Content uploaded by Martin Zobel
Author content
All content in this area was uploaded by Martin Zobel on May 08, 2018
Content may be subject to copyright.
ORIGINAL
ARTICLE
Alien plants associate with widespread
generalist arbuscular mycorrhizal fungal
taxa: evidence from a continental-scale
study using massively parallel
454 sequencing
Mari Moora
1
*, Silje Berger
2
, John Davison
1
, Maarja O
¨pik
1
, Riccardo
Bommarco
3
, Helge Bruelheide
4
, Ingolf Ku
¨hn
5
, William E. Kunin
6
, Madis
Metsis
7,8
, Agnes Rortais
9à
, Alo Vanatoa
10
, Elise Vanatoa
1
, Jane C. Stout
11
,
Merilin Truusa
7,8
, Catrin Westphal
12§
, Martin Zobel
1
and
Gian-Reto Walther
13
1
Department of Botany, Institute of Ecology
and Earth Sciences, University of Tartu, 40 Lai
St., 51005 Tartu, Estonia,
2
Institute of
Geobotany, University of Hannover,
Nienburger Strasse 17, 30167 Hannover,
Germany,
3
Department of Ecology, Swedish
University of Agricultural Sciences, SE-75007
Uppsala, Sweden,
4
Institute of Biology/
Geobotany and Botanical Garden, Martin
Luther University Halle Wittenberg, Am
Kirchtor 1, 06108 Halle, Germany,
5
UFZ,
Helmholtz Centre for Environmental Research
– UFZ, Department of Community Ecology,
Theodor-Lieser-Strasse 4, 06120 Halle,
Germany,
6
Earth & Biosphere Institute, IICB,
Faculty of Biological Sciences, University of
Leeds, Leeds LS2 9JT, UK,
7
Tallinn University
of Technology, Centre for Biology of Integrated
Systems, Akadeemia tee 15A, Tallinn 12618,
Estonia,
8
BiotaP LLC, Akadeemia tee 15,
Tallinn 12618, Estonia,
9
Laboratoire Evolution
Ge
´nomes et Spe
´ciation, CNRS, 91190 Gif-sur-
Yvette, France,
10
Institute of Agricultural and
Environmental Sciences, Estonian University of
Life Sciences, Fr.R. Kreutzwaldi 5, Tartu
51014, Estonia,
11
School of Natural Sciences,
Trinity College Dublin, Dublin 2, Ireland,
12
Department of Animal Ecology I, Working
Group Animal Population Ecology, University
of Bayreuth, 95440 Bayreuth, Germany,
13
Department of Plant Ecology, University of
Bayreuth, 95440 Bayreuth, Germany
*Correspondence: Mari Moora, Institute of
Ecology and Earth Sciences, University of
Tartu, 40 Lai St., 51005 Tartu, Estonia.
E-mail: mari.moora@ut.ee
ABSTRACT
Aim The biogeography of arbuscular mycorrhizal (AM) fungi is poorly
understood, and consequently the potential of AM fungi to determine plant
distribution has been largely overlooked. We aimed to describe AM fungal
communities associating with a single host-plant species across a wide geographical
area, including the plant’s native, invasive and experimentally introduced ranges.
We hypothesized that an alien AM plant associates primarily with the
geographically widespread generalist AM fungal taxa present in a novel range.
Location Europe, China.
Methods We transplanted the palm Trachycarpus fortunei into nine European
sites where it does not occur as a native species, into one site where it is
naturalized (Switzerland), and into one glasshouse site. We harvested plant roots
after two seasons. In addition, we sampled palms at three sites in the plant’s
native range (China). Roots were subjected to DNA extraction, polymerase chain
reaction (PCR) and 454 sequencing of AM fungal sequences. We analysed fungal
communities with non-metric multidimensional scaling (NMDS) ordination and
cluster analysis and studied the frequency of geographically widespread fungal
taxa with log-linear analysis. We compared fungal communities in the roots of
the palm with those in resident plants at one site in the introduced range
(Estonia) where natural AM fungal communities had previously been studied.
Results We recorded a total of 73 AM fungal taxa. AM fungal communities in
the native and introduced ranges differed from one another, while those in the
invasive range contained taxa present in both other ranges. Geographically
widespread AM fungal taxa were over-represented in palm roots in all regions,
but especially in the introduced range. At the Estonian site, the palm was
colonized by the same community of widespread AM fungal taxa as associate with
resident habitat-generalist plants; by contrast, resident forest-specialist plants
were colonized by a diverse community of widespread and other AM fungal taxa.
Main conclusions AM fungal communities in the native, invasive and
experimentally introduced ranges varied in taxonomic composition and
richness, but they shared a pool of geographically widespread, non-host-specific
taxa that might support the invasion of a generalist alien plant. Our dataset
provides the first geographical overview of AM taxon distributions obtained using
a single host-plant species.
Journal of Biogeography (J. Biogeogr.) (2011) 38, 1305–1317
ª2011 Blackwell Publishing Ltd http://wileyonlinelibrary.com/journal/jbi 1305
doi:10.1111/j.1365-2699.2011.02478.x
INTRODUCTION
Most studies of the distribution and abundance patterns of
species focus on conspicuous macro-organisms, while micro-
bial communities such as those of arbuscular mycorrhizal
(AM) fungi remain relatively understudied (Chaudhary et al.,
2008; Dumbrell et al., 2010). AM fungi, which belong to the
phylum Glomeromycota (Schu
¨ssler et al., 2001), are obligate
plant-root endosymbionts and associate with more than 80%
of all vascular plant species (Smith & Read, 2008). Through
this mutualism, AM fungi gain all of their carbon from a host
plant while delivering to the plant a range of benefits, including
improved nutrient acquisition. The prevalence and potential
importance of these interactions suggest that AM fungi play a
key role in determining the distribution and abundance of
plant species, and consequently in shaping terrestrial ecosys-
tems (Fitter, 2005). Despite this, the cryptic lifestyle of AM
fungi means that large-scale data on their distribution and
abundance have remained scarce (Fitter, 2005; O
¨pik et al.,
2006, 2010). Consequently, the development of specific
hypotheses regarding the role of AM fungi in influencing
plant distribution and structuring plant communities has been
impeded (Bever et al., 2010).
Our limited understanding of the distribution of AM
fungi has hindered the development of theory concerning the
role played by microbial organisms in shaping plant
invasions. Direct and indirect mechanisms by which plant
and soil microbial community interactions can influence the
invasiveness of alien plant species have only recently been
considered (Mitchell et al., 2006; Reinhart & Callaway, 2006;
van der Putten et al., 2007; Rodrı
´guez-Echeverrı
´a, 2010). AM
fungi associate with the majority of plant species, are globally
distributed and are generally believed to exhibit low host
specificity (Smith & Read, 2008). As such, they may appear
unlikely candidates to explain the invasive dominance of
certain alien plants (Richardson et al., 2000). Indeed, using
an experimental approach, Klironomos (2002) found that
local AM fungi generally had a similar effect on native and
invasive plant species. On this basis, it seems reasonable to
conclude that AM fungi do not play a major role in either
facilitating or hindering plant invasions. However, recent
studies have proposed scenarios whereby AM fungi play a
more significant role in plant invasions (Pringle et al., 2009;
Shah et al., 2009). As AM fungal taxa exhibit host-specific
growth responses (Helgason et al., 2002; Bever, 2003) and
invoke differential growth responses in host-plant species
(Klironomos, 2003; Moora et al., 2004a,b), there is some
potential for new combinations of alien species and resident
AM fungi to yield strong mutualistic interactions (Reinhart
& Callaway, 2006). However, to the best of our knowledge, it
has not been demonstrated that alien plants establish new
soil-borne mutualisms that specifically lead to dominance
and the competitive exclusion of native species. Another way
in which invasive plants may influence the composition and
density of resident AM fungal communities is by failing to
promote local AM fungi to the same extent as native species
do (Hoffman & Mitchell, 1986; Mummey & Rillig, 2006;
Hausmann & Hawkes, 2009; Vogelsang & Bever, 2009), or by
inhibiting them via root exudates (Callaway et al., 2008). As
host plants can shape distinctive mycorrhizal communities
even when presented with the same AM fungal inocula
(Uibopuu et al., 2009), invasive plants seem likely to
produce altered AM fungal communities under any of the
scenarios mentioned above (Zhang et al., 2010). Thus, it
seems likely that an invader may contribute to a decrease in
AM fungal density and/or to a change in local AM fungal
diversity, which could detrimentally affect resident plant
communities.
