Content uploaded by Xiulin Zhang
Author content
All content in this area was uploaded by Xiulin Zhang on Aug 07, 2014
Content may be subject to copyright.
Available via license: CC BY 2.0
Content may be subject to copyright.
R E S E A R C H Open Access
Inflammation-induced changes in BK
Ca
currents in
cutaneous dorsal root ganglion neurons from the
adult rat
Xiu-Lin Zhang
1
, Lee-Peng Mok
5
, Kwan Yeop Lee
1,4
, Marcel Charbonnet
1
and Michael S Gold
1,2,3,4*
Abstract
Background: Inflammation-induced sensitization of primary afferents is associated with a decrease in K
+
current.
However, the type of K
+
current and basis for the decrease varies as a function of target of innervation. Because
glabrous skin of the rat hindpaw is used often to assess changes in nociception in models of persistent pain, the
purpose of the present study was to determine the type and extent to which K
+
currents contribute to the
inflammation-induced sensitization of cutaneous afferents. Acutely dissociated retrogradely labeled cutaneous
dorsal root ganglion neurons from naïve and inflamed (3 days post complete Freund’s adjuvant injection) rats were
studied with whole cell and perforated patch techniques.
Results: Inflammation-induced sensitization of small diameter cutaneous neurons was associated with an increase
in action potential duration and rate of decay of the afterhyperpolarization. However, no changes in voltage-gated
K
+
currents were detected. In contrast, Ca
2+
modulated iberiotoxin sensitive and paxilline sensitive K
+
(BK
Ca
)
currents were significantly smaller in small diameter IB4+ neurons. This decrease in current was not associated
with a detectable change in total protein levels of the BK
Ca
channel αor βsubunits. Single cell PCR analysis
revealed a significant change in the pattern of expression of αsubunit splice variants and βsubunits that were
consistent, at least in part, with inflammation-induced changes in the biophysical properties of BK
Ca
currents in
cutaneous neurons.
Conclusions: Results of this study provide additional support for the conclusion that it may be possible, if not
necessary to selectively treat pain arising from specific body regions. Because a decrease in BK
Ca
current appears to
contribute to the inflammation-induced sensitization of cutaneous afferents, BK
Ca
channel openers may be effective
for the treatment of inflammatory pain.
Keywords: Sensitization, Voltage clamp, Nociceptor, Perforated patch, in vitro
Background
Peripheral inflammation is associated with pain and
hyperalgesia that reflects, at least in part, the
sensitization of primary afferents innervating the site of
inflammation [1]. This increase in excitability reflects
both acute (i.e., phosphorylation) and persistent (i.e., tran-
scription) changes in a variety of ion channels [1] that
control afferent excitability. Results from a series of stud-
ies on afferents innervating glabrous skin of the rat
suggest that the impact of inflammation on the under-
lying mechanisms of sensitization is complex. Analysis
of afferents in vivo indicate that the inflammation-
induced increase in excitability is associated with
changes in axon conduction velocity, [2] as well as
changes in the action potential waveform invading the
cell soma in a subpopulation of afferents [3]. Evidence
from a relatively small subpopulation of acutely disso-
ciated cutaneous sensory neurons in vitro,suggestthat
at least some of the changes observed in vivo are due to
changes intrinsic to the sensitized afferents [4]. This
observation is consistent with the suggestion that
changes in the density, distribution and/or expression
of ion channels contributes to the inflammation-induced
* Correspondence: msg22@pitt.edu
1
Department of Anesthesiology, University of Pittsburgh, 3500 Terrace Street
Rm E1440 BST, Pittsburgh, PA 15213, USA
2
Department of Neurobiology, University of Pittsburgh, Pittsburgh, PA, USA
Full list of author information is available at the end of the article
© 2012 Zhang et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative
Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work is properly cited.
Zhang et al. Molecular Pain 2012, 8:37
MOLECULAR PAIN
http://www.molecularpain.com/content/8/1/37
increase in excitability. Persistent inflammation is also
associated with at least two changes in Ca
2+
signaling in
cutaneous neurons which include an increase in the
magnitude and duration of depolarization-induced Ca
2+
transients [5] and a decrease in the density of high
threshold voltage-gated Ca
2+
current [6]. In the latter
study, there is a subpopulation of neurons in which a
decrease in high threshold Ca
2+
current resulted in an
increase in excitability, presumably secondary to a de-
crease in Ca
2+
-modulated K
+
current, and a second popu-
lation in which a decrease in Ca
2+
current was associated
with a decrease in excitability. These results were consist-
ent with the observation that Ca
2+
modulated iberiotoxin
(IbTx) sensitive and paxilline sensitive K
+
(BK
Ca
)currents
are differently distributed among subpopulations of cuta-
neous afferents [7,8]. Furthermore, because multiple splice
variants of the αsubunit and 3 of the 4 βsubunits of the
BK
Ca
channel underlying this current was detected in
mRNA extracted from L4 and L5 dorsal root ganglia
(DRG) [8], the impact of inflammation-induced changes
in Ca
2+
signaling on afferent excitability will therefore de-
pend on BK
Ca
channel splice variants and βsubunits as
well as the proximity of these channels to the sources of
intracellular Ca
2+
. Finally, we and others have demon-
strated that persistent inflammation of other tissues in-
cluding the masseter muscle [9], colon [10], bladder [11]
and stomach [12] is associated with a decrease in voltage-
gated K
+
current. Thus, there is the possibility that a
decrease in at least two K
+
currents contributes to per-
sistent inflammation-induced sensitization of cutaneous
afferents.
Nevertheless, because of evidence that the specific K
+
current changes associated with persistent inflammation
depend on the target of innervation [9] and because of
the changes in Ca
2+
signaling in cutaneous afferents
associated with persistent inflammation, we hypothesize
that changes in a Ca
2+
-dependent K
+
current is primarily
responsible for the sensitization of cutaneous afferents.
To test this hypothesis, we have analyzed changes in K
+
currents in cutaneous afferents obtained from naïve and
inflamed rats.
Results
Sensitization
Based on our previous data indicating the inflammation-
induced changes in the regulation of intracellular Ca
2+
[5] and in voltage-gated Ca
2+
currents [6] is restricted to
small and medium diameter cutaneous neurons as well
as in vivo data suggesting that nociceptive afferents in-
nervating cutaneous tissue tend to have a small cell body
diameter [13], we focused on neurons with a cell body
diameter <30 μm in the present study. Consistent with
results of our previous study, cutaneous neurons from
inflamed rats were significantly more excitable than
those from naïve rats, where the increase in excitability
was manifest with a small but significant decrease in ac-
tion potential threshold (from −32 ± 0.8 to −34.9 ± 1.0 mV,
p = 0.03: n = 53 and 38 for naïve and inflamed groups, re-
spectively), decrease in rheobase (3.7 ± to 2.3 pA/pF, p
<0.05) and increase in the response to suprathreshold
current injection (i.e., the number of action potentials
evoked in response to current injection 3x rheobase
increased from 2.5 ± 0.3 to 6.9 ± 0.9, p <0.01).
