Phylogeographic study reveals new cryptic species Teratosphaeria pseudoeucalypti responsible for leaf blight of Eucalyptus in subtropical and tropical Australia.

Full text

Teratosphaeria pseudoeucalypti, new cryptic species
responsible for leaf blight of Eucalyptus in subtropical and
tropical Australia
V. Andjic
a
*, G. S. Pegg
b
, A. J. Carnegie
c
, A. Callister
d
, G. E. StJ Hardy
a
and T. I. Burgess
a
a
Biological Science, Murdoch University, South St, Murdoch 6150;
b
Tree Pathology Centre, The University of
Queensland ⁄Department of Primary Industries, Indooroopilly, Qld 4068;
c
Forest Resources Research NSW Department of Primary
Industries, PO Box 100, Beecroft, NSW 2119; and
d
Department of Forest and Ecosystem Science, The University of Melbourne,
Water St, Creswick, VIC, Australia
Sub-tropical and tropical plantations of Eucalyptus grandis hybrids in eastern Australia have been severely affected by ana-
morphs of Teratosphaeria (formerly Kirramyces) causing a serious leaf blight disease. Initially the causal organism in
Queensland, Australia, was identified as Teratosphaeria eucalypti, a known leaf parasite of endemic Eucalyptus spp. How-
ever, some inconsistencies in symptoms, damage and host range suggested that the pathogen in Queensland may be a new
species. Isolates of T. eucalypti from throughout its known endemic range, including Queensland and New Zealand, where
it is an exotic pathogen, were compared using multiple gene phylogenies. Phylogenetic studies revealed that the species
responsible for leaf blight in Queensland represents a new taxon, described here as Teratosphaeria pseudoeucalypti. While
the DNA sequence of T. pseudoeucalypti was more similar to T. eucalypti, the symptoms and cultural characteristics resem-
bled that of T. destructans. The impact of this disease in central Queensland has increased annually and is the major threat
to the eucalypt plantation industry in the region.
Keywords: clone evaluation, DNA sequence, Eucalyptus spp., haplotypes, kirramyces leaf blight, phylogeographic
analysis
Introduction
Kirramyces leaf diseases, caused by anamorphs of species
of Teratosphaeria (formerly Kirramyces) (Crous et al.,
2009a,b), have emerged as significant diseases impacting
on the eucalypt plantation industry in subtropical and
tropical areas of Australia (Carnegie, 2007a,b; Carnegie
et al., 2008). Three symptom types have been identified
within this disease complex: charcoal leaf disease (caused
by T. suttonii), halo leaf spot (caused by T. eucalypti) and
kirramyces leaf blight (caused by T. viscida and other
Teratosphaeria spp, only found in Queensland). Carnegie
(2007b) included T. suttonii and T. eucalypti under a
single disease complex, kirramyces leaf disease (KLD),
describing it as the ‘most devastating disease in E. grandis
and E. grandis ·E. camaldulensis plantations’ in north-
ern New South Wales (N-NSW), Australia.
During forest health surveys between 1996 and 2005
in NSW, T. eucalypti was observed causing significant
and repeated damage to plantations of E. nitens and
hybrids of E. nitens ·E.nobilis on the Dorrigo Plateau in
northern NSW, where the majority of plantations were
suffering damage of greater then 95% severity (Carnegie,
2007b). The affected plantations of E. nitens recovered
poorly from damage and thus were susceptible to stem
fungi, including Holocryphia eucalypti, resulting in top-
death and tree mortality (Carnegie, 2007b). More recent
surveys of plantations in Queensland have revealed
severe outbreaks and damage by species of Kirramyces in
plantations of E. grandis ·E. camaldulensis in central
Queensland. Due to the severity of damage, and symp-
toms observed, this disease was described as kirramyces
leaf blight (KLB) (Carnegie et al., 2008). The impact of
this disease in the region has increased annually and
whilst it was initially thought that older trees and progeny
of hybrid crosses with E. urophylla or E. pellita parents
were more resistant to KLB, it is now known that
most eucalypt species and hybrids in trials to date, are
susceptible.
Based on spore morphology and sequence data, the
causal agent of KLB in Queensland was initially identified
as T. eucalypti, a species first described from fading leaves
of Eucalyptus sp. collected from Melbourne, Victoria,
Australia, in 1884 (Cooke, 1889). The fungus was also
found on E. dalrympleana and E. viminalis in NSW
(Heather, 1961) and in plantations of E. nitens and
*E-mail: v.andjic@murdoch.edu.au
Published online 18 May 2010
900
ª2010 The Authors
Plant Pathology ª2010 BSPP
Plant Pathology (2010) 59, 900–912 Doi: 10.1111/j.1365-3059.2010.02308.x

E. globulus in southern NSW and Tasmania (Yuan et al.,
2000). Teratosphaeria eucalypti has been recorded in
Queensland since 1971 (Australian Plant Pest Database),
but it was not considered a pathogen of concern. How-
ever, the symptomatology and impact of the disease in
Queensland differed to that observed for T. eucalypti
elsewhere in Australia. In Queensland infection results in
a leaf blight and total defoliation while elsewhere infec-
tion is characterized by discrete lesions and minimal leaf
loss.
Outside Australia, T. eucalypti has been found only in
New Zealand, where it is known to have been introduced
with plantings of E. nitens from south-east Australia
(Miller et al., 1992) and was initially regarded as a minor
pathogen (Dick, 1982; Gadgil & Dick, 1983). However,
this situation has changed with the establishment of plan-
tations of susceptible eucalypt species during the 1990s
when T. eucalypti was found responsible for complete
defoliation of juvenile leaves of E. nitens and became
known as septoria leaf blight (Hood et al., 2002a,b). This
disease outbreak happened because the E. nitens planta-
tion was established in a region with a climate favourable
to T. eucalypti (Ridly, 2004).
The aim of the current study was to use a phylogeo-
graphic approach to construct multiple gene phylogenies
to determine if KLD in Queensland is caused by T. euca-
lypti or a new sister species.
Materials and methods
Fungal isolates
Teratosphaeria eucalypti isolates were collected from
several geographical regions where this pathogen is
known to occur: central NSW (C-NSW), high-altitude
northern NSW (HAN-NSW), northern NSW (N-NSW),
south Queensland (S-QLD), central Queensland (C-
QLD), far north Queensland (FNQ), Victoria (VIC), Tas-
mania (TAS) and New Zealand (NZ). Teratosphaeria
eucalypti was isolated under a dissecting microscope as
described previously (Andjic et al., 2007c).
Cultures were maintained at 20C on 2% malt extract
agar (MEA; 20 g of malt extract and 20 g of agar in 1 L
of distilled water). All isolates are maintained in the Mur-
doch University culture collection (MUCC) or in the col-
lection (CMW) of the Forestry and Agricultural
Biotechnology Institute (FABI), University of Pretoria,
South Africa. Fifty-nine representative isolates from a
range of plantations and hosts throughout Australia were
used: 16 from NSW (three from C-NSW; seven from
HAN-NSW; six from N-NSW), 21 from three regions in
QLD (seven from FNQ; seven from C-QLD; seven from
S-QLD), 12 from TAS, three from VIC and seven from
NZ (Table 1).
DNA extraction, PCR amplification and sequencing
The isolates were grown on 2% MEA at 20C for 4 weeks
and the mycelium was harvested and placed in 1Æ5mL
sterile Eppendorf tubes. Harvested mycelium was frozen
in liquid nitrogen, ground to a fine powder and genomic
DNA extracted as described previously (Andjic et al.,
2007c).
This study included complete amplification of the
mitochondrial ATPase protein gene (ATP-6), internal
transcribed spacer region (ITS-2), part of the b-tubulin
gene region (bT) and part of elongation factor 1a
gene (EF-1a). Primers used for amplification of these
regions are listed in Table 2 and the amplification
protocol was according to Andjic et al. (2007a). For
failed amplifications, the magnesium concentration
was increased to 4 mM, and primer concentration to
0Æ9 pmol and the following PCR conditions were
used: 7 min at 94C, followed by 35 cycles of 1 min
at 94C, 1 min at 45C, 2 min at 72C and a final
elongation step of 10 min at 72C. Amplicons were
visualized and sequenced as described previously
(Andjic et al., 2007a).
Haplotype network estimation
Haplotype networks were generated using the statistical
parsimony method in the TCS v. 1.21 software program
(Clement et al., 2000). The program collapses DNA
sequences into haplotypes and calculates the frequencies
of haplotypes in the sample, which are used to estimate
haplotype out-group probabilities, that correlate with
haplotype age (Donnelly & Tavare
´, 1986; Castelloe &
Templeton, 1994). It then calculates an absolute distance
matrix from which it estimates phylogenetic networks
using a probability of parsimony, until the probability
exceeds 0Æ95 (Templeton et al., 1992). The analysis was
performed on the combined dataset of ATP-6, bT, EF-1a
and ITS-2 DNA sequences.
Phylogenetic analysis
Phylogeny of T. eucalypti isolates were estimated using
a combination of parsimony and maximum likelihood
methods. For each locus, DNA sequence data were
assembled using SEQUENCE NAVIGATOR v. 1.01 (Perkin
Elmer) and aligned in CLUSTAL X (Thompson et al.,
1997) and manual adjustments were made visually
where necessary. All sequences derived in this study
were deposited in GenBank and accession numbers are
shown in Table 1.
The initial analysis was performed on each dataset
alone and subsequent analyses were performed on a com-
bined dataset of bT, EF-1aand ITS-2 sequence, after a
partition homogeneity test (PHT) had been performed in
PAUP v. 4.0b10 (Swofford, 2000) to determine whether
sequence data from the four separate gene regions were
statistically congruent (Farris et al., 1995; Huelsenbeck
et al., 1996). Parsimony analysis with heuristic search
was performed using PAUP * and Bayesian analysis was
conducted on the same aligned and combined dataset as
described previously (Andjic et al., 2007a). Trees were
rooted to Dothistroma septospora.
Causal agent of kirramyces leaf blight in Queensland 901
Plant Pathology (2010) 59, 900–912