Recent findings show that while the composition of local
AM fungal communities can be very variable in nature
(Dumbrell et al., 2010), some AM fungal taxa are ubiquitous
(O
¨pik et al., 2006, 2010). Moreover, widely distributed AM
fungi tend to associate with a wide range of host plants,
including habitat-generalist plant species, while less common
AM fungi are more likely to associate with host-plant species
that occupy a narrower ecological (O
¨pik et al., 2009) and
correspondingly also geographical (O
¨pik et al., 2010) range. As
successful plant invaders are frequently generalists (e.g. Ku
¨hn
et al., 2004; Ku
¨ster et al., 2008), we hypothesize that invasive
AM plants are likely to be generalist hosts that associate
primarily with the widely distributed generalist AM fungal taxa
present in any novel range. In this way, invasive AM plants
might have the potential to accelerate a homogenization of the
biosphere, to the extent that a limited set of AM fungal species
Keywords
Arbuscular mycorrhizal fungi, biotic invasion, China, Europe, forest ecosystem,
fungal diversity, Glomeromycota, host specificity, soil microbial community,
Trachycarpus fortunei.
Present address: Silje Berger, Norwegian
Coastal Administration, Department for Emer-
gency Response, Moloveien 7, 3187 Horten,
Norway.
à
Present address: Agnes Rortais, Emerging Risks
Unit, EFSA, Largo N. Palli 5/A, 43100 Parma,
Italy.
§
Present address: Catrin Westphal, Agroecology,
Department of Crop Science, Georg-August-
University Go
¨ttingen, Waldweg 26, 37073 Go
¨t-
tingen, Germany.
M. Moora et al.
1306 Journal of Biogeography 38, 1305–1317
ª2011 Blackwell Publishing Ltd
becomes widespread and dominant over several continents, to
the detriment of biodiversity.
In this study we use a high-throughput pyrosequencing
methodology – 454 Sequencing
TM
(454 Life Sciences, Bran-
ford, CT, USA) of the small subunit ribosomal RNA (SSU
rRNA) gene – to describe AM fungal communities associated
with the roots of an alien AM plant species, Trachycarpus
fortunei (Hook.) Wendl. (Arecaceae). Originating from China
and introduced into Europe as an ornamental species, this
palm has successfully colonized deciduous forests and has
established a vigorous population in the southern foothills of
the Alps (Walther, 2003).
First, we use experimentally introduced T. fortunei plants as
‘bait plants’ (sensu O
¨pik et al., 2003; Sykorova et al., 2007) to
characterize AM fungal communities over a wide geographical
area outside the native range of the host plant (nine sites in
seven European countries, Walther & Berger, 2010). This could
indicate whether native AM fungi associate with the alien host
plant and might therefore be considered as potential mediators
of the invasion process.
Second, applying a biogeographical approach (Hierro et al.,
2005), we compare the AM fungal communities associated
with T. fortunei in its experimentally introduced range with
those in its native range in both China and Switzerland in
order to determine whether AM fungal community patterns in
the respective ranges might be correlated with the invasive
success of T. fortunei. In particular, we focus on the
geographical range of AM fungal taxa. We predict that the
AM fungi partnering the alien palm should predominantly be
those with a known wide geographical range.
Third, we compare the AM fungal communities in the roots
of the experimentally introduced host with those in resident
plant species at one of the sites in the introduced range
(Estonia) where AM fungal communities associated with
different host-plant ecological groups (habitat-specialist and
habitat-generalist plant species) have previously been described
(O
¨pik et al., 2009). We predict that the AM fungi partnering
the alien palm should also be locally present in the roots of a
wide range of hosts.
MATERIALS AND METHODS
Target plant species
Trachycarpus fortunei occurs naturally in Southeast Asia, but
the species is grown ornamentally in many temperate and
subtropical regions outside its native range (Walther et al.,
2007). Regeneration from cultivated palms has led to the
establishment of naturalized T.fortunei populations in the
southern foothills of the Alps (Walther, 2003). The rapid
expansion of T. fortunei into the semi-natural forests of
Central Europe has been driven by changes in winter
temperature and growing season length, and seems likely to
continue as the climate warms further (Walther et al., 2007).
Trachycarpus fortunei forms associations with AM fungi,
making it a suitable model for investigating the presence and
composition of AM fungal communities colonizing invasive
plant roots. Nomenclature of vascular plants follows Flora
Europaea (Tutin et al., 2001).
Sowing experiment
Experimental introduction of T. fortunei seeds was performed
at nine sites, located in several biogeographical subregions
across Europe, where the palm does not already occur as a
native. The sites constituted part of the Field Site Network
(Table 1, Hammen et al., 2010), which was established within
the framework of the European FP6 project ALARM (Settele
et al., 2005). A further sowing experiment was performed near
Locarno, Switzerland, where T. fortunei has been naturalized
since the 1970s (Walther et al., 2007). To provide a reference
against which to compare the germination and seedling
establishment success of the study plant in field conditions,
seeds were also sown in a greenhouse at the botanical gardens,
University of Hannover, Germany, using regular compost soil.
All the experimental sites and native range sampling sites
used in this study were located in forest vegetation, and all on
mesic soil with gleic texture. We thus expect that geographically
driven variation in AM fungal communities between sites is
considerably larger than variation resulting from local environ-
mental conditions such as soil nutrients and moisture content.
Seeds were sown following the same protocol at all sites.
Within each site, three 0.5 ·0.5 m plots (5–30 m apart, except
for the Serbian site, where the maximum distance between
plots was 300 m) were established in an area of woodland
(canopy cover c. 50%). In order to facilitate the germination
and establishment of T. fortunei and to avoid a competitive
effect from resident plants, soil was removed from each plot to
a depth of 15 cm; large roots, stones and other coarse materials
were removed, and soil returned to half of the plot, to one side
of the diagonal. The other half was filled with locally available
sterile commercial potting soil to account for potential edaphic
variation across sites. Seeds of T. fortunei used at all sites were
collected from two palm individuals in Locarno (Switzerland)
in February 2006. Twenty-five seeds were sown on each soil
type (50 seeds per plot) at the beginning of the 2006 growing
season in the majority of experimental sites, including the
greenhouse. In Austria and Serbia, the experiment started in
the spring of 2007. All plants were harvested in the autumn of
2007. Seedlings had 1–3 leaves at the time of harvesting.
Root sampling
The entire root systems of up to 12 experimental plants (six
each from natural and potting soil) were collected from each
plot, depending on the number of plants surviving at the end
of the experiment. Final sample sizes varied between 4 and 34
root samples per site (Table 1). In the cases of Austria and
Germany3 (Barterode), only plants from potting soil were
available at the end of the experiment. Samples from China
were collected in October 2008 from three localities where the
target plant grows naturally (Table 1). At each locality, 10
Invasive plants associate with ubiquitous arbuscular mychorrhizal fungi
Journal of Biogeography 38, 1305–1317 1307
ª2011 Blackwell Publishing Ltd
randomly selected T. fortunei seedlings were harvested, and
c. 4 g of root mass was collected per individual. Root sampling
and storage protocol followed O
¨pik et al. (2008). All root
samples were sent to the University of Tartu (Estonia) for
DNA extraction.
Molecular identification of AM fungi
Molecular analyses
A 20-cm subsample of the root system of each plant was used
for DNA extraction, polymerase chain reaction (PCR) and 454
sequencing, as in O
¨pik et al. (2009). We pooled the extracted
DNA samples from individual plants (using an equal volume
from each individual) for each substrate type and site
combination (i.e. natural and potting soil samples were pooled
separately at each site where samples from both substrates were
available). The resulting 22 sample mixes were subjected to
amplicon isolation and 454 sequencing.
