Ark. 8: 5, 1934.

Pythium myriotylum Drechsler, J. Wash. Acad. Sci. 20:

404, 1930.

Pythium oligandrum Drechsler, J. Wash. Acad. Sci. 20:

409, 1930.

Pythium pachycaule Ali-Shtayeh, in Ali-Shtayeh &

Dick, J. Linn. Soc., Bot. 91: 313, 1985.

Pythium papillatum V. D. Matthews, J. Elisha Mitchell

scient. Soc. 43: 231, 1928.

Pythium pectinolyticum B. Paul, FEMS Microbiol. Lett.

199: 56, 2001.

Pythium periilum Drechsler, J. Wash. Acad. Sci. 20:

403, 1931.

Pythium periplocum Drechsler, J. Wash. Acad. Sci. 20:

405, 1930.

Pythium perniciosum Serbinow, Scripta Bot. Horti Univ.

Imper. Petrop. 28: 29, 1912.

Pythium phragmitis Nechw., in Nechwatal, Wielgoss &

Mendgen, Mycol. Res. 109: 1343, 2005.

Pythium plurisporium Abad, Shew, Grand & L.T.

Lucas, Mycologia 87: 897, 1996.

Pythium polycarpum B. Paul, Hydrobiologia 131: 31,

1986.

Pythium porphyrae M. Takah. & M. Sasaki, Trans.

Mycol. Soc. Japan 18: 280, 1977.

Pythium pyrilobum Vaartaja, Mycologia 57: 425, 1965.

Pythium rhizo-oryzae B. Paul, in Bala, Gautam & Paul,

Curr. Microbiol. 52: 104, 2006.

Pythium salpingophorum Drechsler, J. Wash. Acad. Sci.

20: 407, 1931.

Pythium scleroteichum Drechsler, J. Agric. Res.,

Washington 49: 881, 1934.

Pythium sukuiense W. H. Ko, Shin Y. Wang & Ann,

Mycologia 96: 647, 2004.

Pythium sulcatum R. G. Pratt & J. E. Mitch., Can. J. Bot.

51: 334, 1973.

Pythium tardicrescens Vanterp. Ann. appl. Biol. 25:

533, 1938.

Pythium tenue Gobi, Script. Bot. Hort. Petr. Fasc. 15:

211, 1899.

Pythium torulosum Coker & P. Patt., J. Elisha Mitchell

scient. Soc. 42: 247, 1927.

Pythium tracheiphilum Matta, Phytopath. Mediterr. 4:

51, 1965.

Pythium vanterpoolii V. Kouyeas & H. Kouyeas, Annals

Inst. Phytopath. Benaki, N.S. 5: 210, 1963.

Pythium volutum Vanterp. & Truscott, Can. J. Res. 6:

77, 1932.

Mycoscience (2010) 51:337–365 359

123

Pythium zingiberis M. Takah., Ann. Phytopath. Soc.

Japan 18: 115, 1954 [as ‘zingiberum’].

Ovatisporangium Uzuhashi, Tojo & Kakish., gen. nov.

Fig. 4.

Mycelium bene evolvens, ex hyphis principalibus hyalinis,

ramosis, nonseptatis, demum raro septatis compositum.

Appressoria saepe efferentia. Sporangia terminalia, interca-

laria vel latetaliter sessilia in hyphis, ovoidea, obovoidea,

globosa, subglobosa, pyriformia vel obpyriformia, saepe

papillata et interne prolifera. Zoosporae biﬂagellatae in ves-

icula protoplasmatis sporangii formantes. Oogonia terminalia

vel intercalaria, globosa vel subglobosa, pariete laevi vel

ornato. Antheridia monoclina, diclina vel hypogyna. Oospo-

rae globosae, vulgo una in oogonio, pleroticae vel apleroticae.

Mycelium well developed, often with appressoria.

Hyphae hyaline, aseptate, rarely septate in old. Sporangia

terminal, intercalary or laterally sessile on hyphae,

(ob-)ovoid, (sub-)globose, lemon-shaped, clavate or vari-

ous shapes, sometimes papillate and internally proliferat-

ing. Zoospores biﬂagellate, formed in a vesicle of

sporangial protoplasm. Oogonia terminal or intercalary,

(sub-)globose, with a smooth or ornamented wall. Anthe-

ridia variable in the shape, one to several per oogonium,

sometimes absent, monoclinous, diclinous or hypogynous,

stalked or sessile. Oospores globose, usually single in an

oogonium, plerotic or aplerotic with a thin or thick wall.

Ovatisporangium species occur as saprophytes or para-

site in soils, water, or on plant substrates.

Type species: Ovatisporangium helicoides (Drechsler)

Uzuhashi, Tojo & Kakish., comb. nov.

Basionym: Pythium helicoides Drechsler, J. Wash.

Acad. Sci. 20: 413, 1931.

Additional species of Ovatisporangium.

Ovatisporangium boreale (R. L. Duan) Uzuhashi, Tojo &

Kakish., comb. nov.

Basionym: Pythium boreale R. L. Duan, Acta Mycol.

Sin. 4: 1, 1985 [as ‘borealis’].

Ovatisporangium carbonicum (B. Paul) Uzuhashi, Tojo &

Kakish., comb. nov.

Basionym: Pythium carbonicum B. Paul, FEMS

Microbiol. Lett. 219: 270, 2003.

Ovatisporangium chamaehyphon (Sideris) Uzuhashi,

Tojo & Kakish., comb. nov.

Basionym: Pythium chamaehyphon Sideris, Mycologia

24: 33, 1932.

Ovatisporangium citrinum (B. Paul) Uzuhashi, Tojo &

Kakish., comb. nov.

Basionym: Pythium citrinum B. Paul, FEMS Microbiol.

Lett. 234: 273, 2004.

Ovatisporangium cucurbitacearum (S. Takim.)

Uzuhashi, Tojo & Kakish., comb. nov.

Basionym: Pythium cucurbitacearum S. Takim., Ann.

Phytopath. Soc. Japan 11: 91, 1941.

Ovatisporangium indigoferae (E. J. Butler) Uzuhashi,

Tojo & Kakish., comb. nov.

Basionym: Pythium indigoferae E. J. Butler, Mem. Dep.

Agric. India 1: 73, 1907.

Ovatisporangium litorale (Nechw.) Uzuhashi, Tojo &

Kakish., comb. nov.

Basionym: Pythium litorale Nechw., in Nechwatal &

Mendgen, FEMS Microbiol. Lett. 255: 99, 2006.

Ovatisporangium megacarpum (B. Paul) Uzuhashi,

Tojo & Kakish., comb. nov.

Basionym: Pythium megacarpum B. Paul, FEMS

Microbiol. Lett. 186: 231, 2000.

Ovatisporangium mercuriale (Belbahri, B. Paul &

Lefort) Uzuhashi, Tojo & Kakish., comb. nov.

Basionym: Pythium mercuriale Belbahri, B. Paul &

Lefort, FEMS Microbiol. Lett. 284: 20, 2008.

Ovatisporangium montanum (Nechw.) Uzuhashi, Tojo &

Kakish., comb. nov.

Basionym: Pythium montanum Nechw., in Nechwatal &

Wsswald, Mycol. Prog. 2: 79, 2003.

Ovatisporangium oedichilum (Drechsler) Uzuhashi,

Tojo & Kakish., comb. nov.

Basionym: Pythium oedichilum Drechsler, J. Wash.

