Content uploaded by Steven R Scofield
Author content
All content in this area was uploaded by Steven R Scofield
Content may be subject to copyright.
1
METHODS FOR VIRUS-INDUCED GENE SILENCING IN HEXAPLOID
WHEAT USING BARLEY STRIPE MOSAIC VIRUS-BASED VECTORS
Steven R. Scofield 1,2 and Amanda S. Brandt1
1USDA-ARS, Crop Production and Pest Control Unit, 915 West State Street, West
Lafayette, IN 47907 USA
2Department of Agronomy, Purdue University, 915 West State Street, West Lafayette, IN
47907, USA
Keywords: Virus-induced gene silencing; VIGS; wheat; hexaploid; monocotyledonous
plants; Barley stripe mosaic virus; functional genomics; gene knockout
Running Title: BSMV-VIGS in wheat
Summary
Virus-induced gene silencing (VIGS) is a useful functional genomics tool for
rapidly creating gene knockout phenotypes that can be used to infer gene function. Until
recently, VIGS has only been possible in dicotyledonous plants. However, the
development of vectors based on Barley stripe mosaic virus (BSMV) has now made
VIGS possible in barley and wheat. VIGS has particular advantages for functional
genomics in wheat, where the organism’s hexaploidy and recalcitrance to transformation
have greatly hindered strategies for functional identification of genes. Here methods are
presented for using the Barley stripe mosaic virus VIGS system (BSMV-VIGS) to silence
genes in hexaploid wheat.
2
1. Introduction
Virus-induced gene silencing (VIGS) is a rapid and powerful tool for creating
gene knockout phenotypes from which gene function can be inferred (1-3). VIGS is
based on the fact that infection by many plant viruses causes the activation of a
homology-dependent plant defense mechanism that results in degradation of the viral
genome and transcripts. By inserting a fragment of a chosen plant gene into the viral
genome, this defense mechanism is exploited in VIGS to cause the sequence-specific
degradation of transcripts, and consequently silencing, of the chosen plant gene.
Unfortunately, effective VIGS systems are available for only a limited number of plant
systems. Until recently VIGS was only possible in a few dicotyledonous plants, tobacco
and tomato, because just a few virus-host combinations had been identified that give
sufficiently reliable silencing to be effective for analysis of gene function. However, in
the last few years two VIGS systems have been reported to be effective in some
monocotyledonous plants (4, 5).
This article will focus on performing VIGS in wheat. Prior to the establishment
of the wheat VIGS system, assessment of gene function in wheat was extremely slow and
laborious. As most wheat is hexaploid, its genome comprised of the A, B and D
homeologous chromosome sets, conventional mutation analysis was often not possible
because loss-of-function mutations in one gene were usually masked by the continued
function of homeologous genes. Additionally, wheat is very recalcitrant to
transformation, so few of the modern tools available for model plants, such as T-DNA
insertion and activation libraries, exist for wheat. Given these biological constraints,
VIGS appears uniquely suited to overcome these obstacles, as it operates through a
homology-dependent silencing mechanism and should, therefore be able to silence any
gene copies with close sequence conservation and it is initiated by viral infection, which
is facile in wheat, unlike transformation.
The wheat VIGS system described here is based on Barley stripe mosaic virus
(BSMV) (4). BSMV is a positive sense single-stranded RNA virus that is a member of
the Hordeivirus genus. Its genome is tripartite, consisting of the α, β and γ RNAs and
infectious clones of the three RNAs from BSMV strain ND18 were constructed by the
Jackson laboratory (6). These authors generated DNA plasmids that each carries a full-
3
length cDNA clone of one of the BSMV RNAs (see Figure 1). Infectious BSMV RNAs
are produced by linearizing each of the plasmids immediately downstream of the viral
cDNA; in vitro transcribing 5’-capped RNAs; combining the three in vitro transcribed
RNAs and then rub inoculating plants.
BSMV was the first virus shown to be useful for VIGS in a monocotyledonous
plant, barley. Holzberg and coworkers inserted a 178 bp fragment of the barley phytoene
desaturase (PDS) gene into the BSMV gamma construct immediately 3’ to the stop codon
of the second and last gene in the gamma RNA, γb (4). Infection with this construct
clearly demonstrated silencing of PDS through the production of photobleaching, as a
consequence of PDS down-regulation, and PDS expression analysis indicated significant
reduction in PDS mRNA accumulation. Our lab has extended the utility of the BSMV-
VIGS system by demonstrating its ability to effectively silence a wide-range of genes in
hexaploid wheat (7).
In this chapter, protocols are provided for performing BSMV-VIGS. This process
is divided into the following steps:
1. Selecting cDNA sequences to be used in VIGS experiments.
2. Amplifying plant cDNA sequences and inserting them into pGEM-T Easy
vector.
3. Excising and transferring cloned inserts into BSMV vectors
4. Preparing in vitro transcripts from BSMV vectors.
5. Inoculating plants with viral transcripts.
6. Confirming gene silencing by quantitative real-time PCR (qRT-PCR).
Before initiating any BSMV-VIGS experimentation be sure to obtain any
approval required by your institution’s biological safety committee. All plants infected
with BSMV should be grown in greenhouses or growth chambers, and all plants and any
materials used to grow them (eg. soil, pots and trays) should be autoclaved at the
conclusion of the experiment.