Glomeromycota sequences were amplified from the DNA
mixtures using the SSU rRNA gene primers NS31 and AM1
linked to sequencing primers A and B, respectively. Most data
concerning the natural diversity of AM fungi have been
obtained using this molecular marker (O
¨pik et al., 2010) and
thus can be used for purposes of comparison. The NS31/AM1
primer pair amplifies a c. 550-bp central fragment of SSU
rDNA in most Glomeromycota, but excludes the basal families
Archaeosporaceae and Paraglomaceae (Helgason et al., 1998;
Daniell et al., 2001). In order to identify sequences originating
from different samples, we used a set of 6-bp barcodes
designed following Parameswaran et al. (2007). The barcode
sequences were inserted between the A primer and NS31
primer sequences. Thus, the composite forward primer was 5¢
GCCTCCCTCGCGCCATCAG (NNNNNN) TTGGAGGGCA
AGTCTGGTGCC 3¢and the reverse primer 5¢GCCTTGC
CAGCCCGCTCAGGTTTCCCGTAAGGCGCCGAA 3¢, where
the A and B primers are underlined, the barcode is indicated by
Ns in parentheses, and the specific primers NS31 and AM1 are
shown in italics (O
¨pik et al., 2009). Sequences that were
included in further analyses had to meet a length criterion of
‡160 bp including barcode and primer A sequences, but
otherwise PCRs and quality control of 454 sequencing reads
were performed as in O
¨pik et al. (2009).
Bioinformatic analyses
In order to facilitate the taxonomic assignment of obtained
sequences, we upgraded a pre-existing database of published
Glomeromycota SSU rRNA gene sequences (O
¨pik et al., 2006).
This database (MaarjAM)(O
¨pik et al., 2010) contains repre-
sentative NS31/AM1 sequences from published Glomeromy-
cota sequence-based taxa and known morphospecies. As of 6
February 2010, MaarjAM contained a total of 2044 records that
could be associated with SSU sequence-based taxa (referred to
as ‘virtual taxa’ or VT) (cf. O
¨pik et al., 2009), including 1607
records with SSU rRNA gene sequences. Glomeromycota
Table 1 Site characteristics and details of recorded arbuscular mycorrhizal (AM) fungi associated with Trachycarpus fortunei. For each site, totals are presented for each of the following: samples
analysed (plant individuals); sequences obtained; obtained sequences that corresponded to known Glomeromycota sequences; and detected arbuscular mycorrhizal fungal (AMF) virtual taxa (VT).
The estimated asymptotic AM fungal taxon richness (Chao1 index ± standard deviation) is also presented for each site.
Country Site Location Habitat Dominant canopy sp.
No. of
samples
No. of
sequences
No. of AMF
sequences
No. of
VT Chao1 ± SD
Sweden SE Torrmyra* 5949¢N; 1722¢E Broadleaf forest Quercus robur 18 3364 2932 21 23 ± 2.9
Norway NO Nøtterøy 5912¢N; 1024¢E Coniferous forest Pinus sylvestris 14 30,173 12,798 16 16 ± 0.5
Estonia EE Koeru* 5858¢N; 2603¢E Coniferous forest Picea abies 34 7284 3912 7 7.5 ± 1.3
Ireland IE Dublin* 5318¢N; 615¢W Botanical gardens Betula pendula 29 33,059 21,160 24 27 ± 4.58
Germany1 DE1 Hannover 5223¢N; 942¢E Greenhouse Not relevant 67633 4326 25 25 ± 0
Germany2 DE2 Hannover 5221¢N; 947¢E Mixed broadleaf forest Fagus sylvatica 23 5139 4127 31 32.5 ± 2.6
Germany3 DE3 Barterode* 5132¢N; 946¢E Mixed broadleaf forest Fagus sylvatica 6322 216 14 14 ± 0.25
France FR I
ˆle-de France* 4850¢N; 238¢E Mixed broadleaf forest Castanea sativa 18 2733 1790 14 14 ± 0
Austria AT Gumpenstein* 4729¢N; 1404¢E Coniferous forest Abies alba 42279 471 11 11.5 ± 1.3
Switzerland CH Locarno 4610¢N; 847¢E Mixed broadleaf forest Castanea sativa 32 5443 3779 20 23 ± 4.18
Serbia RS Grabovo* 4510¢N; 1937¢E Mixed broadleaf forest Crataegus monogyna 18 6093 4342 35 35.7 ± 1.4
China1 CN1 Hong Yuan1 2927¢N; 11808¢E Broadleaf forest Arecaceae spp. 101715 1353 25 30.6 ± 8.5
China2 CN2 Hong Yuan2 2928¢N; 11808¢E Broadleaf forest Arecaceae spp. 103464 2817 26 36 ± 10.3
China3 CN3 Gutianshan Nat. Reserve 2924¢N; 11811¢E Broadleaf forest Arecaceae spp. 101183 978 20 20.3 ± 0.9
*Sites that belong to the ALARM field-site network (Hammen et al., 2010).
Samples available from one soil type only.
M. Moora et al.
1308 Journal of Biogeography 38, 1305–1317
ª2011 Blackwell Publishing Ltd
sequence-based taxa were generated following automatic
sequence alignment using the MAFFT multiple sequence
alignment web service implemented in JalView 2.4 (Clamp
et al., 2004) and neighbour-joining analysis of all MaarjAM
sequences (Milne et al., 2004). A total of 291 virtual taxa were
defined on the basis of bootstrap support and sequence
similarity of ‡97%. These criteria produced groupings with
sequence variability similar to those used by several previous
authors (e.g. Helgason et al., 1998; O
¨pik et al., 2008). Follow-
ing the removal of identical sequences, 1210 sequences were
retained in a non-redundant sequence dataset for use in blast
searches (see below).
The 454 sequencing reads were used to query the non-
redundant set of Glomeromycota SSU rRNA gene sequences
from the MaarjAM database using the blast algorithm,
following the same criteria as in O
¨pik et al. (2009). The
virtual taxa that were detected as blast matches are indicated
in Fig. 1 and Appendix S1 in the Supporting Information,
following the virtual taxon classification from O
¨pik et al.
(2009). A sample of sequencing reads including examples from
each encountered AM fungal virtual taxon has been deposited
in GenBank under accession numbers GU198530–GU198746
(217 unique sequences in total; £3 sequences per virtual
taxon). An additional blast search against the GenBank non-
redundant nucleotide database was used to detect non-
Glomeromycota sequences in our dataset. All blast search
results were parsed using the ‘tcl blast parser version 038’
(Kozik et al., 2003).
Statistical analyses
Our field observations suggested that the small plots
(0.125 m
2
) containing potting soil were efficiently colonized
by the roots of local understorey plants during the timeframe
of the experiment. Furthermore, the AM fungal communities
that colonized palm roots in potting soil did not differ from
those in adjacent natural soil plots in terms of species richness
(ANOVA F
1,14
= 0.61, P= 0.45) or, even more importantly, in
composition permutational multivariate analysis of variance
[PerMANOVA (Anderson, 2001) F
1,12
= 0.18, P= 0.99]. For
these reasons, we pooled the data coming from the two
substrate types at each of the respective eight sites (excluding
CN, DE 1, DE 3 and AT), resulting in 14 sites prior to further
analysis (Table 1).
Similarity between the AM fungal communities present at
the various sites was analysed using cluster analysis and non-
metric multidimensional scaling (NMDS) based on the
presence or absence of fungal virtual taxa (McCune & Grace,
2002). Previously published data on the AM fungal commu-
nities inhabiting native plant species at the Estonian study site
(a 10 ·10 m plot known as plot Z sensu O
¨pik et al., 2008,
2009) allowed us to compare the native fungal community
with that associated with T. fortunei at the same site using
cluster analysis. These analyses and PerMANOVA were
performed using pc-ord for Windows version 5 (MjM
Software, Gleneden Beach, OR, USA).
Several statistical methods are available to estimate the
asymptotic number of taxa present at a site, including
undetected taxa (Chao et al., 2009). For each site we used
Coleman rarefaction analysis to produce AM fungal taxon
accumulation curves and calculated Chao1, jackknife and
bootstrap asymptotic richness estimators using 50 randomiza-
tions without replacement (in EstimateS 8.0.0; Colwell,
2006). All estimators gave very similar results, so we present
only the values of the Chao1 estimator (Table 1).