Table 1 Teratosphaeria and other isolates considered in this study
Fungus Culture no.
a
Host Location Collector Haplotype
GenBank Accession no.
ATP-6 EF-1aß-tubulin ITS-2
Teratosphaeria
eucalypti
CMW 19453 Eucalyptus nitens Settlement Rd,
New Zealand
M Dick KE1 EU101472 EU101585 EU101529 FJ793234
T. eucalypti CMW 19455 E. nitens Coxs, New Zealand M Dick KE4 EU101515 EU101628 EU101571 FJ793260
T. eucalypti CMW 19456 E. nitens Douthetts, New Zealand M Dick KE3 EU101474 EU101587 EU101531 FJ793236
T. eucalypti CMW 19461 E. nitens Sun Valley, New Zealand M Dick KE1 EU101470 EU101583 EU101527 FJ793232
T. eucalypti CMW 19462 E. nitens Sun Valley, New Zealand M Dick KE1 EU101473 EU101586 EU101530 FJ793235
T. eucalypti CMW 19463 E. nitens Sun Valley, New Zealand M Dick KE1 EU101471 EU101584 EU101528 FJ793233
T. eucalypti CMW 19464 E. nitens Sun Valley, New Zealand M Dick KE1 EU101475 EU101588 EU101532 FJ793237
T. eucalypti CMW 19470 E. nitens Kawerau, New Zealand M Dick KE1 EU101476 EU101589 EU101533 FJ793238
T. eucalypti MUCC 635 E. nitens Roses Tier, TAS, Australia T Wardlaw KE2 EU101501 EU101614 EU101557 FJ793250
T. eucalypti MUCC 636 E. nitens Roses Tier, TAS, Australia T Wardlaw KE1 EU101477 EU101590 EU101534 FJ793239
T. eucalypti MUCC 637 E. nitens Roses Tier, TAS, Australia T Wardlaw KE1 EU101517 EU101630 EU101573 FJ793261
T. eucalypti MUCC 638 E. nitens Roses Tier, TAS, Australia T Wardlaw KE1 EU101518 EU101631 EU101574 FJ793262
T. eucalypti MUCC 639 E. nitens Roses Tier, TAS, Australia T Wardlaw KE1 EU101519 EU101632 EU101575 FJ793263
T. eucalypti MUCC 640 E. nitens Roses Tier, TAS, Australia T Wardlaw KE1 EU101525 EU101638 EU101581 FJ793265
T. eucalypti MUCC 641 E. nitens Roses Tier, TAS, Australia T Wardlaw KE1 EU101520 EU101633 EU101576 FJ793264
T. eucalypti MUCC 642 E. nitens Roses Tier, TAS, Australia T Wardlaw KE1 EU101521 EU101634 EU101577 EU101659
T. eucalypti MUCC 643 E. nitens Roses Tier, TAS, Australia T Wardlaw KE1 EU101522 EU101635 EU101578 EU101656
T. eucalypti MUCC 644 E. nitens Roses Tier, TAS, Australia T Wardlaw KE1 EU101526 EU101639 EU101582 EU101661
T. eucalypti MUCC 645 E. nitens Roses Tier, TAS, Australia T Wardlaw KE1 EU101523 EU101636 EU101579 EU101657
T. eucalypti MUCC 646 E. nitens Roses Tier, TAS, Australia T Wardlaw KE1 EU101524 EU101637 EU101580 EU101660
T. eucalypti MUCC 632 E. nitens Kinglake, VIC, Australia PA Barber KE3 EU101494 DQ632726 DQ632631 DQ632661
T. eucalypti MUCC 633 E. nitens Kinglake, VIC, Australia PA Barber KE3 EU101495 EU101608 EU101551 FJ793247
T. eucalypti MUCC 634 E. nitens Kinglake, VIC, Australia PA Barber KE3 EU101478 EU101591 EU101535 DQ632664
T. eucalypti MUCC 616 Eucalyptus sp. Lithgow, C-NSW, Australia AJ Carnegie KE1 EU101496 EU101609 EU101552 FJ793248
T. eucalypti MUCC 617 Eucalyptus sp. Lithgow, C-NSW, Australia AJ Carnegie KE1 EU101497 EU101610 EU101553 FJ793249
T. eucalypti MUCC 618 Eucalyptus sp. Lithgow, C-NSW, Australia AJ Carnegie KE1 EU101514 EU101627 EU101570 FJ793259
T. eucalypti MUCC 619 E. nitens Dorrigo, HAN-NSW, Australia AJ Carnegie KE1 EU101506 EU101619 EU101562 FJ793251
T. eucalypti MUCC 620 E. nitens Dorrigo, HAN-NSW, Australia AJ Carnegie KE1 EU101507 EU101620 EU101563 FJ793252
T. eucalypti MUCC 621 E. nitens Dorrigo, HAN-NSW, Australia AJ Carnegie KE1 EU101508 EU101621 EU101564 FJ793253
T. eucalypti MUCC 622 E. nitens Dorrigo, HAN-NSW, Australia AJ Carnegie KE3 EU101509 EU101622 EU101565 FJ793254
T. eucalypti MUCC 623 E. nitens Dorrigo,HAN-NSW, Australia AJ Carnegie KE1 EU101510 EU101623 EU101566 FJ793255
T. eucalypti MUCC 624 E. nitens Dorrigo,HAN-NSW, Australia AJ Carnegie KE1 EU101511 EU101624 EU101567 FJ793256
T. eucalypti MUCC 625 E. nitens Dorrigo, HAN-NSW, Australia AJ Carnegie KE3 EU101512 EU101625 EU101568 FJ793257
T. eucalypti MUCC 626 E. grandis xtereticornis Kyogle, N-NSW, Australia AJ Carnegie KE5 EU101489 EU101602 EU101546 FJ793241
T. eucalypti MUCC 627 E. grandis xtereticornis Kyogle, N-NSW, Australia AJ Carnegie KE1 EU101490 EU101603 EU101547 FJ793242
T. eucalypti MUCC 628 E. grandis xtereticornis Kyogle, N-NSW, Australia AJ Carnegie KE1 EU101491 EU101604 EU101548 FJ793243
T. eucalypti MUCC 629 E. grandis xtereticornis Kyogle, N-NSW, Australia AJ Carnegie KE3 EU101492 EU101605 EU101549 FJ793244
T. eucalypti MUCC 630 E. grandis xtereticornis Kyogle, N-NSW, Australia AJ Carnegie KE6 EU101493 EU101606 EU101550 FJ793245
T. eucalypti MUCC 631 E. grandis xtereticornis Kyogle, N-NSW, Australia AJ Carnegie KE7 EU101513 EU101626 EU101569 FJ793258
T. pseudoeucalypti MUCC 598 E. grandis xE. camaldulensis Harrisville,S-QLD, Australia AJ Carnegie KE8 EU101479 EU101592 EU101536 FJ793215
T. pseudoeucalypti MUCC 599 E. grandis xE. camaldulensis Harrisville, S-QLD, Australia AJ Carnegie KE8 EU101480 EU101593 EU101537 FJ793216
902 V. Andjic et al.
Plant Pathology (2010) 59, 900–912