2. Materials
4
2.1 Select cDNA sequences to be used in VIGS experiments
1. Sequence data for gene of interest
2. Access to software (we use GCK) and databases such as NCBI
2.2 Amplify plant cDNA sequences and insert into pGEM-T Easy vector
1. pGEM-T Easy vector (Promega)
2. primers (MWG-Biotech AG)
3. HotMasterTM Taq Polymerase (Eppendorf)
4. dNTPs (Eppendorf)
5. DH5α competent cells (Zymo Research Z-Competent E.coli Transformation
kit)
6. LB (Luria-Bertani) agar and liquid media (Per liter: 10g Tryptone, 10g NaCl,
5g Yeast extract, 1g glucose, pH 7, for agar media add 15g/L Bacto Agar,
autoclave. Store at room temp.
7. Agarose (Invitrogen)
8. Tris-Borate EDTA 10X buffer (Sigma)
9. Ampicillin (Sigma)
10. X-gal (FisherBiotech)
11. IPTG (Sigma)
12. EZ Load100bp Molecular Ruler (Bio Rad)
13. Lambda DNA HindIII-EcoRI digested (New England Biolabs)
14. RNasin (Promega)
15. DTT (Promega)
2.3 Excising cloned cDNA and insertion into BSMV γRNA vector
1. BSMV γ RNA vector (pSL038-1)
2. PacI, NotI, EcoRI restriction enzymes (New England Biolabs)
5
3. DH5α competent cells (Zymo Research Z-Competent E.coli Transformation
kit)
4. LB (Luria-Bertani) agar and liquid media (Per liter: 10g Tryptone, 10g NaCl,
5g Yeast extract, 1g glucose, pH 7, for agar media add 15g/L Bacto Agar,
autoclave. Store at room temp.
5. Agarose (Invitrogen)
6. Tris-Borate EDTA 10X buffer (Sigma)
7. Ampicillin (Sigma)
8. EZ Load100bp Molecular Ruler (BioRad)
9. Lambda DNA HindIII digested (New England Biolabs)
10. Lysozyme (USB)
2.4 Preparation of BSMV for in vitro transcription reactions
1. BSMV constructs
2. Plasmid preps (TEG, 0.05M Glucose, 0.01M EDTA pH 8.0, 0.025M Tris pH
8.0, autoclave NaOH+SDS, 0.2M NaOH, 1% SDS, 5M Kacetate, to 60 ml 5M
Kacetate add 11.5 ml glacial acetic acid and 28.5 ml H2O (This solution is 3M
with respect to potassium and 5M to acetate, autoclave)
3. Phenol (pH 8 with Tris)
4. 8.0M LiCl
5. Chloroform
6. Ethanol
7. MluI, and SpeI restriction enzymes (New England Biolabs)
8. Ambion’s mMESSAGE mMACHINE High Yield Capped RNA
Transcription Kit
2.5 Plant Inoculations
1. Plants
6
2. Inoculation buffer (10X GP 18.77g Glycine (Sigma), 26.13g K2HPO4
autoclaved and FES inoculation buffer To prepare 250ml FES: (50ml 10X GP
+ 2.5g Sodium Pyrophosphate (Sigma) + 2.5g Bentonite and 2.5g Celite
(Fluka) autoclave
3. BSMV α, β and γ RNA in vitro transcripts
2.6 Confirming Gene Silencing with qRT-PCR
1. TRIzol Reagent (Invitrogen)
2. Chloroform
3. Ethanol
4. Turbo DNase (Ambion)
5. Primers for analysis
6. iScript cDNA synthesis kit (Bio-Rad)
7. Sybr RT-PCR kit (Bio-Rad)
3. Methods
In this section, the methods used to design and assemble BSMV-VIGS constructs,
produce in vitro transcribed BSMV RNAs, inoculate wheat plants, and confirm gene
silencing will be presented.
3.1.1 Selecting plant gene fragments to use for targeting plant gene silencing.
Once a candidate gene has been chosen for silencing, a gene fragment must be
selected that will be PCR amplified and inserted into pSL038-1. A number of parameters
must be considered when choosing the fragment to be used for silencing. 1) Fragments
used to target gene silencing are typically between 120b and ~500b in length. Shorter
fragments are less effective for silencing (7), while longer fragments are less stable in
BSMV in planta (8, 9). 2) Is your target gene a member of a large family? If so, do you
want to silence all copies, or a specific gene? 3) If you want to silence all copies, choose
a fragment that shares high homology with all other copies. 4) If a single family member
is being targeted, choose the most diverged region. This is likely the 3’UTR. We have
7
used the 3’UTR to silence the Lr21 gene, which is an NBS-LRR disease resistance gene,
and has many closely related homologues present in the wheat genome (Scofield et al.,
2005). 5) Make sure that the sequence you choose does not contain an MluI restriction
site, as the γ plasmid will be linearized with MluI before in vitro transcription (Step
3.1.5). 6) How will you confirm that you have silenced the gene you targeted? We use
qRTPCR, but northern blot analysis is also possible. Regardless of which method you
use, be sure that you do not use qRTPCR primers or hybridization probes that will prime
or hybridize to the fragment cloned into the viral construct, because these will measure
the accumulation of viral RNA rather than the silencing of the endogenous target gene.