For the focal regions of Europe and Asia we calculated the
expected number of fungal virtual taxa falling into three
categories of biogeographical distribution using the corre-
sponding proportions of accessions in the MaarjAM data-
base: taxa previously (1) found only in the focal region; (2)
found in the focal region and elsewhere; and (3) not found
in the focal region (Fig. 2 bar A shows these categories for
Europe; Fig. 2 bar D shows these categories for Asia). Chi-
square tests were used to compare these expected values with
the observed number of taxa belonging to each of the three
distribution categories: the introduced range (compared with
the expected number of taxa for Europe); the invasive range
(compared with the expected number of taxa for Europe);
and China (compared with the expected number of taxa for
Asia). Log-linear analyses were performed to test whether the
frequencies of fungal virtual taxa with different known global
distributions differed among the AM fungal communities
colonizing the study plant in the European localities (11
sites, including Switzerland) and in China (three sites).
RESULTS
AM fungal communities in palm roots
The 454 sequencing analysis of the 14 composite samples
(Table 1) yielded a total of 109,884 sequences that had a
length ‡160 bp (max 295 bp, median 245 bp) and displayed
the correct tag and primer sequences. A blast search against
the GenBank non-redundant database indicated the presence
of non-Glomeromycotan sequences, with hits to sequences of
fungal taxa in the Ascomycetes and Basidiomycetes in most
cases, and to a lesser extent also to those of other fungi or
plants (data not shown). The putatively non-Glomeromyco-
tan sequences had 23,318 sequence reads (i.e. 21.2% of the
total).
The total number of known Glomeromycota sequences
among the 454 sequencing reads was 65,001 (i.e. 59.2% of all
sequences; ranging between 21% and 87% for each sample;
Table 1). These sequences were assigned to 73 virtual taxa
from the MaarjAM database (see Appendix S1). This number
excludes nine taxa that were represented by a single sequence
and were removed from further analysis. The 73 virtual taxa
belonged to Glomeraceae (i.e. Glomus group A, 55), Acaulos-
poraceae (8), Gigasporaceae (4), Diversisporaceae (3) and
Glomus group B (3) (Fig. 1). Fungal community composition
in the roots of study plants at the various localities is provided
in Fig. 1 and Appendix S1. Two fungal taxa were detected at all
Invasive plants associate with ubiquitous arbuscular mychorrhizal fungi
Journal of Biogeography 38, 1305–1317 1309
ª2011 Blackwell Publishing Ltd
study sites: Glomus sp. (VT 113, related to G. fasciculatum) and
Glomus sp. (VT 115, related to G. vesiculiferum).
Rarefaction analysis suggested that sampling intensity was
sufficient, as fungal taxon accumulation curves reached an
asymptote in most cases (Fig. 3). Richness estimator analysis
showed that the estimated AM fungal taxon richness was
similar to the observed richness for most sites, again indicating
sufficient sampling effort (Table 1). However, the expected
MaarjAM
virtual
2EDSRONRF1EDEIHC2NC3NC1NCseicepSpuorG/suneGecnerruccOnoxat AT DE3 SE EE
VT 200 EU,AM Glomeraceae Glomus hoi
VT 129 EU,AM,AF Glomeraceae
VT 62 EU,AS,AM,AF Diversisporaceae
VT 33 EU Acaulosporaceae
VT 135 EU Glomeraceae
VT 162 EU Glomeraceae
VT 186 EU Glomeraceae
VT 193 EU,AS Glomus group B G. claroideum, lamellosum, luteum, etunicatum
VT 56 EU,AM,AF Glomus group B
VT 163 EU,AM Glomeraceae
VT 72 EU,AM Glomeraceae
VT 196 EU Glomeraceae
VT 34 AM Acaulosporaceae Acaulospora scrobiculata
VT 26 EU Acaulosporaceae
VT 151 AM Glomeraceae
VT 212 AM Glomeraceae
VT 214 EU,AM Glomeraceae
VT 198 EU Glomeraceae
VT 152 AM Glomeraceae
VT 143 EU,AM,AF Glomeraceae
VT 160 EU,AM Glomeraceae
VT 140 EU,AM Glomeraceae
VT 64 EU,AS,AM,AF Glomeraceae
VT 191 EU,AS,AM,AF Glomeraceae
VT 74 EU,AM,OC Glomeraceae
VT 108 EU,AS,AM Glomeraceae
VT 37 EU Acaulosporaceae
VT 199 EU,AS,AM Glomeraceae
VT 145 EU,AM Glomeraceae
VT 115 EU,AS,AM Glomeraceae G. vesiculiferum
VT 113 EU,AS,AM Glomeraceae G. fasciculatum
VT 49 EU,AS,AM Gigasporaceae Scutellospora dipurpurescens
VT 60 EU,AS,AF Diversisporaceae
VT 166 EU,AS,AM,AF,OC Glomeraceae
VT 114 EU,AM Glomeraceae G. intraradices
VT 125 EU,AM Glomeraceae
VT 219 EU,AS,AM,AF Glomeraceae
VT 57 EU,AS,AM Glomus group B
VT 187 EU,AM Glomeraceae
VT 275 EU,AM Glomeraceae
VT 52 EU,AM Gigasporaceae S. aurigloba
VT 273 EU,AM Glomeraceae
VT 247 EU,AS,AM,AF Glomeraceae
VT 194 EU,AS,AM Glomeraceae
VT 156 EU,AS,AM Glomeraceae
VT 201 AM Acaulosporaceae
VT 89 EU Glomeraceae
VT 259 AS Glomeraceae
VT 224 AS Glomeraceae
VT 24 AM Acaulosporaceae
VT 69 EU,AM,AF Glomeraceae
VT 95 EU,AM,AF Glomeraceae
VT 84 EU,AS,AM Glomeraceae
VT 80 AS Glomeraceae
VT 181 AF Glomeraceae
VT 222 EU,AS,AM Glomeraceae
VT 90 AS Glomeraceae G. manihotis
VT 264 CU Glomeraceae G. clarum
VT 130 EU,AS,AF Glomeraceae
VT 45 AM,AF Acaulosporaceae
VT 188 EU Glomeraceae
VT 270 AF Glomeraceae
VT 267 AM Glomeraceae
VT 180 AF Glomeraceae
VT 53 AM Glomeraceae
VT 211 AF Glomeraceae
VT 227 AF Acaulosporaceae
VT 124 AM Glomeraceae
VT 39 AS,AM Gigasporaceae
VT 122 EU,AM Glomeraceae
VT 255 AS,AM Gigasporaceae S. cerradensis, reticulata, heterogama, dipapillosa
VT 54 EU Diversisporaceae
VT 216 EU Glomeraceae
Figure 1 Occurrence of Glomeromycota in the native (CN, grey), invasive (CH, chequer) and introduced (black; see codes in Table 1)
ranges of Trachycarpus fortunei. The ‘Occurrence’ column denotes the previously known range of each virtual taxon: Europe (EU), Asia
(AS), America (AM), Africa (AF), Oceania (OC), spore culture without known geographical origin (CU). Each row corresponds to a
different fungal taxon, with filled cells indicating its presence and open cells its absence at a given site. The table is ordered following the non-
metric multidimensional scaling (NMDS) ordination whereby sites are ranked according to their score on the first ordination axis. The final
NMDS solution had three dimensions, and stress was 9.33, which was significantly lower than for randomized data (Monte Carlo test,
P< 0.02, 250 runs). Collectively, the axes explained 88.7% of the variation in the data, with axes 1 and 2 explaining 35.1% and 28.6%,
respectively.
M. Moora et al.
1310 Journal of Biogeography 38, 1305–1317
ª2011 Blackwell Publishing Ltd
number of taxa was somewhat higher than observed in Ireland
(12%), Switzerland (13%), China1 (17%) and China2 (28%).