Table 1 Continued.
Fungus Culture no.
a
Host Location Collector Haplotype
GenBank Accession no.
ATP-6 EF-1aß-tubulin ITS-2
T. pseudoeucalypti MUCC 600 E. grandis xE. camaldulensis Harrisville, S-QLD, Australia AJ Carnegie KE8 EU101481 EU101594 EU101538 FJ793217
T. pseudoeucalypti MUCC 601 E. grandis xE. camaldulensis Harrisville, S-QLD, Australia AJ Carnegie KE8 EU101482 EU101595 EU101539 FJ793218
T. pseudoeucalypti MUCC 602 E. grandis xE. camaldulensis Harrisville, S-QLD, Australia AJ Carnegie KE8 EU101483 EU101596 EU101540 FJ793219
T. pseudoeucalypti MUCC 604 E. grandis xE. camaldulensis Harrisville, S-QLD, Australia AJ Carnegie KE8 EU101502 EU101615 EU101558 FJ793224
T. pseudoeucalypti MUCC 605 E. grandis xE. camaldulensis Harrisville, S-QLD, Australia AJ Carnegie KE8 EU101503 EU101616 EU101559 FJ793225
T. pseudoeucalypti MUCC 606 E. grandis xE. camaldulensis Miriam Vale, C-QLD,Australia G Pegg KE8 EU101516 EU101629 EU101572 FJ793226
T. pseudoeucalypti MUCC 607 E. grandis xE. camaldulensis Miriam Vale, C-QLD,Australia G. Pegg KE8 EU101485 EU101598 EU101542 FJ793220
T. pseudoeucalypti MUCC 608 E. grandis xE. camaldulensis Miriam Vale, C-QLD,Australia G. Pegg KE8 EU101504 EU101617 EU101560 FJ793227
T. pseudoeucalypti MUCC 609 E. grandis xE. camaldulensis Miriam Vale, C-QLD,Australia G. Pegg KE8 EU101505 EU101618 EU101561 FJ793228
T. pseudoeucalypti MUCC 610 E. grandis xE. camaldulensis Miriam Vale, C-QLD,Australia G. Pegg KE9 EU101486 EU101599 EU101543 FJ793221
T. pseudoeucalypti MUCC 611 E. grandis xE. camaldulensis Miriam Vale, C-QLD,Australia G. Pegg KE8 EU101487 EU101600 EU101544 FJ793222
T. pseudoeucalypti MUCC 612 E. grandis xE. camaldulensis Miriam Vale, C-QLD,Australia G. Pegg KE8 EU101488 EU101601 EU101545 FJ793223
T. pseudoeucalypti MUCC 702 Eucalyptus sp. FNQ, Australia TI Burgess KE8 FJ811971 FJ793203 FJ793207 FJ793211
T. pseudoeucalypti MUCC 703 Eucalyptus sp. FNQ, Australia TI Burgess KE8 FJ811972 FJ793204 FJ793208 FJ793212
T. pseudoeucalypti MUCC 704 Eucalyptus sp. FNQ, Australia TI Burgess KE10 FJ811973 FJ793205 FJ793209 FJ793213
T. pseudoeucalypti MUCC 705 Eucalyptus sp. FNQ, Australia TI Burgess KE11 FJ811974 FJ793206 FJ793210 FJ793214
T. pseudoeucalypti MUCC 613 Eucalyptus sp. Davies Creek, FNQ, Australia TI Burgess KE8 EU101498 EU101611 EU101554 FJ793229
T. pseudoeucalypti MUCC 614 Eucalyptus sp. Davies Creek, FNQ, Australia TI Burgess KE8 EU101499 EU101612 EU101555 FJ793230
T. pseudoeucalypti MUCC 615 Eucalyptus sp. Davies Creek, FNQ, Australia TI Burgess KE12 EU101500 EU101613 EU101556 FJ793231
T. cryptica CBS110975 E. globulus Australia AJ Carnegie NA DQ235119 DQ658234 AY309623
T. destructans CMW 19832 E. grandis Sumatra, Indonesia PA Barber NA DQ632665 DQ632623 DQ632665
T. destructans CMW 17919 E. urophylla Guangzhou, China TI Burgess NA DQ632701 DQ632622 DQ632701
T. destructans CMW 15089 E. camaldulensis Vietnam TI Burgess NA EF031465 EF031477 EF031465
T. destructans CMW 16123 E. camaldulensis Thailand MJ Wingfield NA EF031468 EF031480 EF031468
T. molleriana CBS117924 Eucalyptus sp. Portugal MJ Wingfield NA DQ239969 DQ240115 DQ239968
T. molleriana CBS111164 Eucalyptus sp. USA MJ Wingfield NA DQ235104 AF309619 AF309620
T. nubilosa CMW 11560 E. globulus Tasmania A Milgate NA DQ240176 DQ658236 DQ658232
T. suttonii MUCC 425 E. grandis New South Wales TI Burgess NA DQ632713 DQ632613 DQ632655
T. suttonii CMW 22484 E. urophylla China TI Burgess NA DQ632714 DQ632616 DQ632705
T. viscida MUCC 452,
CBS 121156
E. grandis Mareeba, Australia TI Burgess NA EF031495 EF031483 EF031471
T. viscida MUCC 453,
CBS 121157
E. grandis Mareeba, Australia TI Burgess NA EF031496 EF031484 EF031472
T. viscida MUCC 454 E. grandis Mareeba, Australia TI Burgess NA EF031497 EF031485 EF031473
T. viscida MUCC 455 E. grandis Mareeba, Australia TI Burgess NA EF031498 EF031486 EF031474
T. zuluensis CBS117835 E. grandis Mexico MJ Wingfield NA DQ240161 DQ240108 DQ239987
T. zuluensis CBS117262 E. grandis South Africa L Van Zyl NA DQ240155 DQ240102 DQ239976
Dothistroma septospora CMW14822 Pinus ponderosa NA AY808265 AY80819 AY808300
D. septospora CMW13122 Pinus mugo NA AY808260 AY808195 AY808295
a
Designation of isolates and culture collections: CBS = Centraalbureau voor Schimmelcultures, Utrecht, the Netherlands; CMW = Tree Pathology Co-operative Program, Forestry and Agricultural
Biotechnology Institute, University of Pretoria, South Africa; MUCC = Murdoch University Culture Collection, Perth, Western Australia.
Causal agent of kirramyces leaf blight in Queensland 903
Plant Pathology (2010) 59, 900–912