Closer inspection of this dataset, suggested that there
were at least two populations of small diameter neurons
that could be defined by their response to inflammation:
in one there was a clear increase in excitability while in
the other, the increase was less apparent. Data suggest
that sensory neurons defined by their binding to the lec-
tin IB4 may play a differential role in the hypersensitivity
that develops in the presence of inflammation [14,15],
We therefore repeated the excitability experiments on
neurons incubated in FITC-labeled IB4 10 minutes prior
to current clamp recording. The passive electrophysio-
logical properties of the neurons in this dataset were
analyzed with a two way ANOVA where IB4 binding
and inflammation were the main factors. This analysis
revealed a significant (p <0.01, Table 1) influence of
inflammation on membrane capacitance which was
increased in cutaneous neurons from inflamed rats.
There was also a significant interaction between inflam-
mation and IB4 binding with respect to resting mem-
brane potential where post-hoc analysis indicated that
the difference between IB4+ and IB4- neurons in the
inflamed group was significant (p = 0.03, Table 1), and
the difference between IB4- neurons from the naïve
and inflamed groups was also significant (p <0.05,
Table 1 ) .
Results of the analysis of the excitability data indicated
that there were not only differences between IB4+ and
IB4- neurons with respect to baseline excitability, but
the changes in excitability 3 days after the induction of
inflammation. That is, while the IB4- neurons from
naïve rats were more excitable than IB4+ neurons, there
were no detectable inflammation-induced changes in the
excitability of IB4- neurons: action potential threshold
was −35.8 ± 2.3 mV (n = 13) in neurons from naïve rats
Table 1 Passive Properties of Cutaneous Neurons
Manipulation IB4 N V
rest
(mV)†R
in
(MΩ) Capacitance (pF){
Naïve + 10 -62 ± 2.5 601 ± 199 32 ± 2.8
- 13 -59 ± 2.2 436 ± 220 31 ± 2.7
CFA + 9 -59 ± 1.6 800 ± 138 42 ± 1.8
- 23 -66 ± 2.7 640 ± 220 41 ± 3.0
†Interaction between Manipulation and IB4 binding is significant with p = 0.03.
{The impact of Manipulation (inflammation) is significant with p <0.01.
V
rest
is resting membrane potential. R
in
is input resistance. CFA is complete
Freund’s adjuvant.
Zhang et al. Molecular Pain 2012, 8:37 Page 2 of 12
http://www.molecularpain.com/content/8/1/37
and −29.0 ± 2.8 mV (p >0.05, n = 9) in neurons from
inflamed rats; rheobase was 4.2 ± 1.4 pA/pF and 6.9 ± 1.6
pA/pF (p >0.05) in neurons from naïve and inflamed
rats, respectively; and the slope of the stimulus response
function to suprathreshold current injection was
0.52 ± 0.4 and 0.51 ± 0.5 (p >0.05) in neurons from naïve
and inflamed rats, respectively. In contrast, there was a
significant increase in the excitability of IB4+ neurons
with a significant decrease in action potential threshold
(Figure 1A), decrease in rheobase (Figure 1B), and in-
crease in the response to suprathreshold current injec-
tion (Figure 1C and D). Because persistent changes in
excitability appeared to be restricted to IB4+ neurons,
we focused on IB4+ neurons for the remainder of the
study. As there were no significant differences between
IB4+ neurons from naïve and inflamed rats with respect
to resting membrane potential or input resistance
(Table 1) and the increase in membrane capacitance,
would work to attenuate excitability, we next assessed
active electrophysiological properties to begin to identify
mechanisms that may have contributed to the inflamma-
tion-induced increase in the excitability of IB4+ neurons.
Of the active properties assessed, the action potential
duration was the only property that was significant dif-
ferent between groups, and it was significantly longer in
neurons from inflamed rats (Figure 1E, p <0.01). There
was also a trend toward an increase in the decay rate of
the afterhyperpolarization (AHP) (Figure 1F, p = 0.06) in
cutaneous neurons from inflamed rats. Given the role of
K
+
currents in both the action potential duration and
the afterhyperpolarization (AHP), these changes in active
electrophysiological properties are consistent with a de-
crease in a K
+
current.
Inflammation has no detectable influence on Kv currents
in cutaneous DRG neurons
To determine whether a decrease in voltage-gated K
+
(Kv) current contributed to the increase in excitability of
cutaneous IB4+ neurons, we assessed the biophysical
properties of Kv currents in cutaneous neurons from
99.6 22.3ms
46.3 15.1ms
5 mV
100 ms
4.4 0.7 ms
9.1 1.4 ms**
20 mV
10 ms
APs / 750 ms
AP Threshold (mV)
Naïve CFA
Rheobase (pA/pF)
Naïve CFA
Naïve CFA
1x
2x
3x
BDCA
FE
**
**
-40
-35
-30
-25
-20
0
4
8
12
Stimulus Intensity
(x Rheobase)
1x 2x 3x
1
3
5
7
Naïve IB4+ (n = 10)
CFA IB4+ (n = 23)
Naïve CFA
Slope of SRF
0.0
1.0
2.0
3.0 **
40 mV
200 ms
Figure 1 Persistent inflammation of the hindpaw results in an increase in the excitability of cutaneous neurons that is associated with
an increase in action potential duration. Excitability was assessed in acutely dissociated DRG neurons retrogradely labeled from the glabrous
skin of the hindpaw harvested from naïve and inflamed (CFA) rats. Depolarizing current injection was used to determine action potential (AP)
threshold (A), rheobase (B) and the response to suprethreshold current injection (C, D), which was injected at intensities 1, 2, and 3 times
rheobase. The voltage traces in C, are typical of the pooled data plotted in D. As indicated in D, pooled data for all panels are from 10 neurons
from naïve and 23 neurons from inflamed rats. The number of action potentials evoked at 2 and 3x rheobase in neurons from inflamed rats is
significantly greater than that in neurons from naïve rats. Error bars for data from naïve neurons are smaller than the symbol. Inset: The slope of
the stimulus response function (SRF) is significantly greater for neurons from inflamed rats than that for neurons from naïve rats. E. Typical action
potentials from naïve (black trace) and inflamed (gray trace) rats evoked in response to a 4 ms current injection are overlayed with the average
action potential duration indicated for each. These values are significantly different (p <0.05). F. The afterhyperpolarization (AHP) following the
action potentials shown in E are plotted to illustrate the trend toward a decrease in the AHP duration in neurons from inflamed rats. The full
amplitude of the action potential is clipped in these traces to facilitate visualization of the AHP. Average values are indicated next to each trace,
and these differences are significantly different. * is p <0.05 and ** is p <0.01.