Acad. Sci. 20: 414, 1931.

Ovatisporangium ostracodes (Drechsler) Uzuhashi,

Tojo & Kakish., comb. nov.

Basionym: Pythium ostracodes Drechsler, Phytopathol-

ogy 33: 286, 1943.

Ovatisporangium sterile (Belbahri & Lefort) Uzuhashi,

Tojo & Kakish., comb. nov.

Basionym: Pythium sterile Belbahri & Lefort, in

Belbahri, Calmin, Sanchez-Hernandez, Oszako & Lefort,

FEMS Microbiol. Lett. 255: 210, 2006 [as ‘sterilum’].

Ovatisporangium vexans (de Bary) Uzuhashi, Tojo &

Kakish., comb. nov.

Basionym: Pythium vexans de Bary, J. Bot. Paris 14:

105, 1896.

Globisporangium Uzuhashi, Tojo & Kakish., gen. nov.

Fig. 7.

Mycelium bene evolvens, ex hyphis principalibus hy-

alinis, ramosis, nonseptatis, demum raro septatis compos-

itum. Appressoria saepe efferentia. Sporangia terminalia,

intercalaria vel latetaliter sessilia in hyphis, globosa vel

clavata, saepe papillata et interne prolifera. Zoosporae

biﬂagellatae in vesicula protoplasmatis sporangii forman-

tes. Oogonia terminalia vel intercalaria, globosa, subglob-

osa, pariete laevi vel ornato. Antheridia monoclina, diclina

vel hypogyna. Oosporae globosae, vulgo una in oogonio,

pleroticae vel apleroticae.

360 Mycoscience (2010) 51:337–365

123

Mycelium well developed, often with appressoria.

Hyphae hyaline, aseptate, rarely septate in old. Sporangia

terminal, intercalary or laterally sessile on hyphae,

(sub-)globose, lemon-shaped or clavate, sometimes inter-

nally proliferating. Zoospores biﬂagellate, formed in a

vesicle of sporangial protoplasm. Oogonia terminal or

intercalary, (sub-)globose, with a smooth or ornamented

wall. Antheridia variable in the shape, one to several per

oogonium, sometimes absent, monoclinous, diclinous or

hypogynous, stalked or sessile. Oospores globose, usually

single in an oogonium, plerotic or aplerotic with a thin or

thick wall.

Globisporangium species occur as saprophytes or para-

sites in soils, water, or on plant or animal substrates.

Type species: Globisporangium paroecandrum (Drechs-

ler) Uzuhashi, Tojo & Kakish., comb. nov.

Basionym: Pythium paroecandrum Drechsler, J. Wash.

Acad. Sci. 20: 406, 1930.

Additional species of Globisporangium.

Globisporangium abappressorium (Paulitz &

M. Mazzola) Uzuhashi, Tojo & Kakish., comb. nov.

Basionym: Pythium abappressorium Paulitz &

M. Mazzola, in Paulitz, Admas & Mazzola, Mycologia 95:

81, 2003.

Globisporangium acrogynum (Y. N. Yu) Uzuhashi,

Tojo & Kakish., comb. nov.

Basionym: Pythium acrogynum Y. N. Yu, Acta micro-

biol. sin. 13: 117, 1973.

Globisporangium acanthophoron (Sideris) Uzuhashi,

Tojo & Kakish., comb. nov.

Basionym: Pythium acanthophoron Sideris, Mycologia

24: 36, 1932.

Globisporangium apiculatum (B. Paul) Uzuhashi, Tojo &

Kakish., comb. nov.

Basionym: Pythium apiculatum B. Paul, FEMS Micro-

biol. Lett. 263: 195, 2006.

Globisporangium attrantheridium (Allain-Boule

vesque) Uzuhashi, Tojo & Kakish., comb. nov.

Basionym: Pythium attrantheridium Allain-Boule

vesque, in Allain-Boule

, Tweddell, Mazzola, Be

langer &

vesque, Mycol. Res. 108: 798, 2004.

Globisporangium bifurcatum (B. Paul) Uzuhashi, Tojo &

Kakish., comb. nov.

Basionym: Pythium bifurcatum B. Paul, FEMS Micro-

biol. Lett. 224: 217, 2003.

Globisporangium buismaniae (Plaa

ts-Nit.) Uzuhashi,

Tojo & Kakish., comb. nov.

Basionym: Pythium buismaniae Plaa

ts-Nit., Stud.

Mycol. 21: 44, 1981.

Globisporangium carolinianum (V. D. Matthews)

Uzuhashi, Tojo & Kakish., comb. nov.

Basionym: Pythium carolinianum V. D. Matthews, Stud.

Genus Pythium

: 71, 1931.

Globisporangium campanulatum (R. Mathew, K. K.

Singh & B. Paul) Uzuhashi, Tojo & Kakish., comb. nov.

Basionym: Pythium campanulatum R. Mathew, K. K.

Singh & B. Paul, FEMS Microbiol. Lett. 226: 10, 2003.

Globisporangium canariense (B. Paul) Uzuhashi, Tojo &

Kakish., comb. nov.

Basionym: Pythium canariense B. Paul, FEMS Micro-

biol. Lett. 208: 136, 2002.

Globisporangium cryptoirregulare (Garzo

n, Ya

nez &

Moorman) Uzuhashi, Tojo & Kakish., comb. nov.

Basionym: Pythium cryptoirregulare Garzo

n, Ya

nez &

Moorman, Mycologia 99: 300, 2007.

Globisporangium cylindrosporum (B. Paul) Uzuhashi,

Tojo & Kakish., comb. nov.

Basionym: Pythium cylindrosporum B. Paul, Int. J.

Mycol. Lichenol. 4: 339, 1992.

Globisporangium cystogenes (De Cock & Le

vesque)

Uzuhashi, Tojo & Kakish., comb. nov.

Basionym: Pythium cystogenes De Cock & Le

vesque,

Stud. Mycol. 50: 484, 2004.

Globisporangium debaryanum (R. Hesse) Uzuhashi,

Tojo & Kakish., comb. nov.

Basionym: Pythium debaryanum R. Hesse, Diss. Halle.:

34, 1874 [as ‘de-baryanum’].

Globisporangium echinulatum (V. D. Matthews)

Uzuhashi, Tojo & Kakish., comb. nov.

Basionym: Pythium echinulatum V. D. Matthews, Stud.

Genus Pythium: 101, 1931.

Globisporangium erinaceum (J. A. Robertson) Uzuhashi,

Tojo & Kakish., comb. nov.

Basionym: Pythium erinaceum J. A. Robertson, N. Z. Jl

Bot. 17: 283, 1977.

Globisporangium glomeratum (B. Paul) Uzuhashi,

Tojo & Kakish., comb. nov.

Basionym: Pythium glomeratum B. Paul, FEMS

Microbiol. Lett. 225: 49, 2003.

Globisporangium heterothallicum (W. A. Campb. &

F. F. Hendrix) Uzuhashi, Tojo & Kakish., comb. nov.

Basionym: Pythium heterothallicum W. A. Campb. &

F. F. Hendrix, Mycologia 60: 803, 1968.

Globisporangium hypogynum (Middleton) Uzuhashi,

Tojo & Kakish., comb. nov.

Basionym: Pythium hypogynum Middleton, Phytopa-

thology 31: 863, 1941.

Globisporangium intermedium (de Bary) Uzuahshi &

Tojo, comb. nov.