Morphology and cultural characteristics
Representative isolates of T. eucalypti considered in
this study were compared in vivo and in vitro, includ-
ing herbarium specimens of T. eucalypti from QLD
obtained from Plant Pathology Herbarium, Depart-
ment of Primary Industries and Fisheries Brisbane,
Queensland, Australia (BRIP), and previous observa-
tions from published literature. Plugs (2 mm diameter.)
were cut from actively growing cultures and placed at
the centres of Petri dishes (55 mm) containing one of
four different nutrient media. Three replicates of each
representative isolate (nine isolates in total) were
grown on 2% MEA, oatmeal agar (OMA; 30 g of oats
and 15 g of agar in 1 L of distilled water), potato dex-
trose agar (PDA, Biolab) and sterilized eucalypt leaves
placed on the surface of tap water agar (TWA; steril-
ized eucalyptus leaves, 15 g of agar in 1 L of tap
water) at 20 and 30C in the dark. After 30 days, cul-
tures were assessed for growth and photographed.
Squash mounts of fruiting structures were prepared on
slides in lacto-glycerol (1:1:1 volume of lactic acid,
glycerol and water) and observed at 1000·magnifica-
tion with an Olympus BH2 light microscope. The
growth of cultures was determined by taking two mea-
surements of colony diameter perpendicular to each
other. Each isolate was assessed for conidial size,
shape, pigmentation and number of septa. Wherever
possible, 30 measurements (·1000 magnification) of
all taxonomically relevant structures were recorded for
each species and the extremes presented in parenthe-
ses. Colony colour was described using notations in
the Munsell

Soil Color Charts (Gretag Macbeth,
revised 2000). Measurements of conidial size were
obtained using the image analysis software OLYSIA BIO-
REPORT 3Æ2software imaging system. Data analyses were
performed using descriptive statistics in MICROSOFT
EXCEL.
Herbarium specimens examined in this study were:
BRIP-8734a, BRIP-13248a, BRIP-2574a, BRIP-43738a,
BRIP-5465a, BRIP-11345a, BRIP-40158a and BRIP-
5464a.
Fructification rating
Parallel to morphological characterization, an indepen-
dent experiment was set up in order to compare the
estimated number of fruiting bodies (pycnidia) produced
by each isolate grown on the different nutrient media
MEA, OMA and TWA. Six representative isolates (two
isolates from each location) were used for this study. Ini-
tially, isolates were grown on 2% MEA at 20C in the
dark. After 30 days pycnidia were harvested and a spore
suspension made. Two hundred microlitres of each sus-
pension was then spread on agar plates and placed in an
incubator at 20C. After 90 days, isolates were rated for
sporulation. Scale rating was scored from 0 to 6 where
0 = no fruiting bodies produced, 6 = maximum fruiting
bodies produced.
Results
Haplotype network
Haplotype network constructed in TCS software resulted
in 12 haplotypes among the Teratosphaeria isolates from
Eucalyptus spp. (Fig. 1). Haplotype KE-1 was repre-
sented by six isolates from NZ, 11 from TAS, three from
C-NSW, five from HAN-NSW and two from N-NSW;
haplotype KE-2 was represented by one isolate from
TAS; haplotype KE-3 was represented by one isolate from
NZ, three isolates from VIC, two isolates from HAN-
NSW and one isolate from N-NSW; haplotype KE-4 was
represented by only one isolate from NZ; haplotypes KE-
5, KE-6 and KE-7 were each represented by one isolate
from N-NSW; haplotype KE-8 was represented by seven
isolates from S-QLD, six from C-QLD and four from
FNQ; haplotype KE-9 was represented by only one iso-
late from C-QLD; haplotypes KE-10, KE-11 and KE-12
were each represented by one isolate from FNQ.
Regions from Queensland shared one common haplo-
type (KE-8), but did not share any haplotypes with iso-
lates obtained elsewhere (Fig. 1). Five different
haplotypes were observed in the population from NSW,
of which two were shared with isolates from NZ, and one
each with isolates from VIC and TAS. Three other haplo-
types (KE-5, 6 and KE-7) were only present in N-NSW.
Phylogenetic analysis
Parsimony and Bayesian analysis of aligned data sets con-
taining a representative of each haplotype (KE1–12) were
performed on each dataset alone and in combination.
Table 2 Primer sets and annealing temperature used to amplify Teratosphaeria spp.
Region Oligos Oligo Sequence (5¢–3¢)
Amplicon
size (bp) AT (ºC) Reference
ATP-6 ATP6-1
ATP6-2
ATTAATTSWCCWTTAGAWCAATT
TAATTCTANWGCATCTTTAATRTA
600 45 (Kretzer & Bruns, 1999)
b-tubulin Bt2a
Bt2b
GGTAACCAAATCGGTGCTGCTTTC
ACCCTCAGTGTAGTGACCCTTGGC
680 45–58 (Glass & Donaldson, 1995)
EF-1aEF1-728F
EF1-986R
CATCGAGAAGTTCGAGAAGG
TACTTGAAGGAACCCTTACC
350 45–55 (Carbone & Kohn, 1999)
ITS-2 ITS-3
ITS-4
GTATCGATGAAGAACGCAGC
TCCTCCGCTTATTGATATGC
300 50 (Gardes & Bruns, 1993)
904 V. Andjic et al.
Plant Pathology (2010) 59, 900–912