Comparison of native, invasive and experimentally
introduced ranges
Forty-nine AM fungal taxa were recorded from T. fortunei in
its native range in China, 20 taxa in the invasive range in
Switzerland and 46 taxa at the experimentally introduced sites
across Europe. Ten fungal taxa were common to all three
regions, 21 were specific to the native range in China, two were
specific to the invasive range in Switzerland, and 18 were
specific to the introduced range in Europe. Fifty-two taxa were
recorded from Europe (including Switzerland) altogether
(Fig. 1, Appendix S2). Palms grown in the invasive range in
Switzerland and those occurring in the native Chinese range
shared four fungal taxa, none of which occurred elsewhere in
Europe (Fig. 1). Fungal taxon richness at European study sites
was variable, ranging from seven taxa in Estonia to 35 taxa in
Serbia (Table 1, Fig. 1). Most study sites in Europe shared a
common dominant taxon – VT 113 (highest number of
detected sequences per site, Appendix S1). The dominant
taxon in Sweden was VT 219, while that in the greenhouse trial
(DE1) was VT 199. In both sites VT 113 was the second most
abundant taxon. All Chinese sites were dominated by different
AM fungal taxa: VT 166 in CN1, VT 219 in CN2 and VT 130 in
CN3. VT 130 was only recorded in CN3 during this study. The
European dominant VT 113 was present at all Chinese sites,
but was the third most abundant taxon in CN1 and CN3 and
even less abundant in CN2 (Fig. 1, Appendix S1).
0%
20%
40%
60%
80%
100%
Expected Europe Observed EU Observed CH Expected Asia Observed CN
Proportion of AM fungal taxa
AD
C
BE
Figure 2 Comparison of the geographical distribution of Glomeromycota taxa recorded in the introduced (bar B), invasive (bar C)
and native (bar E) ranges of Trachycarpus fortunei with expected values for Europe (bar A) and Asia (bar D) based on accessions in the
MaarjAM database. The proportion of taxa falling into different categories of geographical range are presented in the bars: white – taxa
recorded only in Europe (for bars A, B, C) or only in Asia (for bars D, E); grey – taxa recorded in Europe and elsewhere (A, B, C) or recorded
in Asia and elsewhere (D, E); black – taxa absent in Europe (A, B, C) or absent in Asia (D, E).
0
5
10
15
20
25
30
35
40
1 251 501 751 1001 1251 1501 1751 2001 2251 2501 2751 3001 3251 3501 3751 4001 4251 4501 4751
No. of sequences
No. of AMF taxa
RS
DE2
CN1
CN2
CN3
E
IES
CH
NO
FR
AT
EE
DE3
DE1
Figure 3 Expected arbuscular mycorrhizal
fungal (AMF) taxon accumulation curves
(Coleman rarefaction) along the number of
sequences obtained from the various study
sites in Europe and China. Grey lines indicate
sites from the native range of Trachycarpus
fortunei. Curves are presented up to a maxi-
mum of 5000 sequences. See Table 1 for site
codes and total numbers of sequences.
Invasive plants associate with ubiquitous arbuscular mychorrhizal fungi
Journal of Biogeography 38, 1305–1317 1311
ª2011 Blackwell Publishing Ltd
Cluster analysis of AM fungal communities revealed two
clear groups: fungal communities associating with palm roots
at the European introduced sites on one hand, and those
associating with the roots of plants from native and invasive
ranges on the other (Fig. 4a).
Occurrence of widespread and regionally specific AM
fungal species in palm roots
Palm roots from the native, invasive and introduced ranges all
hosted significantly more geographically widespread (occur-
ring in two or more continents) AM fungal taxa than expected
based on the occurrence of such taxa in regional (Europe or
Asia) and global species pools. The difference was more
pronounced among European (introduced range v
2
= 65.42,
d.f. = 2, P< 0.001; invasive range v
2
= 25.88, d.f. = 2,
P< 0.001) than among Chinese (v
2
= 29.37, d.f. = 2,
P< 0.001) plants (Fig. 2). There were no site-specific differ-
ences in the occurrence of fungal taxa corresponding to the
three biogeographical distribution categories of AM fungi
among the 11 European sites (including introduced and
invasive range; log-linear analysis site ·category interaction,
v
2
= 14.18, d.f. = 20, P= 0.8) or among the three Chinese
sites (log-linear analysis site ·category interaction, v
2
= 0.84,
d.f. = 4, P= 0.66). Eight AM fungal taxa were detected for the
first time from Europe, and 27 taxa from Asia in the current
study.
Differences between resident and palm AM fungal
communities
Detailed analysis of a single experimental introduction site
(Koeru, Estonia) revealed that the AM fungal community
associated with the introduced alien plant species T. fortunei
was similar to that associated with habitat-generalist native
plant species (Fig. 4b). In common with these species,
T. fortunei hosted relatively few AM fungal taxa (7), which
also tended to be the most common fungal taxa inhabiting
the roots of indigenous host plants (data from O
¨pik et al.,
2009).
DISCUSSION
Variation in the AM fungal communities associated
with T. fortunei
We recorded a total of 73 AM fungal taxa from 14 study sites.
Because fungal taxon accumulation curves reached an asymp-
tote in most cases, our dataset can be considered as the first
representative Eurasian overview of AM taxon distributions for
a single host-plant species. Although recent work has provided
important insights into variation in AM fungal communities
(O
¨pik et al., 2006; Dumbrell et al., 2010), understanding of
general patterns has clearly been hampered by limited
sampling (Fitter, 2005). Our results reveal considerable
Distance (Objective Function)
Information Remaining (%)
2.2 x 10
-
2
100
3.4 x 10
-
1
75
6.6 x 10
-
1
50
9.9 x 10
-
1
25
1.3
0
EE
A
T
FR
DE3
NO
SE
DE1
DE2
RS
IE
CH
CN1
CN2
CN3
Origin of samples
Europe China Switzerland
Distance (Objective Function)
Information Remaining (%)
1.4 x 10
-
2
100
1.7 x 10
-
1
75
3.3 x 10
-
1
50
4.8 x 10
-
1
25
6.4 x 10
-
1
0
Fra ves
Hyp mac
Gal lut
Par qua
Hep nob
Oxa ace
Vio mir
Ger pra
Ver cha
Geu riv
Tra for
Species
habitat generalist forest specialist alien
(b)
(a)
Figure 4 Cluster analysis of arbuscular
mycorrhizal fungal (AMF) community com-
position at study sites in (a) the native,
introduced and invasive ranges of the palm
Trachycarpus fortunei and (b) AM fungal
communities associated with different cate-
gories of plant species at Koeru, Estonia:
habitat generalists, forest specialists and an
introduced species Trachycarpus fortunei (Tra
for). Sørensen index and a group-averaging
linkage method were used. Habitat-generalist
plant species: Fragaria vesca (Fra ves),
Hypericum maculatum (Hyp mac), Geum
rivale (Geu riv), Geranium pratense (Ger pra)
and Veronica chamaedrys (Ver cha). Forest-
specialist species: Galeobdolon luteum [syn.
Lamiastrum galeobdolon, (Gal lut)], Paris
quadrifolia (Par qua), Hepatica nobilis (Hep
nob), Oxalis acetosella (Oxa ace) and Viola
mirabilis (Vio mir).
M. Moora et al.
1312 Journal of Biogeography 38, 1305–1317
ª2011 Blackwell Publishing Ltd
variation between AM fungal communities in the experimen-
tally introduced European sites, all of which were located in
wooded habitats. The lowest number of AM fungal taxa was
recorded in the roots of palms introduced into sites charac-
terized by coniferous forest and a cold climate (Estonia,
Norway, Austria; Hammen et al., 2010). In contrast to the low
number of AM fungal taxa (7) that we recorded at the Estonian
site, an earlier study recorded 47 taxa for the same site (O
¨pik
et al., 2009). The fact that T. fortunei does not associate with a
greater number of the fungal species present at this site may be
a consequence of the unfavourable environmental conditions.
By contrast, the high diversity of AM fungi recorded at the
Serbian site might in part be attributable to the larger spatial
extent of this site. The Chinese sites also contained a high
diversity of AM fungi, comparable with those of the European
sites situated in broadleaf forest.