Basionym: Pythium intermedium de Bary, Bot. Ztg. 39:

554, 1881.

Globisporangium irregulare (Buisman) Uzuhashi, Tojo &

Kakish., comb. nov.

Basionym: Pythium irregulare Buisman, Meded.

Phytopath. Labor. Willie Commelin Scholten Baarn 11: 38,

1927.

Mycoscience (2010) 51:337–365 361

123

Globisporangium iwayamae (S. Ito) Uzuhashi, Tojo &

Kakish., comb. nov.

Basionym: Pythium iwayamae S. Ito, in Ito & Tokunaga,

Trans. Sapporo nat. Hist. Soc. 14: 13, 1935.

Globisporangium kunmingense (Y. N. Yu) Uzuhashi,

Tojo & Kakish., comb. nov.

Basionym: Pythium kunmingense Y. N. Yu, Acta

microbial. sin. 13: 119, 1973.

Globisporangium longandrum (B. Paul) Uzuhashi, Tojo

& Kakish., comb. nov.

Basionym: Pythium longandrum B. Paul, FEMS

Microbiol. Lett. 202: 240, 2001.

Globisporangium longisporangium (B. Paul) Uzuhashi,

Tojo & Kakish., comb. nov.

Basionym: Pythium longisporangium B. Paul, FEMS

Microbiol. Lett. 246: 208, 2005.

Globisporangium lucens (Ali-Shtayeh) Uzuhashi, Tojo &

Kakish., comb. nov.

Basionym: Pythium lucens Ali-Shtayeh, in Ali-Shtayeh &

Dick, J. Linn. Soc., Bot. 91: 303, 1985.

Globisporangium macrosporum (Vaartaja & Plaa

ts-Nit.)

Uzuhashi, Tojo & Kakish., comb. nov.

Basionym: Pythium macrosporum Vaartaja & Plaa

ts-

Nit., in van der Plaa

ts-Niterink, Stud. Mycol. 21: 89, 1981.

Globisporangium mamillatum (Meurs) Uzuhashi, Tojo &

Kakish., comb. nov.

Basionym: Pythium mamillatum Meurs, Wortelrot

veroorzaakt door Schimmels uit de Gesl Pythium en

Aphanomyces Proefschr Univ Utrecht: 39, 1928.

Globisporangium marsipium (Drechsler) Uzuhashi,

Tojo & Kakish., comb. nov.

Basionym: Pythium marsipium Drechsler, Phytopathol-

ogy 31: 505, 1941.

Globisporangium mastophorum (Drechsler) Uzuhashi,

Tojo & Kakish., comb. nov.

Basionym: Pythium mastophorum Drechsler, J. Wash.

Acad. Sci. 20: 411, 1930.

Globisporangium megalacanthum (de Bary) Uzuhashi,

Tojo & Kakish., comb. nov.

Basionym: Pythium megalacanthum de Bary, Abh

Senckenb Naturforsch Ges 12: 242, 1981.

Globisporangium middletonii (Sparrow) Uzuhashi,

Tojo & Kakish., comb. nov.

Basionym: Pythium middletonii Sparrow, Aquatic Phy-

comycetes Edn 2 (Ann Arbor): 1038, 1960.

Globisporangium minor (Ali-Shtayeh) Uzuhashi, Tojo &

Kakish., comb. nov.

Basionym: Pythium minor Ali-Shtayeh, in Ali-Shtayeh &

Dick, J. Linn. Soc., Bot. 91: 299, 1985.

Globisporangium multisporum (Poitras) Uzuhashi, Tojo &

Kakish., comb. nov.

Basionym: Pythium multisporum Poitras, Mycologia 41:

171, 1949.

Globisporangium nagaii (S. Ito & Tokun.) Uzuhashi,

Tojo & Kakish., comb. nov.

Basionym: Pythium nagaii S. Ito & Tokun., J. Fac.

Agric., Hokkaido Imp. Univ. Sapporo 32: 209, 1933 [as

‘nagae’].

Globisporangium nodosum (B. Paul, D Galland,

T. Bhatn. & Dulieu) Uzuhashi, Tojo & Kakish., comb. nov.

Basionym: Pythium nodosum B. Paul, D Galland,

T. Bhatn. & Dulieu, FEMS Microbiol. Lett. 158: 209, 1998.

Globisporangium nunn (Lifsh., Stangh. & R. E. D.

Baker) Uzuhashi, Tojo & Kakish., comb. nov.

Basionym: Pythium nunn Lifsh., Stangh. & R. E. D.

Baker, Mycotaxon 20: 374, 1984.

Globisporangium okanoganense (P. E. Lipps) Uzuhashi,

Tojo & Kakish., comb. nov.

Basionnym: Pythiumn okanoganense P. E. Lipps,

Mycologia 72: 1127, 1980.

Globisporangium ornacarpum (B. Paul) Uzuhashi,

Tojo & Kakish., comb. nov.

Basionym: Pythium ornacarpum B. Paul, FEMS

Microbiol. Lett. 180: 340, 1999.

Globisporangium orthogonon (Ahrens) Uzuhashi, Tojo &

Kakish., comb. nov.

Basionym: Pythium orthogonon Ahrens, Z. PﬂKrankh.

PﬂPath. PﬂSchutz 78: 177, 1971.

Globisporangium paddicum (Hirane) Uzuhashi, Tojo &

Kakish., comb. nov.

Basionym: Pythium paddicum Hirane, Trans. Mycol.

Soc. Japan 2: 85, 1960.

Globisporangium parvum (Ali-Shtayeh) Uzuhashi,

Tojo & Kakish., comb. nov.

Basionym: Pythium parvum Ali-Shtayeh, in Ali-Shtayeh &

Dick,J.Linn.Soc.,Bot.91:303,1985.

Globisporangium perplexum (H. Kouyeas & Theoh.)

Uzuhashi, Tojo & Kakish., comb. nov.

Basionym: Pythium perplexum H. Kouyeas & Theoh.,

Annals Inst. Phytopath. Benaki, N.S. 11: 287, 1977.

Globisporangium pleroticum (Take. Ito

) Uzuhashi,

Tojo & Kakish., comb. nov.

Basionym: Pythium pleroticum Take. Ito

, J. Jpn. Bot.

20: 59, 1944.

Globisporangium polymastum (Drechsler) Uzuhashi,

Tojo & Kakish., comb. nov.

Basionym: Pythium polymastum Drechsler, J. Wash.

Acad. Sci. 20: 412, 1930.

Globisporangium proliferatum (B. Paul) Uzuhashi,

Tojo & Kakish., comb. nov.

Basionym: Pythium proliferatum B. Paul, FEMS

Microbiol. Lett. 206: 193, 2002.

Globisporangium pulchrum (Minden) Uzuhashi, Tojo &

Kakish., comb. nov.

Basionym: Pythium pulchrum Minden, in Falck, Falck.

Mykol. Unters. 2: 224, 1916.

362 Mycoscience (2010) 51:337–365

123

Globisporangium radiosum (B. Paul) Uzuhashi, Tojo &

Kakish., comb. nov.

Basionym: Pythium radiosum B. Paul, Mycol. Helv. 5:

2, 1992.

Globisporangium ramiﬁcatum (B. Paul) Uzuhashi,

Tojo & Kakish., comb. nov.

Basionym: Pythium ramiﬁcatum B. Paul, Hydrobiologia

140: 235, 1986.

Globisporangium recalcitrans (Belbahri & Maralejo)

Uzuhashi, Tojo & Kakish., comb. nov.