Analysis and resultant trees for individual bT, ITS-2 and
EF-1adatasets are given in TreeBase S10492. As there
were only two polymorphic sites in the ATP-6 dataset the
analysis was not performed. In all three analyses, Tera-
tosphaeria isolates from QLD (KE9–12) were closely
related to, but phylogenetically distinct from T. eucalypti
from elsewhere (KE1–8). The aligned data set for the
combined bT, ITS-2 and EF-1asequences consisted of
990 characters of which 446 were parsimony informative
and used in the analysis. The partition homogeneity test
showed no significant difference (P>0Æ01; P=0Æ33)
between data from the different gene regions (sum of
lengths of original partition was 1020, range for 1000
randomizations was 1013–1027) thus data were com-
bined. The combined data set contained significant
(P<0Æ01; gl = )2Æ25) phylogenetic signal compared to
1000 random trees. Heuristic searches of unweighted
characters in PAUP resulted in one most parsimonious trees
of 858 steps (CI = 0Æ793, RI = 0Æ876) (Fig. 2). Bayesian
analysis resulted in a tree with identical topology and
clades as those revealed in the parsimony tree (TreeBase
S10492-21664, Fig. 2).
Phylogeny generated from the combined data (Fig. 2)
recognized two major clades. One comprised Teratosp-
haeria isolates from QLD and the second, isolates
of T. eucalypti from elsewhere. The second clade was
subdivided into two sub-clades. The three isolates from
N-NSW were clearly separated from two other sub-
clades with 65% bootstrap support and 1Æ00 Bayesian
posterior probability. The two major clades were
strongly supported with both Bayesian and parsimony
analysis.
There were 16 polymorphic sites across the four
sequenced gene regions among T. eucalypti isolates. Two
1
1
7
27
1
1
1
17
111
Cairns
Townsville
Rockhapmton
Brisbane
Coffs
Harbour
Sydney
Melbourne
Adelaide
Hobart
Auckland
1
Figure 1 Distribution and proportion of the 12 detected Teratosphaeria haplotypes in eastern Australia estimated by TCS 1Æ21 software. Also
shown is a haplotype network, with haplotype identity indicated by colours. Red = KE-1, Orange = KE-2, Yellow = KE-3, Purple = KE-4,
Blue = KE-5, Dark Blue = KE-6, Light Blue = KE-7, Dark Green = KE-8, Light Green = KE-9, Lime = KE-10, Olive Green = KE-11,
Green = KE-12.
Causal agent of kirramyces leaf blight in Queensland 905
Plant Pathology (2010) 59, 900–912

polymorphic sites were detected in the ATP-6 region,
seven in the bT region, four in the EF-1aand three in
ITS-2 region (Table 3). Of the 16 polymorphic sites, nine
fixed sites separated isolates from QLD with those from
elsewhere.
Morphological characterization
Morphological examination of conidia of all Teratosp-
haeria isolates showed similar pigmentation and over-
lapping measurements for length, width and septa
number. Conidia were hyaline to pale brown, (0–)1(–2)
(rarely 3)-septate, slightly verruculose, straight to vari-
ously curved with high levels of length variability,
depending on the origin of the specimen, ranging from
30 to 48Æ5lm (Table 4, Fig. 3). High level of variabil-
ity in conidia length had been previously observed
amongst T. eucalypti from New Zealand (30–60 lm)
(Gadgil & Dick, 1983), New South Wales (24–57 lm)
(Heather, 1961) and Victoria (35–50 lm) (Walker
KE1
KE2
KE3
KE4
0·99/85
0·98/88
Teratosphaeria eucalypti
KE4
KE5
KE6
KE7
1·00/65
1·00/94
Teratosphaeria eucalypti
KE8
KE10
KE11
KE12
1·00/95
0·95/64
Teratosphaeria pseudoeucalypti
KE9
2 changes
Figure 2 Part of a phylogram of the most parsimonious tree of 858 steps inferred from the combined datasets of bT, EF-1aand ITS-2 (for
complete analysis see TreeBASE SN4360). Bootstrap support based on parsimony analysis and posterior probabilities of the branch nodes
based on Bayesian analysis (italics) are given above the line. Teratosphaeria pseudoeucalypti resides in a strongly supported clade close to
T. eucalypti.
Table 3 Haplotypes of Teratosphaeria considered in the phylogenetic study. Positions of polymorphic nucleotides from aligned sequence data of ITS-2,
ATP-6, b-tubulin and EF-1agene regions showing the variation between haplotypes. Only parsimony informative nucleotides (=characters) are shown. For
comparison purposes polymorphisms shared with the first haplotype are highlighted
Haplotype
EF-1 ab-tubulin ATP-6 ITS-2
31 34 52 143 73 91 93 98 201 209 236 236 295 146 193 249
Teratosphaeria eucalypti
KE1 CCCC TGAAT G C T A C T C
KE2 CGCC T GA A T G C G A C T C
KE3 CGCC T GA A T G C T A C T C
KE4 CCCCTGAAT GC GA CT C
Teratosphaeria eucalypti
KE5 CCCC TCGAC A C T A C T C
KE 6 C G C T T C G A C A C T A C T C
KE 7 C G C T T C G A C A C T A C T T
Teratosphaeria pseudoeucalypti
KE8 T CT T C GAGC A T G A T G T
KE 9 T C T T C G A A C A T G A T G T
KE 10 T C T T C G A G C A T G A C T T
KE 11 T C T T C G A G C A T T A T G T
KE 12 T C T T C G A G C A T G T T G T
906 V. Andjic et al.
Plant Pathology (2010) 59, 900–912

et al., 1992). Isolates from QLD were on average
slightly shorter and less variable than those from else-
where (Table 4).
In this study, the conidia of the specimens of T. euca-
lypti from HAN-NSW (39–47 lm) and N-NSW
(38–48Æ5lm) were slightly longer than the conidia of
specimens collected from elsewhere including BRIP her-
barium specimens (34–45 lm). The pycnidia of speci-
mens collected from FNQ were immature therefore
conidia could not be measured.
Conidia of C-QLD isolates produced in culture were
slightly shorter (31Æ5–37Æ5lm) than conidia observed
from leaf material (33–40 lm). This was also true for iso-
lates of T. eucalypti from VIC where conidia produced in
culture were shorter (25–35 lm) than conidia produced
on leaf material (35–50 lm). No variation in conidia
length was found between culture and leaf material
among isolates from TAS. Isolates from NSW, S-QLD
and FNQ did not produce spores in culture.
Cultural characteristics and fructification
No significant effect of temperature (20 and 30C) on col-
ony morphology was observed among all isolates across
the four tested media and thus cultural characteristics are
reported only for isolates maintained at 20C. In general
isolates from QLD had a slower growth rate and were
more olive green in colour than isolates from elsewhere
(Table 5).
On average, isolates of Teratosphaeria from QLD pro-
duced fewer fruiting bodies than isolates from elsewhere
across all media (rate 0Æ5–2) (Table 5). Isolates from
S-QLD did not sporulate on any tested media.
Table 4 Morphological features of conidia of Teratosphaeria isolates from eucalypts recorded in published literature and in the present study
Fungus Specimen number Pigmentation
Conidial
length
(in vivo)
a
lm
Conidial
width
(in vivo)
lm
Conidial
length
(in vitro)
b
lm
Conidial
width
(in vitro)
lm
Number
of septa
T. eucalypti (NSW)
HAN-NSW MURU449 Hyaline to sub-hyaline 34–41 2Æ5–3 n ⁄a
c
n⁄a 0–1
C-NSW MURU451 Hyaline to sub-hyaline 39–47 2–3 n ⁄an⁄a 0–1
N-NSW MURU424 Sub-hyaline to pale brown 38–48Æ52Æ5–3 n ⁄an⁄a 0–1
T. eucalypti (VIC)
(Walker et al., 1992)
K(M) 39487 Pale brown 35–50 3–4 n ⁄an⁄a 0–2
Septoria normae
(Heather, 1961)
DAR 65742 Hyaline, yellow to light brown 24–57 3–3Æ5n⁄an⁄a 1–2
Septoria pulcherrima
(Gadgil & Dick, 1983)
PDD 42838 Hyaline to pale brown 30–60 3–4 n ⁄an⁄a 0–2
T. eucalypti (TAS) TAS MURU452 Hyaline to sub-hyaline 30–40Æ5 2–3 33–41 2Æ5–3 0–1
T. pseudoeucalypti (QLD)
BRIP (this study)
BRIP(average) Sub-hyaline to pale brown 34–45 1Æ5–2Æ5n⁄an⁄an⁄a
T. pseudoeucalypti (QLD)
S-QLD MURU448 Sub-hyaline to pale brown 31Æ5–39Æ5 2–2Æ5n⁄an⁄a 0–2
C-QLD MURU450 Sub-hyaline to pale 33–40 2–2Æ531Æ5–37Æ5 2–3 0–2
FNQ MURU446 Brown Pale brown n ⁄an⁄a 31–39 2–3 0–3
a
In vivo = herbarium specimens.
b
In vitro = isolates from culture.
c
n⁄a = not applicable (the isolates did not produce conidia in culture or were not available).
(a) (b)
(c)
(d)
Figure 3 Conidia in vivo of (a) Teratosphaeria pseudoeucalypti
specimen, MURU 450; (b) T. eucalypti specimen MURU 451.
Conidia in vitro of (c) T. pseudoeucalypti isolate MUCC 607;
(d) T. eucalypti isolate MUCC 631. Bar = 20 lm.
Causal agent of kirramyces leaf blight in Queensland 907
Plant Pathology (2010) 59, 900–912