Our finding that c. 17% of fungal taxa found in European
samples and c. 57% of those in Chinese samples had never
previously been recorded in those respective regions reflects
the present state of knowledge about the global distribution of
AM fungal taxa. More large-scale studies incorporating
multiple continents, biomes, ecosystems and host-plant species
are required in order to build an understanding of the
biogeography of AM fungi (Fitter, 2005; Chaudhary et al.,
2008; Pringle et al., 2009; Dumbrell et al., 2010; O
¨pik et al.,
2010).
Comparison of AM fungal communities in the novel
and native ranges
The role of AM fungi in plant invasions has been largely
overlooked (Levine et al., 2004; Mitchell et al., 2006), and
information on associations between invasive plant species and
AM fungi is extremely limited (Pringle et al., 2009; Shah et al.,
2009). Our study showed that AM fungal communities in the
palm’s native Chinese range and introduced European ranges
differed, while the composition of communities in the invasive
Swiss range (although represented by only one study site)
contained taxa from both regions. These results lend support
to the argument that successful plant invaders are not limited
by a lack of mutualistic fungi (Richardson et al., 2000); in our
study, the invader seems to have replaced ‘lost’ mutualists
from its native range with new mutualists in the introduced
and invasive ranges.
When the palm–AM fungal associations in the native,
invasive and introduced ranges were compared in greater
detail, a slightly more complex picture emerged. First, AM
fungal communities from the invasive range in Switzerland
contained four fungal taxa that also occurred in the host’s
native range in China, but not in any of the European
introduced sites. One of these fungal taxa was previously
known only from Central America (Glomus VT 124), while
the other three have been found to have a wider distribution
(Gigaspora VT 39, Scutellospora VT 255 and Glomus VT 122)
(O
¨pik et al., 2010). Limited replication of invaded sampling
sites means that we cannot reliably determine whether this
pattern indicates that T. fortunei favours AM fungal taxa that
have been or are currently common in its native range, but
this topic deserves future attention. AM fungal communities
in the invasive range were also notable for the presence of
two AM fungal taxa, namely Glomus VT 216 and Otospora
VT 54, that were not found at any of the other sites in this
study but which have previously been described only from
Europe. Future study would be needed to determine whether
these taxa are specific and efficient symbionts yielding strong
mutualistic interactions that enhanced the successful estab-
lishment of T. fortunei in its invasive range, in accordance
with Reinhart & Callaway’s (2006) ‘enhanced mutualism
hypothesis’.
When interpreting these results it is important to keep in
mind that, whilst we sampled experimentally grown seedlings
in artificially created gaps in the introduced and invasive
ranges, we sampled naturally growing plants in the native
range. Although disturbed ecosystems have frequently been
characterized by a low diversity of AM fungi (Helgason et al.,
1998; Daniell et al., 2001; Antunes et al., 2009), we propose
that the small-scale soil disturbance applied to facilitate target
plant germination in otherwise intact vegetation did not
significantly decrease the inoculation potential of the resident
AM fungal communities. Root colonization in small gaps from
surrounding intact vegetation can be relatively rapid (Pa
¨rtel &
Wilson, 2002), and the small plots created in the current study
were colonized by the roots of neighbouring plants, along with
their AM fungal symbionts, in as short a time as several
months. With the exception of the Austrian and Serbian sites,
plants were grown for two seasons.
The comparison of AM fungal communities from identically
treated experimental plants over a wide area largely eliminates
any potential host and treatment biases. The data obtained
suggest that the patterns detected in this study were not biased
by the experimental protocol. First, the AM fungal taxon
richness associated with naturally growing Chinese seedlings
and that with experimentally grown seedlings at European
broadleaf forest sites were similar. Second, while there was
considerable overlap (28 taxa) between AM fungal communi-
ties associated with experimentally and naturally grown
seedlings, experimental seedlings in the introduced and
invasive ranges harboured distinct AM fungal communities
despite identical treatment.
Occurrence of widespread versus regional AM fungal
taxa
By studying T. fortunei in its native, invasive and experimen-
tally introduced ranges, we found that this plant species is
capable of hosting a wide range of AM fungal taxa, which is
also the case with foliicolous microfungi (Taylor et al., 2000).
The taxa with previously described distributions spanning
several continents were over-represented in the roots of
T. fortunei in all ranges (native, invasive, experimentally
introduced), but especially in the European introduced sites.
Interestingly, most study sites in Europe shared the same local
Invasive plants associate with ubiquitous arbuscular mychorrhizal fungi
Journal of Biogeography 38, 1305–1317 1313
ª2011 Blackwell Publishing Ltd
dominant taxon: globally distributed Glomus sp. (VT 113,
related to G. fasciculatum); different dominant taxa were
recorded only in the artificial conditions (compost soil) of the
greenhouse study and in Sweden. Meanwhile, each site in the
native range was characterized by a different dominant taxon,
although all were geographically widespread. The results from
the European sites conflict with the findings of Dumbrell et al.
(2010), who found that AM fungal communities exhibited a
strong overdominance of particular AM fungal taxa, but that
the dominant taxon in almost all analysed AM fungal
communities was different. They proposed that the processes
determining the dominance of a particular AM fungal taxon
may be stochastic or determined by local adaptation to soil
chemistry and host-plant communities. On the basis of our
data, it appears that the alien palm might have been able to
reshape the local AM fungal communities when any wide-
spread and otherwise appropriate AM fungal partners hap-
pened to be present. In addition, repeated association with the
same dominant taxon may also indicate that local edaphic
conditions were relatively similar between experimental sites.
By contrast, our finding that each native population of
T. fortunei in China was associated with a different dominant
AM fungal taxon matched Dumbrell et al.’s (2010) findings.
Perhaps the most likely reason for the different patterns
observed in our European data and by Dumbrell et al. (2010)
is the different nature of the sampling. We targeted a single,
experimentally introduced host-plant species in relatively
similar (wooded) habitats and followed the same analytical
protocol at all sites; in contrast, Dumbrell et al. (2010)
analysed data from multiple studies, representing different
ecosystems and host-plant species. Moreover, it is possible that
our experimental approach favoured the proliferation of VT
113, which is related to the widespread G. fasciculatum because
it has been shown that genotypes of this species and related
species (i.e. G. intraradices) are able to colonize a bait plant
rapidly and that this colonization is maintained through time
(Sykorova et al., 2007). However, their abundance is also high
in the roots of natural plants from non-disturbed sites (O
¨pik
et al., 2003, 2008, 2009; Sykorova et al., 2007).
The pattern of association between alien host plant and
particular widespread AM fungal taxa was further reflected in
our observations at the Estonian study site, where extensive
information on the resident AM fungal community has
recently been collected (O
¨pik et al., 2008, 2009). The roots
of the alien palm were primarily colonized by widespread AM
fungal taxa that were also common in the roots of local
habitat-generalist plants, while habitat-specialist plant species
harboured a variety of more specialized taxa in addition to the
widespread AM fungi (O
¨pik et al., 2009). This pattern might
be explained by two possible mechanisms: either generalist
fungi are capable of rapidly colonizing the roots of any new
plant species, or generalist plant species inhabiting a wide
range of habitats favour the proliferation of generalist AM
fungal taxa. If a generalist alien plant allows generalist fungi to
proliferate and suppress more localized or specific fungal taxa,
an alien host plant may indirectly depress the diversity of local
AM fungal communities. Indeed, there is some descriptive
evidence that AM fungal communities in invaded sites differ
from those in adjacent non-invaded sites (Mummey & Rillig,
2006), but the existence of such a mechanism should ideally be
tested using experimental methods (Zhang et al., 2010). Our
ability to manipulate AM fungal communities is, however, still
limited because the majority of these fungal taxa are not
cultivable, and we are currently unable to selectively eliminate
particular non-sporulating AM fungi from natural soils.
CONCLUSIONS
Information about the natural distribution patterns of AM
fungi remains scarce. Our study, using massively parallel 454
sequencing, is the first large-scale survey of natural AM
fungal communities associated with a single host-plant
species in its native, invasive and experimentally introduced
ranges. During the timeframe of this study, the introduced
palm sprouted successfully and was not limited by a lack of
AM fungal symbionts colonizing its roots. The results are in
accordance with our general hypothesis that alien plants,
which are themselves typically generalists, predominantly find
their AM fungal partners among the widely distributed
generalist AM fungal taxa present in a novel habitat. In
particular, AM fungi partnering the alien palm were
predominantly those that had a wide geographical range
and were locally present in the roots of a wide range of hosts.