In our lab we try to design all the primers we will need for the entire experiment at the
same time. This includes two gene fragments that we can use to silence the same gene by
using different sequence areas (to verify that the phenotype seen is actually a result of the
targeted gene and not some other gene interaction) and primers that do not overlap these
areas for use in the qRTPCR. For qRTPCR primers we try to pick primers with Tms of
approximately 60°C. We use GCK (Gene Construction Kit Version 2.5, Textco, Inc.)
and Oligo (Primer Analysis Version 6.86) software for tracking constructs and
designing primers.
3.1.2 Amplifying plant cDNA sequences and inserting them into pGEM-T Easy
vector
1. Isolate RNA from plant tissue that you know is expressing your gene of
interest using Invitrogen’s TRIzol protocol. Pulverize 50-100mg plant tissue
with a mortar and pestle under liquid Nitrogen. Add 1 ml TRIzol reagent and
continue grinding until reagent is completely thawed. Transfer to 1.5 ml
centrifuge tube. After sitting at room temp for 5 mins add .2ml chloroform
and shake vigorously. (Do not vortex! (Note 1a)). Centrifuge 12,000g for 10
mins. Transfer clear upper aqueous phase to a new 1.5 ml centrifuge tube.
Add 0.5 ml isopropanol. Let RNA precipitate for 30 mins at room temp.
Centrifuge 12,000g for 10 mins. Pour off supernatant and wash RNA pellet
with 1ml 75% ethanol. Centrifuge 7500g for 5 mins. Remove supernatant
8
with a pipette tip carefully because the pellet is quite soft(Note 1b).
Resuspend pellet in 10-20µl H2O. Quantify RNA.
2. Set up a cDNA synthesis reaction as follows:
2µl 10X HotMaster Taq DNA polymerase buffer
4µl dNTPs supplied with HotMaster Kit
--µl RNA (1µg)
1µl Oligo dT
0.5µl RNasin (Promega)
0.2µl 100mM DTT (Promega)
--H2O to a final volume of 20µl
Mix thoroughly
Incubate for 45 mins at 42°C
3. Set up 100ul PCR using Eppendorf’s HotMasterTaq DNA polymerase kit:
9µl 10X HotMaster Taq DNA polymerase buffer
2µl dNTPs supplied with HotMaster Kit
2.5µl 20µM foward primer (Note 2)
2.5µl 20µM reverse primer
5µl cDNA reaction from step 2 above
0.5µl Taq polymerase
78.5µl H2O
Mix thoroughly
Place in PCR machine and run program based on Tm of primers (Note 3)
for 35-40 cycles.
Following amplification the amplified DNA is run on a 1.5% agarose gel
(0.75g agarose in 50ml 1X TBE) along with an appropriate sized DNA
ladder. Following DNA separation, stain the gel for 25 mins with
ethidium bromide (Note 4) by adding 25ul of a 10mg/ml ethidium
bromide stock solution to 100ml 1X TBE. Using a transilluminator locate
and excise the appropriate sized DNA band.
4. Gel purify the DNA band (Note 5)
9
Using Zymo Research’s Zymoclean Gel DNA Recovery Kit proceed as
follows:
Record weight of gel band excised from the agarose gel
Add three volumes of ADB Buffer to each volume of gel (example: for
100mg gel slice use 300µl ADB Buffer)
Incubate at 55°C for 5-10mins until band has dissolved
Add the melted agarose solution onto a Zymo-Spin Column and place into
a 2 ml collection tube. Centrifuge for 5-10 second. Empty the collection
tube. Add 200µl wash buffer and spin for 10 seconds. Empty the
collection tube. Add 200µl of wash buffer and spin for 30 seconds.
Place the Zymo-Spin Column into a new 1.5 ml centrifuge tube. Add 6-
8ul of water directly to the column matrix and spin to elute the DNA.
5. Insertion of cDNA into the pGEM-T Easy Vector
Place 5µl 2X ligation buffer along with the following:
1µl pGEM-T Easy Vector
1µl (0.5-1ug) Purified PCR product from step 4 above
2µl H2O
1µl T4 Ligase
Mix thoroughly
Place in 4°C overnight (Note 6)
3.1.3 Transforming E.coli with ligation reactions of pGEM and plant cDNAs
1. Prepare competent DH5α cells using Z-competent E. coli Transformation Kit
& Buffer Set from Zymo Research (Note 7).
2. For transformation place Z-competent cells + 1µl pGEM+insert on ice for
45mins.
3. Spread onto 37°C LB agar + ampicillin + x-gal/IPTG plates (per liter LB use
10g Tryptone, 10g NaCL, 5g Yeast extract, and 1g glucose. Bring pH to 7.0
then add 15g Bacto agar/liter LB, autoclave. Add ampicillin to a final
concentration of 75µg/ml after LB has cooled to less then 65°C. Prepare a 1000X
stock solution of X-gal by adding 40mg X-gal to 1 ml dimethylformamide. Add
10
1ml/1L LB. Prepare a 1000X stock solution of .5M IPTG. Add 1ml/1L LB (Note
8). Pour 15-20ml media into petrie plates. After media has cooled and solidified,
using sterile techniques spread transformed cells onto media and place at 37°C
overnight.
4. The next day pick 10 to 15 white colonies and begin 5ml cultures in liquid LB
+ ampicillin and allow to grow overnight at 37°C.