Basionym: Pythium recalcitrans Belbahri & Maralejo,

Mycologia 100: 312, 2008.

Globisporangium regulare (B. Paul) Uzuhashi, Tojo &

Kakish., comb. nov.

Basionym: Pythium regulare B. Paul, Curr. Microbiol.

47: 310, 2003.

Globisporangium rhizosaccharum (K. K. Singh, R. Ma-

thew, Masih & Paul) Uzuhashi, Tojo & Kakish., comb. nov.

Basionym: Pythium rhizosaccharum K. K. Singh,

R. Mathew, Masih & Paul, FEMS Microbiol. Lett. 221:

234, 2003.

Globosum rostratiﬁngens (De Cock & Le

vesque)

Uzuhashi, Tojo & Kakish., comb. nov.

Basionym: Pythium rostratiﬁngens De Cock & Le

esque, Stud. Mycol. 50: 485, 2004.

Globisporangium rostratum (E. J. Butler) Uzuhashi,

Tojo & Kakish., comb. nov.

Basionym: Pythium rostratum E. J. Butler, Mem. Dep.

Agric. India, Bot. Ser. 1: 84, 1907.

Globisporangium salinum (Ho

hnk) Uzuhashi, Tojo &

Kakish., comb. nov.

Basionym: Pythium salinum Ho

hnk, Vero

ff. Inst. Me-

eresf. Bremerhaven 2: 89, 1953.

Globisporangium segnitium (B. Paul) Uzuhashi, Tojo &

Kakish., comb. nov.

Basionym: Pythium segnitium B. Paul, FEMS Micro-

biol. Lett. 217: 210, 2002.

Globisporangium solare (De Cock, Melero-Vara,

Y. Serrano & Julio Go

mez) Uzuhashi, Tojo & Kakish.,

comb. nov.

Basionym: Pythium solare De Cock, Melero-Vara,

Y. Serrano & Julio Go

mez, Mycol. Res. 112: 1117, 2008.

Globisporangium spiculum (B. Paul) Uzuhashi, Tojo &

Kakish., comb. nov.

Basionym: Pythium spiculum B. Paul, in Lassaad, Cal-

min, Sanchez-Hernandez & Lefort, FEMS Microbiol. Lett.

254: 319, 2006.

Globisporangium spinosum (Sawada) Uzuhashi, Tojo &

Kakish., comb. nov.

Basionym: Pythium spinosum Sawada, J. Nat. Hist. Soc.

Formosa 16: 199, 1926.

Globisporangium splendens (Hans Braun) Uzuhashi,

Tojo & Kakish., comb. nov.

Basionym: Pythium splendens Hans Braun, J. Agric.

Res. 30: 1061, 1925.

Globisporangium sylvaticum (W. A. Campb. &

F. F. Hendrix) Uzuhashi, Tojo & Kakish., comb. nov.

Basionym: Pythium sylvaticum W. A. Campb. &

F. F. Hendrix, Mycologia 59: 274, 1967.

Globisporangium terrestre (B. Paul) Uzuhashi, Tojo &

Kakish., comb. nov.

Basionym: Pythium terrestre B. Paul, FEMS Microbiol.

Lett. 212: 256, 2002 [as ‘terrestris’].

Globisporangium toruloides (B. Paul) Uzuhashi, Tojo &

Kakish., comb. nov.

Basionym: Pythium toruloides B. Paul, Trans. Br.

mycol. Soc. 86: 331, 1986.

Globisporangium ultimum (Trow) Uzuhashi, Tojo &

Kakish., comb. nov. var. ultimum.

Basionym: Pythium ultimum Trow, Ann Bot 15: 300,

1901. var. ultimum.

Globisporangium ultimum var. sporangiiferum

(Drechsler) Uzuhashi, Tojo & Kakish., comb. nov.

Basionym: Pythium ultimum var. sporangiiferum

Drechsler, Sydowia 14: 107, 1960 [as ‘sporangiferum’].

Globisporangium uncinulatum (Plaa

ts-Nit. & I. Blok)

Uzuhashi, Tojo & Kakish., comb. nov.

Basionym: Pythium uncinulatum Plaa

ts-Nit. & I. Blok,

Neth. Jl Pl. Path. 84: 135, 1978.

Globisporangium violae (Chesters & Hickman) Uzuh-

ashi, Tojo & Kakish., comb. nov.

Basionym: Pythium violae Chesters & Hickman, Trans.

Br. mycol. Soc. 27: 60, 1944.

Elongisporangium Uzuhashi, Tojo & Kakish., gen. nov.

Fig. 8.

Mycelium bene evolvens, ex hyphis principalibus hyali-

nis, ramosis, nonseptatis, demum raro septatis compositum.

Appressoria saepe efferentia. Chlamydosporae raro for-

mantes. Sporangia vulgo clavata usque elongata, saepe

papillata et interne prolifera. Zoosporae biﬂagellatae in

vesicula protoplasmatis sporangii formantes. Oogonia ter-

minalia vel intercalaria, globosa vel subglobosa, pariete or-

nato. Antheridia monoclina, diclina vel hypogyna. Oosporae

globosae, vulgo una in oogonio, pleroticae vel apleroticae.

Mycelium well developed, often with appressoria, rarely

with chlamydospores. Hyphae hyaline, aseptate, rarely

septate in old. Sporangia mostly terminal, clavate to

elongate, sometimes papillate and internally proliferating.

Zoospores biﬂagellate, formed in a vesicle of sporangial

protoplasm. Oogonia terminal or intercalary, (sub-)glo-

bose, with a ornamented wall. Antheridia variable in the

shape, 1–2 per oogonium, sometimes absent, monoclinous,

diclinous or hypogynous, stalked or sessile. Oospores

globose, usually single in an oogonium, plerotic or apl-

erotic with a thin or thick wall.

Mycoscience (2010) 51:337–365 363

123

Elongisporangium species occur as saprophytes or par-

asite in soils, water, or on plant substrates.

Type species: Elongisporangium anandrum (Drechsler)

Uzuhashi, Tojo & Kakish., comb. nov.

Basionym: Pythium anandrum Drechsler, J. Wash.

Acad. Sci. 20: 410, 1930.

Additional species of Elongisporangium.

Elongisporangium dimorphum (F. F. Hendrix &

W. A. Campb.) Uzuhashi, Tojo & Kakish., comb. nov.

Basionym: Pythium dimorphum F. F. Hendrix &

W. A. Campb, Mycologia 63: 979, 1971.

Elongisporangium helicandrum (Drechsler) Uzuhashi,

Tojo & Kakish., comb. nov.

Basionym: Pythium helicandrum Drechsler, Bull.

Torrey bot. Club 77: 255, 1950.

Elongisporangium prolatum (W. A. Campb. &

F. F. Hendrix) Uzuhashi, Tojo & Kakish., comb. nov.

Basionym: Pythium prolatum W. A. Campb. &

F. F. Hendrix, in Hendrix & Campbell, Mycologia 61: 387,

1969.

Elongisporangium undulatum (H. E. Petersen) Uzuh-

ashi, Tojo & Kakish., comb. nov.

Basionym: Pythium undulatum H. E. Petersen, Annls

mycol. 8: 531, 1910.

Pilasporangium Uzuhashi, Tojo & Kakish., gen. nov.

Fig. 5.