However, more large-scale studies crossing continents, bio-
mes, ecosystems and host-plant species are required in order
to describe the biogeography of AM fungi adequately. Such
knowledge is essential for understanding the role of soil-
borne symbionts such as AM fungi in plant distribution and
invasion processes. With new-generation sequencing technol-
ogies becoming increasingly available, the practical barriers to
such endeavours are rapidly disappearing.
ACKNOWLEDGEMENTS
This research was funded by the European Commission within
the FP 6 Integrated Project ALARM ‘Assessing LArge scale
environmental Risks for biodiversity with tested Methods’
(GOCE-CT-2003-506675), by the Estonian Science Founda-
tion grants 7371, 7366, 7738, SF0180098s08 (University of
Tartu), an Enterprise Estonia grant EU 27552 (BiotaP LLC), a
Marie Curie European Reintegration Grant within the 7th
European Community Framework Programme (GLOBAM,
PERG03-GA-2008-231034) and by the European Regional
Development Fund (Centre of Excellence FIBIR). M. Metsis
was partially supported by a grant from Tallinn University of
Technology. Bioinformatics analysis was supported by the
BiotaP LLC. Sampling in China by H.B. was financed by BEF-
China, funded by the German Science Foundation (DFG FOR
891/1). H.B. is indebted to the staff of the Gutianshan National
Nature Reserve. We are thankful to the ALARM local field-site
staff for conducting and harvesting the transplantation exper-
iment.
M. Moora et al.
1314 Journal of Biogeography 38, 1305–1317
ª2011 Blackwell Publishing Ltd
REFERENCES
Anderson, M.J. (2001) A new method for non-parametric
multivariate analysis of variance. Austral Ecology,26, 32–46.
Antunes, P.M., Koch, A.M., Dunfield, K.E., Hart, M.M.,
Downing, A., Rillig, M.C. & Klironomos, J.N. (2009)
Influence of commercial inoculation with Glomus intrara-
dices on the structure and functioning of an AM fungal
community from an agricultural site. Plant and Soil,317,
257–266.
Bever, J.D. (2003) Soil community feedback and the coexis-
tence of competitors: conceptual frameworks and empirical
tests. New Phytologist,157, 465–473.
Bever, J.D., Dickie, I.A., Facelli, E., Facelli, J.M., Klironomos, J.,
Moora, M., Rillig, M.C., Stock, W.D., Tibbett, M. & Zobel,
M. (2010) Rooting theories of plant community ecology in
microbial interactions. Trends in Ecology and Evolution,25,
468–478.
Callaway, R.M., Cipollini, D., Barto, K., Thelen, G.C., Hallett,
S.G., Prati, D., Stinson, K. & Klironomos, J. (2008) Novel
weapons: invasive plant suppresses fungal mutualists in
America but not in its native Europe. Ecology,89, 1043–
1055.
Chao, A., Colwell, R.K., Lin, C.W. & Gotelli, N.J. (2009) Suf-
ficient sampling for asymptotic minimum species richness
estimators. Ecology,90, 1125–1133.
Chaudhary, V.B., Lau, M.K. & Johnson, N.C. (2008) Mac-
roecology of microbes – biogeography of the Glomeromy-
cota. Mycorrhiza (ed. by A. Varma), pp. 529–562. Springer,
Berlin.
Clamp, M., Cuff, J., Searle, S.M. & Barton, G.J. (2004) The
Jalview Java alignment editor. Bioinformatics,20, 426–427.
Colwell, R.K. (2006) EstimateS: statistical estimation of species
richness and shared species from samples. Version 8.0. User’s
guide and application. Available at: http://viceroy.eeb.
uconn.edu/estimates.
Daniell, T.J., Husband, R., Fitter, A.H. & Young, J.P.W. (2001)
Molecular diversity of arbuscular mycorrhizal fungi colon-
ising arable crops. FEMS Microbiology Ecology,36, 203–209.
Dumbrell, A.J., Nelson, M., Helgason, T., Dytham, C. & Fitter,
A.H. (2010) Idiosyncrasy and overdominance in the struc-
ture of natural communities of arbuscular mycorrhizal
fungi: is there a role for stochastic processes? Journal of
Ecology,98, 419–428.
Fitter, A.H. (2005) Darkness visible: reflections on under-
ground ecology. Journal of Ecology,93, 231–243.
Hammen, V.C., Biesmeier, J.C., Bommarco, R. et al. (2010)
Establishment of a cross-European field site network in the
ALARM project for assessing large-scale changes in biodi-
versity. Environmental Monitoring Assessment,164, 337–348.
Hausmann, N.T. & Hawkes, C.V. (2009) Plant neighborhood
control of arbuscular mycorrhizal community composition.
New Phytologist,183, 1188–1200.
Helgason, T., Daniell, T.J., Husband, R., Fitter, A.H. & Young,
J.P.W. (1998) Ploughing up the wood-wide web? Nature,
394, 431.
Helgason, T., Merryweather, J.W., Denison, J., Wilson, P.,
Young, J.P.W. & Fitter, A.H. (2002) Selectivity and func-
tional diversity in arbuscular mycorrhizas of co-occurring
fungi and plants from a temperate deciduous woodland.
Journal of Ecology,90, 371–384.
Hierro, J.L., Maron, J.L. & Callaway, R.M. (2005) A biogeo-
graphic approach to plant invasions: the importance of
studying exotics in their introduced and native range.
Journal of Ecology,93, 5–15.
Hoffman, M.T. & Mitchell, D.T. (1986) The root morphology
of some legume spp. in the south-western Cape and the
relationship of vesicular arbuscular mycorrhizas with dry
mass and phosphorus content of Acacia saligna seedlings.
South African Journal of Botany,52, 316–320.
Klironomos, J.N. (2002) Feedback with soil biota contributes
to plant rarity and invasiveness in communities. Nature,
417, 67–70.
Klironomos, J.N. (2003) Variation in plant response to native
and exotic arbuscular mycorrhizal fungi. Ecology,84, 2292–
2301.
Kozik, A., Chan, B. & Michemore, B. (2003) BLAST parser,
distance matrix file and protein sequence clustering. How to
obtain a distance matrix file from BLAST search results and
use it for sequence clustering analysis. Available at: http://
cgpdb.ucdavis.edu/BlastParser/Blast_Parser.html.
Ku
¨hn, I., Brandenburg, M. & Klotz, S. (2004) Why do alien
plant species that reproduce in natural habitats occur more
frequently? Diversity and Distributions,10, 417–425.
Ku
¨ster, E.C., Ku
¨hn, I., Bruelheide, H. & Klotz, S. (2008) Trait
interactions help explain plant invasion success in the Ger-
man flora. Journal of Ecology,96, 860–868.
Levine, J.M., Adler, P.B. & Yelenik, S.G. (2004) A meta-analysis
of biotic resistance to exotic plant invasions. Ecology Letters,
7, 975–989.
McCune, B. & Grace, J.B. (2002) Analysis of ecological com-
munities. MjM Software Design, Gleneden Beach, OR.
Milne, I., Wright, F., Rowe, G., Marshall, D.F., Husmeier, D. &
McGuire, G. (2004) TOPALi: software for automatic iden-
tification of recombinant sequences within DNA multiple
alignments. Bioinformatics,20, 1806–1807.
Mitchell, C.E., Agrawal, A.A., Bever, J.D., Gilbert, G.S.,
Hufbauer, R.A., Klironomos, J.N., Maron, J.L., Morris,
W.F., Parker, I.M., Power, A.G., Seabloom, E.W., Torchin,
M.E. & Va
´zquez, D.P. (2006) Biotic interactions and plant
invasions. Ecology Letters,9, 726–740.
Moora, M., O
¨pik, M., Sen, R. & Zobel, M. (2004a) Native
arbuscular mycorrhizal fungal communities differentially
influence the seedling performance of rare and common
Pulsatilla species. Functional Ecology,18, 554–562.