5. Take overnight cultures and centrifuge in 1.5 ml centrifuge tubes for 1 min.
6. Pour off supernatant and resuspend bacterial pellet in 0.4 ml boiling prep
buffer (80 g sucrose, 5 ml Triton X-100, 100 mls 0.5 M EDTA (pH 8), and 5 mls
2M Tris-HCL, bring volume to 1L with H2O). (Note 9) After the pellet has been
resuspended add 100µl of a 40mg lysozyme/1ml boiling prep buffer stock
solution (keep at –20°C until prior to use). Boil 60 second in a water bath. (Note
10).
7. Centrifuge tubes for 8 minutes. Remove pellet with a toothpick and discard.
8. Add 50µl 3 M NaAcetate and 350µl isopropanol. Leave at room temperature
for 5 mins.
9. Centrifuge 5 minutes. Remove all supernatant. Wash pellet with 70% ethanol.
Dry thoroughly then resuspend the DNA pellet in 50 µl TE. Use 3-5 µl for
restriction enzyme digest.
10. Set up a restriction enzyme digest as follows: (Note 11)
3 µl DNA (~0.5µg)
2 µl EcoRI 10X buffer
1 µl EcoRI enzyme (10 Units)
0.5 µl RNase A (10µg/ml)
13.5 µl H2O
11. After digesting for 2 hrs. run DNA on a 1.5% agarose gel along with a DNA
ladder of appropriate size markers. Identify the plasmids containing inserts of the
correct size. It is highly recommended that the vector is sequenced to confirm
what has been subcloned into the pGEM vector.
12. Digest 5-10µg plasmid with NotI enzyme
--µl DNA (5-10µg)
11
5 µl NotI 10X buffer
0.5 µl BSA
2 µl NotI enzyme
--H2O to 50µl
13. After digestion run samples on a 1.5% agarose gel. Stain with ethidium
bromide as described previously. Excise gel band and clean with Zymo-clean
DNA recovery kit as described earlier. The fragment is now ready to be ligated
into the BSMV γ RNA vector.
3.1.4 Inserting cDNA fragments into the BSMV γ RNA vector (pSL038-1)
1. Linearize pSL038-1 with NotI as follows: (Note 12)
--µl DNA (2µg pSL038-1)
--H2O to 50µl total volume
5 µl 10X Buffer
0.5 µl BSA
1 µl NotI (10 Units)
2. Treat linearized plasmid with Alkaline Phosphatase
Add 3 units of NEB Calf Intestine Alkaline Phosphatase to the remainder of the
digest and incubate at 37oC for 30minutes.
Add 155 µl TE. Extract 1X with 200µl phenol/chloroform. Collect the
supernatant in a fresh tube.
Add 20µl 3M NaAcetate and precipitate with 600µl ethanol at -20°C. Centrifuge
5 mins. Wash pellet with 70% ethanol. Air dry pellet or dry in SpeedVac.
Resuspend pellet in 10µl TE for use in ligations. Store in -20°C until ready for
ligation reactions.
3. Set up ligation reaction as follows: (Note 13)
--0.5-1µg pSL038-1
1 µl 10X ligation buffer
--0.5 µg NotI digested fragment
1µl T4 Ligase
12
--H2O to 10µl
Place ligation reaction at 16°C overnight
The next day transform competent E. coli as described earlier. (Note 14)
Plate onto LB agar + ampicillin
Incubate at 37°C overnight
4. Pick at least 10 colonies and start overnight 4ml liquid LB + ampicillin
cultures. Use 3 ml of bacterial culture to isolate plasmid and place the other 1 ml
in 4°C.
Use the boiling plasmid prep method to isolate the plasmid.
Set up EcoRI restriction digests to determine which plasmid contains a fragment
of the correct size.
5. Based on sequencing data set up a digest that can orient the directionality of
the fragment. (Note 15)
6. Once the correct construct has been identified, perform a large scale plasmid
prep. (Note 16) Do not expose any of the BSMV plasmids, that will undergo in
vitro transcription, to RNase! Unless very stringent steps are taken to remove it,
any residual RNase will ruin the in vitro transcription reactions. The following
plasmid DNA preparation procedure is a modified version of the alkaline lysis
prep. It is very reliable and does not utilize RNase (10).
Use the 1 ml liquid LB culture (kept at 4°C) to inoculate a 200 ml liquid
LB+ampicillin. Grow overnight at 37°C.
Pour cells in 250 ml Sorvall bottle. Spin at 7000 rpm 10minutes.
Pour off supernatant and resuspend cells in 12 mls GTE (50mM glucose,
50mMTris pH 7.5 and 10mM EDTA).
Add 100 µl lysozyme solution and mix thoroughly. (40mg/ml lysozyme in
50% GTE and 50% glycerol (keep stored at –20°C)).
Add 24 mls 0.2M NaOH + 1% SDS and swirl quickly to mix.
After 5 minutes add 20 mls 3MK/5M acetate pH 5.5, mix by swirling and
place on ice for 10 minutes.
Spin 7000 rpm 10 minutes.
13
Pour supernatant into 40 mls isopropanol in another 250 ml bottle and mix
completely. Don’t worry about floating material from previous spin.
Allow 5 minutes at room temp for DNA to precipitate. Spin 7000 rpm.
Decant off supernatant. Dissolve DNA pellet in 3 ml TE
Measure final volume, transfer to 15-30ml tube and add 1/3 volume 8M
LiCl to precipitate RNA. Let sit on ice for 30 minutes. Spin 8000 rpm
for10 minutes. Keep supernatant!