Mycelium bene evolvens, ex hyphis principalibus hy-

alinis, ramosis, nonseptatis, demum raro septatis compos-

itum. Appressoria saepe efferentia. Sporangia terminalia

vel intercalaria, globosa vel subglobosa. Zoosporae biﬂa-

gellatae in vesicula protoplasmatis sporangii formantes.

Oogonia terminalia vel intercalaria globosa vel subglobosa,

pariete laevi. Antheridia monoclina, diclina vel hypogyna.

Oosporae globosae, una vel duae in oogonio, pleroticae vel

apleroticae.

Mycelium well developed, often with appressoria.

Hyphae hyaline, aseptate, rarely septate in old. Sporangia

terminal or intercalary, globose. Zoospores biﬂagellate,

formed in a vesicle of sporangial protoplasm. Oogonia

terminal or intercalary, (sub-)globose, with a smooth wall.

Antheridia variable in the shape, one to several per oogo-

nium, sometimes absent, monoclinous, diclinous or hypo-

gynus, stalked or sessile. Oospores globose, one to two in

an oogonium, plerotic or aplerotic with a thin or thick wall.

Pilasporangium species occur as saprophyte or parasite

in soils, water, or on plant substrates.

Type species: Pilasporangium apinafurcum (Uzuhashi &

Tojo) Uzuhashi, Tojo & Kakish., comb. nov.

Basionym: Pythium apinafurcum Uzuhashi & Tojo,

Mycoscience 50: 283, 2009.

The genus Pilasporangium includes only one species.

References

Akaike H (1974) A new look at the statistical model identiﬁcation.

IEEE Trans Automat Contr 19:716–723

Allain-Boule

N, Tweddell R, Mazzola M, Be

langer R, Le

vesque CA

(2004) Pythium attrantheridium sp. nov.: taxonomy and com-

parison with related species. Mycol Res 108:795–805

Bedard JEJ, Schurko AM, de Cock AWAM, Klassen GR (2006)

Diversity and evolution of 5S rRNA gene family organization in

Pythium. Mycol Res 110:86–95

Belbahri L, McLeod A, Paul B, Calmin G, Moralejo E, Spies CF,

Botha WJ, Clemente A, Descals E, Sa

nchez-Herna

ndez E, Lefort

F (2008) Intraspeciﬁc and within-isolate sequence variation in

the ITS rRNA gene region of Pythium mercuriale sp. nov.

(Pythiaceae). FEMS Microbiol Lett 284:17–27

Belkhiri A, Buchko J, Klassen GR (1992) The 5S ribosomal RNA

gene in Pythium species: two different genomic locations. Mol

Biol Evol 9:1089–1102

Blair JE, Coffey MD, Park SY, Geiser DM, Kang S (2008) A multi-

locus phylogeny for Phytophthora utilizing markers derived

from complete genome sequences. Fungal Genet Biol 45:266–

277

Briard M, Dutertre M, Rouxel F, Brygoo Y (1995) Ribosomal RNA

sequence divergence within the Pythiaceae. Mycol Res 99:1119–

1127

Cooke DEL, Drenth A, Duncan JM, Wagels G, Brasier CM (2000) A

molecular phylogeny of Phytophthora and related Oomycetes.

Fungal Genet Biol 30:17–32

de Cock AWAM, Le

vesque CA (2004) New species of Pythium and

Phytophthora. Stud Mycol 50:481–487

de Cock AWAM, Mendoza L, Padhye AA, Ajello L, Kaufman L

(1987) Pythium insidiosum sp. nov., the etiologic agent of

pythiosis. J Clin Microbiol 25:344–349

de Cock AWAM, Le

vesque CA, Melero-Vara JM, Serrano Y,

Guirado ML, Go

mez J (2008) Pythium solare sp. nov., a new

pathogen of green beans in Spain. Mycol Res 112:1115–1121

Dick MW (1990) Key to Pythium. Published by the author, Reading

Dick MW (1999) Classiﬁcation of the Peronosporomycetes. In:

Robinson R, Batt C, Patel P (eds) Encyclopaedia of food

microbiology, vol 2. Academic press, London, pp 871–882

Dick MW (2001a) Straminipilous Fungi: systematics of the Pero-

nosporomycetes including accounts of the marine straminipilous

protists, the Plasmodiophorids and similar organisms. Kluwer

Academic Publishers, Dordrecht

Dick MW (2001b) The Peronosporomycetes. In. McLaughlin Dj,

McLaughlin EG, Lemke PA (eds) The Mycota VII PartA.

Systematics and evolution. Springer Verlag, Berlin, pp 39–72

Fischer A (1892) Phycomycetes. Rabenhorst’s Kryptogamenﬂora

1:505

ker M, Voglmayr H, Riethmu

ller A, Oberwinkler F (2007) How do

obligate parasites evolve? A multi-gene phylogenetic analysis of

downy mildews. Fungal Genet Biol 44:105–122

Hudspeth DSS, Nadler SA, Hudspeth MES (2000) A COX2

molecular phylogeny of the Peronosporomycetes. Mycologia

92:674–684

Hudspeth DSS, Stenger D, Hudspeth MES (2003) A cox2 phyloge-

netic hypothesis for the downy mildews and white rusts. Fungal

Divers 13:47–57

Hulvey JP, Padgett DE, Bailey JC (2007) Species boundaries within

Saprolegnia (Saprolegniales, Oomycota) based on morphologi-

cal and DNA sequence data. Mycologia 99:421–429

Kageyama K, Nakashima A, Kajihara Y, Suga H, Nelson EB (2005)

Phylogenetic and morphological analysis of Pythium gramini-

cola and related species. J Gen Plant Path 71:174–182

364 Mycoscience (2010) 51:337–365

123

Kageyama K, Senda M, Asano T, Suga H, Ishiguro K (2007) Intra-

isolate heterogeneity of the ITS region of rDNA in Pythium

helicoides. Mycol Res 111:416–423

Kirk PM, Cannon PF, Minter DW, Stalpers JA (2008) Ainsworth &

Bisby’s dictionary of the fungi, 10th edn. CAB International,

Wallingford

Ko WH, Wang SY, Ann PJ (2004) Pythium sukuiense, a new species

from undisturbed natural forest in Taiwan. Mycologia 96:647–

649

Leclerc MC, Guillot J, Deville M (2000) Taxonomic and phyloge-

netic analysis of Saprolegniaceae (Oomycetes) inferred from

LSU rDNA and ITS sequence comparisons. Antonie Van

Leeuwenhoek 77:369–377

vesque CA, de Cock AWAM (2004) Molecular phylogeny and

taxonomy of the genus Pythium. Mycol Res 108:1363–1383

Lipps PE (1980) A new species of Pythium isolated from wheat

beneath snow in Washington. Mycologia 72:1127–1133

Maddison DR, Maddison WP (2000) MacClade 4: Analyses of

phylogeny and character evolution. Sinauer Associates, Aunder-

land, MA

Martin FN (2000) Phylogenetic relationships among some Pythium

species inferred from sequence analysis of the mitochondrially

encoded cytochrome oxidase II gene. Mycologia 92:711–727

Martin FN (2008) Mitochondrial haplotype determination in the

oomycete plant pathogen Phytophthora ramorum. Curr Genet

54:23–34

Martin FN, Tooley PW (2003) Phylogenetic relationships among

Phytophthora species inferred from sequence analysis of mitoc-

hondrially encoded cytochrome oxidase I and II genes. Myco-

logia 95:269–284

Matsumoto C, Kageyama K, Suga H, Hyakumachi M (1999)