Zhang et al. Molecular Pain 2012, 8:37 Page 3 of 12
http://www.molecularpain.com/content/8/1/37
inflamed and naïve rats. Kv currents were recorded in
Ca
2+
free bath solution containing 2.5 mM Co
2+
to elim-
inate contribution from BK
Ca
channels. Based on previ-
ous data indicating that there are Kv currents both
subject, and resistant, to steady-state inactivation [16],
we first assessed steady-state inactivation of Kv currents
in each neuron studied (Figure 2A, B). With this proto-
col, it was possible to determine the total current avail-
able for activation, as well as the fractions of total
current subject to (inactivatable), or resistant to (non-
inactivatable), steady-state inactivation. There was no
detectable influence of inflammation on either the
voltage-dependence of steady of inactivation or the frac-
tion of current resistant to steady-state inactivation
(Figure 2B, Table 2). Nor was there a detectable influ-
ence of inflammation on the voltage-dependence of
current activation (Figure 2B). Furthermore, analysis of
the peak current density of the total (not shown), inactiva-
table (Figure 2C) and non-inactivatable (Figure 2D)
current in cutaneous neurons from naïve rats as well as
both ipsilateral and contralateral to the site of inflamma-
tion revealed no significant differences between groups
(p >0.05). Finally, there were no significant differences be-
tween cutaneous neurons from naïve and inflamed rats
Current Density
@ +60 mV (pA/pF)
200
100
0
Naïve
(n = 66)
CFA
Contra
(n = 27)
CFA
Ipsi
(n = 34)
Non-Inactivatable
-120
10 20
-100
-60
-a
-c
-b
V (mV)
-100 -60 -20 20 60
I / Imax
0.0
0.2
0.4
0.6
0.8
1.0
G / Gmax
0.0
0.2
0.4
0.6
0.8
1.0
Naïve (n = 41)
CFA (n = 31)
80
40
0
120
Naïve
(n = 66)
CFA
Contra
(n = 27)
CFA
Ipsi
(n = 34)
Inactivatable
Current Density
@ +60 mV (pA/pF)
BA
DC
2 nA
10 ms
Figure 2 There is no detectable influence of inflammation on voltage-gated K
+
(Kv) currents in cutaneous DRG neurons. A. Typical Kv
currents evoked in a cutaneous DRG neuron from a naïve rat with the inactivation protocol shown below the current traces. A significant fraction
of total current (a) was subject to steady-state inactivation (b, inactivatable), leaving a sustained, non-inactivatable current (c). The potential at
which steady-state inactivation was complete was used as the prepulse potential with which inactivatable current was separated from non-
inactivatable current. B. The voltage-dependence of total Kv current activation, determined from conductance-voltage (GV) plots, was comparable
in neurons from naïve and inflamed (CFA) rats. Similarly, the steady-state inactivation curves from these two groups of neurons were also
comparable. Complete data sets were only collected on a subpopulation of the total number of neurons studied. C. The current density (peak
current at +60 mV) of the inactivatable fraction of the total current was comparable in neurons from naïve and inflamed (CFA) rats, whether data
were collected from neurons contralateral (CFA Contra) or ipsilateral (CFA Ipsi) to the site of inflammation. D. Similar results were obtained with
the analysis of current density of the non-inactivatable fraction of the total Kv current in cutaneous DRG neurons.
Table 2 Kv Current Properties
Group N Cap (pF) Imax (pA/pF) Slope (pA-mV) V0.5 (mV) a
Naïve 66 (7) 40 ± 1.8 166 ± 10.7 8.3 ± 0.5 -65 ± 1.0 28 ± 1.7
CFA –Contra. 27 (7) 41 ± 3.4 161 ± 14.6 11.5 ± 1.4 -65 ± 1.9 27 ± 2.4
CFA –Ipsi. 34 (7) 44 ± 2.4 160 ± 17.3 9.5 ± 1.0 -67 ± 1.7 24 ± 3.6
N is the number of neurons studied with the number of animals indicated in parenthesis. Cap is capacitance. Imax is maximal current estimated from steady-state
inactivation data fitted with a Boltzmann function. Slope, V0.5 and a are parameters determined from the same Boltzmann function where Slope is the slope
of the I-V curve, V0.5 is the potential at which half of the inactivatable current is inactivated, and “a”is the percentage of total current resistant to steady
state inactivation.
Zhang et al. Molecular Pain 2012, 8:37 Page 4 of 12
http://www.molecularpain.com/content/8/1/37
with respect to the rate of Kv current activation, inactiva-
tion, or deactivation (data not shown). Despite evidence
for inflammation-induced changes in Kv current in other
populations of neurons [9], results of this series of experi-
ments suggest that this is not the case for cutaneous
neurons.
Inflammation results in a decrease in BK
Ca
currents in
cutaneous DRG neurons
Based on evidence that large conductance Ca
2+
-modu-
lated K
+
(BK
Ca
) currents contribute to action potential
duration as well as the decay of the AHP [7,8,17], as well
as evidence that inflammation results in a decrease in
high threshold voltage-gated Ca
2+
channels in cutaneous
DRG neurons, we next assessed the impact of inflamma-
tion on BK
Ca
currents in cutaneous neurons. Iberiotoxin
(IbTx, 100 nM) or paxilline (10 μM) were used to isolate
BK
Ca
currents from the total current evoked in IB4+ cu-
taneous neurons from naïve and inflamed rats (Figure 3).
The IbTx sensitive current was significantly smaller in
cutaneous neurons from inflamed rats than from naïve
rats (Figure 3), at voltage steps to potentials ≥−10 mV.
Comparable results were obtained with paxilline, where
peak paxilline sensitive current in IB4+ neurons from
naïve rats (153.3 ± 28.07 pA/pF, n = 17) was significantly
(p <0.01) larger than that in cutaneous neurons from
inflamed rats (49.5 ± 18.04 pA/pF, n = 10).
As previously described [8], BK
Ca
currents in cutane-
ous neurons from naïve rats were in general, rapidly ac-
tivating, with a variable degree of inactivation during
sustained depolarization (Figure 4A). BK
Ca
currents
evoked in neurons from inflamed rats appeared to acti-
vate more slowly and demonstrated little, if any detect-
able inactivation during a 500 ms depolarizing voltage
step (Figure 4B). Consistent with this impression, the
average time constant for IbTx sensitive current activa-
tion was significantly larger in neurons from inflamed
rats than in neurons from naïve rats (Figure 4C, D).
Comparable results were obtained with paxilline. Deacti-
vation of toxin sensitive currents was assessed with a tail
current protocol evoked before and after toxin applica-
tion (Figure 4E inset). While there was no influence of
inflammation on the deactivation of IbTx sensitive cur-
rents, paxilline sensitive currents in cutaneous neurons
from inflamed rats deactivated significantly more slowly
than those from naïve rats (Figure 4E, F).
Inflammation was associated with no detectable change
in BK
Ca
channel subunits expression
While the decrease in high threshold voltage-gated Ca
2+
current previously described [6] could be sufficient to
account for the inflammation-induced decrease in BK
Ca
current density, two experiments were performed to
begin to assess the possibility that a decrease in channel
protein also contributed to the decrease in current. The
first was a real time PCR analysis of BK
Ca
subunit
mRNA levels in L4/5 ganglia. GAPDH was used as an
internal comparator as Ct values for amplification of
GAPDH were comparable for ganglia from naïve
(17.0 ± 0.2, n = 4) and inflamed (17.5 ± 0.3, n = 4) rats. No
significant changes in mRNA levels were detected for ei-
ther total αsubunit or a splice variant of the αsubunit
containing the STREX insert, nor were there significant
changes detected in mRNA levels for β2, 3 or 4: values
for 2
ΔΔCt
were all close to 1.