Taxonomy
Although morphological characteristics showed no
major differences amongst Teratosphaeria isolates,
phylogenetic inference and cultural characteristics and
sporulation have provided robust evidence to show that
the causal agent of a serious leaf disease on Eucalyptus
hybrids in Queensland represents a unique taxon.
The fungus is thus described as a new cryptic species as
follows:
Teratosphaeria pseudoeucalypti Andjic, T.I. Burgess sp.
nov (Figs 3a,c and 4m,n,o)
Mycobank no MB 514057
Teleomorph:Teratosphaeria sp. (based on phylogenetic
inferences, but not seen)
Etymology: Named after its sister species, T. eucalypti.
Conidiomata pycnidialia, hypophylla, singularia,
atrobrunnea ad atra. Conidiophori redigent ad cellu-
las conidiogenas. Conidia singularia, 0–3-septata,
subhyalina et pallide brunnea, parum verruculosa,
cylindracea, recta ad varie curvata, cum parietibus
crassis, ad basim truncata, interdum cum margine fi-
mbriato, apex obtusus, (26Æ0—)31Æ5–40Æ0(—58Æ0) ·
(1Æ7—)2Æ0–2Æ5(3Æ5—).
Leaf spots: subcircular to irregular, 2–15 mm
diameter, single to confluent, often blighting on E.
grandis hybrids, initially pale green, turning chlorotic
before becoming necrotic, light to medium brown
with red-purple margin on the upper and lower sur-
face. Conidiomata: pycnidial, hypophyllous, single,
black. Conidiophores reduced to conidiogenous cells.
Conidia: solitary, 0–3 septate, subhyaline to pale
brown, slightly verruculose, cylindrical, straight to
variously curved, thick-walled, base truncate some-
times with marginal frill, apex obtuse, (26Æ0—)31Æ5–
40Æ0(—58Æ0) ·(1Æ7—)2Æ0–2Æ5(3Æ5—) (mean = 35 ·
2Æ2lm).
Cultures: Colonies 9–29 mm after 1 month at 20Cin
the dark on MEA, margins irregular, sometimes lobed;
the upper surface white 5YR 8 ⁄1 to pinkish white 5YR
8⁄2 with black pycnidia, margin pink and smooth; the
lower surface light reddish brown 5YR 6 ⁄4. Conidiomata
if present, pycnidial, single, black. Conidiogenous cells:
not seen in culture. Conidia: solitary, 0–3-septate, subhy-
aline to pale brown, smooth to slightly verruculose,
cylindrical, straight to variously curved (27Æ0—)31Æ0–
39Æ0(—43Æ0) ·(1Æ5—)2Æ0–3Æ0(—3Æ0) (mean = 35Æ0·
2Æ5lm).
Holotype: on leaves of E. grandis ·E. camaldulensis
Miriam Vale, Queensland, Australia, G. Pegg, August
2005 (HOLOTYPE MURU450; culture ex-type
MUCC607, CBS 124577).
Hosts: Eucalyptus sp., E. grandis ·E. camaldulensis
Geographic distribution: Queensland.
Table 5 Comparison between colony diameter (mm) and morphology after 30 days at 20C on four media for isolates of Teratosphaeria eucalypti and T.
pseudoeucalypti
Media
Teratosphaeria pseudoeucalypti Teratosphaeria eucalypti
Colony diameter Colony characteristics Colony diameter Colony characteristics
MEA S-QLD 18 mm
C-QLD 11–30 mm
FNQ 9–26 mm
(Fig. 4m,n,o)
Margins irregular, sometimes lobed,
sometimes smooth and pink
Upper surface white to pinkish
white with black pycnidia when present
Reverse light reddish brown
Fructification rating 2Æ72 ± 0Æ21
NSW 12–16 mm
TAS 7–10 mm
VIC 13–15 mm
(Fig. 4p,q,r)
Margins irregular
Upper surface pinkish white
with olive green aerial mycelium
Reverse olive brown
Fructification rating 2Æ07 ± 0Æ17
OMA S-QLD 10–13 mm
C-QLD 7–16 mm
FNQ 11–14 mm
Margins irregular, sometimes
light olive brown
Upper surface pink, sometimes
with a smooth surface and
white aerial mycelium
Reverse pink to light red
Fructification rating 3Æ17 ± 0Æ17
NSW 7–10 mm
TAS 5–7 mm
VIC 8–11 mm
Margins irregular
Upper surface pinkish white
with olive green outer zone
Reverse olive green
Fructification rating 0Æ94 ± 0Æ18
TWA S-QLD 5–11 mm
C-QLD 7–16 mm
FNQ 7–11 mm
Margins regular to irregular
Upper surface white, sometimes
with a smooth light olive brown surface
Reverse light olive brown
Fructification rating 2Æ44 ± 0Æ23
NSW 2–7 mm
TAS 2–7 mm
VIC 2–7 mm
Margins irregular
Upper surface black with
pinkish white aerial mycelium
Reverse olive brown
Fructification rating 0Æ61 ± 0Æ16
½ PDA S-QLD 17–21 mm
C-QLD 12–23 mm
FNQ 8–13 mm
Margins irregular, lobed,
Upper surface pink with black spore masses
Reverse light red to red and
black at the point of inoculation
NSW 17–18 mm
TAS 14–16 mm
VIC 19–20 mm
Margins regular sometimes lobed
Upper surface pale red
with pinkish aerial mycelium
Reverse pink red and black
at inoculation point
908 V. Andjic et al.
Plant Pathology (2010) 59, 900–912