Transfer supernatant to 15ml orange capped falcon tube containing 4ml
phenol/chloroform and 0.1 vol 3M NaAcetate pH 5.2. Vortex. Spin 3000
rpm 5 mins in table top centrifuge.
Collect the upper phase and transfer to a 30 ml tube
Add 2.5 volumes ethanol and let sit 5 minutes in ice.
Spin 8000 rpm for 10 minutes. Pour off supernatant. Redissolve pellet in
0.3 ml TE. Transfer to 1.5 ml centrifuge tube.
Add 1ml ethanol, mix and spin. (If no precipitate appears at this stage add
40 µl 3M NaAcetate pH 5.2 and place back on ice for 5 minutes.)
Pour off supernatant.
Redissolve pellet in 200µl TE.
3.1.5 Preparing in vitro transcripts from BSMV vectors.
All BSMV-VIGS experiments require preparing in vitro transcripts of α, β and γ
BSMV RNAs. All experiments utilize the same α and β RNAs, but unique γ RNAs are
required to target chosen plant genes for silencing or to serve as controls. We strongly
recommend that each experiment include inoculations with two controls: 1) α, β and
γ pSL038-1 which is a γ RNA with no plant gene inserted and will serve as a control for
the effects of BSMV infection and 2) α, β and γ pSL039B-1 which targets the phytoene
desaturase gene (PDS) for silencing. PDS silencing is easily detected by the appearance
of photobleaching and serves as a positive control indicating that your experiment
produced transcripts capable of silencing.
14
Figure 1. Maps of the DNA plasmids used to produce BSMV α, β and γ in vitro
transcripts (IVT). Arrows indicate the BSMV genes. The position of the T7
RNA polymerase promoters used for the IVT reactions are indicated. The MluI
15
and SpeI restriction sites in bold font are used for linearization of the plasmids for
IVT reactions. The PacI, SmaI and NotI restriction sites marked in bold font in
pSL038-1 are used for cloning plant cDNA sequences.
1. Linearize BSMV plasmids (see Figure 1). Do not use RNAse in these digests!
pα46: Linearize with MluI
pβ42sp1 Linearize with SpeI
pγSL038-1 Linearize with MluI (This clone carries the BSMV γRNA
with PacI, NotI and SmaI sites for cloning VIGS fragments)
pγSL039B-1 Linearize with MluI (BSMV γ RNA with 185bp fragment
from barley PDS gene)
2. Run a 1% agarose gel using 1 µl of each of the digests to confirm that the
plasmids have been completely linearized. (Note 17)
3. Having confirmed complete digestion heat inactivate the digest at 65°C for 20
mins. Or, phenol/chloroform the extract and ethanol precipitate the linearized
plasmids; wash with 70% ethanol, dry and resuspend in TE to approximately
1µg/µl. (Note 18)
4. In vitro transcription of viral RNAs
For every 20 plants to be inoculated, linearize 0.7-1 µg of plasmid DNA for
each of the 3 genomic RNAs. Do not use RNase in these digests!
Capped in vitro transcripts are prepared from linearized BSMV α, β and γ
plasmids using the mMessage mMachine™ T7 in vitro transcription kit (Ambion,
Inc. Austin, TX, USA) following the manufacturer’s protocol. These in vitro
transcription reactions typically result in 1–1.5 µg/µl final concentration of RNA.
This protocol can easily be scaled up. Calculate the number of plants that need to
be inoculated then determine how much transcript is needed.
A 20µl reaction has 10µl 2X NTPs, 1µg linearized plasmid, 2µl Buffer (at room
temperature (Note 19)), 2µl enzyme mix (added last) and H2O (bringing the
volume to 20µl). The reaction is placed at 37°C for 2 hrs.
16
5. Verify in vitro transcription reaction by running a 1% agarose gel with 1ul of
each transcript diluted with 9µl RNase free water and 10µl gel running dye
provided in the Ambion kit. (Note 20)
3.1.6 Inoculating plants with viral transcripts.
For the seedling VIGS assay we first germinate seeds on dampend paper towels
for 3-4 days, followed by an additional 5-7 days growth at 4oC. Two to three seedlings
are transplanted in 4” pots filled with potting soil. Greenhouse temperatures are kept
between 18°C and 24°C and supplemental lighting is used to provide daylengths that are
16hr long.
1. For each plant to be inoculated, 3 in vitro transcription reactions (one for each
BSMV genomic RNA) are required. The inoculation buffer contains an abrasive
to facilitate viral infection. Each inoculation contains:
1 µl α BSMV in vitro transcribed RNA
1 µl β BSMV in vitro transcribed RNA
1 µl γ BSMV in vitro transcribed RNA (γ construct is specific for each
gene to be silenced, or control)
22.5 µl IB (Note 21)
2. Pipette 25.5 µl of the inoculation mixture onto the index finger of the gloved
hand you will use to inoculate the plant. Gently hold the base of the plant with
your hand that does not carry the inoculation mixture. Pinch the base of the leaf
to be inoculated with hand carrying the RNA mixture between your index finger
and thumb and starting at the base of the leaf, firmly press these fingers together
as you move your hand from the base to the tip of the leaf. Repeat this rubbing
motion two more times. (Note 22)
3.1.7 Confirming gene silencing by comparative quantitative real-time PCR
(qRTPCR)
17
A critical step in any VIGS experiment is confirmation that the
accumulation of the mRNA of the gene targeted for silencing is significantly
reduced. We typically do this using comparative quantitative real-time PCR
(qRTPCR) This method’s chief advantages are that it provides precise
measurements of gene expression, while requiring very little RNA, which is
particularly useful in VIGS where only a small amount of tissue may undergo
silencing. Excellent reviews of the theoretical and practical aspects of qRTPCR
have been extensively reviewed (11).