Inflammation was associated with no detectable change
in total protein levels of BK
Ca
channel subunits
Given evidence for inflammation-induced changes in
protein in the absence of detectable changes in mRNA
[18], the second experiment was to assess changes in
BK
Ca
subunit protein levels. Total protein from L4 and
L5 ganglia from naïve (n = 4) and inflamed (n = 5) rats
was recovered, processed for Western blot analysis, and
probed with antibodies specific to the αand β2-4 BK
Ca
Membrane Potential (mV)
Current Density (pA/pF)
100
80
60
40
20
0
80400
-80 -40
CFA (n = 32)
Naïve (n = 32)
20 nA
100 ms
Total +IbTx
-100mV
+60mV
B
A
**
Total-IbTx
Figure 3 Inflammation is associated with a significant decrease
in BK
Ca
currents in cutaneous DRG neurons. A. Outward currents
were evoked before (Total) and after the application of iberiotoxin
(IbTx, 100 nM), with the voltage protocol shown below the Total
current traces. The toxin sensitive current (the bottom set of current
traces) was obtained by digitally subtracting current evoked in the
presence of IbTx from that evoked prior to its application. B. Pooled
current voltage (I-V) data from cutaneous neurons from naïve and
inflamed (CFA) rats highlight the significant decrease in BK
Ca
current
density in neurons from inflamed rats. Note, pooled data are only
from neurons in which BK
Ca
current was detectable (>200 pA at
+60 mV). ** is p <0.01.
Zhang et al. Molecular Pain 2012, 8:37 Page 5 of 12
http://www.molecularpain.com/content/8/1/37
channel subunits. The multiple bands present in the
blots of the αsubunit are consistent with the results of
our previous PCR analysis of the BK
Ca
channel in DRG
which indicated that a number of splice variants of the α
subunit are expressed [8]. Nevertheless, there was no de-
tectable influence of inflammation on relative BK
Ca
sub-
unit protein levels (Figure 5).
Inflammation was associated with a change in the pattern
of expression of BK
Ca
α-subunit splice variants
and β-subunits
In our previous analysis of BK
Ca
currents in cutaneous
DRG neurons, we noted the presence of considerable
heterogeneity in the biophysical properties of currents
between neurons, with variability in the rate of current
activation as well as in the rate and extent of current
inactivation [8]. In neurons from inflamed rats, the cur-
rents were considerably more homogeneous with prop-
erties similar to those illustrated in Figure 3. Given the
influence of both splice variants in the α-subunit [19],
and β-subunits [20] on the biophysical properties of
BK
Ca
currents, this change raised the possibility that the
changes in biophysical properties were due to changes in
the subunit expression pattern. Subunit expression in
cutaneous neurons was assessed with single cell RT-PCR
(Figure 6). Results of this analysis indicated that there
was a significant increase in the proportion of neurons
in which all 4 splice variants (Figure 6, zero insert, as
well as all 3 higher molecular weight species) were
detected at the X4 splice site. This site corresponds to
the stress-axis regulated exon (STREX) site previously
described by others [20]. There was also a significant
500 pA
10 ms
CFA
Naïve
Tau Activation (ms)
AFCevïaN
10 nA
100 ms
5 nA
100 ms
BA
DC
Naïve
(19)
CFA
(15)
Naïve
(9)
CFA
(7)
**
**
0
5
10
15
20
25
30
0
2
4
6
Tau Deactivation (ms)
Naïve
(19)
CFA
(15)
Naïve
(9)
CFA
(7)
100 pA
10 ms
Naïve
CFA
2 nA
20 ms
**
FE
IbTx Paxilline
IbTxa Paxilline
Figure 4 The biophysical properties of BK
Ca
currents are altered in neurons from inflamed rats. BK
Ca
currents from naïve (A) and inflamed
(B, CFA) rats were isolated as described in Figure 3. C. To illustrate differences in the rate of current activation, current evoked at +30 mV in the
traces shown in A and B have been scaled relative to peak current and overlaid. The time constant for current activation was used to quantify the
rise time. D. Pooled data indicate that this difference in activation rate is significant for currents isolated with IbTx and paxilline. E. Deactivation
rate was determined from tail currents evoked at −90 mV following BK
Ca
current activation at +30 mV. While there was no apparent difference in
the deactivation rate of currents isolated with IbTx between naïve and inflamed neurons (not shown), currents isolated with paxilline appeared to
deactivate more slowly in neurons from inflamed rats. Inset: example of IbTx sensitive tail currents used to assess deactivation rate. F. Pooled
deactivation rate data (at -90 mV) for BK
Ca
currents isolated with IbTx and paxilline from naive and inflamed rats. ** is p<0.01.
Zhang et al. Molecular Pain 2012, 8:37 Page 6 of 12
http://www.molecularpain.com/content/8/1/37
decrease in the proportion of neurons in which β2 and
β3 subunits were detected.
Discussion
Summary of major findings
Consistent with previous studies, persistent inflamma-
tion results in an increase in the excitability of sensory
neurons innervating the site of inflammation that is de-
tectable in acutely isolated sensory neurons. This in-
crease in excitability was restricted to the IB4+
subpopulation of neurons and was associated with a sig-
nificant increase in action potential duration with no
additional changes in any other passive or active electro-
physiological property. These changes in excitability and
BA
Naïve CFA Naïve CFA Naïve CFA
0.0
1.0
2.0
3.0
BK / GAPDH
Naïve
(n = 4)
CFA
Contra
(n = 5)
BK / GAPDH
0
2
4
6
8
CFA
Ipsi
(n = 5)
10
1234
150
100
50
37
Naïve CFA
IC U
ICICIC
kDa
BKα
GAPDH
U
C
IICIC I C
kDa
50
37
25
20
25
20
Naïve CFA
67 89
β2
β3
β4
50
37 GAPDH
DC
β2
(n = 4)
β3
(n = 5)
β4
(n = 5)
Figure 5 Inflammation was associated with no detectable change in total BK
Ca
channel subunit protein levels. Total protein was
extracted from L4 and L5 ganglia from naïve and inflamed rats ipsilateral (I) or contralateral (C) to the site of CFA injection. A. Example of a
western blot of the BK
Ca
αsubunit. A sample of total protein from the uterus of a naïve rat was used as a loading control to enable comparisons
between blots. Ispilateral and contralateral in the naïve rats were simply left and right, respectively, as all CFA injections in the inflamed group
were made in the left hindpaw. GAPDH was used as a loading control. B. Example of western blots for BK
Ca
βsubunits 2, 3, and 4. The uterus
protein sample was again used to enable comparisons between blots. Pooled data for relative levels of α(C), and β(D) subunit revealed no
significant differences between groups.