Phylogenetic relationships of Pythium species based on ITS

and 5.8S sequences of the ribosomal DNA. Mycoscience

40:321–331

Moralejo E, Clemente A, Descals E, Belbahri L, Calmin G, Lefort F,

Spies CFJ, McLeod A (2008) Pythium recalcitrans sp. nov.

revealed by multigene phylogenetic analyses. Mycologia

100:310–319

Nechwatal J, Mendgen K (2006) Pythium litorale sp. nov., a new

species from the littoral of Lake Constance, Germany. FEMS

Microbiol Lett 225:96–101

Nechwatal J, Oßwald WF (2003) Pythium montanum sp. nov., a new

species from a spruce stand in the Bavarian Alps. Mycol Prog

2:73–80

Nechwatal J, Wielgoss A, Mendgen K (2005) Pythium phragmitis sp.

nov., a new species close to P. arrhenomanes as a pathogen of

common reed (Phragmites australis). Mycol Res 109:1337–1346

Page RDM (1996) TreeView: an application to display phylogenetic

trees on personal computers. Comput Appl Biosci 12:357–358

Panabieres F, Ponchet M, Allasia V, Cardin L, Ricci P (1997)

Characterization of border species among Pythiaceae: several

Pythium isolates produced elicitins, typical proteins from

Phytophthora spp. Mycol Res 101:1459–1468

Paul B (2003) Pythium carbonicum, a new species isolated from a

spoil heap in northern France, the ITS region, taxonomy and

comparison with related species. FEMS Microbiol Lett 219:269–

274

Paul B (2006) A new species of Pythium isolated from vineyard in

France. FEMS Microbiol Lett 263:194–199

Paul B, Bala K (2008) A new species of Pythium with inﬂated

sporangia and coiled antheridia, isolated from India. FEMS

Microbiol Lett 282:251–257

Petersen AB, Rosendahl S (2000) Phylogeny of the Peronosporomy-

cetes (Oomycota) based on partial sequence of the large

ribosomal subunit (LSU rDNA). Mycol Res 104:1295–1303

Posada D, Crandall KA (1998) MODELTEST: testing the model of

DNA substitution. Bioinformatics 14:817–818

Pringsheim N (1858) Beitra

ge zur Morphology and Systematik der

Algen. 2. Die Saprolegnı

een. Jb. wı

ss. Bot 1:284–306

Riethmu

ller A, Weiß M, Oberwinkler F (1999) Phylogenetic studies

of Saprolegniomycetidae and related groups based on nuclear

large subunit DNA sequences. Can J Bot 77:1790–1800

Riethmu

ller A, Voglmayr H, Goker M, Weib M, Oberwinkler F

(2002) Phylogenetic relationships of the downy mildews (Per-

onosporales) and related groups based on nuclear large subunit

ribosomal DNA sequences. Mycologia 94:834–849

Saitou N, Nei M (1987) The neighbor-joining method: a new method

for reconstructing phylogenetic trees. Mol Biol Evol 4:406–425

Schro

ter J (1897) Saprolegniineae III Pythiaceae. Engler & Prantl nat

PﬂFam 1, Abt 1:104–105

Sideris CP (1931) Taxonomic studies in the family Pythiaceae.

1 Nematosporangium. Mycologia 23:252–295

Stamatakis A (2006) RAxML-VI-HPC: maximum likelihood- based

phylogenetic analyses with thousands of taxa and mixed models.

Bioinformatics 22:2688–2690

Su X (2006) A new species of Pythium isolated from mosquito larvae

and its ITS region of rDNA. Mycosystema 25:523–528

Swofford DL (2002) PAUP*. Phylogenetic analysis using parsimony

(*and other methods), version 4.0b10. Sinauer Associates,

Sunderland, MA

Takahashi M, Ichitani T, Sasaki M (1977) Pythium porphyrae

Takahashi et Sasaki, sp. nov. causing red rot of marine red algae

Porphyra spp. Trans Mycol Soc Jpn 18:279–285

Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG

(1997) The CLUSTALX windows interface: ﬂexible strategies

for multiple sequence alignment aided by quality analysis tools.

Nucleic Acids Res 24:4876–4882

Uzuhashi S, Tojo M, Kobayashi S, Tokura K, Kakishima M (2008)

First records of Pythium aquatile and P. macrosporum isolated

from soils in Japan. Mycoscience 49:276–279

Uzuhashi S, Tojo M, Kobayashi S, Kakishima M (2009) Pythium

apinafurcum sp. nov.: its morphology, molecular phylogeny, and

infectivity for plants. Mycoscience 50:281–290

van der Plaa

ts-Niterink AJ (1981) Monograph of the genus Pythium.

Stud Mycol 21:1–242

Villa NO, Kageyama K, Asano T, Suga H (2006) Phylogenetic

relationships of Pythium and Phytophthora species based on ITS

rDNA, cytochrome oxidase II and b-tubulin gene sequences.

Mycologia 98:410–422

Voglmayr H (2003) Phylogenetic relationships of Peronospora and

related genera based on nuclear ribosomal ITS sequences. Mycol

Res 107:1132–1142

Voglmayr H, Riethmu

ller A (2006) Phylogenetic relationships of

Albugo species (white blister rusts) based on LSU rDNA

sequence and oospore data. Mycol Res 110:75–85

Wang PH, White JG (1997) Molecular characterization of Pythium

species based on RFLP analysis of the internal transcribed spacer

region of ribosomal DNA. Physiol Mol Plant Path 51:129–143

Waterhouse GM (1963) Key to the species of Phytophthora de Barry.

Mycol Pap 92:1–22

Yachevskij AA, Yachevskij PA (1931) Opredelitel’ gribov (key to the

fungi), 1. Phycomycetes. Moscow-Leningrad, 294 pp

Mycoscience (2010) 51:337–365 365

123

Diversity of mycoparasitic Pythium sensu stricto and Globisporangium species in West Azarbaijan province of Iran

Article

Full-text available

Jun 2024
ANN APPL BIOL

Pythium sensu stricto (s.s.) and Globisporangium species are important components of the soil microbial community and exhibit diverse lifestyles, including mycoparasitism. However, a comprehensive understanding of the species diversity of these mycoparasites in the West Azarbaijan province of Iran is lacking. In this study, a total of 114 mycoparasitic Pythium s.s. and Globisporangium isolates were obtained from agricultural soils collected from six regions in the province. Through DNA barcoding, all Globisporangium isolates were identified as G. nunn, while the barcode markers were insufficient to accurately resolve species boundaries in Pythium s.s. By combining morphological and multilocus sequence data, five species within the genus Pythium s.s. were identified: P. salmasense sp. nov., a potentially new species, and three known species, P. acanthicum, P. ornamentatum, and P. periplocum. Pythium ornamentatum was the most common species and found in all regions studied, followed by G. nunn and P. acanthicum, which were both isolated from four regions. While the isolates of G. nunn showed no mycoparasitic activity against Sclerotinia sclerotiorum, all Pythium s.s. species were capable of infecting the hyphae of this pathogen. The existence of mycoparasitic species is promising for biological control of soil‐borne fungal pathogens in the province. The widespread occurrence of P. ornamentatum, G. nunn, and P. acanthicum may suggest their adaptation to local soil and environmental conditions, indicating their potentially superior effectiveness in controlling plant diseases across different regions if used as biocontrol agents.