The considerations for qRTPCR that are unique to VIGS relate to the
choice of primers used to measure gene expression and the choice of tissue from
which RNA is prepared. It is essential that the primers used to monitor
expression of the gene targeted for silencing not have complementarity to the
gene fragment inserted into the VIGS vector. If they do, they will amplify cDNA
copied from viral RNA rather than mRNA from the plant gene.
In comparative qRTPCR two gene-specific primer sets are utilized. One
set amplifies a fragment from a gene whose expression does not vary during the
course of the experiment, and serves to normalize for any differences in cDNA
concentration between samples. Care should be taken in choosing this gene to be
sure that it is stable during the conditions of your particular VIGS experiment.
For the experiments we have conducted, we have found that glyceraldehyde-3-
phosphate dehydrogenase (GAPD) serves as a good normalization gene. The
second primer set is specific for the mRNA being targeted for silencing. As
mentioned before, these primers must not be able to amplify a product from the
fragment cloned within the BSMV γ RNA used for VIGS.
The protocol given here is what we use to make expression measurements
using a Stratagene MX3000P. All operations prior to setting up the PCR
amplification are appropriate regardless of what qPCR machine is used, however
the reagents used for the PCR amplification must be chosen based on the qPCR
machine that will be used in your experiment.
18
1. Isolate RNA from plant tissue in which the gene-of-interest is silenced and
from control plants infected with BSMV constructs that do not contain a plant
cDNA (γ pSL038-1) We use Invitrogen’s TRIzol protocol to prepare the RNA.
Pulverize 50-100mg plant tissue with a mortar and pestle under liquid nitrogen.
Add 1 ml TRIzol reagent and continue grinding until reagent is completely
thawed. Transfer to 1.5 ml centrifuge tube. After sitting at room temp for 5 mins
add 0.2ml chloroform and shake vigorously. (Do not vortex! (Note 1a)).
Centrifuge 12,000g for 10 mins. Transfer clear upper aqueous phase to a new 1.5
ml centrifuge tube. Add 0.5 ml isopropanol. Let RNA precipitate for 30 mins at
room temp. Centrifuge 12,000g for 10 mins. Pour off supernatant and wash
RNA pellet with 1 ml 75% ethanol. Centrifuge 7500 g for 5 mins. Remove
supernatant with a pipette tip carefully because the pellet is quite soft. (Note 1b)
Resuspend pellet in 15-20µl H2O
2. Quantify the RNA
3. DNase 2.5 µg RNA using 1/2 reaction of Ambion’s Turbo DNase kit.
--RNA (2.5 µg)
--H2O to 10µl
1.25 µl Buffer
0.5 µl DNase
1.25 µl Inactivator
Centrifuge, transfer upper aqueous layer to a new tube being sure not to disturb
the pellet.
4. Use 2.5 µl DNased RNA (~200ng/µl) to make cDNA using half reactions of
Bio-Rads iScript cDNA synthesis kit. (Note 23)
2.5 µl RNA
2 µl 5X iScript buffer
5 µl RNase free H2O
0.5 µl Reverse Transcriptase
Leave tubes at 25°C for 5 mins, 42°C for 30 mins, then 85°C for 5 mins.
Place tubes on ice for 1 minute then centrifuge for 10 seconds. Dilute samples
10-20 fold to use in Q-PCR
19
5. Use the cDNA to set up Q-PCR using Bio-Rad Sybr RT-PCR kit. Prepare 3
replicate reaction tubes for each sample. (Note 24)
12.5 µl Bio-Rad Sybr Mix with Rox (Note 25 and 26 )
6.0 µl H2O
0.75 µl qRTPCR foward primer (20µM)
0.75 µl qRTPCR reverse primer (20µM)
5 µl cDNA template
4. Notes
1a. If you vortex the RNA, contaminating genomic DNA present in the sample will be
sheared. Because the RNA for this particular procedure is not DNased, sometimes many
bands amplify during PCR. If the PCR primers span an intron there will likely be larger
products in the PCR especially if you have vortexed the sample. This isn’t a huge
problem as the specific sized cDNA band can still be isolated from the gel and ultimately
you will sequence the cloned product to confirm that the correct PCR product has been
obtained.
1b. Do not centrifuge at faster speeds or allow the pellet to air dry as it will be very hard
to resuspend. Just pipette off the aqueous layer and immediately resuspend the pellet in
RNase free water.
2. All of our primers are dissolved in T1E0.1. This is 10mM Tris pH 7.5 and 0.1mM
EDTA with the final concentration of primers being 100µM stock solutions. For working
solutions the final concentration is 20µM in T1E0.1. We have lowered the EDTA
concentration to prevent interference of the Taq polymerase and other downstream
manipulations while still providing buffering protection of the primers at low
temperatures during storage (-20°C).
20
3. Typically, the 100µl PCR reaction is divided into 5-20µl aliquots and placed across a
temperature gradient during PCR that spans a few degrees above and below the predicted
Tm of the primers.