100
300
400
100
300
400
Naïve
CFA
X4 Insert
% of Neurons
110bp 160 bp 275 bp
0
20
40
60
80
100
Naïve (n = 4)
CFA (n = 3)
Naïve (n = 4)
CFA (n =4)
β1β2β3β4
CBA
0
20
40
60
80
% of Neurons
Figure 6 Inflammation-induced changes in the pattern of BK
Ca
α-subunit splice variant and βsubunit expression. A. Example of splice
variants at the X4 site of the BK
Ca
αsubunit detected in mRNA harvested from single cutaneous DRG neurons. Each lane is the PCR product from
a single neuron. The “zero insert”bottom band is dominant in all neurons. However, the larger inserts were more common in neurons from
inflamed (CFA) than naïve rats. B. Pooled data for the expression of splice variants at the X4 site from 4 naïve and 4 inflamed rats were analyzed
with a two-way ANOVA, which revealed a significant influence of inflammation (p <0.05), but no interaction between inflammation and splice
variant. C. Pooled data for βsubunit expression from 4 naïve and 4 inflamed rats was also analyzed with a two-way ANOVA, which also revealed
a significant influence of inflammation (p <0.05), but no interaction between inflammation and subunit expression.
Zhang et al. Molecular Pain 2012, 8:37 Page 7 of 12
http://www.molecularpain.com/content/8/1/37
action potential waveform were not associated with any
detectable change in Kv current. However, they were
associated with a significant decrease in IbTx- and paxil-
line-sensitive current. This decrease in current was not
associated with a change in total BK
Ca
subunit mRNA
or protein as assessed at the whole ganglion level. Fur-
thermore, the decrease in IbTx-and paxilline-sensitive
current was associated with changes in the biophysical
properties of the current as well as changes in the pat-
tern of splice variant expression of the BK
Ca
channel α
subunit and a decrease in the proportion of neurons in
which the β2 and 3 subunits were detected. These
results are consistent with the suggestion that a decrease
in BK
Ca
current contributes to the inflammation-
induced sensitization of cutaneous afferents.
The pattern of changes in excitability observed in cu-
taneous neurons were comparable to patterns observed
in afferents innervating other target tissue including
muscle [9], joint [21] and bladder [11]. However, there
appear to be subtle, yet potentially important differences
in the associated changes in passive and active electro-
physiological properties. For example, the only signifi-
cant change in the passive or active electrophysiological
properties associated with the inflammation-induced
sensitization of temporomandibular joint afferents is a
decrease in the duration of the AHP [21], while in blad-
der afferents, there is an increase in membrane capaci-
tance with no change in action potential duration [11].
Because passive and active properties reflect the actions
of ion channels, these differences suggest differences in
underlying ionic mechanisms. These differences also
highlight the fact that comparable increases in excitabil-
ity can be achieved through a number of different
mechanisms.
Persistent inflammation has no detectable influence on
Kv currents in cutaneous neurons
Changes in passive and active electrophysiological prop-
erties assessed in current clamp can be used to predict
the ion channels that contribute to the inflammation-
induced increase in excitability. For example, the ab-
sence of a detectable change in V
rest
or R
in
argues
against a channel active at the resting membrane poten-
tial such as the Cl
-
conductance activated by inflamma-
tory mediators we recently described in dural afferents
[22]. Similarly, the increase in action potential duration
and trend toward a decrease in duration of the AHP in
association with a decrease in rheobase and action po-
tential threshold are consistent with a decrease in a K
+
current activated with membrane depolarization that
contributes to membrane repolarization on the falling
phase of the action potential as well as the duration of
the AHP. However, in contrast to masseter muscle [9]
and bladder [9] afferents, where an inflammation-
induced decrease in Kv current subject to steady-state
inactivation was readily detectable, no changes in Kv
currents were detected in cutaneous neurons. These
results suggest that a decrease in a Ca
2+
dependent K
+
current is likely to contribute to the inflammation-
induced increase in the excitability of cutaneous
neurons.
Persistent inflammation is associated with a reduction in
BK
Ca
currents in cutaneous neurons
Consistent with the prediction based on the negative
results obtained with Kv currents, we observed signifi-
cant decrease in IbTx and paxilline sensitive current.
The observation that the paxilline sensitive currents
were larger than the IbTx sensitive currents is consistent
with our single cell PCR data suggesting that the β4 sub-
unit is present in the majority of IB4+ cutaneous neu-
rons and previous data suggesting that the β4 subunit
confers resistance to IbTx [23] but not paxilline [24]. It
is important to point out that a decrease in BK
Ca
current
was not necessarily a foregone conclusion. That is, in
addition to the inflammation-induced decrease in volt-
age-gated Ca
2+
currents recently described in cutaneous
neurons [6], there is also an inflammation-induced in-
crease in the magnitude and decrease in the decay of the
depolarization-evoked increase in the concentration of
intracellular Ca
2+
([Ca
2+
]
i
) in cutaneous neurons [5].
BK
Ca
channels coupled to the latter process would have
resulted in an increase in channel activity and a decrease
in excitability [17]. However, the observed decrease in
BK
Ca
current suggests that the activation of these chan-
nels in cutaneous afferents is tightly coupled to an in-
crease in intracellular Ca
2+
mediated via Ca
2+
influx
through voltage-gated Ca
2+
channels. Consistent with
this suggestion is the observation that a decrease in high
threshold Ca
2+
current alone is sufficient to increase ex-
citability, at least in a subpopulation of cutaneous affer-
ents [8]. The observation that BK
Ca
channels are largely
restricted to IB4+ small diameter cutaneous neurons [8]
is also consistent with this suggestion given the observa-
tion that the inflammation-induced increase in excitabil-
ity was restricted to this subpopulation of neurons
despite our previous observation that the inflammation-
induced decrease in voltage-gated Ca
2+
currents is de-
tectable in both IB4+ and IB4- neurons [6].
The absence of a detectable inflammation-induced
change in BK
Ca
channel subunit mRNA or protein at the
whole ganglia level is also consistent with the suggestion
that the decrease in BK
Ca
current was largely secondary
to the decrease in voltage-gated Ca
2+
current rather than
a decrease in BK
Ca
channels. This suggestion is made
with caution, however, given that afferents innervating
the site of inflammation constitute far less than half of
the neurons in L4 and L5 ganglia and as a result, a
Zhang et al. Molecular Pain 2012, 8:37 Page 8 of 12
http://www.molecularpain.com/content/8/1/37
decrease in mRNA or protein in a subpopulation of
these neurons may not have been detectable.
Changes in BK
Ca
subunit expression are associated with
inflammation-induced changes in the biophysical
properties of BK
Ca
currents in cutaneous neurons
Changes in the biophysical properties of the BK
Ca
cur-
rents in neurons from inflamed rats suggest that a de-
crease in high threshold voltage-gated Ca
2+
current
alone is insufficient to account for all of the changes in
BK
Ca
currents. At least some of the changes in biophys-
ical properties appear to reflect changes in the pattern of
BK
Ca
channel subunit expression. That is, β3 subunits
confer rapid channel activation, and β2 confers both
rapid channel activation and channel inactivation [20].