Pythium banihashemianum sp. nov. and Globisporangium izadpanahii sp. nov.: Two New Oomycete Species from Rice Paddies in Iran

Article

Full-text available

Jun 2024
J. Fungi

An investigation into oomycete diversity in rice paddies of Fars Province in Iran led to the identification of two new Pythium sensu lato (s.l.) species as Globisporangium izadpanahii sp. nov. and Pythium banihashemianum sp. nov. The identification was based on morphological and physiological features as well as on the phylogenetic analysis of nuclear (ITS and βtub) and mitochondrial (cox1 and cox2) loci using Bayesian inference and Maximum Likelihood. The present paper formally describes these two new species and defines their phylogenetic relationships with other congeneric species. According to multiple gene genealogy analysis, G. izadpanahii sp. nov. was grouped with other species of Globisporangium (formerly, clade G of Pythium s.l.) and was closely related to both G. nagaii and the recently described G. coniferarum. The second species, designated P. banihashemianum sp. nov., was grouped with other species of Pythium sensu stricto (formerly, clade B of Pythium s.l.) and, according to the phylogenetic analysis, shared an ancestor with P. plurisporium. The production of globose hyphal swellings was a major characteristic of G. izadpanahii sp. nov., which did not produce vesicles and zoospores. In pathogenicity tests on rice seedlings, P. banihashemianum sp. nov. isolates were highly pathogenic and caused severe root and crown rot, while G. izadpanahii sp. nov. isolates were not pathogenic.

Diseases caused by Oomycetes

Chapter

Jan 2024

Francine Govers

Yeni Bir Toprak Patojeni: Phytopythium

Article

May 2024

Phytopythium genusu önceleri Pythium cinsi altında yer alan, taksonomik çalışmaların devam etmesiyle birlikte Pythium genusundan ayrılan, günümüzde ise Pythium genusuna göre daha farklı özellikleri ortaya konmuş ve daha yeni anlaşılmaya başlamış toprak kaynaklı bir patojen grubudur. Phytopythium cinsi içinde yer alan toprak kaynaklı organizmalar Phytophthora ve Pythium türleri ile yakından ilişkili, benzer morfolojik yapı ve biyolojiye sahip organizmalardır. Phytopythium genusunda yaklaşık olarak 20 tür bulunmakta ve çoğu tür konukçu bitkilerde saprofitik olarak yaşamını devam ettirmektedir. Patojen olan türler ise konukçu bitkiler için oldukça tehlikeli ve potansiyel tehdit oluşturmaktadırlar. Bu türler içinde özellikle Phytopythium vexans dikkat çekmektedir. Yapılan çalışmalar incelendiğinde Pp. vexans’ın kültür bitkilerinin yanı sıra odunsu bitkilerde ve süs bitkilerinde de ciddi zararlar meydana getirdiği görülmektedir. Bu çalışmanın amacı Phytopythium genusunun genel özelliklerini tanıtabilmek, Phytophthora ve Pythium genusundan farklılaşan ve benzeşen özelliklerini ortaya koyabilmek, özellikle bitkilerde patojenik tür olan ve Türkiyede de son yıllarda çeşitli bitkilerde patojen olduğu saptanan ve önemi vurgulanan Pp. vexans hakkında ayrıntılı bilgi vermektir. Bu derlemede Phytopythium genusu hakkında genel bilgilendirmenin yanı sıra Pp. vexans’ın morfolojik özellikleri, konukçu bitkilerde meydana getirdiği hastalık belirtileri, tanılanmasında kullanılan yöntemler, dünyada ve Türkiye’de yürütülen çalışmalar ve savaşımına yönelik stratejilere yer verilecektir. Böylece toprak kaynaklı olan bu patojen grubunun tarımsal üretimde meydana getirdiği potansiyel tehdit hakkında fikir sahibi olunacaktır.

Multiplex PCR specific for genus Phytophthora and P. nicotianae with an internal plant DNA control for effective quarantine of Phytophthora species in Japan

Article

Full-text available

May 2024
J Gen Plant Pathol

To prevent threats from pathogens such as Phytophthora species from international plant trade, molecular identification techniques are needed for rapid, accurate quarantine inspection. Here, for quarantine control in Japan, we developed a simple DNA extraction for plants and a practical detection method that combines multiplexed PCR using primers specific for Phytophthora species, for P. nicotianae, which is the only non-quarantine Phytophthora species, and as internal controls, for plants. For the new genus-level primer set, we modified previously reported genus-specific primers to improve detectability. The new primers were able to detect mycelial DNA of 155 taxa among Phytophthora clades 1–10, with a sensitivity of 100 fg/µL for three representative species, P. ramorum, P. kernoviae and P. nicotianae. In the PCRs using DNA from non-target species, amplification was observed for only three taxa, and for some strains, four taxa in a closely related genus. Duplex and triplex PCR of the genus-specific primers combined with previously reported plant primers verified the success of DNA extraction and PCR detection from diseased plant samples, and in the triplex PCR, whether the pathogen was diagnosed as P. nicotianae or not by the species-specific primer. The new method detected the pathogen in naturally infected and inoculated plants. The amplicons using the genus-specific primer have enough variation to be sequenced to identify the species. This new method can be used immediately for detecting Phytophthora species and for quarantine control in Japan.

Sensitivity of Globisporangium ultimum to the fungicide metalaxyl is enhanced by the infection with a toti-like mycovirus

Article

May 2024
MICROBIOL RES

New species Pythium amaminum sp. nov. isolated from river water on Amami Island in Japan

Article

Full-text available

May 2024

Pythium amaminum sp. nov. was isolated from river and reservoir water on Amami island, Kagoshima Prefecture, Japan. The species can grow at temperatures between 10 °C and 35 °C. At the optimum temperature of 25 °C, the radial growth rate is 22.5 mm per day. Pythium amaminum produces filamentous sporangia consisting of branched, lobulate or digitate elements forming large complexes. Zoospores form inside the vesicle, which is discharged through a long tube at least 320 μm. Globose oogonia are ornamented with conical blunt spines. Oospores are aplerotic and globose. Antheridia twine around the oogonia or stick to them. These features having a both of the long discharge tube from sporangium and oogonia with spines are not observed in any other species of the genus Pythium, and thus we conclude that P. amaminum is a new Pythium species.

First report of Pythium aphanidermatum and Pythium myriotylum causing root rot on chili pepper (Capsicum annuum L.) in Guizhou, China

Article

Apr 2024
CROP PROT

1-1172

Article

Full-text available

Apr 2024

S Rehan Ahmad

Background: Fungi and oomycetes continue to be the primary source of plant diseases, which cause major crop loss factors in agriculture. Trichoderma is a genus of ascomycete fungus that lives in soil and is known for its ecological significance as a bio-fungicide. Aim: The current study aimed to assess and contrast the antagonism and exoenzyme activity of Trichoderma isolates against Pythium sp., which causes damping-off and root rot diseases on tomato plants. Trichoderma spp. was isolated from rhizospheric soil of healthy plants in the agricultural fields of Patna, Bihar district, India. Methodology: The Trichoderma isolates were evaluated for their suitability as antagonists by in vitro dual culture and non-volatile assay. Results: The results showed that the isolated Trichoderma species were effectively reduced the growth of Pythium sp. in the dual culture assay and non-volatile metabolites (12.5%, 25% and 50% v/v concentration) assay. Trichoderma atrobrunneum effectively inhibited the mycelial growth of Pythium sp. both in the dual culture (81.48%) and non-volatile metabolite assay (71.37%). Followed by Trichoderma harzianum (79.01% and 58.82%), and Trichoderma asperellum (65.43% and 50.58%) respectively. Exoenzyme activities of the Trichoderma isolates were also investigated. The antagonistic Trichoderma atrobrunneum exhibited maximum activities of β-1,3-glucanase (41.39 U/ml) and chitinase (33.06 U/ml) in comparison to T. harzianum and T. asperellum. The capacity of antagonism is enhanced by the production of the enzyme. Based on the above results, it can be said that the non-volatile metabolites and the exoenzyme of the antagonist T. species act synergistically in inhibiting Pythium growth. Conclusion: The secretion of enzymes by Trichoderma species shows that they can be used in plant disease control as novel biocontrol agents as well as to produce enzymes in biotechnological processes.