Additional specimens examined: T. pseudoeucalypti
on E. grandis ·E. tereticornis, Harrisville, Queensland,
Australia, A.J. Carnegie, G. Pegg, August 2005 (MURU
448; culture ex-isotypes, MUCC600) and Eucalyptus
sp., North Queensland, Australia, T.I. Burgess, August
2006 (MURU447; culture ex-isotypes MUCC614).
(a) (b)
(c)
(d)
(e) (f) (g) (h)
(i)
(m) (n) (o) (p) (q) (r)
(j) (k) (l)
Figure 4 A comparison between the foliar disease symptoms and cultural morphology of Teratosphaeria eucalypti and T. pseudoeucalypti.
Teratosphaeria pseudoeucalypti: (a) defoliated Eucalyptus hybrid in C-QLD; (b, e) leaf infection of E. grandis ·E.camaldulensis, C-QLD ;
(f) leaf infection of Eucalyptus sp., FNQ; (g) leaf infection of E. grandis ·E.camaldulensis hybrids, S-QLD. Colony morphology on MEA at
20C of (m) MUCC600 from S-QLD; (n) MUCC613 from C-QLD; (o) MUCC607 from FNQ. Teratosphaeria eucalypti: (c, l) leaf infection of E.
nitens, Tasmania; (d, h) leaf infection of E. grandis ·E. tereticornis hybrids, Kyogle, N-NSW; (i) leaf infection of Eucalyptus, Victoria; (j) leaf
infection of E. nitens, HNA-NSW; (k) leaf infection of E. nitens, New Zealand. Colony morphology on MEA at 20C of (p) MUCC632 from VIC;
(q) MUCC635 from TAS; (r) MUCC626 from N-NSW. Bar = 10 mm.
Causal agent of kirramyces leaf blight in Queensland 909
Plant Pathology (2010) 59, 900–912

Comparison of distribution, impact and symptoms
of T. pseudoeucalypti and T. eucalypti
The disease caused by T. pseudoeucalypti was first
detected in August 2005 causing leaf blight to E. gran-
dis ·E. camaldulensis hybrids at Harrisville, S-QLD and
Miriam Vale, C-QLD, and based on symptoms and the
blighting nature of damage resembled T. destructans
(Fig. 4a).However, at the time the causal agent was
identified as T. eucalypti based on conidia size and
morphology. Results of collections reveal that whilst
the major damage to plantations in NSW is caused by
T. eucalypti, in Queensland, the major damage is caused
by T. pseudoeucalypti. The current geographical distri-
bution of T. pseudoeucalypti is unknown, but the results
of this study suggest that this pathogen is limited to
regions with sub-tropical and tropical climate, whilst
T. eucalypti is found in both temperate and sub-tropical
areas. Teratosphaeria pseudoeucalypti has recently also
been found and confirmed from a production nursery in
central NSW on E. grandis ·E. camaldulensis material
derived from Queensland.
Symptoms on leaves caused by T. pseudoeucalypti are
variable and similar to those caused by both T. eucalypti
and T. destructans depending on host and potentially
maturity of leaves at time of infection. On E. grandis ·
E. camaldulensis hybrids symptoms were typically simi-
lar to T. destructans, with large blights that crinkled
leaves (Fig. 4b,e,g), while on E. camaldulensis, and in
some cases older leaves of E. grandis ·E. tereticornis,
symptoms were more commonly individual necrotic leaf
spots.
Discussion
The genetic diversity of the leaf pathogen, T. eucalypti,
was examined using nucleotide sequence variation of
four gene regions. Nine fixed polymorphic sites were
found in three genomic and one mitochondrial gene
(1496 bp of sequence) distinguishing isolates of Tera-
tosphaeria from Eucalyptus spp. in Queensland, Austra-
lia, from T. eucalypti found elsewhere. The fungal
isolates from Queensland represent a new cryptic species
and has been described as T.pseudoeucalypti.
In general, boundaries of fungal species are recog-
nized using a simple approach by fulfilling either of
two criteria: (i) genealogical concordance, to identify
independent evolutionary lineages and phylogenetic
species from multiple gene genealogies, a clade must be
present in the majority of the single locus genealogies;
(ii) genealogical nondiscordance; recognizes a clade
as an independent evolutionary lineage if it is well
supported by at least one single locus genealogies by
both bootstrap and posterior probabilities values above
70% and 0Æ95 respectively, and if it is not contradicted
by any other single locus genealogies determined by
the same methods (Dettman et al., 2003). In the
present study, phylogenetic analyses based on multiple
gene phylogeny strongly support the existence of an
independent evolutionary lineage of isolates from
Queensland, now designated as T. pseudoeucalypti, by
fulfilling both the aforementioned criteria. Data
obtained by haplotype networking also distinguished
T. pseudoeucalypti from T. eucalypti. Furthermore,
there were no shared haplotypes between isolates from
Queensland and those from elsewhere.
Apart from cultural characteristics and higher sporula-
tion rate of T. eucalypti, T. eucalypti and T. pseudoeuca-
lypti are morphologically similar and this differentiation
has been based principally on DNA sequence compari-
sons. However, this is not surprising as Teratosphaeria
anamorphs (Kirramyces-like) from eucalypts are often
morphologically similar, thus relying heavily on DNA
sequence comparison for differentiation (Andjic et al.,
2007a,b,c).
Cryptic speciation has been seen in Paracoccidioides
brasiliensis, an important human pathogen, endemic to
Latin America (Restrepo, 2003). Whilst considered to be
a clonal species by mycological criteria, this assumption
was not supported by multiple gene phylogenies. As a
result P. brasiliensis was divided into three distinct spe-
cies (Matute et al., 2006). A similar situation has been
seen with species of Teratosphaeria cryptica and
T.pseudocryptica,T.endophytica and T.pseudoendo-
phytica (Crous et al., 2006), T. vespa and T. pseudovespa
(Carnegie et al., 2007c) and T. destructans and T. viscida
(Andjic et al., 2007b; Burgess et al., 2007).
Teratosphaeria eucalypti isolates were collected from
three geographical regions in NSW: C-NSW, HAN-NSW
and N-NSW. The DNA sequence of isolates collected
from N-NSW was more variable than that of isolates col-
lected from C-NSW. Phylogenetic analysis using multiple
genes has separated three isolates from N-NSW in one
sub-clade which was strongly supported by Bayesian
analysis. The three isolates from N-NSW were from a
taxa trial (at Kyogle) where severe defoliation eventually
resulted in the death of many trees. Interestingly, this trial
location is less than 60 km south of where T. pseudoeuca-
lypti was first collected (Harrisville, Queensland) and
while phylogenetically close to T. eucalypti, could repre-
sent a new cryptic species or a hybrid with T. pseudoeuca-
lypti.
The impact of this disease in central Queensland has
increased annually and while it was initially thought
that older trees and some hybrid crosses were more
resistant to KLB it is now known that if the inoculum
load is high most eucalypt species and hybrids trialled
to date in sub-tropical Australia are susceptible. The
confirmation of T. pseudoeucalypti from a production
nursery in central NSW on material derived from
Queensland is of concern as it appears to be a more
significant pathogen than other Teratosphaeria species
already established in NSW.
Acknowledgements
The authors acknowledge Sally Collins, Peter Albert-
son and the operations staff at ITC Forestry, Mackay,
910 V. Andjic et al.
Plant Pathology (2010) 59, 900–912