Thus, a decrease in the number of cutaneous neurons in
which these subunits were detected is consistent with
the more slowly activating persistent currents observed
in neurons from inflamed animals. However, at least two
of the inserts at the X4 site of the BK
Ca
αsubunit result
in a dramatic leftward shift in the voltage-dependence of
channel activation [19], an increase in the rate of chan-
nel activation as well as a decrease in the rate of channel
deactivation. The decrease in rate of paxilline-sensitive,
but not IbTx-sensitive current deactivation suggests
there may be preferential assembly of channels with an
X4 insert in the α-subunit and a β4 subunit (resulting in
a channel with a slower deactivation rate that is resistant
to IbTx), but additional biochemical data would be
needed to confirm this prediction. Several possibilities
could account for the failure to detect a larger influence
of the splice variants on the whole cell current. These
include: 1) that the larger αsubunit transcripts are not
translated as efficiently, 2) that the larger αsubunits are
not assembled in inflamed neurons, or 3) that the traf-
ficking of these larger channels is also altered such that
they are targeted to other parts of the afferent than the
cell soma. These latter two possibilities are predicated
on the assumption that at least some of the variability in
biophysical properties of BK
Ca
currents observed in neu-
rons from naïve animals [8] is due to the presence of
splice variants of the αsubunit.
Conclusions
A decrease in K
+
current is a general mechanism found
throughout the nervous system to increase in neuronal
excitability. The ubiquity of this mechanism begs the
question as to why there should be diversity in the spe-
cific channels that are reduced in primary afferent neu-
rons as a function of the target of innervation and or the
type of injury [1]. It is certainly possible that because the
mediators such as prostaglandin E2, TNFαand nerve
growth factor, that drive the changes in K
+
channels
have specific intracellular targets, and that different K
+
currents are suppressed in different populations of affer-
ents because the pattern of mediators varies with target
of innervation and type of injury. This possibility does
not account for the fact that the net result in each case
is an increase in excitability. Given the impact of subtle
differences in K
+
channels properties on spiking behav-
ior, the primary impact of this diversity is likely to be net
differences in neuronal activity with some channels
favoring one type of output such as sustained or burst-
ing activity, whereas other channels favoring irregular
activity. Of course the context in which these changes
take place will also be critical for the net change in out-
put [25], where the biophysical properties, density and
distribution of other ion channels in the neuron will also
impact the net change in afferent output. Minimally, this
level of diversity serves as a reminder as to why it has
been so difficult to identify more effective therapeutics
for the treatment of pain devoid of deleterious conse-
quences. This is also additional support for the sugges-
tion that the most effective therapeutic interventions
may ultimately need to be tailored to the specific site
and type of injury.
Methods
Adult male Sprague–Dawley rats (Harlan Sprague Dawley,
Indianapolis IN) were used for all experiments. Rats
were housed in an AAALAC approved animal facility
with a 12:12 light/dark cycle (lights off at 7 PM) with
food and water available ad libitum. All procedures were
approved by the University of Pittsburgh Institutional
Animal Care and Use Committee and performed in
according with the recommendations of the National
Institutes of Health and the Committee for Research and
Ethical Issues of the International Association for the
Study of Pain. All efforts were employed to minimize the
number of animals used in this study.
Retrograde labeling and inflammation
Cutaneous afferents were retrogradely labeled with DiI
as previously described [5,8]. Briefly, rats were anesthe-
tized with isofluorane and 10 μl of 1,1’-dioctadecyl-
3,3,3’,3’-tetramethylindocarbocyanine perchlorate (DiI,
Invitrogen, Carlsbad CA, 17 mg/ml in saline diluted
from a stock of 170 mg/ml in DMSO) was injected at 3–
5 sites (with 1.5 - 2 μl per site) with a 30 g needle direc-
ted into the epidermis. Rats were studied 14 to 17 days
post DiI injection. Inflammation was induced in a sub-
group of rats with a 100 μl subcutaneous injection of
complete Freund’s adjuvant (CFA, mixed 1:1 in saline)
into the same site previously labeled with DiI. This injec-
tion was also made under isofluorane-induced
anesthesia. This group of rats was studied 3 days after
CFA injection.
Zhang et al. Molecular Pain 2012, 8:37 Page 9 of 12
http://www.molecularpain.com/content/8/1/37
Preparation of isolated cutaneous neurons
Acutely dissociated cutaneous neurons were obtained as
previously described [5,8]. Briefly, rats were deeply
anesthetized with 1 ml/kg rat cocktail (55 mg/ml keta-
mine, 5.5 mg/ml xylazine and 1.1 mg/ml acepromazine)
and L4 and L5 dorsal root ganglion (DRG) were har-
vested, enzymatically treated, mechanically dissociated
and plated onto laminin-ornithine coated cover slips.
After 2 hrs of incubation at 37°C/3% CO
2
, cover-slips
were flooded with HEPES buffered L-15 media and
stored at room temperature during the period of record-
ing (<8 hrs after removal from the animal).
Patch clamp recording
Isolated cutaneous neurons were studied with conven-
tional whole-cell and perforated patch configurations
with an Axopatch 200B (Medical Devices Sunnyvale CA)
controlled with pClamp (v 8.2, Molecular Devices) or a
HEKA EPC9 amplifier (HEKA Electronik, Lambrecht/
Pfalz Germany) controlled with Pulse software (V8.8,
HEKA). The conventional whole cell configuration was
used for current clamp recording and for voltage-clamp
analysis of Kv currents while the perforated patch con-
figuration was used for the analysis of BK
Ca
currents.
For current clamp recording, the bath solution con-
tained (in mM): NaCl, 130; KCl, 5; CaCl
2
, 2.5; MgCl
2
,
0.6; HEPES, 5; and glucose, 10; pH adjusted to 7.4 with
Tris-Base, and osmolality adjusted to 320 mOsm with
sucrose. For voltage-clamp recording of Ca
2+
dependent
K
+
currents, NaCl was replaced with choline-Cl to elim-
inate voltage-gated Na
+
currents. This same solution was
used for voltage clamp recording of voltage-gated K
+
currents, except that CaCl
2
was replaced with CoCl
2
to
eliminate voltage-gated Ca
2+
currents. The electrode
solution used for current clamp and to record voltage-
gated K
+
currents contained (in mM): KCl, 30; K-
methanesulfonate (MES), 110; MgCl
2
,1; CaCl
2
, 0.1;
EGTA, 1; HEPES, 10; ATP-Mg, 2; GTP, 1; pH adjusted
to 7.2 with Tris-Base, and osmolality adjusted to
310 mOsm with sucrose. The electrode solution used for
perforated patch clamp recordings contained (in mM):
KCl, 30; K-MES, 110; MgCl
2
, 1; HEPES, 10; EGTA, 0.1;
pH adjusted to 7.2 with Trisbase, and osmolality adjusted
to 310 mOsm with sucrose. Amphotericin B, used to ob-
tain whole cell access for perforated patch recording,
stock solution was prepared in DMSO (90 mg/ml) then
diluted to a final concentration (600 μg/ml) in electrode
solution immediately prior to use. All salts used for elec-
trophysiology were obtained from Sigma-Aldrich (St
Louis MO).