Trichoderma atrobrunneum: In vitro analysis of exoenzyme activity and antagonistic potential against plant pathogen from agricultural fields in the Patna region, India

Article

Full-text available

Mar 2024

S Rehan Ahmad

Background: Fungi and oomycetes continue to be the primary source of plant diseases, which cause major crop loss factor in agriculture. Trichoderma is a genus of ascomycete fungus that lives in soil and is known for its ecological significance as a bio-fungicide. Aim: The current study aimed to assess and contrast the antagonism and exoenzyme activity of Trichoderma isolates against Pythium sp., which causes damping-off and root rot diseases on tomato plants. Trichoderma spp. was isolated from rhizospheric soil of healthy plants in the agricultural fields of Patna, Bihar district, India. Methodology: The Trichoderma isolates were evaluated for their suitability as antagonists by in vitro dual culture and non-volatile assay. Results: The results showed that the isolated Trichoderma species were effectively reduced the growth of Pythium sp. in the dual culture assay and non-volatile metabolites (12.5%, 25% and 50% v/v concentration) assay. Trichoderma atrobrunneum effectively inhibited the mycelial growth of Pythium sp. both in the dual culture (81.48%) and non-volatile metabolite assay (71.37%). Followed by Trichoderma harzianum (79.01% and 58.82%), and Trichoderma asperellum (65.43% and 50.58%) respectively. Exoenzyme activities of the Trichoderma isolates were also investigated. The antagonistic Trichoderma atrobrunneum exhibited maximum activities of β-1,3-glucanase (41.39 U/ml) and chitinase (33.06 U/ml) in comparison to T. harzianum and T. asperellum. The capacity of antagonism is enhanced by the production of the enzyme. Based on the above results, it can be said that the non-volatile metabolites and the exoenzyme of the antagonist T. species act synergistically in inhibiting Pythium growth. Conclusion: The secretion of enzymes by Trichoderma species shows that they can be used in plant disease control as novel biocontrol agents as well as to produce enzymes in biotechnological processes.

A COX2 molecular phylogeny of the Peronosporomycetes

Article

Jul 2000

The evolutionary history of the mitochondrial COX2 locus has been used to infer the phylogenetic relationships among 15 peronosporomycete and a hyphochytriomycete species. This molecular phylogenetic analysis at both the ordinal and generic levels provides strong evidence for the recognition of the Saprolegniomycetidae and the Peronosporomycetidae as natural groups, and for the monophyly of the Saprolegniales, Leptomitales and Pythiales. A three amino acid insertion/deletion event (indel) has been identified as a putative synapomorphy for the Saprolegniales. Parsimony mapping of 12 morphological and biochemical characters on the COX2 molecular phylogeny yields an hypothesis for peronosporomycete ancestral states and shared-derived features.

A New Species of Pythium Isolated from Wheat Beneath Snow in Washington

Article

Nov 1980

Patrick E. Lipps

Pythium okanoganense differs from other members of the genus in having terminal oblate-spheroidal sporangia that infrequently proliferate internally to produce another sporangium within the old sporangial wall. Oogonia are smooth, except commonly a single, terminal hyphal protrusion extends from the oogonial wall. Antheridia are mostly single, frequently borne on inflated antheridial stalks, and monoclinous or less often diclinous. Oospores are aplerotic to nearly plerotic.

Pythium sukuiense, a new species from undisturbed natural forest in Taiwan

Article

May 2004

A new species, Pythium sukuiense, was isolated from an undisturbed natural forest in northern Taiwan. The fungus produces sporangia indistinguishable from hyphae and very small oogonia and oospores. Oogonia were smooth and terminal or intercalary and attached with a single antheridium. Oospores were aplerotic, with an average size of only 11 μm.

Taxonomic studies in the family Pythiaceae

Article

Sep 2018

C. P. Sideris

Classification of the Peronosporomycetes

Article

Jan 1999

M.W. Dick

A cox2 phylogenetic hypothesis for the downy mildews and white rusts

Article

Jun 2003

Mitochondrially encoded cox2 sequences were used to infer evolutionary relationships of downy mildew and white rust taxa in a data set of 36 peronosporomycete isolates. The data set of 599 aligned nucleotides was analysed using neighbor joining, maximum parsimony, and maximum likelihood. These phylogenetic analyses did not infer separate monophyletic orders for the Pythiales versus downy mildews (Peronosporales), but do indicate that separation of monocotyledonus and dicotyledonous-infecting downy mildews into separate subclasses is not justified. Analyses of three species of Albugo, however, infer that Peronosporales are a polyphyletic group, unless this order is expanded to include species of the Pythiales and Rhipidiales. Whereas all examined downy mildew cox2 amino acid sequences bore the signature indel LEF/Y characteristic of the subclass Peronosporomycetidae the three Albugo species did not. Instead, the LEF/Y signature indel was replaced by a highly variable indel unique to each Albugo species. Collectively, these results indicate that the white rusts are only distantly related to downy mildews and constitute a distinct order basal to other orders within the Peronosporomycetidae.

Beiträge zur Morphologie und Systematik der Algen. II. Die Saprolegnieen

Article

N. Pringsheim

The Neighbor-Joining Method: A New Method for Reconstructing Phylogenetic Trees

Article

Jul 1987
MOL BIOL EVOL

A new method called the neighbor-joining method is proposed for reconstructing phylogenetic trees from evolutionary distance data. The principle of this method is to find pairs of operational taxonomic units (OTUs [= neighbors]) that minimize the total branch length at each stage of clustering of OTUs starting with a starlike tree. The branch lengths as well as the topology of a parsimonious tree can quickly be obtained by using this method. Using computer simulation, we studied the efficiency of this method in obtaining the correct unrooted tree in comparison with that of five other tree-making methods: the unweighted pair group method of analysis, Farris's method, Sattath and Tversky's method, Li's method, and Tateno et al.'s modified Farris method. The new, neighbor-joining method and Sattath and Tversky's method are shown to be generally better than the other methods.

A new species of Pythium isolated from mosquito larvae and its ITS region of rDNA

Article

Jan 2006

X.Q. Su

Pythium porphyrae Takahashi et Sasaki, sp. nov. causing red rot of marine red algae Porphyra spp

Article

Jan 1977

Phylogeny of the genus Pythium and description of new genera

Abstract and Figures

Recommended publications

Phylogeny of the genus Pythium and description of new genera

Pythium apinafurcum: Its morphology, molecular phylogeny, and infectivity for plants

Pythium apinafurcum: its morphology, molecular phylogeny, and infectivity for plants

An annotated checklist of Pythium species from Iran