for their work establishing and maintaining the field
trials. We also thank Mrs Margaret Dick, Scion Forest
Biosecurity and Protection, NZ Forest Research Insti-
tute Rotorua who provided T. eucalypti isolates from
New Zealand. Also thanks to Dr Tim Wardlaw,
Biology & Conservation Division of Forest Research
& Development Forestry, Hobart, Tasmania who
collected the leaves infected with T. eucalypti from
Tasmania and Dr Paul Barber for those from Victoria.
Dr Thomas Jung is thanked for providing the Latin
translation.
References
Andjic V, Cortinas MN, Hardy GEStJ, Burgess TI, Wingfield MJ,
2007a. Multiple gene genealogies reveal important relationships
between Phaeophleospora spp. infecting Eucalyptus leaves.
FEMS Microbiology Letters 268, 22–33.
Andjic V, Barber PA, Pegg GS et al., 2007b. Kirramyces viscidus sp.
nov,a new eucalypt pathogen from tropical Australia is closely
related to the serious leaf pathogen, Kirramyces destructans.
Australasian Plant Pathology 36, 478–87.
Andjic V, Barber PA, Carnegie AJ, Hardy GEStJ, Wingfield MJ,
Burgess TI, 2007c. A morphological and phylogenetic
reassessment of the genus Phaeophleospora and the resurrection
of the genus Kirramyces.Mycological Research 111, 1184–98.
Burgess TI, Andjic V, Wingfield MJ, Hardy GEStJ, 2007. The
eucalypt leaf blight pathogen Kirramyces destructans discovered
in Australia. Australasian Plant Disease Notes 2, 141–4.
Carbone I, Kohn LM, 1999. A method for designing primer sets for
speciation studies in filamentous ascomycetes. Mycologia 91,
553–6.
Carnegie AJ, 2007a. Forest health condition in New South Wales,
Australia, 1996–2005. I Fungi recorded from eucalypt
plantations during forest health surveys. Australasian Plant
Pathology 36, 213–24.
Carnegie AJ, 2007b. Forest health condition in New South Wales,
Australia, 1996–2005. II Fungal damage recorded in eucalypt
plantations during forest health surveys and their management.
Australasian Plant Pathology 36, 225–39.
CarnegieAJ,BurgessTI,BeilharzV,WingfieldMJ,2007c.New
species of Mycosphaerella in plantations and native forests in
Eastern Australia. Mycologia 99, 461–74.
Carnegie AJ, Lawson S, Smith T, Pegg GS, Stone C, McDonald J,
2008. Healthy Hardwoods: A Field Guide to Pests, Diseases and
Nutritional Disorders in Subtropical Hardwoods. Melbourne,
Australia: Forests and Wood Products Australia Ltd.
Castelloe J, Templeton AR, 1994. Root probabilities for
intraspecific gene trees under neutral coalescent theory.
Molecular Phylogenetics and Evolution 3, 102–13.
Clement M, Posada D, Crandall KA, 2000. A computer
program to estimate gene genealogies. Molecular Ecology 9,
1657–9.
Cooke MC, 1889. New Australian fungi. Grevillea 18, 1–8.
Crous PW, Wingfield MJ, Mansilla JP, Alfenas AC, Groenewald
JZ, 2006. Phylogenetic reassessment of Mycosphaerella spp. and
their anamorphs occurring on Eucalyptus II. Studies in
Mycology 55, 99–131.
Crous PW, Groenewald JZ, Summerell BA, Wingfield BD,
Wingfield MJ, 2009a. Co-occurring species of Teratosphaeria on
Eucalyptus.Persoonia 22, 38–48.
Crous PW, Summerell BA, Carnegie AJ et al., 2009b. Unravelling
Mycosphaerella: do you believe in genera? Persoonia 23, 99–
118.
Dettman JR, Jacobson DJ, Taylor JW, 2003. A multilocus
genealogical approach to phylogenetic species recognition in
the model eukaryote Neurospora.Evolution 57, 2703–
20.
Dick M, 1982. Leaf-inhabiting fungi of eucalypts in New Zealand.
New Zealand Journal of Forestry Science 12, 525–37.
Donnelly P, Tavare
´S, 1986. The ages of alleles and a coalescent.
Advances in Applied Probability 18, 1–19.
Farris JS, Kallersjo M, Kluge AG, Bult C, 1995. Testing significance
of incongruence. Cladistics 10, 315–9.
Gadgil PD, Dick M, 1983. Fungi eucalyptorum Novozelandiae:
Septoria pulcherrima sp. nov. and Trimmatostroma bifarium sp.
nov. New Zealand Journal of Botany 21, 49–52.
Gardes M, Bruns T, 1993. ITS primers with enhanced
specificity for basidiomycetes – application to the
identification of mycorrhizae and rusts. Molecular Ecology
2, 113–8.
Glass NL, Donaldson GC, 1995. Development of primer sets
designated for use with the PCR to amplify conserved regions
from filamentous Ascomycetes. Applied and Environmental
Microbiology 61, 1323–30.
Heather WA, 1961. Studies in Septoria n. sp. Causing a Leaf
Blotch of Eucalyptus dalrympleana. Maiden.Sydney,
Australia: University of Sydney, MSc Thesis.
Hood IA, Chapman SJ, Gardner JF, Molony K, 2002a. Seasonal
development of septoria leaf blight in young Eucalyptus nitens
plantations in New Zealand. Australian Forestry 65,
153–64.
Hood IA, Gardner JF, Kimberley MO, Molony K, 2002b.
Variation among eucalypt species in early susceptibility to
the leaf spot fungi Phaeophleospora eucalypti and
Mycosphaerella spp. New Zealand Journal of Forestry
Science 32, 235–55.
Huelsenbeck JP, Bull JJ, Cunningham CW, 1996. Combining data
in phylogenetic analysis. Trends in Ecology and Evolution 11,
152–8.
Kretzer A, Bruns TD, 1999. Use of ATP6 in fungal phylogenetics:
an example from the Boletales. Molecular Phylogenetics and
Evolution 13, 483–92.
Matute DR, McEwen JG, Puccia R et al., 2006. Cryptic speciation
andrecombinationinthefungusParacoccidioides brasiliensis as
revealed by gene genealogies. Molecular Biology and
Evolution 23, 65–73.
Miller JT, Cannon PG, Ecroyd CE, 1992. Introduced forest trees in
New Zealand: recognition, role, and seed source part 11.
Eucalyptus nitens (Deane et Maiden) Maiden. New Zealand
Ministry of Forestry, Forest Research Bulletin No. 124.
Restrepo A, 2003. Paracoccidiodomycosis.In:DismukesWE,
Pappas PG, Sobel JD, eds. Clinical Mycology. Oxford University,
UK: Oxford University Press, 328–45.
Ridly GS, 2004. Six months in a leaky boat: the biosecurity of New
Zealand forests. New Zealand Journal of Forestry Sciences
33, 429–38.
Swofford DL, 2000. PAUP*; Phylogenetic Analysis Using
Parsimony (*and Other Methods). Version 4.0b10. Sunderland,
MA, USA: Sinauer Associates.
Templeton AR, Crandall KA, Sing CF, 1992. A cladistic analysis of
phenotypic associations with haplotypes inferred from restriction
Causal agent of kirramyces leaf blight in Queensland 911
Plant Pathology (2010) 59, 900–912

endonuclease mapping and DNA sequence data III. Cladogram
estimation. Genetics 132, 619–33.
Thompson JD, Gibson TJ, Plewniak FJeanmougin F, Higgins DG,
1997. The ClustalX windows interface: flexible strategies for
multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Research 24, 4876–82.
Walker J, Sutton BC, Pascoe IG, 1992. Phaeoseptoria eucalypti and
similar fungi on Eucalyptus with description of Kirramyces gen.
nov. (Coelomycetes). Mycological Research 96, 911–24.
Yuan ZQ, Wardlaw T, Mohammed C, 2000. A new species of
Dichomera (Mitosporic fungus) described on eucalypt leaves
from Tasmania, Australia. Nova Hedwigia 70, 139–42.
912 V. Andjic et al.
Plant Pathology (2010) 59, 900–912