Moora, M., O
¨pik, M. & Zobel, M. (2004b) Performance of two
Centaurea species in response to different root-associated
microbial communities and to alterations in nutrient
availability. Annales Botanici Fennici,41, 263–271.
Mummey, D.L. & Rillig, M.C. (2006) The invasive plant spe-
cies Centaurea maculosa alters arbuscular mycorrhizal fungal
communities in the field. Plant and Soil,288, 81–90.
Invasive plants associate with ubiquitous arbuscular mychorrhizal fungi
Journal of Biogeography 38, 1305–1317 1315
ª2011 Blackwell Publishing Ltd
O
¨pik, M., Moora, M., Liira, J., Ko
˜ljalg, U., Zobel, M. & Sen,
R. (2003) Divergent arbuscular mycorrhizal fungal com-
munities colonize roots of Pulsatilla spp. in boreal Scots
pine forest and grassland soils. New Phytologist,160, 581–
593.
O
¨pik, M., Moora, M., Liira, J. & Zobel, M. (2006) Composi-
tion of root-colonizing arbuscular mycorrhizal fungal
communities in different ecosystems around the globe.
Journal of Ecology,94, 778–790.
O
¨pik, M., Moora, M., Zobel, M., Saks, U
¨., Wheatley, R.,
Wright, F. & Daniell, T. (2008) High diversity of arbuscular
mycorrhizal fungi in a boreal herb-rich coniferous forest.
New Phytologist,179, 867–876.
O
¨pik, M., Metsis, M., Daniell, T.J., Zobel, M. & Moora, M.
(2009) Large-scale parallel 454 sequencing reveals host
ecological group specificity of arbuscular mycorrhizal
fungi in a boreonemoral forest. New Phytologist,184, 424–
437.
O
¨pik, M., Vanatoa, A., Vanatoa, E., Moora, M., Davison, J.,
Kalwij, J.M., Reier, U
¨. & Zobel, M. (2010) The online
database MaarjAM reveals global and ecosystemic distribu-
tion patterns in arbuscular mycorrhizal fungi (Glomer-
omycota). New Phytologist,188, 223–241.
Parameswaran, P., Jalili, R., Tao, L., Shokralla, S., Gharizadeh,
B., Ronaghi, M. & Fire, A.Z. (2007) A pyrosequencing-tai-
lored nucleotide barcode design unveils opportunities for
large-scale sample multiplexing. Nucleic Acids Research,35,
e130.
Pa
¨rtel, M. & Wilson, S.D. (2002) Root dynamics and spatial
pattern in prairie and forest. Ecology,83, 1199–1203.
Pringle, A., Bever, J.D., Gardes, M., Parrent, J.L., Rillig, M.C. &
Klironomos, J.N. (2009) Mycorrhizal symbioses and plant
invasions. Annual Review of Ecology, Evolution, and Sys-
tematics,40, 699–715.
van der Putten, W.H., Klironomos, J.N. & Wardle, D.A. (2007)
Microbial ecology of biological invasions. ISME Journal,1,
28–37.
Reinhart, K.O. & Callaway, R.M. (2006) Soil biota and invasive
plants. New Phytologist,170, 445–457.
Richardson, D.M., Allsopp, N., D’Antonio, C.M., Milton, S.J.
& Rejma
´nek, M. (2000) Plant invasions – the role of
mutualisms. Biological Review,75, 65–93.
Rodrı
´guez-Echeverrı
´a, S. (2010) Rhizobial hitchhikers from
Down Under: invasional meltdown in a plant–bacteria
mutualism? Journal of Biogeography,37, 1611–1622.
Schu
¨ssler, A., Schwarzott, D. & Walker, C. (2001) A new fungal
phylum, the Glomeromycota: phylogeny and evolution.
Mycological Research,105, 1413–1421.
Settele, J., Hammen, V., Hulme, P. et al. (2005) ALARM:
assessing large-scale environmental risks for biodiversity
with tested methods. Gaia,14, 69–72.
Shah, M.A., Reshi, Z.A. & Khasa, D.P. (2009) Arbuscular
mycorrhizas: drivers or passengers of alien plant invasion.
The Botanical Review,75, 397–417.
Smith, S.E. & Read, D.J. (2008) Mycorrhizal symbiosis, 3rd edn.
Academic Press, Amsterdam.
Sykorova, Z., Ineichen, K., Wiemken, A. & Redecker, D. (2007)
The cultivation bias: different communities of arbuscular
mycorrhizal fungi detected in roots from the field, from bait
plants transplanted to the field, and from a greenhouse trap
experiment. Mycorrhiza,18, 1–14.
Taylor, J.E., Hyde, K.D. & Jones, E.B.G. (2000) The biogeo-
graphical distribution of microfungi associated with three
palm species from tropical and temperate habitats. Journal of
Biogeography,27, 297–310.
Tutin, T.G., Heywood, V.H., Burges, N.A., Valentine, D.H.,
Walters, S.M. & Webb, D.A. (eds) (2001) Flora Europaea,
2nd edn. Vols 1–5 and CD-ROM Pack. Cambridge Uni-
versity Press, Cambridge.
Uibopuu, A., Moora, M., Saks, U., Daniell, T., Zobel, M. &
O
¨pik, M. (2009) Differential effect of arbuscular mycorrhizal
fungal communities from ecosystems along management
gradient on the growth of forest understorey plant species.
Soil Biology & Biochemistry,41, 2141–2146.
Vogelsang, K.M. & Bever, J.D. (2009) Mycorrhizal densities
decline in association with nonnative plants and contribute
to plant invasion. Ecology,90, 399–407.
Walther, G.R. (2003) Are there indigenous palms in Switzer-
land? Botanica Helvetica,113, 159–180.
Walther, G.R. & Berger, S. (2010) Palms (and other evergreen
broad-leaved species) conquer the North. Atlas of biodiver-
sity risk (ed. by J. Settele, L. Penev, T. Georgiev, R. Grabaum,
V. Grobelnik, V. Hammen, S. Klotz, M. Kotarac and I.
Ku
¨hn), pp. 212–213. Pensoft Publishers, Sofia.
Walther, G.R., Gritti, E.S., Berger, S., Hickler, T., Tang, Z.Y. &
Sykes, M.T. (2007) Palms tracking climate change. Global
Ecology and Biogeography,16, 801–809.
Zhang, Q., Yang, R.Y., Tang, J.J., Yang, H.S., Hu, S.J. & Chen,
X. (2010) Positive feedback between mycorrhizal fungi and
plants influences plant invasion success and resistance to
invasion. PLoS ONE,5, e12380.
SUPPORTING INFORMATION
Additional Supporting Information may be found in the
online version of this article:
Appendix S1 Glomeromycota sequences in the roots of
Trachycarpus fortunei at the studied sites.
Appendix S2 Venn diagram showing the number of Glom-
eromycota virtual taxa in the current study that are unique to
and shared between different ranges.
As a service to our authors and readers, this journal provides
supporting information supplied by the authors. Such mate-
rials are peer-reviewed and may be re-organized for online
delivery, but are not copy-edited or typeset. Technical support
issues arising from supporting information (other than
missing files) should be addressed to the authors.
M. Moora et al.
1316 Journal of Biogeography 38, 1305–1317
ª2011 Blackwell Publishing Ltd
BIOSKETCH
The research programme of M. Moora, J. Davison, M. O
¨pik, A. Vanatoa, E. Vanatoa and M. Zobel addresses local and global
diversity patterns of glomeromycotan fungi using molecular markers. The study was conducted in the ALARM field-site network,
which was established as a platform for integrated research on large-scale risks to biodiversity.
Author contributions: G.R.W., S.B., M.O
¨., M.Z. and M. Moora conceived the research; S.B., R.B., H.B., I.K., W.E.K., A.R., J.C.S, C.W
and M. Moora collected the data; M.O
¨., M. Metsis, E.V. and M.T. performed the molecular analyses; J.D., M.O
¨., A.V., M. Metsis and
M. Moora analysed the data; and M. Moora led the writing.
Editor: S¸erban Proches¸
Invasive plants associate with ubiquitous arbuscular mychorrhizal fungi
Journal of Biogeography 38, 1305–1317 1317
ª2011 Blackwell Publishing Ltd