4. Ethidium bromide is a mutagen! Always wear gloves when working with Ethidium
bromide. Anything coming into contact with it must be handled as hazardous waste and
handled accordingly.
5. There are many methods and products for recovering DNA from agarose gels. The
Zymoclean Gel DNA Recovery Kit is an excellent product.
6. The pGEM-T Easy Vector is a very efficient system for cloning PCR products made
with Taq Polymerase which creates A-overhangs. Incubating the ligation reaction for 2
hrs at room temperature is enough time for our lab to get sufficient quantities of ligated
inserts.
7. Many companies sell competent E.coli cells that can be transformed with the pGem
vectors containing the ligated plant cDNA fragments. However, if many constructs are
going to be made then Zymo Research has a kit that is easy to use and produces cells with
high transformation efficiencies of 108-109 colonies/µg of supercoiled pUC19 plasmid
DNA.
8. Prepare the 1000X stock solutions of X-gal and IPTG before preparing the LB. These
stock solutions can be kept at -20°C and thawed prior to use. X-gal will allow blue/white
screening of the transformed E.coli cells. Colonies that are white will contain an insert
that disrupts the β-galactosidase gene in the pGEM vector while those colonies that are
blue will have no insert. This is the main reason we use the pGem vector to clone our
plant cDNA. The BSMV γ RNA vector that will ultimately receive the plant cDNA has
no such selection making screening for inserts more difficult. The IPTG activates the β-
galactosidase gene resulting in darker blue colonies.
21
9. There are many methods for isolating the plasmids from bacteria. This boiling
method is quick, easy, and efficient giving large yields of DNA albeit the DNA is a little
dirty. However, all we want to accomplish here is confirmation that we have subcloned
the correct fragment into the pGEM vector.
10. A large beaker with 1-2inches of water can be brought to boiling in the microwave.
Remove the beaker carefully from the oven and set tubes in a floating tube rack into the
water for one minute.
11. When doing a large number of digests with one restriction enzyme it is generally
easier to make a master mix of enzyme, buffer, RNase, and water, than it is to pipette
everything multiple times. We use EcoRI for these digests. When the amplified DNA is
ligated into the pGEM vector, it is flanked on both sides by EcoRI and NotI restriction
sites. Using either of these two enzymes will release the DNA fragment. However,
EcoRI is much less expensive and works very well for screening miniprep DNA samples.
Once you have determined which plasmid contains the correct sized fragment it can be
digested with NotI.
12. Digest for 2 hours at 37oC, then run 5µl on a 0.8% agarose gel along with uncut
pSL038-1 to check for complete digestion. If the digest is complete proceed to
phosphatase treatment. If not, add another 10 units of NotI and incubate 2 more hours
and then check again.
13. Make sure to set up a ligation reaction that only contains pSL038-1 as a control.
There should be substantially fewer colonies on the control plate than on the plate with
the ligated fragment. If there isn’t, it is likely that the pSL038-1 plasmid was not
completely linearized or the alkaline phosphatase treatment didn’t work.
14. This is a good time to transform E.coli with the other plasmids that are required for
in-vitro transcription reactions. Every plant will be inoculated with at least three
transcripts: the α, β, and γ or γ RNA carrying a plant gene fragment.
22
15. The most effective silencing results when the silencing fragment is inserted into
pSL038-1 in the antisense orientation relative to the γa and γb genes. The likely
explanation for this is that the majority of the siRNAs produced during VIGS result from
dicing of the positive viral strand, rather than the double-stranded replicative intermediate
(12). Therefore, if the plant gene is cloned in the antisense orientation, the siRNA
produced by dicing the positive viral strand will be complementary to the plant gene’s
mRNA and can direct cleavage of the target mRNA when loaded into RISC.
The cloning sites in pSL038-1 are PacI, SmaI (blunt) and NotI. Typically, we
PCR amplify the fragment we want to use with Taq polymerase, using primers that do not
add any new restriction sites to the termini. We clone these PCR products in pGEM-T
Easy and sequence the plasmids to confirm that the correct target was amplified. We
then cut the inserts out of pGEM using the NotI sites that flank the pGEM cloning site.
We then clone the NotI PCR fragment into pSL038-1 that has been cut with NotI and
treated with alkaline phosphatase. Alternatively, it is certainly possible to include PacI,
NotI or blunt sites in your PCR primers and then clone the appropriately digested PCR
products directly into pSL038-1. The following primers can be used to sequence
fragments cloned into pSL038-1:
Gamma Forward: 5’ TGATGATTCTTCTTCCGTTGC 3’
Gamma Reverse: 5’ TGGTTTCCAATTCAGGCATCG 3’
16. DO NOT TREAT BSMV PLASMIDS WITH RNase!! Many manufacturer’s
plasmid prep protocols contain RNase! Some do provide it in a separate tube in which
case you just don’t add it. But many already have the RNase added. Any residual RNase
will degrade the in vitro transcribed RNAs produced from these plasmids.
17. T7 RNA polymerase will preferentially transcribe supercoiled templates, so partial
linearization will result in inferior production of the viral RNA.
23
18. The plasmid preps will have a significant amount of RNA in them. This RNA will
interfer with accurate quantification of the DNA using a spectrophotometer, so you will
have to estimate the DNA concentration on the agarose gel. This can be done based on
known amounts of your marker DNA.