Semi-quantitative RT-PCR (sqRT-PCR)
Dorsal root ganglia (DRG) from anesthetized male rats
were harvested in a manner identical to that used for
neuron isolation and plating. mRNA was extracted and
cDNA synthesis performed as previously described [6], ex-
cept that that random hexomers were used to prime the re-
verse transcription reaction. SYBR Green was used to
monitor amplification of template with primers on a real-
time thermal cycler (Life Technologies, Grand Island NY)
controlled by a PC running Prism 7000 SDS software. A
melting curve was generated at the end of each experiment
to assess for the presence of contamination. Amplification
efficiency was determined for each target gene. The ΔΔCT
method was used to assess differences in relative expression
levels. Primers for amplification of the core BK
Ca
αsubunit
were: F - TGTCATGATGACGTCACAGATCC, R -TTTT
TTTGGTGACAGTGTTGGC; those for amplification of
the BK
Ca
αsubunit with the STREX insert were: F -
AGCCGAGCATGTTGTTTTGAT, R- ACGCACACGGC
CTGACA; while those for GAPDH were: F - GGCCTAC
ATGGCCTCCAA, R -TGGAATTGTGAGGGAGATGCT.
Commercially available primer sets were used for the amp-
lification of β2,3and4(Qiagen).
Single cell PCR
Single cell PCR was performed as previously described
[26]. Because perforated patch recording is relatively
slow and many neurons are needed from a single animal
to obtain a reasonable estimate of the proportion of neu-
rons from a single animal, a different set of neurons was
used for single cell PCR analysis. Following identification
of cutaneous neurons under epifluorescence illumina-
tions, neurons were collected with large bore (~30 μm)
glass pipettes and expelled into microcentrifuge tubes
containing reverse transcriptase (RT) mix. RT-PCR was
performed as described previously [26] utilizing an
anchored primer (5’-ttttttttttttttttttvn-3’;v=a,c,org;
n = a, c, g, or t, from Life Technologies) for the RT reac-
tion and a nested PCR amplification strategy for the PCR
reaction. rslo primer sequences were identical to those
described previously [8]. For each cell preparation, at
least two tubes were run in which no cell was collected
(although the electrode was manipulated in a manner
identical to that used for cell collection) and at least two
additional tubes were run in which no reverse transcript-
ase was added to the RT mix prior to the RT reaction.
Cyclophillin (0.5 μl of cDNA) was used to monitor the
success of the cell collection/RT reaction: only neurons
in which cyclophillin was detected were used for further
analysis. 5 μl of PCR products were loaded onto 2%
agorase/TAE gel.
Western Blot
DRG (L4/L5) were rapidly removed from deeply
anesthetized rats and homogenized in solubilization buf-
fer (50 mM Tris.HCl, pH8.0; 150 mM NaCl, 1 mM
EDTA, 1% NP40, 0.5% deoxycholic acid, 0.1% SDS,
Zhang et al. Molecular Pain 2012, 8:37 Page 10 of 12
http://www.molecularpain.com/content/8/1/37
1mMNa
3
VO
4
, 1 U/ml aprotinin, 20 μg/ml leupetin,
20 μg/ml pepstatin A). The homogenate was centri-
fuged at 20,000 X g for 10 min at 4°C. The supernatant
was removed. Protein (50–120 μg) was separated on a
7.5-10% SDS-PAGE gel and blotted to nitrocellulose
membrane (Amersham) with a Trans-Blot Transfer Cell
system (Bio-Rad). Blots were blocked with 5% milk in
TBS buffer (20 mM Tris, 150 mM NaCl pH 7.4) at room
temp for 1 hour. After decanting the blocking buffer, the
blots were incubated with primary antibodies. These
included: the αsubunit of the BK
Ca
channel (AKA slo1,
NeuroMab clone L6/60, NeuroMab, Davis CA: 1:200),
BK
Ca
β2 (NeuroMab clone N53/32: 1:200), BK
Ca
β3
(NeuroMab clone N40B/18: 1:200), BK
Ca
β4 (NeuroMab
clone L18A/3: 1:200), and GAPDH (sc-25778, Santa
Cruz Biotechnology: 1:1000). The specificity of all BK
Ca
subunit antibodies has been confirmed in heterologous
expression systems where there was no evidence of cross
reactivity with other BK
Ca
subunits or KV2.1. Mem-
branes were incubated with BK
Ca
subunit antibodies
overnight at 4°C, and GAPDH for 1 hour at room
temperature. Membranes were washed with TBS buffer
and incubated for 1 hour with anti-goat IgG horseradish
peroxidase (1:3000, Santa Cruz) in 5% milk/TBS. Mem-
branes were then washed with TBS buffer. The immunor-
eactivity was detected using Enhanced Chemiluminescence
(ECL, Amersham). Chemiluminescence was captured with
a CCD camera (Las-3000, Fujifilm) and analyzed with Fuji
software Multi Gauge. The relative protein levels were
obtained by comparing target protein to loading control
(GAPDH) in the same membrane.
Statistical analysis
Data are expressed as mean ± S.E.M unless otherwise
stated. Student’sttest, one- and two-way ANOVA with
the Holm-Sidak post hoc test were used for comparisons
of parametric data between groups. For single cell PCR
analysis, between 30 and 40 cutaneous neurons were
collected from each animal, although only 29 neurons
were collected for one of the 4 naïve animals used to as-
sess changes in α-subunit splice variants. The proportion
of the total number of neurons from each animal in
which a splice variant or β-subunit was detected was
used as the “statistic”for that animal, where the mean
proportion of expression in naïve animals was compared
to that in inflamed animals. Statistical significance was
assessed at p <0.05.
Abbreviations
AHP: Afterhyperpolarization; AP: Action potential; BK
Ca
: Iberiotoxin or paxilline
sensitive large conductance Ca
2+
modulated K
+
channel; CFA: Complete
Freund’s adjuvant; DRG: Dorsal root ganglion; IbTx: Iberiotoxin; Kv: Voltage-
gated K
+
current; PCR: Polymerase chain reaction; STREX: Stress axis
regulated exon.
Competing interests
None of the authors have either financial or non-financial competing
interests in relation to any of the material described in this manuscript.
Acknowledgements
The authors would like to thank Ms. Lei Zhang for help with Kv current
recording, Mr. Pathasarathy Kesavaramanujam for help with the real time
PCR experiments, and Ms. Nicole Scheff for helpful comments during the
preparation of this manuscript. This work was supported by NIH Grant NS
44992 (MSG).
Author details
1
Department of Anesthesiology, University of Pittsburgh, 3500 Terrace Street
Rm E1440 BST, Pittsburgh, PA 15213, USA.
2
Department of Neurobiology,
University of Pittsburgh, Pittsburgh, PA, USA.
3
Department of Medicine,
Division of Gastroenterology Hepatology and Nutrition, Pittsburgh, PA, USA.
4
Pittsburgh Center for Pain Research, University of Pittsburgh, Pittsburgh, PA,
USA.
5
Department of Biomedical Sciences, University of Maryland, Baltimore,
MD, USA.
Authors’contributions
XLZ carried out the electrophysiological studies and drafted the manuscript.
LM validated the strategy to detect multiple splice variants from a single cell
and carried out the molecular biological analysis. KYL contributed to the
electrophysiological analysis. MC carried out western blot analysis. MSG
conceived of the study, and participated in its design and coordination and
analysis and helped to draft the manuscript. All authors read and approved
the final manuscript.