19. If using the Ambion kit, be sure to observe their warning to keep the 10X buffer at
room temperature during preparation of the reaction and to not place the reaction mixture
on ice as this can cause the spermidine to precipitate the template DNA.
20. A standard DNA gel is used to check the IVT products for convenience. However,
remember that you are running RNA samples. Therefore, the gel running buffer and gel
box need to be clean and free of RNases. . A gel analyzing typical IVT reactions is
shown (Fig. 2). Note that as this is not a denaturing gel the sizes of the IVT RNAs are
not accurately indicated by the DNA markers.
Figure 2. Gel image of in vitro transcription products from linearized BSMV
24
plasmids. Lane 1 λ EcoRI+HindIII DNA markers; Lane 2 BSMV α IVT;Lane 3
BSMV β IVT; Lane 4 BSMV γ IVT; Lane 5-7 BSMV γ constructs 1µl of IVT
products were loaded in lanes 2-7. The major bands in lanes 2-7 are the full-
length RNA products. The thinner bands (6-7kb) in lanes 2-7 are the linearized
DNA plasmid templates.
21. Inoculation buffer (Prepare 10X GP 18.77 g/L Glycine (Sigma) and 26.13 g/L
K2HPO4. Autoclave. Prepare 250 ml of IB (inoculation buffer) by mixing 50ml 10X GP
+ 2.5g Sodium Pyrophosphate (Sigma) + 2.5 g Bentonite and 2.5 g Celite (Fluka) and
autoclave
22. Inoculation is accomplished most efficiently if two people work together. One
person pipettes the transcript mixture onto the gloved hand of the second person. You
want to squeeze firmly but not so hard that you break the leaf. Also, if you have multiple
plants in a pot place a toothpick next to an inoculated plant as a marker so that it doesn’t
get inoculated more than once. To prevent contamination, be sure to change gloves
whenever a different VIGS RNA mixture is going to be inoculated
23. It is important to set up a couple of control reactions with no reverse transcriptase
(RT). These will reveal whether or not the cDNA synthesis reaction has worked or if a
sample is contaminated with DNA. If significantly greater amplification is not observed
with a sample containing the RT than one without the RT, the cDNA synthesis has likely
not worked orgenomic DNA is likely serving as the template.
24. This and the succeeding steps are specific to type of qPCR machine you are using.
The steps given here are specific to using a Stratagene MX3000P qPCR machine.
25. Add 3.3 µl ROX to the 1.25 ml tube BioRad Sybr 2X master mix prior to using it the
first time. Protect this tube from light after adding the ROX by wrapping foil around the
tube.
25
26. The use of any trademarked products does note constitute an endorsement by the
U.S. Department of Agriculture, Agricultural Research Service.
REFERENCES
1. Kumagai, M. H., Donson, J., della-Cioppa, G., Harvey, D., Hanley, K., and Grill,
L. K. (1995) Cytoplasmic inhibition of carotenoid biosynthesis with virus-derived
RNA. Proc Natl Acad Sci U S A 92, 1679-83.
2. Ratcliff, F., Harrison, B. D., and Baulcombe, D. C. (1997) A similarity between
viral defense and gene silencing in plants. Science 276, 1558-60.
3. Baulcombe, D. C. (1999) Fast forward genetics based on virus-induced gene
silencing. Curr Opin Plant Biol 2, 109-13.
4. Holzberg, S., Brosio, P., Gross, C., and Pogue, G. P. (2002) Barley stripe mosaic
virus-induced gene silencing in a monocot plant. Plant J 30, 315-27.
5. Ding, X. S., Schneider, W. L., Chaluvadi, S. R., Mian, M. A., and Nelson, R. S.
(2006) Characterization of a Brome mosaic virus strain and its use as a vector for
gene silencing in monocotyledonous hosts. Mol Plant Microbe Interact 19, 1229-
39.
6. Petty, I. T., Hunter, B. G., Wei, N., and Jackson, A. O. (1989) Infectious barley
stripe mosaic virus RNA transcribed in vitro from full-length genomic cDNA
clones. Virology 171, 342-9.
7. Scofield, S. R., Huang, L., Brandt, A. S., and Gill, B. S. (2005) Development of a
virus-induced gene-silencing system for hexaploid wheat and its use in functional
analysis of the Lr21-mediated leaf rust resistance pathway. Plant Physiol 138,
2165-73.
8. Bruun-Rasmussen, M., Madsen, C. T., Jessing, S., and Albrechtsen, M. (2007)
Stability of Barley stripe mosaic virus-induced gene silencing in barley. Mol Plant
Microbe Interact 20, 1323-31.
26
9. Cakir, C., and Scofield, S. R. (2008) Evaluating the ability of the barley stripe
mosaic virus-induced gene silencing system to simultaneously silence two wheat
genes. Cereal Research Communications (in press).
10. Sambrook, J., and Russell, D. W. (2001) Molecular Cloning: A laboratory
manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
11. Bustin, S. A. (2005) Real-time, fluorescence-based quantitative PCR: a snapshot
of current procedures and preferences. Expert Rev Mol Diagn 5, 493-8.
12. Molnar, A., Csorba, T., Lakatos, L., Varallyay, E., Lacomme, C., and Burgyan, J.
(2005) Plant virus-derived small interfering RNAs originate predominantly from
highly structured single-stranded viral RNAs. J Virol 79, 7812-8.