Authors’information
Dr. Zhang is presently at the University of Pittsburgh in the Department of
Pharmacology, 200 Lothrop Street Room E1303 BST, Pittsburgh PA 15213.
Ms. Mok is presently at the Division of Biology, California Institute of
Technology, 1200 East California Boulevard, Pasadena, CA 91125. Mr
Charbonnet is presently at the Hayward Genetics Center, Tulane University
School of Medicine, 1430 Tulane Avenue, Box SL-31 New Orleans, LA, 70112.
Received: 12 October 2011 Accepted: 18 May 2012
Published: 18 May 2012
References
1. Gold MS, Gebhart GF: Nociceptor sensitization in pain pathogenesis. Nat
Med 2010, 16:1248–1257.
2. Djouhri L, Lawson SN: Increased conduction velocity of nociceptive
primary afferent neurons during unilateral hindlimb inflammation in the
anaesthetised guinea-pig. Neuroscience 2001, 102:669–679.
3. Djouhri L, Lawson SN: Changes in somatic action potential shape in
guinea-pig nociceptive primary afferent neurones during inflammation
in vivo. J Physiol (Lond) 1999, 520(Pt 2):565–576.
4. Katz EJ, Gold MS: Inflammatory hyperalgesia: a role for the C-fiber
sensory neuron cell body? J Pain 2006, 7:170–178.
5. Lu SG, Gold MS: Inflammation-induced increase in evoked calcium
transients in subpopulations of rat dorsal root ganglion neurons.
Neuroscience 2008, 153:279–288.
6. Lu SG, Zhang XL, Luo ZD, Gold MS: Persistent inflammation alters the
density and distribution of voltage-activated calcium channels in
subpopulations of rat cutaneous DRG neurons. Pain 2010, 151:633–643.
7. Scholz A, Gruss M, Vogel W: Properties and functions of calcium-activated
K + channels in small neurones of rat dorsal root ganglion studied in a
thin slice preparation. J Physiol 1998, 513(Pt 1):55–69.
8. Zhang XL, Mok LP, Katz EJ, Gold MS: BK(Ca) currents are enriched in a
subpopulation of adult rat cutaneous nociceptive dorsal root ganglion
neurons. Eur J Neurosci 2010, 31:450–462.
9. Harriott AM, Dessem D, Gold MS: Inflammation increases the excitability
of masseter muscle afferents. Neuroscience 2006, 141:433–442.
10. Beyak MJ, Ramji N, Krol KM, Kawaja MD, Vanner SJ: Two TTX-resistant
Na + currents in mouse colonic dorsal root ganglia neurons and their
role in colitis-induced hyperexcitability. Am J Physiol Gastrointest Liver
Physiol 2004, 287:G845–G855.
Zhang et al. Molecular Pain 2012, 8:37 Page 11 of 12
http://www.molecularpain.com/content/8/1/37
11. Yoshimura N, de Groat WC: Increased excitability of afferent neurons
innervating rat urinary bladder after chronic bladder inflammation. J
Neurosci 1999, 19:4644–4653.
12. Dang K, Bielefeldt K, Gebhart GF: Gastric ulcers reduce A-type potassium
currents in rat gastric sensory ganglion neurons. Am J Physiol Gastrointest
Liver Physiol 2004, 286:G573–G579.
13. Lawson SN: Phenotype and function of somatic primary afferent
nociceptive neurones with C-, Adelta- or Aalpha/beta-fibres. Exp Physiol
2002, 87:239–244.
14. Alvarez P, Gear RW, Green PG, Levine JD: IB4-saporin attenuates acute and
eliminates chronic muscle pain in the rat. Exp Neurol 2012, 233:859–865.
15. Joseph EK, Levine JD: Hyperalgesic priming is restricted to isolectin
B4-positive nociceptors. Neuroscience 2010, 169:431–435.
16. Gold MS, Shuster MJ, Levine JD: Characterization of six voltage-gated
K + currents in adult rat sensory neurons. J Neurophysiol 1996,
75:2629–2646.
17. Zhang XF, Gopalakrishnan M, Shieh CC: Modulation of action potential
firing by iberiotoxin and NS1619 in rat dorsal root ganglion neurons.
Neuroscience 2003, 122:1003–1011.
18. Ji RR, Samad TA, Jin SX, Schmoll R, Woolf CJ: p38 MAPK activation by NGF
inprimary sensory neurons after inflammation increases TRPV1 levels
and maintains heat hyperalgesia. Neuron 2002, 36:57–68.
19. Xie J, McCobb DP: Control of alternative splicing of potassium channels
by stress hormones. Science 1998, 280:443–446.
20. Brenner R, Jegla TJ, Wickenden A, Liu Y, Aldrich RW: Cloning and functional
characterization of novel large conductance calcium-activated potassium
channel beta subunits, hKCNMB3 and hKCNMB4. J Biol Chem 2000,
275:6453–6461.
21. Flake NM, Gold MS: Inflammation alters sodium currents and excitability
of temporomandibular joint afferents. Neurosci Lett 2005, 384:294–299.
22. Vaughn AH, Gold MS: Ionic mechanisms underlying inflammatory
mediator-induced sensitization of dural afferents. J Neurosci 2010,
30:7878–7888.
23. Meera P, Wallner M, Toro L: A neuronal beta subunit (KCNMB4) makes the
large conductance, voltage- and Ca2 + −activated K + channel resistant to
charybdotoxin and iberiotoxin. Proc Natl Acad Sci U S A 2000, 97: 5562–5567.
24. Hu H, Shao LR, Chavoshy S, Gu N, Trieb M, Behrens R, Laake P, Pongs O,
Knaus HG, Ottersen OP, Storm JF: Presynaptic Ca2 + −activated
K + channels in glutamatergic hippocampal terminals and their role in
spike repolarization and regulation of transmitter release. J Neurosci 2001,
21:9585–9597.
25. Rush AM, Dib-Hajj SD, Liu S, Cummins TR, Black JA, Waxman SG: A single
sodium channel mutation produces hyper- or hypoexcitability in
different types of neurons. Proc Natl Acad Sci U S A 2006, 103:8245–8250.
26. Hermanstyne TO, Markowitz K, Fan L, Gold MS: Mechanotransducers in rat
pulpalafferents. J Dent Res 2008, 87:834–838.
doi:10.1186/1744-8069-8-37
Cite this article as: Zhang et al.:Inflammation-induced changes in BK
Ca
currents in cutaneous dorsal root ganglion neurons from the adult rat.
Molecular Pain 2012 8:37.
Submit your next manuscript to BioMed Central
and take full advantage of:
• Convenient online submission
• Thorough peer review
• No space constraints or color figure charges
• Immediate publication on acceptance
• Inclusion in PubMed, CAS, Scopus and Google Scholar
• Research which is freely available for redistribution
Submit your manuscript at
www.biomedcentral.com/submit
Zhang et al. Molecular Pain 2012, 8:37 Page 12 of 12
http://www.molecularpain.com/content/8/1/37
